JNKVV RESEARCH JOURNAL

Volume 46 Number 3 September - December 2012

Contents

Review Paper

Stress management in Lac production 277 Moni Thomas, Yogesh Engle, Vijay Rathore, Devendra Khobragade, Bhalerao Kunal and Atul Shrivastava Expanding dimensions of Plant Pathology 286 Sanjeev Kumar and Om Gupta

Research Paper

Extension education approaches for quality seed replacement: need for productive agriculture 294 K.K. Saxena, Anay Rawat, A.K. Singh and Y.M. Sharma Screening wheat genotypes suitable for late and very late sown condition using stability analysis 301 Sanjay Birla, R.S. Shukla and D.K. Mishra Screening of bark and leaves of black catechu for phytochemical properties 304 Karuna S. Verma, Deepak Kori, Aparna Awasthi and Rachna Pandey Exploitation of short duration, multiple resistant, high yielding, promising kabuli 307 chickpea lines for crop diversification in agro-climatic zones of Madhya Pradesh Anita Babbar and Om Gupta Correlation studies between morpho-physiological characters and yield of 313 mungbean and urdbean in rainfed vertisols K. Kanaka Durga Assessment of heritability and genetic advance in coriander germplasms 317 Beena Nair, S.K. Sengupta, A.K. Naidu, A.K. Mehta, Krishna Pal Singh and P.K. Jain Beneficial effects of pre-harvest application calcium nitrate and gibbrellic acid 322 on storage behaviour of guava fruits Sharad Bisen and R.S. Thakur Variability, heritability and genetic advance in fenugreek germplasms 328 Krishna Pal Singh, P.K. Jain, S.K. Sengupta, A.K. Mehta and Beena Nair Genetic variability, heritability and genetic advance in okra 333 D.P. Sharma, Meenakshi Dwivedi, Rajani Bisen and B.P. Bisen Biochemical and proximate studies of growth promoters on Aswagandha 338 K.C.Meena, A.L. Birla, A.S. Gontia, U.S. Mishra, Anubha Upadhyay and S.Rao Influence of growth promoting substances and PGRs on fruit retention, drop and yield of acid 343 lime var. Kagzi (Citrus aurantifolia Swingle) under Kymore plateau of Madhya Pradesh, India Neha Patel and S.K. Pandey Growth and yield response of rice in relation to different thermal environments at 346 Kymore plateau zone of Madhya Pradesh, India Sandip Silawat and K.K. Agrawal

Jawaharlal Nehru Krishi Vishwavidyalaya Jabalpur 482004 (Madhya Pradesh) India

C Y M K JNKVV RESEARCH JOURNAL

ISSN : 0021-3721 Registration No.: 13-37-67

Effect of plant spacing and nitrogen levels on phenophasic developments and physiological 350 attributes of kalmegh (Andrographis paniculata Nees) Abha Tripathi, Sathrupa Rao , S.K. Dwivedi and A.B. Tiwari Assessment of productivity and economics of various soybean + pigeonpea intercropping 355 system under rainfed condition of Rewa region of Madhya Pradesh P.S. Yadav and B.M. Maurya Soil properties of Bheeta village Jabalpur and its land capability classification 360 B.S. Dwivedi, B.K. Dixit, P.C. Amule and N.K. Khamparia Isolation of salt tolerant cyanobacterium Synechococcus spp. and its use for reclamation 365 of salt affected agricultural soil S.S. Yadav, V.S. Chauhan and Bhanumati Singh Application of biochemical parameters for characterization of soybean mutants and elite lines 368 S.S. Sawarkar, A.N. Shrivastava, M.K. Shrivastava and Stuti Mishra Management of root knot nematode in lentil through the application of botanicals and biopesticides 371 Jayant Bhatt, S.P. Tiwari and Kamlesh Pawar Diversity in isolates of Rhizoctonia bataticola causing dry root rot in chickpea from Central India 376 Om Gupta, Surendra Patel and Madhuri Mishra Pest complex and their succession of Kharif castor at Kampasagar conditions of Nalgonda District 382 R. Muralidhar Naik, P. Rajanikanth, L. Krishna, Md. Latheef Pasha and D. Bhadru Scenario of bee-flora in Vindhyan plateau, Madhya Pradesh 385 Rajesh Verma Multimedia Software for Integrated Pest Management of Oilseeds and 390 Pulse Crops (e-IPM) in Central India Gigi Annee Abraham and Sharad K. Jain Evaluation of culinary oil after deep frying of traditional food 394 Deepali Agrawal and Anubha Upadhyay Constraints in empowering the women with reference to Jabalpur district of Madhya Pradesh 398 Monika Chaturvedi, M.K. Dubey, S.R.K. Singh and Shashi Gaur Sustainable income generation through non wood forest products in Mandla district of MP 400 A.N. Gautam and B.B. Beohar A discrete probability distribution for describing pattern of four major insects on pigeonpea crop 403 Manoj Kumar, H.L. Sharma and S.B. Das Prioritization of sub-watersheds based on morphometric analysis using RS and GIS Technique 407 S.K. Sharma, R. Pathak and S. Suraiya Land use pattern changes during past decade for crop and agricultural in Betul tehsil, MP 414 V.K. Verma, N.K. Khare, D.P. Rai and K.K. Saxena Luteinising hormone receptor (LHr) transcripts in buffalo ovarian follicles 419 N. Lail, T. Nanda, R. Ranjan and R. Prasad Tuberculosis in monkeys and its impact on wildlife health 423 Nidhi Rajput and A.B. Shrivastav Effect of Asparagus racemosus supplementation on qualitative and quantitative 425 parameters of hypogalactic buffalo milk A.K. Soni, P.C. Shukla and R.P.S. Baghel Effect of educational background of girl students on extent of participation in sports and 429 games at different educational level in Rewa Division of Madhya Pradesh Rachna Mishra and J.K. Sharma

Published by : Dr. S.K.Rao, Dean, Faculty of Agriculture, JNKVV, Jabalpur 482 004 (M.P.),India Printed at : M/s Fortune Graphics & Scanning Centre, Golebazar, Jabalpur 482 002 (M.P.)

C Y M K ISSN : 0021-3721 JNKVV Volume 46 Research Journal Number (3) 2012 (September - December 2012)

Contents

Review Paper Stress management in lac production 277 Moni Thomas, Yogesh Engle, Vijay Rathore, Devendra Khobragade, Bhalerao Kunal and Atul Shrivastava Expanding dimensions of Plant Pathology 286 Sanjeev Kumar and Om Gupta

Research Paper Extension education approaches for quality seed replacement: need for productive agriculture 294 K.K. Saxena, Anay Rawat, A.K. Singh and Y.M. Sharma Screening wheat genotypes suitable for late and very late sown condition using stability analysis 301 Sanjay Birla, R.S. Shukla and D.K. Mishra Screening of bark and leaves of black catechu for phytochemical properties 304 Karuna S. Verma, Deepak Kori, Aparna Awasthi and Rachna Pandey Exploitation of short duration, multiple resistant, high yielding, promising kabuli chickpea lines 307 for crop diversification in agro-climatic zones of Madhya Pradesh Anita Babbar and Om Gupta Correlation studies between morpho-physiological characters and yield of mungbean and 313 urdbean in rainfed vertisols K. Kanaka Durga Assessment of heritability and genetic advance in coriander germplasms 317 Beena Nair, S.K. Sengupta, A.K. Naidu, A.K. Mehta, Krishna Pal Singh and P.K. Jain Beneficial effects of pre-harvest application calcium nitrate and gibbrellic acid on storage 322 behaviour of guava fruits Sharad Bisen and R.S. Thakur Variability, heritability and genetic advance in fenugreek (Trigonella foenum graecum L.) 328 germplasms Krishna Pal Singh, P.K. Jain, S.K. Sengupta, A.K. Mehta and Beena Nair Genetic variability, heritability and genetic advance in okra 333 D.P. Sharma, Meenakshi Dwivedi, Rajani Bisen and B.P. Bisen Biochemical and proximate studies of growth promoters on Aswagandha 338 K.C. Meena, A.L. Birla, A.S. Gontia, U.S. Mishra, Anubha Upadhyay and S.Rao Influence of growth promoting substances and PGRs on fruit retention, drop and yield of acid 343 lime var. Kagzi (Citrus aurantifolia Swingle) under Kymore plateau of Madhya Pradesh Neha Patel and S.K. Pandey Growth and yield response of rice in relation to different thermal environments at Kymore plateau 346 zone of Madhya Pradesh Sandip Silawat and K.K. Agrawal Effect of plant spacing and nitrogen levels on phenophasic developments and physiological 350 attributes of kalmegh (Andrographis paniculata Nees) Abha Tripathi, Sathrupa Rao, S.K. Dwivedi and A.B. Tiwari Assessment of productivity and economics of various soybean + pigeon pea intercropping 355 system under rainfed condition of Rewa region of Madhya Pradesh P.S. Yadav and B.M. Maurya Soil properties of Bheeta village Jabalpur and its land capability classification 360 B.S. Dwivedi, B.K. Dixit, P.C. Amule and N.K. Khamparia Isolation of salt tolerant cyanobacterium Synechococcus spp. and its use for reclamation of salt 365 affected agricultural soil S.S. Yadav, V.S. Chauhan and Bhanumati Singh Application of biochemical parameters for characterization of soybean mutants and elite lines 368 S.S. Sawarkar, A.N. Shrivastava, M.K. Shrivastava and Stuti Mishra Management of root knot nematode in lentil through the application of botanicals and biopestcides 371 Jayant Bhatt, S.P. Tiwari and Kamlesh Pawar Diversity in isolates of Rhizoctonia bataticola causing dry root rot in chickpea from central India 376 Om Gupta, Surendra Patel and Madhuri Mishra Pest complex and their succession of Kharif castor at Kampasagar conditions of Nalgonda Dist., AP 382 R. Muralidhar Naik, P. Rajanikanth, L. Krishna, Md. Latheef Pasha and D. Bhadru Scenario of bee-flora in Vindhyan plateau, Madhya Pradesh 385 Rajesh Verma Multimedia Software for Integrated Pest Management of Oilseeds and Pulse Crops (e-IPM) 390 in Central India Gigi Annee Abraham and Sharad K. Jain Evaluation of culinary oil after deep frying of traditional food 394 Deepali Agrawal and Anubha Upadhyay Constraints in empowering the women with reference to Jabalpur district of Madhya Pradesh 398 Monika Chaturvedi, M.K. Dubey, S.R.K. Singh and Shashi Gaur Sustainable income generation through non wood forest products in Mandla district of MP 400 A.N. Gautam and B.B. Beohar A discrete probability distribution for describing pattern of four major insects on pigeonpea crop 403 Manoj Kumar, H.L. Sharma and S.B. Das Prioritization of sub-watersheds based on morphometric analysis using RS and GIS Technique 407 S.K. Sharma, R. Pathak and S.Suraiya Land use pattern changes during past decade for crop and agricultural in Betul tehsil, MP 414 V.K. Verma, N.K. Khare, D.P. Rai and K.K. Saxena Luteinising hormone receptor (LHr) transcripts in buffalo ovarian follicles 419 N. Lail, T. Nanda, R. Ranjan and R. Prasad Tuberculosis in monkeys and its impact on wildlife health 423 Nidhi Rajput and A.B. Shrivastav Effect of Asparagus racemosus supplementation on qualitative and quantitative parameters 425 of hypogalactic buffalo milk A.K. Soni, P.C. Shukla and R.P.S. Baghel Effect of educational background of girl students on extent of participation in sports and 429 games at different educational level in Rewa Division of Madhya Pradesh Rachna Mishra and J.K. Sharma Issued 31st December, 2012 STATEMENT OF OWNERSHIP FORM IV (See Rule 8)

Place of Publication : Jabalpur (Madhya Pradesh), India

Periodicity of Publication : 3 issues per year (from 2012)

Publisher's Name : Dr. S.K. Rao Indian Dean, Faculty of Agriculture JNKVV, Jabalpur 482 004 (M.P.), India

Printer's Name : M/s Fortune Graphics and Scanning Centre Golebazar, Jabalpur 482 002 (M.P.)

Editor's Name : Dr. Mohan S. Bhale Indian Senior Scientist Department of Plant Pathology JNKVV, Jabalpur 482 004 (M.P.), India

Name and address of individuals : Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur Who own the news papers and partners of share holders holding more than one per cent of total capital

I, S.K. Rao, hereby declare that the particulars given above are true to the best of my knowledge and belief.

Dated the 31st December, 2012 Sd/- S.K. Rao Publisher A Publication of Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (Madhya Pradesh) India Phone: (+91) (0761) 2681200; Fax: (+91) (0761) 2681200 Website: www.jnkvv.nic.in

JNKVV Research Journal Editorial Board

Patron Prof. Vijay Singh Tomar Vice Chancellor, JNKVV, Jabalpur Chairman Dr. S.K. Rao Dean, Faculty of Agriculture, Jabalpur Members Dr. P.K. Mishra Director Instruction, Jabalpur Dr. K.K. Saxena Director Extension Services, Jabalpur Dr. R.S. Khamparia Dean, College of Agriculture, Jabalpur Dr. T.K. Bhattacharya Dean, College of Agricultural Engineering, Jabalpur Editor Mohan S. Bhale Co-Editor Abhishek Shukla

General Information: JNKVV Research Journal is the publication of J.N. Agricultural University (JNKVV), Jabalpur for records of original research in basic and applied fields of Agriculture, Agricultural Engineering, Veterinary Science and Animal Husbandry. It is published thrice a year (from 2012). The journal is abstracted in CAB International abstracting system, Biological Abstracts, Indian Science Abstracts. Membership is open to all individuals and organizations coping with the mission of the University and interested in enhancing productivity, profitability and sustainability of agricultural production systems and quality of rural life through education, research and extension activities in the field of agriculture and allied sciences.

Submission of manuscript for publication: Manuscripts should be submitted in duplicate to the Editor, JNKVV Research Journal, J.N. Agricultural University, Adhartal, Jabalpur 482 004 (M.P.) India.

Membership and subscription: The annual fee for individuals is Rs. 200/- for residents in India and US$50 for residents outside India. The annual fee for Libraries and Institutions is Rs. 500/- for residents in India and US$100 for outside. All authors must be subscribers. Payment should be made by Demand Draft in favour of Dean, Faculty of Agriculture, JNKVV payable at Jabalpur 482 004 MP to the Editor, JNKVV Research Journal, JNKVV, Jabalpur (M.P.).

Exchange of the journal: For exchange of the journal, please contact the Librarian, University Library, JNKVV, Jabalpur 482 004 (M.P.), India.

ISSN : 0021-3721 Registration No. : 13-37-67

Published by : Dr. S.K. Rao, Dean, Faculty of Agriculture, JNKVV, Jabalpur 482 004 (M.P.), India Printed at : M/s Fortune Graphics & Scanning Centre, Sahu Mohalla, Golebazar, Jabalpur (M.P.) JNKVV Res J 46(3): 277-285 (2012)

Stress management in lac production

Moni Thomas, Yogesh Engle, Vijay Rathore, Devendra Khobragade, Bhalerao Kunal and Atul Shrivastava Directorate of Research Services Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482004 (MP)

In the course of its evolution, plants have developed earliest reference is found in Atherva Veda. The English mechanisms to cope with and adapt to different types word lac synonyms 'Lakh' in Hindi which itself is of abiotic and biotic stress imposed by the frequently derivative of Sanskrit word Laksh meaning a lakh or adverse environment.Crop growth and crop yield are hundred thousand. It would appear that Vedic people affected by abiotic and biotic factors including weather knew that the lac is obtained from numerous insects (rain, heat and temperature), soil conditions (water, pH (Kerr 1782). and nutrients), insect populations, disease incidence K. lacca is a scale insect belongs to order- and management practices (cultivar, irrigation, Hemiptera, suborder Homoptera, super family fertilization and rotation). The biology of a cell or cells Coccoidea and family Lacciferidae. More than 400 host in tissues is so complicated that with any given stimulus plants of lac insects have been observed throughout from the environment, multiple pathways of cellular the world (Varshney and Teotia 1967; Faruq et al. 1999). signaling that have complex interactions or crosstalk K . lacca completes its life cycle on host trees like Palash are activated; these interactions probably evolved as (Butea monosperma), Ber (Zyziphus mauritiana), Kusum mechanisms to enable the live systems to respond to (Schleichera oleosa), Khair (Acacia catechu), Babul stress with minimal and appropriate biological (Acacia arabica), Khatber (Zyziphus xylophora), Pigeon- processes. The sensing of biotic and abiotic stress pea (Cajanus cajan), Bargad (Ficus bengalensis), induces signaling cascades that activate ion channels, Peepal (Ficus religiosa), Rain tree (Samanea saman), kinase cascades, production of reactive oxygen species Babul (Acacia nilotica), Shirish (A. saman) besides (ROS), accumulation of hormones such as salicylic acid several trees of regional importance (Glower 1933; (SA), ethylene (ET), jasmonic acid (JA) and abscisic Mahdihassan 1953 ; Negi 1956; Roonwal et al.1958, acid (ABA).Plant defence mechanisms have evolved Ben et al. 1968;Purkayastha and Moti Ram, 1979; Li during the co-evolutionary arms race between plants and Hu 1994; Le Thi Phi 1995; Sharma 1997;Ghosal et and their attackers and come with costs in addition to al. 2005; Chen et al. 2003; Barman et al. 2006;Kumar benefits (Schoonhoven et al. 2005; Chisholm et al. et al. 2007; Nure et al. 2010; Ramani et al. 2010). 2006; Jones and Dangl 2006 ), insights into their significance for plant fitness should ideally come from ecological studies. Research on Arabidopsis has Economic importance of Lac production contributed to our understanding of molecular mechanisms of plant-microbe and plant-insect Lac-a minor forest produce and a cash crop is of wide interactions (Van Poecke and Dicke 2004; Pieterse et industrial application. The enterprise is an important al. 2002). source of subsidiary income among forest dependants and rainfed farmers in many parts of Madhya Pradesh Lac (Olge et al. 2006), Jharkhand, West Bengal, Chhattisgarh, Maharashtra in India, where about 3 to 4 million people are involved (Rao and Singh 1990). In Lac insect, Kerria lacca (Kerr) is a valuable gift of nature Lac growing areas around 20 to 28 per cent of total to mankind. Lac - a resinous secretion through its three agriculture income is contributed by lac cultivation pairs of specialized glands from the body of female (Jaiswal et al. 2006). Average net profit from a B K. lacca that forms its protective covering (Colton monosperma, Z mauritiana and S oleosa tree is Rs.109, 1984).Lac insect is known since Vedic period as its Rs. 202 to 1060 and Rs. 1320 per crop cycle 277 respectively (Sharma et al. 1997). Over 80 per cent of insect population on the host plant (Youqing et al. 2010). the country's total lac production is exported and foreign exchange to the tune of $ 16-22 million is earned Invariably lac production varies from host to host(Yang annually (Prasad et al. 2004). Lac, production and et al. 1998), season to season and strain to strain. The processing generate considerable income both at the yield of the same strain of K. lacca varies even on closely local and national level. related busy hosts like F. semialata and F. macrophylla. The live cell weight, Phunki (dry) cell weight and India is the largest producer of lac in the world, fecundity of K lacca on F. semialata varied from 13.16 while other important countries are Indonesia, Thailand, to 38.33 mg, 8.00 to 19.00 mg and 253 to 565 eggs China, Burma, Sri Lanka (Chamberlin 1923). On an respectively, whereas on F. macrophylla it were from average, India produces 18,000 tons of lac per year 16.83 to 31.67 mg, 9.33 to 18.83 mg and 297 to 477 (Prasad et al. 2004).In India, Chhattisgarh is the largest eggs and were significant (Mishra et al. 1999). The yield producer of lac, followed by Jharkhand and Madhya variation exists even among the same host with different Pradesh (MP). Among the two type of lac; Rangeeni Lac strains. Resin production by individual female lac lac and Kusmi lac, and the latter contributes to over 80 insects was highest on S oleosa (22.84 mg), followed per cent of lac produced in India (Tewari 1994), the bulk by Acacia auriculiformis (18.9 mg), F. macrophylla (9.43 of which is grown on B. monosperma. Both the types of mg) and Cucurbita moschata fruits (6.11 mg) for Kusmi lac have two harvesting seasons in the year. Lac while A. auriculiformis (9.09 mg), followed by B. growers give more importance to Lac production as it monosperma (8.76 mg), F. macrophylla (7.49 mg) and provides them regular income at definite intervals during C. moschata fruits (6 mg) for the Rangeeni strain the years than timber production. (Sharma et al. 2007). The performance of Lac insect on same host during different seasons is markedly different. The highest fecundity, female cell diameter Lac production and cell weight of Rangeeni strain of lac insect in Baishakhi (summer season) crop was 525.2 per female, The pruning of host trees, bundling of broodlac twigs, 3.52mm and 14.21mg respectively while that during tying of broodlac on trees for infestation, removal of Katki (rainy season) crop was 450.6 per female, 3.06 used up broodlac sticks (phunki) from trees, harvesting mm and 10.12 mg respectively (Kumar et al. 2007). of crop and lac scraping are the basic operations in lac Shirish (A. saman) yields about 80kg lac per tree (Nure production. These operations are carried out manually et al. 2010). and with the help of locally available traditional tools. And the energy requirements in the production of lac Variation in the type of resin content of among from B. monosperma, Z. mauritiana and S. oleosa are different species of Kerria and in different seasons is 11.68, 3.33 and 4.71 GJ/t in the first year and 10.25, quite interesting. The raw lac contains both hard and 2.94 and 4.00 GJ/t respectively in the subsequent years soft resins, but the latter remains in higher quantity. (Prasad et al. 2004). Among the three species of lac insects (K. chinensis, K .sindica Mahd. and K.lacca) soft resin excreted by K. A single lac insect (K. lacca) has a potential to chinensis in the summer generation is lower than that multiply 250 times in one generation, but the actual seed of the other two, though it remains comparatively higher (broodlac) to yield (lac-produced) ratio is very low. For the winter generation. The content of yellow pigment is example single cell cultures maintained on Flemingia richer in both generations of lac insect but comparatively macrophylla yielded 56-175 times more lac in the lesser in the case of K. chinensis in both generations. laboratory while in the field conditions it was just 45 to The content of soft resin and yellow pigment is higher 50 times (Sharma et al. 2005). Large scale inoculation in the latter two in both generations though somewhat of Lac insect also reduces the performance. In the field higher in winter (Li et al. 1994). condition on study to mass inoculation with an increase in the scale of operation, the yield of Rangini crop As mentioned earlier Lac production is a drastically reduced to 3, 4 and 7 times of the input on subsidiary income generation activity. It involves a B. monosperma, F. macrophylla and Z. mauritiana, simple operation, skill and less time than other respectively, in Kusmi crop while it was 5, 9 and 14 agricultural operations (Prasad et al. 2004). Therefore times, respectively, on F. macrophylla, Z. mauritiana there should be always integrated with crop production. and S. oleosa for Kusmi strain during rainy/winter Integration of Lac production with crop production in season crop under field condition (Sharma et al. 2005). the fragile agro-ecosystem along the upper maintains This may be due to quantitative and qualitative loss of slopes of in Yunnan Province of South-west China are broodlac, damage due to pests and management of lac benefiting farmers economically and ecologically. The

278 host plants besides increasing soil fertility helps in soil abiotic stress, this affect the yield of lac crops. Lac retention while presence of lac insect on it provide a production induces stress on the host plants as it good arthropod bank in the ecosystems that helps in reduced the yield of Z. jujube by 10.9 to 25.3% (Barman crop pest management naturally (YouQing et al. 2010). et al. 2007). Lac production also reduces the contents of extractives, pentose, total nitrogen and tannin of bark Stress in Lac production (Lin and Su 2001).Especially during summer, soil moisture stress and insect load on the host leads to mortality of Lac insect, which is a common observed in Stress is defined as an influence that is outside the India. Many workers (Nigel 1998; Gaivoronskaya 2005; normal range of homeostatic control in a given genotype Singh et al. 2007; Dhiman et al. 2009; Arshad and (Lerner 1999a). Where a stress tolerance is exceeded, Qamar 2010; Koltunov and Andreeva 1999 Grover et response mechanisms are activated (Lerner 1999b). al. 2000; Shrivastava et al. 2003) have reported that Where the stress is controlled a new physiological state the effect of abiotic stress on organism. An increasing is established, homeostasis is re-established. When the concentration of greenhouse gases in the atmosphere stress is removed the plant may return to the original is likely to lead to an increase in global average state or a new physiological state may be established temperature of between 0.15 and 0.30 C per decade. (Amzallag 1999). There are well characterised specific responses to abiotic and biotic stresses, however, it Large-scale pre-summer mortality of Rangeeni appears that commonly if not universally, multiple stress lac insects on Bhalia, Palash and Ber plants especially defence pathways are induced (Inze and Van Montagu in Jharkhand and West Bengal have been observed in 2002). the recent years; affecting summer Rangeeni lac production (Sharma et al. 2006). A similar condition was The bacterial pathogen P. syringae, the also observed in Madhya Pradesh where Lac growers necrotrophic fungus Alternaria brassicicola, the cell- suffered heavy loss due to Lac mortality during summer. content feeding thrips Frankliniella occidentalis and the The weather parameters had significant role in chewing caterpillar Peries rapae all stimulate JA governing the mustard aphid Lipaphis erysimi (Kalt) biosynthesis and JA-responsive gene expression in population (Singh et al. 2007) which is also a plant sap Arabidopsis (De Vos et al. 2005). Yet, most JA- feeder. responsive genes that were activated by each attacker were specific for the plant- attacker combination. The dissection of stress responses in plants is showing high Biotic Stress levels of complexity and redundancy at the perception, signalling and expression levels with cross regulation Continuous rearing of Lac insect on the host trees keep (cross talk) between stress pathways and over lapping the tree under stress, as a result not only the tree grows functions between stress metabolites and stress weak but give less coppices in the subsequent years. proteins in different stresses. Stress metabolite Thus there is a drastic decline in the yield of lac crop. engineering is complicated by a lack of knowledge of pathways and their regulation and poses the question Predators are the biotic stress factors in Lac of how metabolite fluxes between shared pathways can production(Varshney 1976), there are three major be controlled, indeed redundant homeostatic predators of K. lacca predators of Eublemma amabilis mechanisms may be discovered (Cassells and Doyle Moore (Lepidoptera; Noctuidae), Psuedohypatopa 2003). pulverea Meyr (Lepidoptera; Blastobesidae), Chrysopa lacciperda Kimmins and C. madestes Banks (Chrysopidae; Neuroptera) (Glower, 1937; Narayanan, Abiotic stress 1962; Mehra 1965; Thomas 2004; Malhotra and Katiyar 1975; Sharma et al. 2006). Lac production involves rearing of K lacca on its host plants. The insect feed on phloem sap of its host plant. Nigel (1998) reported that droughts and floods Most of the host plants of Lac insects are found in semi- in recent years in many countries have stimulated further arid and arid regions. Thus the host plant undergoes interest in global warming and its possible effects on environmental stress as well as that imposed by sap water resources. The Second Assessment of the feeding by K. lacca. Apart from this in a given eco- Intergovernmental Panel on Climate Change (IPCC system even the Lac insect experiences both biotic and 1996) states that a human influence on global climate

279 is discernible, and that recent variability is unlikely to crop than to the Baishakhi crop ( Rahaman et al. 2009). be entirely due to natural causes. In contrast to E. amabilis which undergoes three overlapping generations in both summer and rainy Yield losses season lac crop (Mishra et al.1930), Holcocera pulverea Meyr (now Psuedohypatopa pulverea) completes five generations in about 381 days (Mishra and Gupta 1934). The genetic yield potential of a crop variety is limited However Rahaman et al. (2009) reported six generation by the environment, including abiotic and biotic stresses of E. amabilis in a year. E. amabilis moth is generally (Oerke 1999). Stress, whether abiotic or biotic always white pinkish in colour and lays round eggs, depressed have a detrimental effect on the performance of a crop in the centre. The whole newly hatched larva enters and its yield (Sharma et al. 2005). Yield losses of lac the lac insect either through one of the opening in the due to predators have been reported widely. However cell or by tunneling (Rahaman et al. 2009). The moth lac being a cash crop (Tewari 1994), lac grower prefers has an ovi-position preference. E. amabilis laid 65.03 to spend money for good returns, E. amabilis Moore per cent eggs on paper strips treated with whole body (Lepidoptera: Noctuidae) and P. pulverea Meyr extract of lac insect while 7.81, 9.75 and 8.77 per cent (Lepidoptera: Blastobasidae) are the two major of the total eggs laid, respectively paper strips treated predators of Lac insect that cause lac crop loss ranging with resin, honeydew and wax (Jaiswal et al. 1995). from 20 to 40% (Narayanan 1962; Malhotra and Katiyar 1975; Glover 1937, Bhattacharya et al. 2004; Jaiswal The life history of C. madestes Banks, a predator et al. 2007; Bhattacharya et al. 2007). However, of K. lacca is described it in detail under the laboratory Rahaman et al. (2009) considers it as very destructive condition by Mehra (1965a). The female insect lays 4 to lac insect and lac encrustation .Similarly C. madestes to 81 eggs lay during its life time. The duration of is very damaging as its first, second and third instar different stages varied with the season. Thus the three larvae of can destroy up to 20, 24 and 74 mature females larval stages up to the time of spinning (pupae of lac insect per day (Mehra 1965). formation) lasted for 2 to 24 days, 2 to 27 days and 3 to 26 days respectively in winter and 2 to 12 days, 2 to 10 The lac insect excretes honeydew secreted by days and 2 to 11 days respectively in summer, The total K. lacca (Singh 2006) also damages the Lac crop. larval period is 9 to 60 days in winter and 7 to 22 days Honey dew falling on the lac settlement on lower in summer. The combined pre-pupal and pupal stages branches with Lac ,ferment and promote shooty mould inside the cocoon varied from 6 to 24 days winter and 8 which grow to form a thick felt like covering suffocating to 14 days in summer. The complete life cycle from egg the lac insect to death(Gokulpure and Mehra 1973). to adult ranged from 21 to 80 days in winter and 19 to Besides this squirrels (Funambulus pennanti) damaging 34 days in summer. Mehra (1965b) has also detailed Kusmi lac on S. oleosa when it plucks the Lac settlement the feeding behavior of the larva of C. madestes. When in search of E. amabilis larvae to eat it (Thomas it is hungry but not weak due to starvation, the larvae 2004).Termite also damages Lac crop (Thomas and makes fast move in search of food. On finding the lac Gupta 2003). insect it selects one, search out the apertures and pierces generally through the anal opening but Biology of predators sometimes through the brachial opening as well. If the lac insect happens to be too young and its resin still soft it pierce any where through on the dorsum. While In the year 1884 George Hampson listed 128 species feeding on a loose insect without a hard covering, the of Genus Eublemma, of which 44 species were from larva pierce through a suitable place with one jaw and India and Sri Lanka. Six species of the Genus holds it the other. Sometimes both jaws may be pierced Eublemma have been recorded as coccidophagous. through. The predatory response of Chrysoperla carnea The larvae of E. amabilis after hatching from the eggs (Stephens) against the lac insect, K. lacca was also on the surface of the lac colonies, lead a cryptic mode reported for the first time by Sushil et al. (2002b). of life by burrowing and tunneling within the lac encrustation feeding exclusively on lac insects and About 54 per cent of lac-insects of the samples undergo moulting ten times before pupating (Mishra et were found parasitized by Aprostocetus purpureus, al. 1930). Witt (1901) was the first to study the general showing unusual mortality in February, and nearly 25 life history of E. amabilis Moore and referred to its per cent parasitization was recorded in the apparently injurious nature with regarded to the lac insect. E. normal cultures collected from Jharkhand and West amabilis causes comparatively more injury to the Katki Bengal Sharma et al. (2006). In a Caging experiment

280 also confirmed heavy parasitization by A. purpureus, pest and disease control that maximise biological up to 573 parasitoids emerged from 10 cm lac cultural pest and disease control practices with the use encrustation in March. It was observed that of selective pesticide when necessary (Horn and Page parasitization before sexual maturity killed lac insects 2008). invariably. A. purpureus survived for the longer period when lac insects were parasitized after fertilization; but Non- pesticide approach then also brood value and resin-producing efficiency were affected adversely. Thus, parasitization appears to be the major factor causing pre-summer lac-insects' Placing of brood sticks in 60 mesh nylon net bag during mortality Sharma et al. (2006). inoculation traps parasitoids and predators while allowing lac crawlers to move out for settlement on new shoots (Malhotra 1983) is a practice. Light trap also Abiotic Stress Management helps in trapping large numbers of Chrysopa spp. attacking Kusmi lac crop (Bhattacharya et al. 2008). Establishment of Broodlac nurseries in low lying areas Extracted essential oils from Cymbopogon citratus in the Forest areas in Madhya Pradesh is a policy (lemon grass), C. martini (Palmarosa) and C. nardus intervention to prevent summer mortality of lac insect (Citronella) acts as excellent repellents against E. and ensuring quality brood lac for July inoculation is amabilis and P. pulverea (Bhattacharya et al. 2006b, paying rich dividends. As a matter of fact Lac host trees 2008). on the hillocks and upstream areas are inoculated with Rangeeni brood lac in July while in the valley and near Use of trap crops is also helpful as Trichogramma water bodies are inoculated during October. In chilonis (parasitoid of E. amabilis and P. pulverea) Bangladesh basal irrigation during summer season at parasitizes the egg of Catopsilia pyranthis L weekly interval to Ber plants remarkably reduced the (Lepidoptera : Pireridae) a Lepidopteran pest of a insect mortality from 39.71% to 44.9% while increasing naturally occurring medicinal plant, Cassia occidentalis the yield from 31.9% to 33.8%(Barman et al. 2006). L (Patel and Yadav 1991). A significant reduction E. Irrigation to host trees of Lac insect in forest areas is amabilis Moore and P pulverea Meyr and significant difficult. But rearing of Lac insect on B monosperma increase in brood lac yield was obtained when C. trees in the valley or near water bodies that is followed occidentalis L. was planted on the border of the Lac in MP is cheap and successful. Gaivoronskaya (2005) infested F. macrophylla plot (Bhattacharya et al. 2006a, has rightly reported that agricultural enterprises cannot 2008). function successfully without establishing cost Extensive research work of the biological management systems. Ideally the cost management management of the predators has been carried out by process should begin at the stage of production many workers earlier. Bacillus thuringiensis to be safe planning. And in MP for Lac production we are following against lac insect and it is highly effective against early the above concept for production management. stage predators of lac insect and ecto-parasites of E. amabilis (Malhotra and Choudhary 1968; Bhattacharya Biotic Stress Management et al. 2008a; Jaiswal et al. 2008). The hymenopterous egg parasitoids T. brasiliense Ashmead, T. chilonis Ishii and T. pretiosum Riley (Sushil et al.,1995; Bhattacharya Pruning is an important operation for lac cultivation et al. 2002, 2003, 2007) T. achaeae, T. exiguum and T. (Ghosal et al. 2008; Jaiswal and Singh 2010) for ostrinae (Bhattacharya et al. 2006) could significant maximum coppices and maximization of lac yield. suppress of E. amabilis and P. pulverea population in Pruning time is also equally important. Brood yield to field condition on winter crop of Kusmi lac insect. Larval brood used ratio in Aghani lac production was found parasitoid, Bracon greeni, also significantly suppresses maximum 6.87 when pruning of Ber was carried out in E. amabilis but only at higher doses of 100 and 120 April (Ghosal 2009). Pruning of host not only rejuvenate larval parasitoids/tree (Sharma et al. 2008). the plant but also provides a resting stage for the plant to recoup. Bohnert et al. (2006) reported that Telenomus remus Nixon was reported as an egg homeostasis, a set-value for metabolism under optimal parasitoid of Chrysopa spp for the first time by Sushil conditions, is rarely achieved by plants because of the et al. (2002a). The population of both predators- E. cost exerted by external stress factors, i.e. climatic, biotic amabilis and P. pulverea were significantly less in lac and nutrient imbalances. encrustation harboring the ant population, probably because in search of honeydew ants were destroying Integrated pest management is an approach to

281 the eggs of these two predators (Kumar et al. 2007). The (0.05%) against parasitoids infecting the lac insect (K. role of ants in significantly reducing populations of P. lacca) on B. monosperma. A. purpureus and T. pulverea by interfering with oviposition, destroying their tachardiae were the dominant parasitoids that emerged eggs and physically attacking eggs and larvae is reported from the lac insect. The mortality of the lac insect did Yayi region, Mojiang County, Yunnan Province China by not significantly vary between the control and insecticide SiMing et al. (2010). treatments, suggesting the safety of the insecticides at 20 and 40 days after treatment. The populations of T. tachardiae and A. purpureus at 20 and 40 days after Pesticide approach treatment were also not significantly affected by the insecticides. Ethofenprox at 0.01% resulted in 100, 84 Malathion (0.005, 0.01, 0.02 %) dichlorvos (0.005, 0.01, and 70% mortality of the first, second and third instar 0.02, 0.03, 0.04 %) and endosulfan (0.05%) proved to larvae of C. madestes respectively. However, treatment be safer to K. lacca and toxic to E. amabilis. However with 0.02% ethofenprox was the most suitable for Dichlorvos at 0.03% was most suitable for the control protecting the lac crop at the critical stage against C. of egg, larval and pupal stages of E. amabilis (Mishra madestes since field evaluation showed it caused 100% et al. 1995) as well as C. madestes (Mishra et al. 1996). mortality of all developmental stages and did not harm Cartap hydrochloride and Ethofenprox is effective for the lac culture(Jaiswal et al. 2007). the management of lepidopterian (E. amabilis Moore, P .pulverea Meyr) and the neuropteran (Chrysopa spp.) Topical application of lambdacyhalothrin (0.005 and safe for K. lacca (Jaiswal et al. 2004; Bhattacharya and 0.008%), carbosulfan (0.02 and 0.03%), fipronil et al. 2005a) . Endosulfan 35 EC also application (0.005 and 0.01%), alphamethrin (0.005 and 0.01%), resulted in killing E. amabilis (Bhattacharya et al. spinosad (0.02%), indoxacarb (0.02%), and ethofenprox 2005a)and increasing the brood lac yield significantly (0.02%) exhibited 100% mortality of serious neuropteran from 3 to 8.7 times in comparison to control (Jaiswal et predator (C.lacciperda Kimmins) of K. lacca within 24 al. 2004).Ethofenprox was safe to lac insects but was hr of treatment. Fipronil (0.005 and 0.01%) and unable to suppress the population of insect E. amabilis indoxacarb (0.02%) were found to be equally effective and 2 important parasitoids (A. purpureus and as cent per cent mortality of was observed within 24 hr Tachardiaephagus tachardiae) of lac insect. Endosulfan of treatment with both modes of treatment (Singh et al. was unable to reduce the population of insect 2009, 2010). According to Jaiswal and Singh (2010) parasitoids (Bhattacharya et al. 2005b). Ethofenprox control for predators of lac insect spraying of (0.05; 004; 0.03; 0.02; 0.01; and 0.005%) was found to ethofenprox 0.02% or Endosulfan 0.05% + carbendazim be a suitable insecticide for application in lac ecosystem 0.01% solution is to done one month after inoculation. as it manages all 3 major lac insect predators, i.e. Chrysopa spp., E. amabilis and P. pulverea, if applied References timely (Jaiswal et al. 2005, 2007). Jaiswal et al. (2005) studied the impact of Amzallag G N (1999) Plant evolution an adaptive theory. In: ethofenprox insecticide application a day prior to the Plant Responses to Environmental Stresses. Ed. H. probable time of emergence of male lac insect .They R. Lerner, Marcel Dekker, New York, 171-246 observed that the application killed emerging male Barman JC, Rahman MM, Sarker D ,Alam MA (2006) Study insects resulting in the loss of brood value of the produce on the effect of water application on Lac survival as most of the female insects remained unfertilized. As and Lac yield during extreme hot weather condition in Bangladesh. Gurpukar, Bangladesh. Gurpukur the unfertilized females secreted less resin Research Institute. Inter J Sust Agri Tech, 2(4): 1- 4 approximately one-third of that secreted by normal Barman JC, Rahman MM, Pramanik MEA, Alam M A ,Uddin fertilized female insects, it was suggested that MZ (2007) Effect of lac cultivation on the yield of ethofenprox should not be applied in lac culture either jujube of different ber (Zizyphus jujube) varieties. J at the time of male emergence or near to that time. Subtrop Agri Res and Dev Gurpukar, Bangladesh, Jaiswal et al. (2006) evaluation of ethofenprox for the 5(3): 286-290 toxicity adult male insects under field conditions on Ben B, Shelby C E, Rowe K E, Urban WE, Blunn CT, shoots of S. oleosa in Kusmi lac ecosystem resulted in Chapman AB, Garwood V A, Lasley JF, Magee WT, the mortality of a large number of adult male insects.. Hazel L N, McCarty J W , Whatley JA (1968) Inbreeding and Swine Productivity Traits. Copyright Jaiswal et al. (2006) studied the efficacy of by Am Soc of Ani Sci Madison. Paper No. 1185 ethofenprox (0.005, 0.01, 0.02, 0.03 or 0.04%), Cartap Bhattacharya A, Mishra YD, Susil SN, Jaiswal AK ,Kumar KK hydrochloride (0.05, 0.075 or 0.1%) and endosulfan (2002) Relative efficacy of some Trichogramma spp.

282 for management of lepidopteran predators of lac Chisholm et al. (2006) Host-microbe interactions: shaping insect, Kerria lacca (Kerr). Entomon 13(3): 12-17 the evolution of the plant immune response. Cell Bhattacharya A, Jaiswal, AK, Sharma KK ,Mishra YD (2003) 124: 803-814 Efficacy of Trichogramma chilonis in the Colton HS (1984)The anatomy of the female American lac management of lepidopteran predators of lac insect. insect Tachardiella larea. Bull Mus nth Arizona In: Proc Nat Symp Front Areas of Ent Res pp: 239- Flagstaff 21:1 -24 240 De Vos et al. (2005) Signal signature and transcriptome Bhattacharya A, Jaiswal AK, Mishra YD, Chakrabarty PK changes of Arabidopsis during pathogen and insect (2004) Efficacy of Trichogramma brasiliense attack. Mol Plant-Microbe Interact 18 923-937 Ashmead, in the management of Lepidoptera Dhiman S, Reji G, Diganta G , Das N G, Baruah I, Rabha B, predators of lac insect, Kerria lacca (Kerr) Lac Talukdar P K, Singh L (2009) Diversity, spatio- production Division, Indian lac Research Institute, temporal distribution and biting activity of mosquitoes Namkum, Ranchi Jharkhand in Tripura State, India. Entomon 34(4): 223-232 Bhattacharya A, Jaiswal AK and Kumar S, Kumar M, (2005a). Gaivoronskaya N F (2005) Production planning and cost Evaluation of Carptap hydrochloride for management management in crop production sectors. Ekonomika of Eublemma amabilis Moore, a serious lepidopteran Sel'skokhozyaistvennykhi Pererabatyvayushchikh predator of lac insect. J App Zoo Res 16(1): 93-94 Predpriyatii 8: 18-24 Bhattacharya A, Jaiswal AK and Kumar, S, (2005b). Effect of Glower P M (1933) Aspidiotus (Furcaspis) orientalis Newstead treatment of broodlac with a few insecticides on the (Coccidae), its economic importance in lac cultivation harboured inimical insects. J Ento Res 29(3): 223- and its control. Bull Indian Lac Res Inst 16: 1-23 225 Glower P M (1937) Lac cultivation of India. Monograph of Bhattacharya A, Kumar S, Jaiswal AK ,Kumar KK (2006a) Indian lac Institute Ranchi pp 147 Efficacy of the egg parasitoids, Trichogramma spp. Ghosal S (2008) Effect of different pruning times on Aghani for the management of Eublemma amabilis Moore lac yield from ber (Zizyphus mauritiana). J Environ (Lepidoptera: Noctuidae) a predator of Indian lac Ecol 26(3): 1020-1022 insect. Entomon 31(2): 121-124 Ghosal S (2009) Effect of different pruning times of Ber Bhattacharya, A, Jaiswal A, Kumar S, Kumar KK (2006b) (Zizyphus mauritiana) in relation to Aghani lac yield. Management of lepidopteran insect predators of lac J Environ Ecol 27: (1) 275-277 insect through habitat manipulation. Entomon 31(1): 53-56 Ghosal S, Sharma K K , Kumar P S (2005) Effect of seedling size and irrigation on plant survival in Flemingia Bhattacharya A, Kumar S ,Jaiswal AK (2007) Evaluation of semialata an important bushy lac host plant. J App Trichogramma species for the suppression of Zoo Res 16(2): 236-237 lepidopteran insect predator, Eublemma amabilis Moore, in lac culture on Flemingia macrophylla. J Gokulpure R S, Mehra B P (1973) Insect visiting Lac insect Bio Cont 21(2): 267-270 for honeydew. J Bombay Nat Histo. Soc 75(2): 502- 505 Bhattacharya A Jaiswal, AK ,Singh JP (2008) Management of lac insect predators through IPM based bioregional Grover A, Agarwal S, Agarwal M S, Katiyar C, Lakshmi O S, approaches. Emerging trends of researches in insect Dubey H, Agarwal S, Kapoor A (2000) Production of pest managt and environ safety 1:221-226 abiotic stress-tolerant transgenic rice plants. Adv in rice gen, Los Banos, Laguna, Philippines, pp 579- Bohnert HJ, Gong Q Q, Li P H , Ma S S (2006) Unraveling 581 abiotic stress tolerance mechanisms - getting genomics going. (Special Issue: Plant Biotechnology He J, Shi L, Deng JA, Mao YF, Shi BC (2003) A preliminary Fast-forward genomics for improved crop study on biology of K. lacca strain Rangeeni. For production). Curr Opi Pl Bio 9( 2): 180-188 Res 16(5): 604-609 Cassells A C, Doyle BM (2003)Genetic engineering and Horne P A , Page J (2008) Integrated Pest Managenment for mutation breeding for tolerance to abiotic and biotic crops and pastures. CSIRO Landlinks Press, Autralia stresses: science, technology and safety. Bulg J 119p Plant Physiol Special issue 2003, 52-82 Inze, D M , Van Montagu 2002. Oxidative stress in plants. Chamberlin JC (1923) A systematic monograph of the Taylor and Francis, London Tachardiidae or lac insects (Coccidae). Bull Ento Res Jaiswal A K, Bhattacharya A, Kumar KK , Kumar S (2004) London, 14 (2):147 -212 Evaluations of ethofenprox (Nukil 10 EC) on lac insect Chen YQ, Xu T, Chen XM and Li K (2003) Study on culture for management of Eublemma amabilis comparative anatomy of bark of seven host tree Moore a lepidopteran predator. New Horizon of species of Kerria lacca (Kerr) and its parasitic animal sciences. Zoo soc of India Magadh University, characteristics. For Res 16(4): 411-417 Bodh Gaya Bihar, India, pp. 47-50 Chen YQ, Chen XM, Li K, Shi L and Chen Z Y (2004) Jaiswal A K, Bhattacharya, A, Kumar M ,Kumar S (2005) Preference of lac insect to host branch in foraging. Evaluation of ethofenprox toxicity to male lac insect For Res 17(2): 159-166. and its effect on broodlac yield. Aisha Shams 12(2): 114-116

283 Jaiswal A K., Bhattacharya A, Kumar M, Kumar S (2006) Effect Malhotra C P (1983) Control of pest of lac insect Kerria lacca of ethofenprox, cartap hydrochloride and endosulfan (Kerr) for easy adoption by cultivators. Indian Shellac on the incidence of two major parasitoids 1(7): 6-7 Aprostocetus purpureus Cameron (Hymenoptera: Malhotra C P , Choudhary S G (1968) Control of Eublemma Eulophidae) and Tachardiaephagus tachardiae amabilis Moore (Noctuodae: Lepidoptera) and Howard (Hymenoptera: Encyrtidae) on lac crop. J Holcocera pulverea Meyr (Blastobasidae : Ento Res, 30(1): 71-73 Lepidoptera) predators of lac insect, Kerria lacca Kerr Jaiswal A K, Bhattacharya A, Kumar S, Patamajhi P (2007) by Bacillus thuringiensis .Ber J Invert Path 11(3): Evaluation of ethofenprox on Chrysopa madestes 429-439 (Neuroptera: Chrysopidae) a serious pest of Indian Malhotra C P , Katiyar R N (1975) Control of Eublemma lac insect, Kerria lacca Kerr. J Ento Res 31(2): 113- amabilis Moore, serious predators of the lac insect 114 Kerria lacca (Kerr.). Screening of insecticide for their Jaiswal A K, Bhattacharya A, Kumar S,Singh, J P (2008) safety to lac insect. Indian J Ent 37: 385 -396 Evaluation of Bacillus thuringiensis Berliner var. Mehra B P (1965) Biology of Chrysopa madestes Banks kurstaki on kusmi winter crop for management of (Nuropteran), Chrysopidae. Ent Soc India, 27(4): 398- lepidopteran pests in lac culture. Indian J Ento 70(2): 407 153-156 Mishra M P, Negi P S , Gupta S N (1930) The noctuid moth Jaiswal A K , Singh J P (2010) How to culture lac insect on (Eublemma amabilis Moore),a predator of the lac Zizyphus mauritiana - Indian Plum tree. Indian insect and its control. J Bombay Nat Hist Soc 34: Institute of Natural Resin and Gums Namkum 431-445 Ranchi, Bulletin no. 01 pp 1-22 Mishra M P ,Gupta S N (1934) To study the life cycle of Jones J D G , Dangl J L (2006) The plant immune system. Holcocera pulverea Meyr. Indian J Agri Sci 4(2), 364- Nature 444, 323-329 382 Kerr J (1782) The philosophical transaction . Royal Soc of Mishra Y D, Bhatacharya A, Sushil S N, Sharma K K , Jaiswal London 71: 374-382 A K (1995) Efficacy of some insecticides against Koltunov E V , Andreeva E M (1999) The abiotic stress as a Eublemma amabilis Moore, a major predator of lac factor responsible for gypsy moth outbreaks. J Appl insect, Kerria lacca (Kerr). J Ento Res 19(4): 351- Ent, 123(10): 633-636 355 Kondo T, Gullan P J (2005) Systematic, morphology and Mishra Y D, Sushil S N, Sharma K K, Bhattacharya A , Jaiswal physiology a new lac insect from colombia, with A K (1996) Efficacy of selected organophosphorus revised keys to lac Insect Genera and to Species of insecticides for control of Chrysopa madestes Austrotachardiella Chamberlin (Hemiptera: (Neroptera: Chrysopidae ) a serious sporadic Coccoidea: Kerriidae). Neotrop Entomo 34(3):395- predators of Indian lac insect , Kerria lacca (Kerr). 401 New Agri 7(1): 17-20 Kumar A, Kumawat M M, Meena K (2007) Lac host plants Mishra Y D, Sushil S N, Bhattacharya A, Kumar S, Mallick A, recorded from southern Rajasthan and their relative Sharma K K (1999) Intra specific variation in host - performance. Trivandrum, India: Assofor Advan of plants affecting productivity of Indian lac insect, Ento 32(2): 129-132 Kerria lacca (Kerr). J Non Timb For Prod 6(3/4): 114- Le Thi Phi (1995) Beyond timber: social, economic and cultural 116 dimensions of non wood forest products in Asia and Mishra Y D, Sushil S N, Kumar S , Bhattacharaya A (2000) the Pacific. For Spec Forest Prod Appl Res Cent 1- Variability in lac productivity and related attributes 8 of Kerria spp. (Homoptera: Tachardiidae) on Ber Lerner H R (1999a) Introduction to the response of plants to (Zizyphus mauritiana). J Ent Res 24(1): 19-26 environmental stresses. In:Plant Responses to Narayanan E S (1962) Pest of lac in India. Indian Lac Research Environmental Stresses. Ed. H. R. Lerner. Marcel Institute, Ranchi, pp 90-133 Dekker, New York, 1-26 Negi P S (1956) Improved methods of lac cultivation. Indian Lerner H R Ed., (1999b) Plant Responses to Environmental Lac Research Institute, Namkum Ranchi. Bulletin no. Stresses. Marcel Dekker, New York 76 pp 1-9 Li J, ZhaoY, Li Y , Huang W (1994) Comparison on the lac Nigel W A (1998) Climate change and water resources in quality of three species of lac insects. For Res 7(4): Britain. Climatic Change 39: 83-110 456-459 Nure F, Nayenb M J, A T M Rafiqul, H , Mohammed M (2010) Li J,Hu X (1994) Rejuvenation and utilization of wild Ziziphus Lac production and its economic return to rural mauritiana. For Res 7(2): 224-226 economy in Rajshahi Division, Bangladesh. Florida Lin X L , Su X Q (2001) Effects of stocking lac insect on Ento pp: 89 quality of bark extract of Acacia auriculiformis. J Oerke E C C, A Weber, W H Dehne,F Schonbeck, (1999) Fujian College of Forestry pp 21 Crop Production and Crop Protection. Elsevier, Mahdihassan S (1953) On Lakshadia FICI, Green, with its Amsterdam. red and yellow forms. Indian For Res 79(7): 366-68 Ogle A, Thomas M ,Tiwari L M (2006) Technical consultancy

284 report on strategic development of lac in Madhya insect (Kerria lacca). Indian J Agri Sci 79(9): 727- Pradesh. Enterplan Limited UK, 61 pp 731 Patel H M , Yadav Y D (1991) Occurrence of mottled emigrant Singh J P, Jaiswal A K, Monobrullah M ,Bhattacharya A (2010) Catopcilia pyranthe (Lepidoptera: Pyridae) and its Effect of selected pesticides on larval mortality of natural enemies at Anand. Indian J Agri Sci 61(10): the neuropteran predator, Chrysopa lacciperda 781 - 791 Kimmins, of the lac insect, Kerria lacca (Kerr). J Asia- Pieterse et al. (2002) Signalling in rhizobacteria-induced Pacific Ento 13(1): 69-72 systemic resistance in Arabidopsis thaliana. Plant Singh R (2006) Lac Culture a monograph. Published by Udai Biol 4, 535-544 Pratap Autonomous College Varanasi- 221002; pp Prasad N, Jaiswal A K ,Kumar K K (2004) Energy requirement 2-18 in lac production. Agri Mechani in Asia, 35(1): 54-58 Singh R, Singh D , Rao V U M (2007) Effect of abiotic factors Pukayastha B K , Motiram (1979) effect of gibberellic acid on on mustard aphid on Indian brassica. Indian J Agric the growth of bushy lac host plants in relation to lac Res 41(1): 67- 70 yield. Indian J Agri Sci 49 (8): 620 SiMing W, YouQing C, Li Qiao, Lu ZhiXing, Liu ChunJu,Guo Rahaman M, Ahamad K N, Shahjahan K N, Karim M , Ali S ZuXue (2010) The influence of ant-visiting Kerria (2009) Bionomics of Eublemma amabilis Moore yunnanensis on populations of Holcocera pulverea (Lepidoptera: Noctuidae), a major predator of lac in lac plantation. Chinese Bull of Ento 47(4) 730- insect and its control measure. Bangladesh J Sci 735 Indust Res 44(1), 57-64 Sushil S N, Bhattacharya A, Sharma K K, Jaiswal A K and Ramani R, Monobrullah M , Baboo B (2010) Lac hosts and Mishra YD (1995) Introduction of Trichogramma gum-yielding trees for agro-forestry in Jharkhand pretiosum Riley (Hymenoptera: Trichogrammatidea) Indian Institute of Natural Resins and Gums, Ranchi. as eggs parasitoid of Eublemma amabilis Moore World J Agri Sci 6 (3): 268-273 (Lepidoptera: Noctuidea) a predator of lac insect. Rao A R , Singh P (1990) Lac cultivation and marketing. Indian Pest Manag and Econ Zoo 3:51-53 For 166(6): 459-463 Sushil S N, Bhattacharya A, Jaiswal A K(2002) Predatory Roonwal M L, Raizada M B, Chatterjee R N, Singh B 1958 response of Chrysoperla carnae (Stephens) Descriptive account of the host plants of the lac (Neuroptera : Chrysopidae) against lac insect, Kerria insect, Laccifer lacca (Kerr) and the allied plants in lacca (Kerr). J Appl Zool Res 13(1): 100-101. the Indian region (Part 1 & 2),Indian Lac Cess Schoonhoven L M et al., eds (2005) Insect-Plant Biology, Committee, Ranchi, pp 140 Oxford University Press Sharma K K, Ramani R , Mishra Y D 1997 An additional list of Tewari D N (1994) Tropical Forest Produce. International Book the host - plants of Lac insects. Kerria spp Distributers, Dehradun pp 83 (Tachardiidae : Homoptera). Journal of Non - Timber Thomas M (2004) Squirrel damage to Kusumi lac in Madhya For Prod 4 (3/4): 151 -155 Pradesh, India. Vaniki-Sandesh 28(1): 14-15. Sharma K K, Kumari K, Kumar M (2005) Analysis of factors Thomas M , Gupta B S (2003) First report of termite damage responsible for low yield of lac in India. J Appl Zool on lac. Bharatiya Krishi Anusandhan Patrika Res 16(1), 95-96 18(1&2):77-79 Sharma K K, Kumari K , Kumar M (2006). Role of lac culture Varshney R K (1976) A check list of insect parasites in biodiversity conservation: issues at stake and associated with lac. Orient Insects 10: 55-78 conservation strategy. Curr Sci 91(7): 894-898 Van Poecke R M P, Dicke M (2004) Indirect defence of plants Sharma K K, Kumari K , Lakhanpaul S (2007) Host plant against herbivores: using Arabidopsis thaliana as a mediated variations in resin producing efficiency of model plant. Plant Biol 6, 387-401 Indian lac insect, Kerria lacca (Kerr) (Homoptera: Varshney R K , Teotia T P S (1967) A supplementary list of the Coccoidea: Tachardiidae) Entomon Trivandrum, India. host plants of lac insects. J. Bombay Nat. Hist. Soc., Ass Advan of Ento 32(3): 203-207 64: 488-511 Sharma A K, Kumar S, Kumari, K, Gupta, K K (2008) Effect Witt D O (1901) A note on the larva of Eublemma amabilis of larval parasitoid, Bracon greeni Ashmead on Moore, as a lac insect destroyer in Damoh Division, Eublemma amabilis, the lepidopteran predator on C.P. Indian Forestry pp 17 lac insect, Kerria lacca Kerr. Analysis of factors Yang C Y, Zhang J Y , Cai J (1998) Study on the adaptability responsible for low yield of lac in India. J Appl Zool response between lac insect and its host tree. Forest Res 19(2): 215-216 Res 11(6): 647-651 Shrivastava A K, Srivastava D C, Solomon S, Srivastava M K Youqing C, Qiao Li, YanLin C, SiMing W, YuanCheng Y, , Singh I (2003)Physiological characters imparting (2010) Lac-production, arthropod biodiversity and resistance to biotic and abiotic stresses in sugarcane. abundance, and pesticide use in Yunnan Province, Sugar Tech 5: (3): 105-120 China.Trop Ecol 51(2): 255-263 Singh J P, Jaiswal A K, Monobrullah M,Bhattacharya A (2009) Response of some selected insecticides on neuropteran predator (Chrysopa lacciperda) of lac (Manuscript Receivd : 27.12.2011; Accepted 18.05.2012)

285 JNKVV Res J 46(3): 286-293 (2012)

Expanding dimensions of Plant Pathology

Sanjeev Kumar and Om Gupta Department of Plant Pathology Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract at Rs. 1,200 crores The worst suffers from spurious pesticides are the poor, gullible farmers who lose money on the pesticides Plant pathologist's have the onus to address the current and bought and do not controlling the target pest; they sometimes emerging global concern of the plant pathology sector. The lose the entire crop. This is a very difficult and challenging status and importance of various diseases have changed over task, as the local officials from the agriculture and vigilance the years. Several diseases like papaya mosic in citrus, sheath police department have to be involved to make the entire blight of rice, bract mosaic of banana, charcoal rot of soybean, operation fool proof and to ensure that the offender do not dry root rot of chickpea, downy mildew of maize etc have escape. Integration of all the methods of disease management taken serious proportions and are recent examples of minor is essential as any single method will not be effective .The and secondary diseases becoming the major ones. The crop area under IDM needs to be expanded. losses due to pests, diseases and weeds are approximately assessed to be ranging between 10-30 % crop productions. Agriculture is the income provider for more than 65 Accurate diagnosis of viral, bacterial, fungal and nematode percent of the people. Although the contribution of the diseases using serological and molecular diagnostics will be agriculture to Indian GDP has gone down considerably order of the day. Transgenic plants showed resistance to different diseases. Ribozyme, plantibodies, PR proteins, in the last few years, this sector continues to be the defensins will provide resistance to many diseases and largest economic sector of India. The diminishing blow technologies need to be fined tuned. However, it remains to of this proletarian sector in India's bourses has raised be seen how these transgenics perform under natural disease concerns considering the dependency of two thirds of conditions. Ug 99 race of stem rust pathogen Puccinia the Indian population on it for survival. So discussions graminis tritici originated in Uganda in 1999 has potential to on sustainability, biodiversity, hybrid varieties, migrate to the Indian subcontinent. Several alien genes have transboundry movement, development of races/strains, been proved to provide resistance to this race in Indian transgenic crops, and enhancing productivity are doing research programmes, but the long term strategy should focus rounds in the scientific circles and policy veterans. on rebuilding the "Sr2- complex" to achieve long term durability. Over the year, during quarantine processing, the pests Amidst these talks of injecting prosperity into the Indian intercepted include many that are not known to occur in India, farming scenario, the relevance of plant protection in have different races/biotypes /strains not known to occur in saving losses amounting to crores of rupees has been India. These interceptions, especially of disease and pests vastly undermined. not yet reported from India signify the importance of quarantine in preventing the introduction of destructive exotic disease As per the estimate by the Central Pollution Control and pests. The need of hour is to strengthen the agricultural Board of the Govt. of India, the highest food grain loss biosecurity of the country. Biopesticides offer a large array of is due to weeds (28%), diseases (25%), insects (23%), alternatives and hope to our efforts in disease management. during storage (10%), rats (8%) and others (6%). As At present, biopesticides have been less than 5% share in reported by the Union Minister of Agriculture while the world market. Even when we find that some microbial responding to a starred question No. 62 in Rajya Sabha biocontrol options are working effectively, We cannot promote on 2 March 2007, the crop losses due to pests, diseases them to be routinely sold from a sales counter like fungicides. and weeds are approximately assessed to be ranging Forecasting systems for potato late blight, apple scab, powdery mildew of mango and rice blast are now available. between 10-30 % crop productions. If we consider, on But for practical utility in growers' field there is still a lacuna. a average, crop loss of 20% , and the present gross In this connection, training programme for the palnt value of our agriculture produce as Rs, 7 lakh crore, pathologists, extension persons as well as for the grower is the loss comes to Rs. 1,40,000 crore, which is very huge. necessary. The size of spurious pesticides in India is estimated Even if we could save 50 percent by using plant

286 protection, it will add Rs. 70,000 crore additional income by virtue of evolution of virulent races or resurgence to our farmers. At a same time, when all of us are capabilities. concerned about National Food Security, can the country afford these losses? The nematode problems have taken their toll and with each year passing some of them are gaining Not only does the agriculture sector incur momentum to decimate the entire cropping systems- monumental monetary losses due to these factors, as the root knots, reniform and burrowing nematodes are an agrarian industry it is letting away the expectacular important in different states; M. indica is devastating export opportunities under the liberalized WTO regime. the kagzi lime in Gujarat, the root knot complex has The export market demands the products to be on par similarly created serious situation with Ceratocystis with national quality standards, The discerning Indian fimbriata on pomegranate in Maharashtra, Karnataka consumers also expect the commodities to be of good and North Gujarat; the root knot is severely infesting quality. Moreover, in this era when there is mounting mulberry plants which is adversely affecting the silk pressure on each unit of cultivated land to produce, it industry in Karnatka. Mostly, the reactions to outbreaks is only logical to assume that saving these losses is as of diseases are in fire fighting mode and once the fire is good a strategy as increasing production. Research doused, there is no follow up or recording the causes thrust is needed to develop new novel technologies and which had resulted in outbreaks. Even where the causes strategies in plant pathology to insulate the farm produce are investigated by eminent teams, their from pests and pathogens. The plant pathologists have recommendations remain on paper a crucial role to play in this juncture. We have to be more proactive than reactive in our approach. Some of Plant disease diagnostics the current thrust area for our proactive interventions to boost agricultural production in our country are briefly discussed below. All the disease management strategies are based on accurate identification and diagnosis of plant pathogens during early stages of infection. A simple cost effective, Changing disease status safe and rapid method of pathogen detection is a pre- requisite of all the disease management programmes. The status and importance of various diseases have Visual identification of pathogens is a very rapid method changed over the years. Several diseases like papaya of disease diagnosis. However, it is difficult to perform mosic in cirus, phytophthora diseases have taken by inexperienced personnel and is limited particularly serious proportions and are recent examples of minor to diseases affecting aerial parts of the plants. The and secondary diseases becoming the major ones. In second methods of choice is microscopic examination 2008, there was flare up of neck blast and brown plant of diseased tissues and identification of pathogen on hopper of rice in Haryana causing losses up to 40% the basis of their morphological characteristics. This due to incessant and unprecedented rains at the flag method of disease diagnosis also requires highly end of monsoon season ( Bambawale 2008). Similarly, specialized taxonomists. Pathogen detection based on diseases with unknown or complex etiology such as antigen- antibody interaction is another rapid method mango malformation and para wilt and grey mould of of disease diagnosis that involves monoclonal cotton and other diseases such as sheath blight of rice/ antibodies (Kohler and Milstein1975) and enzyme linked maize, bract mosaic of banana, downey mildews in immunosorbant assays (Clark and Adams 1977). maize and several other crops have become devastating However, the technique is predominantly used in the detection of viral diseases of plants.

Major present and expected threats

Diseases Pests Nematode

Sheath blight of rice & maize Helicoverpa armigera/ Spodoptera/ Root knot/ reniform. Burrowing Downy mildews /wilts / bract mosaic Plutella xylostella / Rice BPH/ Stem nematode/ root knot complex with of banana/virus diseases/Phytophthora borer/White grubs/ Termites/ Fruit fly/ Ceratcystis fimbriatain diseases/Parawilt cotton/Mango mites pomegranate/ citrus/ root knot on malformation Mites mulberry

287 Nucleic acid based detection methods overcome migration of Ug 99 into Indian subcontinent in the near various problems associated with microscopically and future. Although, several alien genes have been proved immunological detection of plant pathogens. Besides, to provide resistance to this race in Indian research these can be used at any developmental stages of plant programmes, but the long term strategy should focus since all living cells contain entire set of the genome on rebuilding the "Sr2- complex" to achieve long term and not affected by the environment. DNA probes are durability. It is expected that consequences of global basically used for the precise and accurate detection warming may lead to emergence of more deadly of pathogens or pathogen propagules in infected pathogenic variants not only in stem rust pathogen but tissues. In India DNA probes have been made for the in leaf and stripe rusts too. Hence, it is the need of the detection of Alternaria spp (Sharma and Tewari., 1996a; hour to be ewxtra vigilant on evolutionary trends as well Sharma & Tiwari., 1998) and Rhynchosporium secalis as internationally as wind borne rust spores know no (Sharma et al., 1996b). However, not many reports are political boundaries. At the same time, suitable available on these aspects from India since most of the strategies on breeding for rust resistance need to be work is concentrated on the development of PCR based devised as preparedness to fight these human enemies diagnostic tools. Molecular characterization and not only on national front but through the international detection of plant pathogens would be better done by convention. the use of single nucleotide polymorphisms (SNPs) by making use of unique sequence polymorphisms. These Biopesticides and infrastructure available markers can detect differences at single base pair level, which is the ultimate limit of molecular detection. Biopesticides offer a large array of alternatives and hope to our efforts in disease management. At present, Climate change biopesticides have been less than 5 percent share in the world market. Even when we find that some microbial Climate change and the response of pathogens to biocontrol options are working, effectively. We cannot changing conditions are matters for utmost priority for promote them to be routinely sold from a sales counter Plant Pathologists. Research on impacts of climate like fungicides. change on plant diseases has been limited, with most Since 2001, the biopesticides have come under work concentrating variable on the host, pathogen, or the CIB pesticide registration act and we now have a the interaction of the two under controlled conditions. little more than 100 registered products of Trichoderma, Climate change could result in - extension of around 50 of Pseudomonas fluorescens. It can be said geographical range of crops and their pathogens, that only around 10 percent of these production units increased over wintering/over summering periods, have good facility with regard to fermentation changes in population growth rates; increased number equipment, trained staff including qualified plant of pathogen/ vector generations; evolution of new pathologists, sufficient space for each operation, rolling biotypes/races; changes in crop pest synchrony; capital and enough buffering capacity. They are changes in interspecific interactions; increased risk of providing standard quality products, through there is invasions by migrant vectors and pathogens; and introduction of alternative hosts etc. Intensified research good scope for further improvement. The remaining 90% on climate change- related issues could result in of the biopesticide entries are mostly 'one man shows' improved understanding and management of plant which look mostly at short term gains. They lack proper diseases in the face of current and future climate infrastructure and often end up with contamination of extremes. Specific genes in different crops that can the nucleus culture obtained from public institutes. perform under increased temperatures need to be These two types of setup have some major problems- identified and exploited. in general, these lack R & D facility. A strain of culture is obtained for some public sector institute/ foreign laboratory and the production starts. Even without Ug 99 evaluation against the target pest the label claims say that it can manage several different diseases. Their Ug 99 race of stem rust pathogen Puccinia graminis exists a high level of specificity with respect to tritici originated in Uganda in 1999 has potential to Trichoderma spp, P fluorescens, etc. and label claims migrate to the Indian subcontinent. Majority of Indian are even more relevant to the biopesticides than the cultivars possess gene Sr h31 which is susceptible to chemical pesticides. this deadly race. Plant pathologist has anticipated

288 The transfer of biopesticides from public research The low levels of resistance conferred by PR proteins institutions to private firms is like a relay race with the has been most likely due to fact that there are several ultimate goal of achieving adequate control of a disease. minor genes involved in the expression of resistance A number of characteristics are desirable for the response along with major R genes. On the other hand biocontrol agent to become commercial reality. desired levels of resistance has been obtained by over expression of key regulatory genes such as Arabidopsis Researcher need to demonstrate through preliminary Npr1 gene to rice has resulted in enhanced resistance screening tests that the biopesticides has potential uses against both bacterial leaf blight and sheath blight at appropriate CFU (colony forming units) counts. If we (Chern et al. 2001). look at the data generated by some public institutions, we find that very high levels of CFU have been used In India, not much work has been done on not only for Trichoderma field evaluations but also for development of disease resistant transgenics except other bioagents viz, Beauveria bassiana, Verticillium one report where in disease resistance transgenics have lacanii, Metarhizium anisopliae, etc. If the preliminary been developed in banana and tobacco by transferring screenings require very high dose of 10 or even 100 a synthetic substitution analogue of a short peptide. kg/ ha (as per the existing CIB registration standards) Maganin (Chakarbarti et al. 2003). Magainin is one of to achieve field efficacy, we can not expect these the earliest reported antimicrobial peptides from skin biopesticides to work at existing standards and rate of secretions of the African clawed frog. The peptide is applications. We either have to appropriately revise our not stable in its native form and, therefore, researchers existing commercial standards or should be able to show modified it to express in foreign plant systems. Tobacco that these biopesticides work at relatively low levels plants transformed with the peptide showed enhanced reisistance against Sclerotinia sclerotium, Alternaria under field situations. alternata and Botrytis cinerea. Transgenic banana plants showed resistance to Fusarium oxysporum f. sp. Transgenics cubense and Mycosphaerella musicola. However, it remains to be seen how these transgenics perform under natural disease conditions. Transgenics i.e. plant genetically modified by transferring a foreign gene either off plant or any other origin are expected to be an important component of Farmer participatory crop heath management (CHM) agriculture. Plant transformation offers the possibility of introducing cloned resistance genes into recipient species without the requirement of sexual compatibility Participation is about letting people do it themselves. It and therefore, has the potential to greatly increase the is about providing the occasion for them to think about resistant germplasm. For this strategy to be successful, their own development, what values they hold, what the isolated R gene (s) must interact appropriately with skills and resources they have and how they want to the signal transduction apparatus of the new host cell develop CHM. It is about giving new ideas and and must also, in some cases, be capable of recognizing information and encouraging villagers to consider their new pathogen species not previously encountered. different options- but imposing the agenda of outsiders. Successful transfer of R genes across genus/species Project staff who are participative in their approach do barriers has been achieved wherein a pepper disease not act as expert but as facilitators. But to be effective resistance gene Bs2 has been transferred to tomato as a facilitator it helps to know how other do it and what and shown to provide desired levels of resistance to they do. These guidelines are a 'how to do it' practical bacterial leaf spot (Tai et al. 1999). In another study a guide for all those who are new to the project. This late blight resistance gene, RB has been successfully reflects the project philosophy and current practice. transferred from wild potato, Solanum bolbocastanum These guidelines are meant to the revised and updated to cultivated S. tuberosum ( Song et al. 2003). Both with experience. The second Green revolution and for these R gene transfers have been made across sexually that matter Ever green revolution can be realized incompatible genera or species. through the leadership of plant pathologists through Significant investments have been made during participatory plant pathology with focus on CHM. the past 10-15 years in developing disease resistant transgenics by over expressing pathogenesis related Disease forecasting and monitoring proteins (PR- proteins) or defense- response gene such as chitinase, glucanases, etc., however, success in terms of obtaining desired levels of resistance under Plant disease forecasting and monitoring provides early field conditions has been minimal (Mondal et al. 2003). information about the probable occurrence of a disease

289 to facilitate chemical prophylaxis at appropriate time sale of pesticides in the country, Government of India either to stop pathogen multiplication or further spread has in acted the insecticides Act, 1968 and has made of the disease. Early information is essential to Rules there under, under the Act, manufactures of determine number of sprays and schedules to make insecticides must obtain a manufacturing license from economically sound disease control, and limit the the state Government and the product registration from chance of development of pathogen resistance to the the Central Government. The enforcement of provisions pesticides. In developed countries pesticide use is of the Act relating to manufacture and sale of warranted by well established monitoring, surveillance insecticides primarily rests with the state governments. and forecasting system. It is generally done by The state governments have set up a Central established relationships between pathogen population Insecticides Laboratory under section 16 of the Act to and physical weather parameters like air temperature, perform the statutory role of referral analysis. There are rainfall, relative humidity, cloudiness, dry wetness or provisions in the Act to provide punishment to the offenders. The central government has also conducted leaf wetness duration. Field monitoring for pre disease awareness campaign by way of advertisements in symptoms at susceptible stage and monitoring of national as well as local news paper against spurious favorable weather conditions make the basis of disease pesticides. monitoring. Forecasting and monitoring of major air borne diseases have been given based on the knowledge on biology and ecology of the pathogen, Development of resistance to fungicides quantitative seasonal studies over several years, season range , and variation in the population pattern, The problem of fungicide resistance has become a geographical distribution and weather records. subject of concern ever since the release of site specific Forecasting systems for potato late blight, apple scab, fungicides for plant disease control. All major classes powdery mildew of mango, beer and rice blast are now of systemic fungicides like benzimidazoles, phenyl available (Sinha and Banik 2009). However, forecasting amides, sterol biosynthesis inhibitors, dicarboximides, systems developed elsewhere could be adopted with organ phosphorous and recently strobilurins have local situation after expert judgments and field trials. encountered the problem of resistance build up in target But for practical utility in growers' field there is still a pathogens numbering more than 100 mostly in lacuna. In this connection, training programme for the plant pathologists, extension persons as well as for the developed countries where consumption of fungicides grower is necessary. per unit area is more. Limited work is being done in India to monitor and record development of fungicide resistance and for developing effective, rapid methods Adoption / implementation of IDM for detection of resistance genotypes of pathogens, Fungicide Resistance Action Committee (India) has The boon in the knowledge centric array of IDM ironically been formed in 1999 by Crop Life India, Mumbai with proves a bane on reaching the knowledge -poor and the main aim to formulate fungicide use guidelines and resource deficient farmers at the implementation stage. strategies for prevention and management of resistance. Socio economic and educational status of farmers have Much work needs to be done on this problem under had a lot of bearing on the adoption/ success of the natural situations in India. programme. More worrisome are environmental insensitivities of a majority of farmers, either due to lack Spurious pesticides of knowledge or desperate economic situations, mainly the rural indebtedness. Unprofessional and unstructured farm mechanism of small land holding In India inspite of elaborate system to control the makes the socio economic situation of most of the manufacture and sale of pesticides. The unscrupulous Indian farmers unenviable. Under such situations, the element produce, distribute & sell substandard spurious expectation that knowledge intensive IDM should pesticides, without any fear of law. The size of spurious succeed appears far fetched. Under such compelling pesticides in India is estimated at Rs. 1,200 crores ( situations , most of the IDM implementation efforts in Crop care 2008). The producers of spurious products the country have been rather sporadic in terms of manage to escape from the clutches of law, often temporal and spatial. As per current estimates only 5 because of the local authorities either turning a blind percent of the cropped area in the country is under IDM eye or being a partner in the crime. Because of this (Mayee 2006). collusion between the criminals and law enforcing To regulate inter-alia the manufacture, import and agencies, genuine manufacturing companies have to

290 seek the help of private agencies, to identify and nab harvests. With the current significant shift towards the culprits and seek legal course to punish the market liberalization and reductions in government offenders. This is a very difficult and challenging task, controlled food storage. It is vital that plant health as the local officials from the agriculture and police services provide increased post harvest support to department have to be involved to make the entire growers and farmers. operation fool proof & to ensure that the offender do not escape. The manufacturers of spurious pesticides most often target popular & expensive brands for MNCs Plant quarantine measures or leading Indian companies which have better acceptance amongst farmers. While some of the With the globalization and liberalization in international spurious pesticides contain the active ingredient, trade of plants and plant material in the wake of Sanitary mentioned on the label but at a much less percentage and Phytosanitory (SPS) Agreement under WTO, the than declared on the label, some do not contain any plant quarantine measures have become more active ingredients, mentioned on the label but at a much imperative. Liberalization in trade polices have helped less percentage than declared on the label, some do the world agriculture trade to prosper which is key sector not contain any active ingredients. It could be talcum/ for many countries like Inida whose economies are very chalk powder or simply a solvent or kerosene. much dependent on agrarian industry. But the likely The worst suffers from spurious pesticides are hood of the presence of pest/disease inherent in the the poor, gullible farmers who lose money on the import material can very well jeopardize the trade. It pesticides bought and do not controlling the target pest; needs coherence from the participatory member they sometimes lose the entire crop. Given the cost countries. benefit ratio of 1:5 of genuine pesticides, and on an The phenomenal success of Indian Agriculture estimated sale of Rs.1200 crores of spurious pesticides, has been largely due to the introduction of valuable farmers loose about Rs. 6000 crores. Income expected germplasm. The tempo agrarian industry can only be from their crop. The manufacturing sector loses the maintained if this flow of germplasm is continued. But market of Rs.1200 crores & expected profit there from the threat of 'accompanying pest/pathogen/ while the Central govts lose 14 percent exercise ( Rs. weeds'continue to overshadow this import. Domestic 168 crores) and state govts lose 4 percent VAT (Rs. 48 quarantine is also as important as the international crores). Above all, the extent of harm done to quarantine and therefore, planting materials should be consumers' health and environment is not known (Crop moved from one state to another or from one place within care 2008). a state to another under strict phytosanitory conditions. To much conservation on the part of plant quarantine Post harvest, food safety and processing officials and too liberal an attitude on the part of plant introduction officials/breeder would be harmful. Plant Post harvest is a key element in agricultural systems. genetic stocks are a global resource meant for the Often post harvest activities compete with the welfare of humanity. For the success of agriculture as husbandry of other crops with the results that the drying, a whole, introduction of germplasm is imperative. Plant threshing, marketing and storage of food crop are given quarantine services are charged with the responsibility less attention than the land preparation for the next crop of preventing the entry of hazardous pests, pathogens to be taken in sequence. Unfortunately, the integrated and weeds, but to deny entry to the valuable genetic perception of crop production therefore tend to stop resources would be against national interest. These when the crop is harvested with minimum attention paid activities are meant to help agricultural development to post harvest activities particularly in small farms. and they are complementary to each other and therefore Post harvest operations are regarded generally as quite are necessary, and we on our partnered to be fairly separate from production activities. The deficient vigilant. As has been very truly said - "An ounce of storage facilities lead to poor germination of seed. On prevention is worth a pound of cure" an average 30% of food grains and more than 50 percent or fruits and vegetable are lost or damaged in Human Resource Development (HRD) transportation, market and in storage, mainly due to damage from fungi, bacteria and insects. (Kolte 2006) National food security therefore, depends on safe HRD is a process by which employees are helped in conservation of grains, fruits, vegetables and other crop continuous planned way to (a) acquire/sharpen the

291 capabilities that are needed to perform various functions • Plant Pathology has turned molecular. DNA associated with their present or expected future roles, sequences of a few plant viruses and bacteria (b) develop general capabilities and discover and exploit completed. More will follow alongwith the their inner potential for their own and/ or organizational sequences of other pathogens. development purposes, and (c) develops an • Law will become stringent in the movement of seed, organizational culture in which superior - subordinate planting materials and non tariff barriers will relation ships, team work and collaborations to increase. professional well being motivation and pride of employees. It largely deals with improvement of • Climate change and the response of pathogens to knowledge, skills an attitude. The skills are of two kinds: changing conditions are matters for utmost priority- Technical skills and personal skills. While some training It calla for quick response from Plant Pathologists. is provided to a Plant Pathologist for technical skills, • Epidemiology using satellite photography, remote no attention is paid to the personal skills. sensing with better predication of weather will become accurate or near accurate. Since the costliest resource of Plant Pathology is the Plant Pathologists. The progress in Plant Pathology • Gene shears (ribozyme), plantibodies, PR proteins, would occur only by developing Plant Pathologists. The defensins will provide resistance to many diseases combination of HRD and Plant Pathologist is the need of and the technologies will be fine tuned. the hour. The synergism of the two would yield following • Support development and adoption of new benefits: technologies including GM technologies in all crops. • Plant Pathologists and administrative staff (PPA) • Biocontrol agents and botanicals will find greater will become more competent role. • PPA will understand their roles better • Integration of all the methods of disease management is essential as any single method • PPA will be more committed will not be effective .The area under IDM needs to • PPA will develop greater trust and respect for be expanded. each other Epilogue These are only few examples and the • Greater collaboration and team work among PPA area is so wide that we can contribute substantially to reduce losses due to diseases in coming years and play • PPA will have better problem solving capabilities our role in food security. We wish to remind you all to • Useful and objectives data on PPA get generated what Stakeman has said, 'research must be good but it must be good for something.' Horsfall remarked that • Top management becomes more sensitized to Pathology is both a science and an art. Science is the employees' problems and human resources understanding the pathogenesis, development, resistance and so on and the art is managing crop diseases. Now it is also commerce where the It is noteworthy that the success of the HRP - Plant technologies developed can carry tag of Intellectual Patholgoist marriage would largely depend upon the Property Right and earn money. We do not know organizational commitment, which concerns with the whether the frontier area elaborated here are new but persons' emotional attachment to their organization. they are in limelight for over a decade. We the young pathologists will make an endeavor to take up research Future prospects in some of these areas and contribute significantly to reduce losses due to diseases in future.

• Accurate diagnosis of viral, bacterial, fungal and nematode diseases using serological and molecular References techniques will be the order of the day. Bambawale OM, Saradana HR, Arora S (2008 ) Expanding dimensions of plant protections as per current needs

292 . Crop Care 34(2)15-21 Mayee CD (2006) Plant pathology in growth of Indian Chakarbarti A, Ganapathi TR, Mukherjee PK and Bapat VA Agriculture. J Mycol Pl Pathol 36(3) 355-359 (2003) MSI-99, a magainin analogue, im7parts Thakur RP (1999) Pathogen diversity and plant disease enhanced disease resistance in transgenic tobacco management Indian Phytopath 55 (1)1-9 and banana. Planta 216: 587-596 Sharma TM and Singh BM (1995b) In vitro microrhizome Chern MS, Fitzgerald HA, Yadav RC, Canlas PE, Dong X , production in Zinger officinale; Plant Cell Rep 15:274- Ronald PC (2001) Evidence for adisease resistance 277 pathway in rice similar to the NPRI- mediated Sharma TR and Tewari JP (1998) RAPD analysis of three signaling pathway in Arabidopsis. Plant J 27:101- Alternaira species pathogenic to crucifers. Mycol 103 Res 102:807-81 Clark MF, Adams AN (1977) Characteristics of the microplate Shekhawat GS (2000) Management of potato diseases method of enzyme - linked immunosorbent assay through host resistance. J Mycol Pl Pathol 30(2) 143- (ELASA) for the detection of plant viruses. J Gen 150 Virol 34:475-483 Sinha P, Banik S ( 2009) Plant disease forecasting and Crop care ( 2008) Official magazine of Crop Care Federation monitoring: An imoerative in precision agriculture. of India 34(2) 1-100 Indian Farming 59(8) 46-50 Kohler G, Milstein C (1975)Continuous culture of fused cells Song J, Bradeen M, Naess SK, Raasch JA , Wielgus SM, secreting antibody of predefined specificity. Nature Heberlach GT, Liu J, Kuang H, Phillips Austin S, Buell (256) 495-497 CR Helgeson JP and Jiang J (2003) Gene RB cloned Kolte SJ (2006) Carrers in Plant Pathology: Plant pathologists from Solanum bulbocastanum confers broad have reasons to be proud of their profession. J Mycol spectrum resistance to potato late blight Proc. Natl Pl Pathol 36(3) 360-364 Acad Sci USA 100: 9128-33. Mayee CD (2008) Molecular Pathology assisted agriculture Tai TH, Dahlbeck D, Eszter TC, Paresh G, Romela P, Maureen growth in India. J Mycol Pl Pathol 38(2) 151-157 C, Whalen RE, Stall RE, Staskawicz (1999) Mondal KK, Chatterjee SC, Viswakarma N, Bhattacharya RC, Expression of the Bs2 pepper gene confers Grover A ( 2003) Chitinase- mediated inhibitory resistance to bacterial spot disease in tomato. Proc activity of Brassica transgenic on growth of Alternaria Natl Acad Sci USA 96 14153-14158 brassicae. Curr Microbiol 47: 171-173 Pathak VN (2000) The dividing walls are transparent. J Mycol Nagarajan S (2000). Plant Pathology and Indian Agriculture- Pl Pathol 30(2) 137-142 past, present and future. Indian Phytopath 53(2) 121- 128 (Manuscript Receivd : 30.10.2011; Accepted 04.05.2012)

293 JNKVV Res J 46(3): 294-300 (2012)

Extension education approaches for quality seed replacement: need for productive agriculture

K.K. Saxena, Anay Rawat, A.K. Singh and Y.M. Sharma Directorate of Extension Services Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract was 1.32 billion (FAOSTAT 2006). The rate of increase in productivity i.e., yield per unit area has not been so impressive (Singh, 1985). This is because of the various This paper argues that only the improved agricultural production technologies does not improve the productivity but constraints faced by farmers in adoption of a integrated extension system can effectively and efficiently recommended practices/ innovations and other factors. carry out certain functions which are contributory for enhancing Complete lack of knowledge based extension and the yield. The seed plays a pivotal role in agriculture and acts technology dissemination mechanism is major as a carrier of the genetic potentialities of improved varieties. constraints in replacement of seeds (Arora 1998). With no geopardy to the importance of other inputs, the quality Development of technologies, their fine tuning to seeds of improved varieties have major say in increasing address niche specific demands, large-scale adoption production. The average contribution in yield is around 15- and dovetailing of technologies gleaned from diverse 36%. However, conjunctive use of quality seeds with other disciplines of agriculture in well orchestred manner inputs like water, nutrients, plant protection measures etc, will tap up the genetic potentiality of high yielding varieties actually derives the driving force to affect successful raising their aforesaid contribution manifold. Even the local agriculture. Since India is endowed with diverse agro quality graded seed would give substantial increased climatic zones with contrasting climatological production over local unimproved non-quality seed. Quality parameters across the country and the kinds of seed constitutes the key input for increased productivity, agricultural crops and commodities being cultivated are production and profitability. Extension strategies may play vital also diverse, the task of managing the requirements of role for productive agriculture to meet out the present such a highly diversified agriculture is obviously a requirement. stupendous job which needs redressal of the existing and emerging problems through deployment of both Keywords: production technologies, seed replacement conventional and cutting edge frontier science to have ratio and extension strategies speedy remedy synergistically. In the beginning after independence of the country the production of food grain was nearly 50 million tonnes which has reached over Food production from mere 50 million tons in 1950 has 200 million tonnes in the recent past. The projected touched an all time record of approximately 235 million demand by 2020 is 296 million tonnes and 300 millions tons in 2010-11. While retrospecting this spectacular tonnes by 2025. Several emerging challenges confront achievement, significant contribution of agricultural Indian farmers. These include limited land and water technologies, hard work of the farmers and enabling availability, which is further exacerbated by degradation policy support from the Governments are found to be of natural resources; climate changes; changes in the prime mover in enhancing productivity sensulato. demand and consumption patterns, moving toward high- In the globalized economy, agriculture has become a value agriculture; increasing population pressure; and commercial activity. Thus, technological up-gradation liberalization of trade and replacement of local seed of agriculture based enterprises has become imperative. with quality seeds (Lele et al. 2010). In most of the developing countries, majority of the rural poor (farmers) have small landholdings, limited The seed plays a pivotal role in agriculture and resources and excess family labour. In 2006, the acts as a carrier of the genetic potentialities of improved estimated population of farmers in developing countries varieties. With no geopardy to the importance of other

294 inputs, the quality seeds of improved varieties have major The progress of Breeder Seed Production during say in increasing production. The average contribution in 2009-10 was spectacular and touching the level of yield is around 15-36%. However, conjunctive use of quality 115866.81q. Under Annual Oilseed Scheme, the seeds with other inputs like water, nutrients, plant production of breeder seed was 23370.84q against an protection measures etc, will tap up the genetic potentiality indent of 17519.80q in groundnut, 7163.75q against of high yielding varieties raising their aforesaid contribution 11901.20q in soybean and 68.01q against 18.58q in manifold. Even the local quality graded seed would give sunflower, respectively. Under the project, Seed substantial increased production over local unimproved production in agricultural crops? the total production of non-quality seed. There is a wide gap between agricultural quality seeds including all classes were 637618 q along technologies developed at research institutions and its with 606.17 lakh plating materials. adoption by small-scale farmers and rural households (Kroma 2003). Quality seed constitutes the key input for increased productivity, production and profitability. Seed Replacement Rate It has been realized that the pace of progress in agricultural production will largely depend upon the Seed Replacement Rate is the percentage of area sown extent of progress of quality seed production out of total area of crop planted in the season by using programme. Inadequate availability of quality seed is a major constraint limiting productivity and it is largely Table 1. Seed Replacement Rate at National level depends upon development and deployment of new and improved varieties of crops with superior genetics and Crop SRR% an efficient system for timely supply of quality seed to Wheat 13 the farmers. Viable and active extension system will play Paddy 19.16 important role in replacement of seeds in the farmers Maize 24.41 field for improving the productivity. Jowar 26.7 Bajra 51.02 Seed is the most important determinant of Gram 7.09% agricultural production potential, on which the efficacy Urd 20.48 of other agriculture inputs is dependent. Seeds of Arhar 13.60 appropriate characteristics are required to meet the Moong 19.48 demand of diverse agro-climatic conditions and Groundnut 5.50 intensive cropping systems. Sustained increase in Rapeseed and mustard 66.96 agriculture production and productivity is dependent, Soybean 15.58 to a large extent, on development of new and improved Sunflower 19.61 varieties of crops and an efficient system for timely Cotton 37.25 supply of quality seeds to farmers. Jute 68.49 (Source - Ministry of Agriculture, GOI) Year 2003-04

Table 2. Seed replacement rate of major crops SRR% SRR% Crop 2007-08 2008-09 Crop 2007-08 2008-09 Wheat 25.23 26.84 Arhar 16.05 16.02 Paddy 36.77 30.05 Ground nut 14.29 17.04 Maize 44.24 48.48 Rape seed Mustard 76.34 52.67 Jowar 19.87 26.16 Til 25.0 - Bajra 48.47 62.92 Sunflower 69.17 43.64 Ragi 30.34 - Soybean 33.39 35.12 Barley 16.84 - Linseed 1.35 - Gram 18.35 14.38 Castor 31.34 - Lentil 15.86 - Safflower 15.69 - Peas 16.27 - Cotton (-82% of the cotton area is under GM crop) 15.30 12.07 Urd 23.89 26.31 Jute 32.88 35.4 Moong 21.75 21.94 Potato 1.49 -

295 certified/quality seeds other than the farm saved seed. • Zone-specific adaptability and fitness for edific, This rate is very low in all the states due to lower biotic and climatic variations. adoption and poor extension about the seed • Seed production and extension agencies should replacement. Seed replacement rate in the country is ensure that seeds are available to farmers. around 25% for self pollinated crops and 35% for crops pollinated crops. Reasons of low replacement of quality seeds at desired There is considerable variation in seed interval replacement rate depending on crops and regions on an average, it is around 20 % which should be increased Farmers would like to change seed more often than to at least 50% in the next few years. they do at present. Reasons are reported by farmers to be important which prohibits them from doing so: Status of quality seed • The high cost of seed It has become evident that in order to achieve the food • The unreliable quality of seeds production targets of the future, a major effort will be • Unavailability of seed suitable for local conditions. required to enhance the seed replacement rates of • Lack of sources of Information on New Seed Lack of Awareness of the Plant Varieties Act various crops. This would require a major increase in • • Source of seed availability the production of quality seeds. • Improperly organized seed distribution and The entire seed production programme revolves around marketing the quantity and quality of breeder seed production • Lack of technical knowledge of seed production which consequently affects the quantity of foundation, and maintenance of purity of quality seeds at certified and truthfully labelled seeds. farmers level.

The high cost of seed Table 3. Production of breeder, foundation and certi- fied/quality seeds The high cost of seed was found to be particularly important Year Breeder Foundation Distribution in low replacement of seeds. Still f armers relied on seed seeds Certified/ purchased seed for a significant proportion (more than 25 Quality seeds percent) of their seed requirement. 2005-06 865 4000 1405000 2006-07 7382 79654 1481800 The unreliable quality of seeds 2007-08 9196 85254 1943100 2008-09 9441 96274 2503500 Farmers do not trust the quality of seed available in the 2009-10 10604 180817* 2797200 market. This is cited as the most important reason for not purchasing new seed and relying largely on own 2010- 11 11,000* 185000* 3213592 saved seed. (Anticipated) (Source - Ministry of Agriculture, GOI Year 2010-11) Sources of Information on New Seed

Need of Seed Extension Activities The farmers' access to new seed also depends on information. Most respondents depend on other farmers • Wide gap exists in the average yield of crops es- for information on new seeds. Proper information is pecially pulses and oilseeds and their yields ob- not available to farmers about quality seeds, new tained under minikit / adaptive trials / FLDs on released varieties and purchase of quality seeds. improved varieties. • Replace the local admixture. Making available Lack of Awareness of the Plant Varieties Act seeds of improved varieties in adequate quantities to increase SRR. The farmers are not aware of India's legislation on the • Proper choice of variety and its quality seeds. Protection of Plant Varieties and Farmers' Rights. In

296 Madhya Pradesh only few farmers may be aware of the The methods of seed production, places and climatic Legislation. Farmers can purchase seed on bill to reclaim stability for their multiplication will decide the strategy of in case of damaged or duplicate seeds. extension for enhancing seed production.

Source of Seed Community Based Programme

Saved seeds were found to be the most common source Large proportion of damaged, shriveled, undeveloped, and of seed in all the states. Almost all the farmers surveyed admixture seeds used by resource poor farmers. were found to use saved seed. The overwhelming Experimental findings revealed 15-20% yield advantage importance of saved seed is also shown by the quantity of grading / improving the seed quality. Community seed of saved seed being used. In terms of volume, more cleaning and grading services of farmers be established. than 70-80 percent of the seed used through out the country is the farmers' own seed. Seed village concept

Seed Distribution and Marketing • Presently seed production by various agencies is inadequate - need of seed villages in selected dis- The availability of high quality seeds to farmers through tricts. an improved distribution system and efficient marketing set-up meagerly existed to facilitate greater security of • Sale of seed / farmer to farmer exchange of seed seed supply. and purchase by the government. As a result of the World Bank driven new Seed • Handling of seeds, seed storage, processing and Policy of 1988, MNCs like Cargill and Monsanto entered subsequent distribution to the farmers in small the seed supply system in India. With their entry, India's packets also needs consideration. agriculture has become destabilized. MNC seeds are • Role of KVKs / Department of Agriculture / private costly and non-renewable. Farmers must buy them agencies / NGOs could be utilised for different every year. High costs and non-renewability of MNC coordinated activities like technical support, train- seeds have created severe distress among farmers. ing, field visits, marketing and establishing coop- Farmers have become indebted. erative societies. For promoting efficient and timely distribution and • Seed producing units need to be strengthened and marketing of seed throughout the country, a supportive added. environment will be required to encourage expansion of the role of the private seed sector. Efforts will be • Seed replacement in dryland, rainfed, tribal and made to achieve better coordination between State hilly areas continue to below. governments to facilitate free Inter-State movement of seed and planting material through exemption of duties and taxes. Sales promoting activity

Extension strategies for incresing seed replacement The sale promotional activity forms integral part of the marketing organizations. To sale the seeds there are various ways in which the farmers can be approached While considering the strategy for increasing the rate and apprised about the qualities of the commodity. of seed replacement, it has to be kept in mind that methodology of extension will differ with variety and hybrids, vegetatively propagated planting material: • Demonstration • Kisan Diwas • Food grain crops and oilseeds • Kisan Mela • Vegetable and spices • Advertising in press on radio and TV • Medicinal & aromatic plants • Posters • Vegetatively propagated plants • Individual approach by sale personnel

297 Prevention of Storage Losses Role of Private sector and voluntary agency in seed distribution • Nearly 80% of the total loss is caused by insects, rodents and micro - organisms during storage. • Production of improved seeds by private agencies • Pulses are more susceptible to damage due to needs to be encouraged to meet the demand of insects (5%) as compared with major food grains, the farmers. like wheat (2.5%) rice (2%) and maize (3.5%). • Improved seeds of maintained quality should be • Storage losses at producers site, tarding and tran- made available to the farmers at the doorstep at sit site, end user site. reasonable rates. • Improved storage structures developed at Agril. • The subsidized production of bacterial cultures can Universities, ICAR institutes or IGSIs needs to be be undertaken by the private sector to be provided popularised through demonstrations. with the seed. • The funding agencies need to support the private Seed industry and voluntary agencies in the production and supply of seeds. • Seed industry in India started with the recommen- dation of a Seed Review Committee in 1968 and Role of Public Sector in certified and labelled seed distri- assistance of the World Bank. bution • The supply of quality seeds of cereals, pulses, oilseeds and the field and horticultural crops re- Certified / labelled seed distribution prior to 1976 was mained inadequate. done mainly through Government Institutions and total • Besides Govt agencies, the gap in need can be quantum was less than 1 lac quintals. The total seed bridged by developing seed industries with strong distribution which was 2.95 lac quintals in 1978-79 has infrastructure in private sector. gone up to 10.92 lac quintals in 1998- 99. Thus, the • Government and private seed producing corpora- certified /labelled seed use has trippled in the last 20 tion should have close linkage. years. • Need for the seed export be developed. Public -Private -Partnership Krishi Vigyan Kendra The sovereignty of India's seed supply systems rests on The Krishi Vigyan Kendra (KVK), or farm science center, two sources of public seed supply - 80% of which comes is a multidisciplinary educational institution situated at from farmer bred traditional varieties, and 20% of which the district level, with funding and technical supervision used to come from public sector seed breeding stations from ICAR will be key player for seed replacement and seed farms. India's food security has been based on obejctive. There are currently centers in 569 districts, the diversity of seeds and on the public supply system, covering almost India. The performance of KVKs may both at the community and state level. vary depending on the administrative control. Each KVK For developing and the providing quality seed of is in one of 15 agroclimatic zones, and the zonal improved cultivars & hybrids in adequate quantity at coordinator pays a visit to each of them every three reasonably cheaper rates, expeditiously, the partnership months. Within each center, around 20 scientists are of public and private sector on mutually agreeable employed from different disciplines, including crop appropriate terms will be a very desirable preposition. production, plant protection, agricultural engineering, and home science (Dash and Mishra 2004). As per mandate each scientist is expected to carry out two Role of goverment agencies frontline demonstrations and two farm testing demonstrations per year which may include the replacement of local seeds with quality seeds. A National Seed Corporation, State Seed Farm Corporation meeting of the scientific advisory committee is held once and Seed Certification Agency, SAU's are playing vital a year, in which the KVK action plan for the following role in seed production and distribution. These need to year is discussed. The action plan is based on a be strengthen to play their role more confidently, Participatory Rural Appraisal (PRA) assessment, carried transparently and trustably. out by KVK staff. In this way, the need of the seed regalement for improving the productivity are incorporated into the action plan of the KVK. 298 83.0/100

9.0/100

- /61.61 - /99.32 - /58.27

/ 30.0

/29.0 82.0/100

/28.0 80.0/100

V hyd V hyd

- / 15.03.40/100

50.0/ - 15.0/ - 50.0/ - 15.0/ - 50.0/ - 12.0/ - 50.0/ - 15.0/ -

- /30.0 85.0/100

18.0/100 6.0/100

Sunflower Cotton

45.00 -

44.00 -

33.00 -

20.00

- 20.00 - 20.00 - 20.00

10.00 - - - - 10.00 - - - -

10.00 - - - -

10.00 - - - -

8.00 2.50 - 16.00

7.58 7.030 0.75 90.78 6.72 - 9.01 9.93 0.49 55.52 5.56 - 8.24 27.58 0.80 - 5.23 - - /56.36

6.00 8.00 4.00 - 13.00 14.0/100 10.0/100

Moong Arhar G.nut R/m Soyabean

3.08 8.67 14.30 0.75 68.95 4.37 -

1.39 2.47 2.78 0.03 7.15 6.35 4.13 4.65 3.85 0.35 10.80 6.04 - 7.2/0/100 5.58 5.62 4.04 0.19 6.85 10.31 - 6.80/100 5.86 5.90 - 0.20 7.19 10.83 - 7.15/100

20.00 20.00

20.00

45.00 22.00 13.00 2.00 - 42.00

17.50 13.70 6.00 5.00 -

14.40 22.20 10.45 1.16 71.44 - - 31.0/100 16.80 25.60 10.13 1.78 68.82 - - 21.0/100 17.40 23.80 10.41 1.25 95.12 - - 20.0/100

20.00

18.00 - 19.00 20.00 12.00 - 13.00 20.0/100 14.0/100

12.50 12.50 12.50 12.50 5.00 12.50 12.50 12.50 12.50 5.00 12.50 12.50 12.50 12.50 5.00

100 3.00 18.00 22.70 12.50 6.00 - 77.00 81.0/100 13.0/100 100 6.00 51.00 13.00 14.00 13.00 - 76.00 97.0/100 18.0/100 100 8.00 20.00 11.00 14.00 21.00 - 59.00 84.0/100 23.0/100 100 - 21.00 12.00 15.00 17.00 - 65.00 91.0/100 21.0/100

100 12.00 18.00 6.00 8.00 5.00 - 25.00 15.0/100

/100 3.42 /100 4.05

- -

-

-

/32.91 6.64

/35.17 1.29 /31.30 2.26

/35.10 - 5.97

/43.71 2.04 /45.89 2.14

6.0/ - 0.46 6.0/ - 6.0/ -

Bajra Gram Urd

- /100 4.35

75.0/100 10.00 45.00 22.00 14.00 3.00 -

47.0/100 9.00 41.00 17.00 13.00 2.00 -

74 0/100 6.00

72.0/100 6.00 44.00 26.00 13.00 2.00 -

- 6.0/ -

- /100 -

- / 100 - /100 - 14.00 23.80 8.50 0.80 - - - 26.0/100

33.0/ - -

13 /100100 26.0/ 5.00 7.00 7.00 17 /100100 21.0/ 6.00 7.00 20 /100 22.0/ 22 /100100 23.0/

- /5.99 - - /8.91 - - /10.41 - - /10.93 -

- /1.43 -

igures in percentage (%)

100 91 /100 44.0/ 100 53 /100 87.0/ 100 28 /100 69.0/ 100 38 /100 78.0/

F

1.70

60.00 15.0/100

60.00 14.0/100

59.00 14.0/100

12.49 - /4.48 - /34.73 3.09 5.39 11.89 - /5.95 -

53.00 15.0/100

12.54 - /3.83 - /58.79 7.28 5.15

V hyd V hyd V hyd

Paddy Maize Jowar

Wheat

Year

2001 11.16 4.41 - /

2003 37.00 19.00 - /

2002 29.00 24.00 - /

2002 21.84 6.77 - / 2003 14.50 3.03 - /

2001 5.64 3.30 - / 8.05 2002 6.51 3.91 - / 7.06 2003 6.10 4.02 - / 8.56

2001 - 42.00 48 / 2002 - 62.00 62 / 2003 - 62.00 38 /

2001 6.00 22.00 - / 100 2002 17.00 25.00 - / 100 2003 16.00 25.00 - / 100

2001 - 17.00 8.0/ - 6.0 / - 2002 - 15.00 8.0/ - 4.0 / - 2003 - 14.00 8.0/ - 6.0 / -

2001 - 10.00 - - 2002 - 20.00 - - 2003 - 20.00 - -

2001 20.00 18.21 - / 100 2002 19.49 19.25 - / 100 2003 19.50 19.73 - / 100 - / 100

2001 25.00 18.00 - /

2004(T) 40.00 24.00 - /

2004(T) - 1.67 - /

2004(T) 6.40 4.22 - / 8.99

2004(T) - 65.00 50 /

2004(T) 18.00 25.00 - / 100

2004(T) - 17.00 8.0/ - 6.0 /

2004(T) - 20.00 - -

2004(T) - 20.00 - / 100

State-wise achievement of the targeted replacement of important crops

RAJASTHAN

MADHYA PRA.

Table 4. Table

T = Target = T

State

A.PRADESH

KARNATAKA

TAMILNADU

KERALA

GUJARAT

MAHARASHTRA

299 Broadening the interval of change of the quality seed replacements. After sincere efforts there was not requirement significant increase in SRR. All the issues related with SRR may be communicated effectively by all means of Training and strong assistance to farmers in maintenance extension as given below: of purity and safe storage of seeds is needed in order to increase the interval of requirement of change of seed. a. Kisan Call Centre (KCC): KCC may play very ma- This will reduce the total quantity of seed required by jor role for convincing farmers for use of quality individual farmers thus facilitating spread of quality seed seeds. Every KCC is receiving farmer's calls fre- over larger area. quently so they could be informed about the latest Production can be stabilized with the development varieties released and their availability. of good improved, short duration varieties and crop b. FLD's: Farmers do not believe without seeing so management technologies available for different that Krishi Vigyan Kendra can conduct FLD to situations. show the yield increase due to use of quality seeds. c. ATIC: Agricultural technology Information Centre Seed supply channel is the single woindow system for providing tech- nology support and input to the Farmers. Farmers Supply of seed to the end users must be easy and there are visiting ATIC for purchase of seeds etc. so this will be minimum middlemen or transactions agency may be increase by providing technical support. improve faith of farmers. d. E- Media: In this information era use of internet, CD-Rom, Kioask will be very helpful in promo- Break-up of Monopoly tion of seed replacements. Success story of farm- It is essential to find some way to avoid the emergence ers who are using quality seeds and getting maxi- of a single all powerful parastatal monopoly. One mum profit may be digitized in CD and shown to alternative may be to foster competing parastatals, farmers. Kioasks with success stories and avail- another would be to provide for seed importation by ability of seeds may be installed at Mandi's or companies, other than the seed production parastatal. Rural Bank's or Cooperatives for farmers use. The apparent confusion due to imbalance in seed supplies from different sources is a small price to pay References for avoidance of the policy inertia and bureaucratic procedures which characterize dominance of an industry Arora VPS (1998) Managing vegetable marketing in Hill Region by a single parastatal, or other forms of central planning. of Utter Pradesh: Deptt. of Agril. Eco. G.B. Pant University of Agricultural & Technology, Pant Nagar": Remove Barriers to Entry 269 Dash AK, M Mishra (2004) Krishi Vigyan Kendra: The light It is important to ensure that there are no unnecessary house for rural people. Orissa Review October: 52- barriers to entry of private firms into the industry, that 56 government not impose regulations that prevent the FAOSTAT (2006) All longitudinal production and population private sector from functioning efficiently; and that the data from http://faostat.fao.org private sector has equal access to improved seeds and Kroma M (2003) Participation and social learning: Supporting germplasm produced from the research system. It is farmers' innovation in Central Ghana. International not necessary to have an active pro-private policy Agricultural and Extension Education 10 (1): 43 stance; but it is essential not to have an anti-private Lele U (2010) Transforming agricultural research for sector stance. development. Paper presented at the Global Conference on Agricultural Research for Development, Montpellier, France Subsidy Singh S N (1985) Management of agriculture and rural Under no circumstances should a subsidy be used to development. Indian J Extn Edun 21 (192) : 1-9 give differential advantage to the public sector. Any subsidy should be available to all.

(Manuscript Receivd : 20.05.2012; Accepted 20.09.2012) Extension support for seed replacements Now there is strong need to motivate farmers for seed

300 JNKVV Res J 46(3): 301-303 (2012)

Screening wheat genotypes suitable for late and very late sown condition using stability analysis

Sanjay Birla, R.S. Shukla and D.K. Mishra Department of Plant Breeding and Genetics Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482004 (M P)

Abstract provides 20 per cent of food calories to the mankind. India is maintaining its second position of wheat producing nations since last 10 years and continuous To evaluate the performance of aestivum wheat genotypes with respect to its performance under a specific environment record breaking wheat harvest to the tune of 85.9 million or over the environment for better yield potential, a set of 20 tones during 2010-11 crop seasons from 29.0 million genotypes developed and released for cultivation in Madhya ha (Anonymous 2011). It is now realized that sustaining Pradesh were involved in stability analysis using Eberhart and the productivity of wheat growing areas in existing Russel model (1966). All the varieties were grown in a cropping system and under climate change of country randomized complete block design with three replications particularly in MP essential to provided food security to under normal, late and very late date of sowing during 2010- the population of India which by the year 2020 AD will 2011. The data were recorded for morpho-physiological be 1.25 billion and thus the projected demand for wheat attributes viz, days to 50 % flowering, relative water content by the year 2020 AD will be 95-109 million tones. (RLWC), pollen fertility, days to physiological maturity, plant height, number of tillers per meter, number of tillers per meter, Wheat is cultivated in India as well as in MP in spike weight, spike length, number of spikelet per spike, kernel various growing situations viz., rainfed / limited irrigated, weight, grain yield per plant, biological yield per plant and irrigated timely sown and irrigated late sown. Due to harvest index. The pooled analysis of variance revealed that the difference among the genotypes, genotype x environment high cropping intensity in MP particularly is Kymore and variance due to environment linear was significantly Plateau Satpura hill the farmers used to cultivate the different for most of the characters under study. Stability wheat in month of December as well as January after analysis indicated that the genotypes GW 366, GW 322, GW harvesting of rice and potato. In such condition they 273, LOK-1, JW 3269 and JW 3211 were found promising for need early genotypes tolerance to terminal heat with normal date of sowing where as genotypes LOK-1, HD 2864, average production. However many varieties are bread HD 2932, JW 3269, and 3211 and LOK-1, HD 2864, MP 4010, for December sowing but there is unavailability or HD 2932, and JW 3269 were emerging for late and very late lacking of single variety bread for very late sown sown condition. condition. High temperature stress during post anthesis is one of the limiting factors for sustainable wheat Keywords: Wheat, variability, physiological attributes, production. High temperatures have an adverse effect identification, terminal heat, late and very late sowing on various growth stages. These are reproductive and stability analysis. phase, pollen fertility, number of spikes per plant, number of spikelets per spike, spike weight, grain number, grain weight per spike, biomass and yield. Wheat (Triticum aestivum L.) is grown under wide range There is great scope to increase wheat production in of climatic condition but the favorable one adapted for late and very late sown condition by breeding more growing in cool and dry environment which prevails efficient plant types adaptable to hot weather (terminal between 300 and 600 N and 270 and 400 E latitudes. In heat) conditions. India it is mostly grown in plains, in the northern hilly region of Himalayas and Nilgiries and Palani hills The objectives in many crop improvement southern India. It is staple food for nearly 40 per cent of programmes are the selection of genotype which gives world population covering at least, 43 countries and consistence performance over a wide range of

301 environments. The selection is often ineffective due to as sterile. lack of information of genotype X environmental interaction because the sustainability of crop production The observation were recorded on five randomly is more important than high yield based on high selected plants from each plot and from each replication environment, similarly the tolerance of heat particularly for the character days to 50 % flowering, relative water terminal heat in the present context is equally important content (RLWC), pollen fertility, days to physiological at the time of selection, it is important to recognize the maturity, plant height, number of tillers per meter, component associated with general and specific number of tillers per meter, spike weight, spike length, adaptation of genotypes to prevailing range of number of spikelet per spike, kernel weight, grain yield environmental condition through the use of stability per plant, biological yield per plant and harvest index. analysis. Keeping in this view the aforesaid problems The data were subjected to stability analysis using and prospects, the present investigation has been Eberthhart and Russel model (1966). planned under different environments (3 date of sowing) to identify the stable genotypes using stability analysis Result and Discussion (Eberthart and Russel, 1966) suitable under late sown and very late sown condition. The pooled analysis of variance revealed that the In view of aforesaid problems present difference among the genotypes were highly significant investigation is an attempt to identify genotypes tolerant for all the characters except pollen fertility, number of to terminal heat, selection criteria and their contribution tillers per meter, 1000 grain weight and grain yield per towards genetic improvement for heat tolerance in wheat plant (Table 1-2). during late and very late sown condition. Highly significant genotypes x environment interactions were observed for all the character under Material and methods study suggesting that these characters are highly influenced by the change in the environmental A set of 20 bread wheat genotypes developed by various conditions. The above result is in agreement with the wheat workers and released and recommended for finding of Bangarwa and Luthra (1996), Jena et al. Central Zone and state of Madhya Pradesh were grown (2005) and Hakim et al. (2008). in a Randomized Complete Block Design with three The variance due to environment linear was replications. Each plot consists of three rows of 2.0 m significantly different for all characters except harvest length and 23 cm apart in among normal sown, late index indicating the genetic control of response to the sown and very late sown conditions. The sowing was environments. done on 15/11/2010 (normal sown condition), 10/12/ 2010 (late sown condition) and 05/01/2011 (very late Genotype x environment interaction (linear) was sown condition) by dibbling of seeds in row. The also significant for relative water content at ear recommended cultural packages of practices for late emergence, pollen fertility, relative water content at sown were followed to raise the healthy crop. milking stage, number of tiller per meter, 1000 grain weight and grain yield per pant while non significant for The experimental area occupied was quite days to 50% flowering, days to physiological maturity, uniform in respect of topography and fertility. days to maturity, plant height, spike weight per spike, Temperature vary from 03.10C being minimum in spikeklets per spike, spike length, spike density, December to 37.2 0C being maximum in April. The 77.2 biological yield and harvest index. This indicated the mm precipitation received at grain filling stage in the differential response of the genotype to different last week of February and March that helps wheat crops agroclimate conditions. Eberhart and Russell (1966) and save irrigation. The recommended cultural stated that stable variety would be one, having above packages of practices for late sown were followed to average mean value near unit regression coefficient (b- raise the healthy crop. 1) and deviation from regression as small as possible. Pollen fertility was observed at time of initiation Varieties JW 3211, LOK-1, WH 147, HD 2864, and HD up to completion of flowering. It was ascertained by the 2932 possessing regression coefficient near unity and acetocarmin staining test. The slides were observed also low value of deviation from regression with high under the microscope. The stained and normal size of mean for most of the traits and considered to be stable pollen grains was recorded as fertile, whereas, varieties (Table 3-6). The finding of Mishra and Khan unstained and smaller than the normal were counted (2000) suggested that WH 147 was responsive to rich

302 environment which is contradicting the present 2010&2011 esa dh xbZ A voyksdukFkZ mijkUr okg~;&dkf;sdh xq.kks tSls investigation. 50 izfr'kr Qwyus dk le;] fjyksVhHk ikuh dh ek=k] ijk.k fugkspu] Most of the genotypes showed varying degree idus dh vof/k] ikS/k Å¡pkbZ] 'kk[kk izfr ikS/k] 'kk[kk izfr ck.kh] nkus dk of stability for different character. Genotypes MP 3304, GW 366 and JW 1201 with regression coefficient (b) otu] cht izfr ikS/k] Fkk;ksykftdy mit ,oa gkjosLV lw¡ph A l~fFkfr less than one and mean values less than their fo'ys"k.k cSfjeUl ls thuksVkbil esa vUrj] thuksVkbi x okrkok.k ,oa population mean exhibited above average stability for oSfj;Ul fyfu;j okrkoj.k ds vUrj vFkZ iq.kZrk :i ls ik;k x;k A most of the character. Genotypes HI 1544, MP 4010, LFkf;Ro fo'ys"k.k mijkUr xsgw¡ dh fdLe th-MCy;w 3211] th-MCy;w Raj 3765 and HI 8498 with regression coefficient (b) greater than 1 and mean value less than their population 322] th-MCy;w 273] yksd&1] ,p-Mh- 2864] ,p-Mh- 2932] ts- mean exhibited below average stability performance for MCy;w 3269] ts-MCy;w 3211 nsj ls cqokbZ gsrq ,oa yksd&1] ,p-Mh- all the characters. Genotypes JW 3269, JW 3288, and 2864] ,e-ih- 4010] ,p-Mh- 2932 ,oa ts-MCy;w 3269 nsj ls ,oa GW 322 with regression coefficient (b) greater than 1 and mean value more than their population mean cgqr nsj ls cqvkbZ ds fy, mi;qDr ikbZ xbZ A exhibited than performance under specific condition for all most all the characters except few. References It has been concluded from above finding that genotypes GW 366, GW 322, GW 273, LOK-1, JW 3269 Anonymous (2011) Project Director Report, Directorate of and JW 3211 were found promising for normal date of Wheat Research, Karnal, page 3 sowing where as genotypes LOK-1, HD 2864, HD 2932, Bangarwa KS, Luthra, OP (1996) Stability analysis for spike JW 3269, and 3211 and LOK-1, HD 2864, MP 4010, attributes in macaroni wheat. Agri Sci Digest 16(1): HD 2932, and JW 3269 were emerging for late and very 1-4 late sown condition respectively. Similar results has Eberhart SA, Russel WA (1966) Stability parameters for been obtained by Singh et al. (2010) to have promising comparing varieties. Crop Sci 6:36-40 genotype for better yield. The performance of genotypes Jena SN, Mudul KC, Tripathy S (2005) Type x environment LOK-1 and JW 3269 were found promising for over the interaction and stability analysis in wheat. Indian Agri environment. The above findings indicates that due 49(3/4): 183-188 consideration should be given to above varieties for Mishra DK, Khan RA (2000) Stability of wheat varieties under better yield potential at the time of formation of sowing various dates of sowing. Annals of Agri Res 21(4). programme of wheat. 564-566 Singh SS, Singh SK (2010) Marching towards enhanced productivity of wheat. The Hindu Survey of Indian e/;izns'k ds fofHkUu tyok;q {ks=ks ds fy, fodflr ,oa vuq'kaflr fd Agriculture pp 28-31 xbZ 20 xsgw¡ dh fdLeks dk fo'ks"k okrkoj.k ,oa vU; okrkoj.k esa vPNh mit lHkkO;rk gsrq ,dkjgkVZ ,oa jly ekMy ¼1966½ ds rgr LFkf;Ro fo'ys"k.k fd;k x;k A lHkh fdLeks dks jsUMksekbt Cykd fMtkbZu ds (Manuscript Receivd : 18.08.2012; Accepted 20.12.2012) vUrZxr rhu vUrjks eas lkekU;] nsj ls ,oa cgqr nsj ls cqvkbZ o"kZ

303 JNKVV Res J 46(3): 304-306 (2012)

Screening of bark and leaves of black catechu for phytochemical properties

Karuna S. Verma, Deepak Kori, Aparna Awasthi and Rachna Pandey Aeroallergens, Immunology and Angiosperm's Diversity Lab Department of Post Graduate Studies and Research in Biological Science Rani Durgawati University Jabalpur 482 001 (MP)

Abstract the teeth), kanthi (beneficial for the throat) and kusthaghna (anti- dermatitis) etc. The great sage Acacia catechu family (Fabaceae, subfamily - Mimosaceae), Charaka has categorized it as anti-urticarial and anti- is commonly known as black catechu or cutch. Ayurveda dermatitis. Acharya Vagbhata had praised it as the drug recognizes the uses of Acacia catechu in treating various of choice for the treatment of numerous skin diseases. human disorders and diseases. Black catechu is highly valued Susruta described the plant to be effective as an anti for its effective astringent and antioxidant properties. It is obesity herb. known to contain catechins, which have wide range of therapeutic action. Phytochemical screening of the plant Phytochemical progress has been aided revealed the presence of tannins, flavonoid, saponins, lipids enormously by the development of rapid and accurate and sterols. methods of screening plants for particular chemicals. The drugs contained in medicinal plants are known as Keywords: Acacia catechu, phytochemical screening, active principles. The active principles are divided Fabaceae chemically into a number of groups among which are alkaloids, volatile essential oils, phenols and phenolic The tropical plants are an important source of alkaloids, glycosides, resins, oleosins, steroids, tannins and terpenoids, steroids, phenols, saponins, tannin. Bisht terpenes ( Mitcher et al. 1988; Habtermariam1993). and Kamal (1994) realized that there is strong need to Black catechu is also known as khadira in investigate the chemical composition of such plants to Sanskrit. It is said that the name 'catechu' was given to determine their ability to be used as germicidal. it because its bristles resemble the claws of animals of Phytochemicals derived from plant sources can the cat family or may be because its heart wood contains act as larvicide, insect growth regulators, and repellent cutch. Acacia catechu commonly known as Katha or and ovipositor attractant and have different activities Karangali is widely used in India for its various observed by many researchers (Babu and Murugan pharmacological effects (Ismail and Asad 2009). 1998). Plants are considered as rich sources of bioactive chemicals and there may be an alternative source of Material and methods insect control agents (Wink1993). Fresh leaves and bark of Acacia catechu were collected Description of plant in the month of January 2009 from an old tree (about 25 years) from Bhatowli gaon (Kali mandir) Gwarighat Jabalpur. The fresh leaves and bark of Acacia catechu Acacia catechu has synonyms in ancient scriptures of Willd. were then shade dried in open air. Eight grams Ayurveda, that include balapatra (tiny leaved); of leaves and bark was grinded using mortar and pestle vakrakanta (hooked spines), dantadhavana (cleansing with 15 ml distilled water and solvents (acetone and

304 methanol). The crude was then filtered and extracted positive result in all (Table 1&2).Lipids and flavonoids (Mehrotra 1976). were present only in aqueous extract, while methanol and acetone gave negative results. Phytochemical screening Maximum amount (leaves and bark) of constituents found in aqueous extract was flavonoids Chemical tests were carried out using aqueous, which are the potent water soluble antioxidants and free methanol and acetone extracts and phytochemical radical scavengers, which prevent oxidative cell damage, have strong antioxidant activity (Okwu constituent were identified using standard procedure 2004).Tannins have astringent properties: hasten the (Howk et al. 1954; Rosenthler 1930; Trease and healing of wound and inflamed mucous membranes Evans1989; Sofowora 1993). (Agoha 1974). Presence of tannin in the plant justifies the Results and Discussion powerful astringent property. Presence of flavonoid in leaf and bark of black catechu justifies the use of plant Carbohydrate gave positive result only in acetone as antioxidant. The medicinal value of black catechu extract where as methanol and aqueous extract gave plant is due the presence of various active constituents negative result for Carbohydrate. Saponins, tannin gave in there like flavonoid, tannin, resin and lipid. The bark

Table 1. Phytochemical analysis of Acacia catechu Willd Table 2. Phytochemical analysis of Acacia catechu Willd. leaves Bark Test Aqueous Acetone Methanol Test Aqueous Acetone Methanol Alkaloids Alkaloids Mayers test _ _ _ Mayers test _ _ _ Dragendroff test _ _ _ Dragendroff test _ _ _ Wagners test _ _ _ Wagners test _ _ _ Carbohydrate Carbohydrate Benedict test _ _ _ Benedict test _ _ _ Fehling test _ + _ Fehling test _ _ _ Tollens test ___ Tollens test ___ Saponins Saponins Foam test + + + Foam test + + + Proteins Proteins Xanthoprotein test _ _ _ Xanthoprotein test _ _ _ Biuret test ___ Biuret test ___ Flavanoids Flavanoids Flavanoids test + _ _ Flavanoids test + + + Tannins Tannins Ferric chloride test _ _ + Ferric chloride test _ _ _ Lead acetate test + + + Lead acetate test + + + Resin Resin Resin test _ _ + Resin test + _ _ Sterol Sterol Salkowaski test + + _ Salkowaski test + + + Lipid Lipid Glycerol test + _ _ a Glycerol test + + +

305 of black catechu gave wax positive results for active Howk PB, Osler BL, Summerson (1954) The Particle constituents as compared to the leaves of black catechu. Physiological Chemistry Mc Graw Hill Co. New York The presence of tannin and flavonoid in plant justifies 13 Ed. 55-111 its antioxidant and astringent action. Finally it can be Ismail S. and Asad M. (2009) Immunomodulatory activity of concluded that the present work which includes Acacia catechu. Ind J Physiol Pharmacol 53 (1): phytochemical studies of Black catechu will be 25-33 significant to the local people to get the information Mehrotra BN (1976) Processing of plant sample for chemical about Acacia catechu and utilize it in curing of various and biological investigation. Indian Drugs 13: 15-18 diseases. The result reveals that alkaloids, tannins and Mitcher LA, Okwute SK, Gollapudie SR, Drake S, Anova E flavonoid were positive in methanol extracts of leaves (1988) Antimicrobial pterocarpans of Nigeria Erythrina midbreadii. 27 (11): 3449 - 3452 and bark of Black catechu. The presence of tannin shows that the plant can be used as purgative. It can Okwa DE (2004) Phytochemical and vitamin content of indigenous species of Southern Eastern Nigeria. J also be used in the treatment of cough, asthma and Sustain Agric Environ 6 (1): 30-37 hay fever. Rosenthler L (1930) The clinical investigation of plants, G.Bell & Sons London 23:119-155 Acknowledgment Sofoworo A (1993) Recent trends in research into African medicinal plants. J Ethnopharmacol 38:209-214 Trease GS , Evans HC (1978) Textbook of Pharmacognosy.9th The authors are thankful to the Head, Department of Ed .Baliar Zindall & Co. London Biological Science R.D. University Jabalpur (M.P.) for Verma AK, Kumar M, Bussmann WR (2007) Medicinal plants help and encouragement during the tenure of work. in an urban environment: The medicinal flora of Banaras Hindu University Varanasi Uttar Pradesh. References J Ethnomed 3-35 Verma KS, Binu R(2011) Screening of extracts of Tinospora cordifolia Miers. to evaluate the antifungal activity. Agoha RC (1974) Medicinal plants of Nigeria offset Drakkerij: Biosci Guardian an Internatnal J 1(2):431-433 Faculfcitoler Wiskunde on Neturweten Schappen. Verma KS, Saxena N, Sinha R, Agarwal A (2010) The Netherlands. 33- 41 Phytochemical Screening and Therapeutic Profiling Babu R, Murugan K (1998) Interactive effect of neem seed of Madhuca indica. Vegetos- Internatnal J Pl Res 23 kerna and neem gum extract on the control of Culex (1) : 109 -115 quinquefasciatus Say, Neem Newsl 15(2): 9-11 Wink M (1993) Production and application of phytochemicals Bisht SS, Kamal R (1994) Garlic extract: An antifungal from agricultural perspective In: Van Beck TA, treatment for the control of storage of apple. Proc Breteler H, (Editors) Phytochemistry and Agriculture Nat Acd India 64: 233-234 Clarendon Press Oxford UK 171-213 Habtermariam S, Gray AI., Waterman RG (1993). A new Antibacterial sesquiterpene from Premma oligotricha. (Manuscript Receivd : 05.08.2012; Accepted 10.09.2012) J. Nat. Prod. 5(1) 140 - 143.Hall, Ltd. 49-188.

306 JNKVV Res J 46(3): 307-312 (2012)

Exploitation of short duration, multiple resistant, high yielding, promising kabuli chickpea lines for crop diversification in agro-climatic zones of Madhya Pradesh, India

Anita Babbar and Om Gupta Department of Plant Breeding and Genetics Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract purpose. Kabuli cultivars show specific adaptation to a particular environment especially to irrigated planting because there is no popular variety which is adopted to An intensive crop selection programme was initiated at JNKVV Jabalpur for combining earliness, bold seed, multiple wide range of agro-ecosystem. resistance and varied adaptation. The preliminary yield trials were conducted under Chickpea Breeding programme during Material and methods 1999-2003.Of the 88 kabuli lines the better performing entries were promoted to All India Coordinated experimentation (2000- 01 to 2003-04) and thereafter evaluated in multiple disease The present study comprised of 88 kabuli entries under sick plot at different agromatic zones. Kabuli chickpea entries ICRISAT-JNKVV collaborating programme at Seed JGK 1, MPJGK 3 (JGK 2), MPJGK 4 and MPJGK 6 exhibited Breeding Farm of JNKVV under AICRP on Chickpea superior performance over checks in central and south zones Jabalpur since 1998. Superior performing genotypes of the country with consistent performance in earliness (86- 110 day), bold seed size (>35 g/100 seed), higher yield (15- further evaluated for two years in randomized complete 18 q /ha) and multiple disease resistance/moderately block design with three replications. Each genotype was resistance for Collar rot, wilt, dry root rot and root rot and also grown in 4 rows of 4 meter at 30 cm meter apart and identified as least susceptible to pod borer insect infestation. plant to plant distance of 10 cm was maintained. The data were recorded on the five randomly selected plants from each entry on yield and its related traits. Further Keywords: Chickpea, multiple disease resistance, crop the superior performing lines viz., JGK 1, MPJGK 2, diversification, agroclimatic zones MPJGK 3, MPJGK 4, MPJGK 5, MPJGK 6, MPJGK 7 and MPJGK 11 were evaluated in multi location testing Chickpea (Cicer arietinum L.) is globally the second in different agro ecological environments for yield and largest post rainy season traded pulse crop. The pest/ disease testing alongwith susceptible check JG productivity is affected by several biotic and abiotic 62 during rabi 1999-2004. stresses. Development of short duration varieties has been the most promising strategy under diversified Results and Discussion condition of rice-wheat cropping system, inclusion chickpea legume crop, for substantially of cereal base cropping system and to ensure better soil health seems Widening of existing genetic base of kabuli chickpea is a better option. Combination of other useful traits with the foremost endeavor for the yield enhancement. early maturity in kabuli chickpea is expected to provide Hence, an early flowering macrosperma line was further option of using in crop diversification also, extensively used in hybridization programme (Table1). increase area and productivity in short growing season According to Yadav et al. (2003), it may be due to that environment such as South India and rainfed areas of kabuli types are represented by specific and vulnerable Central India. Tremendous scope exists in India to gene pool. The phenology plays critical role in cultivate large seeded kabuli type as a remunerating adaptation of a crop to various growing conditions (Gaur alternative option to the commercial crops for export et al. 2003). The era of crop diversification started with

307 the development of short duration varieties combining also fit in any cropping sequences (Dahiya and Lather,; photo and thermo insensitivity (Sandhu et al. 2003). In Singh et al. 1985). Bold seeded kabuli variety has a this context eight newly developed Kabuli genotypes better demand to fetch more price than desi. were intensively evaluated in during 1999 - 2004 (Table MPJGK 3 (JGK 2) exhibited its stable 2). On the basis of the yield and related traits, resistant performance in wide range of environments in south reaction to disease and pest, the good performing and central zone. Its yielding ability of an average of genotypes viz, JGK 1 in 1999-2000, MPJGK 2 and four years (3) shows 63.96% increase over L 550, MPJGK 3 in 2000-2001, MPJGK 4 in 2000-2002, 21.42% over ICCV 2, 78.87% over BG 1003 and 12.50% MPJGK 5 and MPJGK 6 in 2002-2003 and MPJGK 7 over KAK 2. MPJGK 3 also showed its stable and MPJGK 11 in 2003-2004 were evaluated under performance for maturity and seed size. MPJGK 6 and multilocation testing for yield, maturity and seed size in MPJGK 2 have been identified for south zone different agro ecosystem. Genotypes observed superior (Annonymous, 2002). These drought resistant lines can in comparisons to high yielding national varieties of the be used as donor parent for hybridization programme. zone as checks viz., KAK 2, ICCV 2, BG 1053, L550 and BG 1003 were retested in second year for Environmental factors and intensity are known multilocation testing for respective zones. (Table 3.1 and to compound the occurrence of severity of the biotic 3.2) JGK 1 exhibited promising with all the checks on stresses causing yield losses up to 100 percent (Nene an average of three years multilocation testing in central and Reddy, 1987). Of the various diseases insect pest zone. The yield increased 31.6% from KAK 2, 20% from encountered by chickpea crop, wilt, dry root rot, collar ICCV 2, 13.6% from BG 1053 and 9.5% from L 550. rot, and pod borer are of great significance in CZ and Widely adopted high yielding line MPJGK 4 also found SZ. The use of disease resistant varieties is the most superior over 3 years under multi location testing in economic and eco-friendly method for the management central zone, that yielded 1691 kg/ha, with seed weight (Gupta and Babbar, 2003). In this context, attempts have 35.3g/100 and maturity 110 day. Short duration kabuli been made to identify multiple resistant genotypes chickpea genotypes viz., MPJGK 2, MPJGK 3 and suitable for different agro ecosystems. MPJGK 6, showed their consistence performance in seed size and yield over years (3) and locations in Seven promising chickpea genotypes which central (12) and south zone (7) (Table 4). Short duration preliminary exhibited superior for different yield chickpea lines escaped the terminal drought and could attributing traits were evaluated in multilocation for

Table 1. Pedigree of superior performing genotypes and the features Variety Pedigree Features JGK 1 (ICCV2xsuratuto 77) x ICCV 7344 High yielding, wider adaptability, early, bold resistant or moderately resistant to wilt MPJGK 2 ICC 7633 x ICC 8151 High yielding, wider adaptability, early, bold MPJGK 3 (ICC 32xL144) x (ICCC49 x Drought tolerant, high yielding, early, bold, wider FLIP 82-16) x ICCV3 adaptability, multiple resistant or moderately resistant to disease and pod borer MPJGK 4 ICC 8151 x ICC 118116 High yielding, early, bold, MR to Collar rot, DRR MPJGK 5 ICCV2 x LCC 7344 High yielding MPJGK 6 Select in from JGK 92337 Drought tolerant, high yielding, early, bold MPJGK 7 (Shoba x ICCV 2) x Mocorito-88 High yielding MPJGK 11 (ICC 2588 x ICC 32) x Early, bold seeded , tolerant to pod borer, high yielding {ICC 49 x FLIP 82-IC x ICCV3} BG 1053 Selection from ICCV 3 High yielding BG 1003 Mutant of L 352 High yielding ICCV2 L 550 x Gaumirchil High yielding, Tolerant to drought KAK 2 Not available High yielding, bold seeded, wider adaptability L 550 PB 7 x Rabat High yielding

308 multiple disease resistance under field conditions, along with 21 genotypes, including susceptible check JG 62.

BG1003 Of these JGK 1 showed resistant reaction for wilt at two locations and moderately resistant at 50 percent of the test locations from where the data were compared (Table L550 5). MPJGK 3 was identified multiple disease resistant/ moderately resistant for wilt, collar rot, dry root rot and root rot at almost 50-60% locations. In this study, use of MPJGK 3 confirmed the presence of high to moderate level of resistance against these three major fungal diseases. ICCV2 BG1053 Regarding the performance of genotypes against Helicovrepa armigera, the entries identified as least (Ch) (Ch) (Ch) (Ch) (Ch) KAK2 ICCV2 BG1053 L 550 susceptible (PSR 4) to pod borer under preliminary screening trial, were further evaluated alongwith other entries at multiplications over 2000-2004. The entries (Ch) (Ch) (Ch) (Ch) KAK2 consisting of JGK 1 with 18 entries in second year, MPJGK 2 in 3rd year trial with 34 entries were least susceptible with a PSR rating of only 4 on a scale of 1- 9 as compared to check where, it was 9 (Table 6). [Thus these verities/genotypes have better choice for exploitation under diverse systems]. 1069 1240 - 1222 - 755 Dharwar Mean

Acknowledgement Kota Bharari Banswara Mean Hiriyur

The authors acknowledge to ICRISAT for providing the genetic material of Kabuli chickpea. Rahuri

dkcqyh pus esa 'kh?kz idus okyh] eksVs o vkd"kZd nkus] jksx izfrjks/kh

Gulbrga Bangalore ,oa Ñf"k tyok;q {ks= ds vuqdwy iztkfr;ksa dh ekax gS A bls /;ku esa j[krs gq, oj.k dk;ZØe t-us-Ñ-fo-fo-] tcyiqj esa 'kq# fd;k x;k Fkk A izkjafHkd mit ifj{k.k puk iztuu dk;ZØe ¼1999&2003½ ds

Coimbatore rgr 88 dkcqyh izfof"V;ksa dk csgrj izn'kZu ns[kus ds ckn bu izfof"V;ksa dks vf[ky Hkkjrh; lefUor ijh{k.k ¼2000&01 ls

2017 2243 2507 13282003 -&04½ ds - fy, vxzflr 1000 1918 fd;k - x;k 1597vkSj fofHkUu - Ñf"k 1668 tyok;q 1769 {ks= ij dbZ izfof"V;kas tSls tsthds 1] ,eihtsthds 3] ,eihtsthds 4] ,eihtsthds 6 us mRrj] e/; vkSj nf{k.k csgrjhu izn'kZu fn[kk;k gS 1076 625 2361 1283 - - - 1577 - - - - 1302 1982 1354 1147 2035 1319 - - 1523 - - - - -

Jabalpur Kopergaon Sehore Badnapur A bu izfof"V;kas ds yxkrkj izn'kZu ls 'kh?kz idus okyh ¼86&110 fnu½] cM+s vkdkj ds cht ¼> 35g/100 cht ½] vf/kd mit ¼15&18@gsDV;sj ½ vkSj dbZ jksxksa ds fy, ekewyh izfrjks/kd xq.kksa ¼ruk lM+u] mdBk]'kq"d tM+ lM+u½ dk irk pyrk gS rFkk fofHkUu 2000-20012000-20012001-2002 32222002-2003 33092002-2003 20342003-2004 2173 18522003-2004 2352 2254 1561 2389 1818 739 1555 681 1389 - - - - - 778 1284 1090 - 2333 1681 - - 1471 1738 550 841 677 - - 949 - 1028 - 1527 - 1609 - - - - 1684 - 1626 1807 1510 1457 1660 - - 1351 1605 - 1566 1382 1217 1222 - - - 1095 - - 999 - - - - 2000-200120012001-2002 31082002-20032002-20032003-2004 1430 - 2708 9782003-2004 1668Ñf"k 1076 1782 2505 - 913tyok;q 1083 1808 1545 - 1562 2106{ks=ksa 1399 1563 ds 1412 1139 1358 934fy, 1353 861 1424 2020 2375Qyh 2243 1231 1159 1854 Nsnd - 2118 - - 1111 - 1331geys 1884 1840 1250 - ds 1610 - - 1424fy, - 1506 - 1321vfrlaosnu'khy 1754 1873 - 1178 - 1543 1379 - 1336 1201 1526 - - 1593 - 1252 1753 1473 1936 1693 1482 - 1443 ------

Multilocation testing of kabuli genotypes in Central and South Zone for yield performance (Kg/ha) ,oa tYnh ifjiDo gksus okyh izfof"V;ksa ds e/; ladj.k dk;ZØe dh flQkfj'k dh x;h gS vkSj lkFk gh ifjiDou vof/k dks de djds Table 2. Table South Zone Variety Year ICRISAT Lam JGK1MPJGK2 MPJGK3 MPJGK4 1999-2000MPJGK5 MPJGK6 MPJGK7 2013MPJGK11 Central Zone 862 - 925 - - JGK1MPJGK2 MPJGK3 MPJGK4 1999-2000MPJGK5 MPJGK6 MPJGK7 2413 MPJGK11 bldk mi;ksx fofof/krk ds nksgu dh mi;ksafxrk esa fd;k tk ldrk gSA

309 Table 3.1 Yield performance of JGK 1 in comparison to checks in central zone

Variety 1999-01 2001-02 2001-02 Weighted average % increase over check JGK 1 1918(6) 1518(6) 1502(5) 1655 - L550 (ch) 1668(5) 1353(5) - 1511 9.5 ICCV2(ch) 1597(6) - 1117(5) 1379 20.0 BG 1003(ch) 1769(6) 1294(6) 1274(5) 1456 13.6 KAK2(ch) 1192(6) 1335(5) 1257 31.6 Location - Rahuri, Badnapur, Jabalpur, Kota, Sehore, Kopergaon, Banswara, Bharari

Table 3.2 Yield performance of MPJGK 3 in comparison to checks in south zone

Variety 2000-01 2001-02 2002-03 2003-04 Weighted average % increase over check MPJGK 3 1605(5) 1464 (2) 1340 (4) 1482 (3) 1474 - L550 (ch) 1084 (5) 784 (2) 733 (4) 996(3) 899 63.96 ICCV2(ch) - 1120 (2) 1029 (4) 1103(3) 1214 21.42 BG 1003 - 1223(2) 1331(4) 1166(3) 1240 18.87 KAK2(ch) - 1319)2) 1383 1347(3) 1349 12.50

Location - Banglore, Lam, Coimbatore, Gulbarga; ICRISAT, Dharwad

Table 4. Performance of promising kabuli chickpea genotypes for yield, days to maturity and 100 seed weight in Central and South Zone

Yield Kg/ha 100 Seed weight (g) Days to maturity Entries Year CZ SZ CZ SZ CZ SZ JGK 1 1999-2000 1918 (6) 1240 (4) 28.7 (6) 33.6(4) 109 (6) 88 (4) 2000-2001 1518( 6) 32.7 (6) 119 (6) 2001-2002 1502 (5) 33.9 (5) 115 (5) 1655 1240 31.8 33.6 114 88 MPJGK 2 2000-2001 1610 (7) 1527 (5) 35.0(7) 36.7 (5) 113 (7) 88 (5) 2001-2002 1289 (2) 38.1(2) 92 (2) 1610 1408 35.01 37.4 113 90 MPJGK 3 2000-2001 1754 (7) 1609 (5) 33.4(7) 33.9(5) 112 (7) 86 (5) 2001-2002 1410 (4) 1464 (2) 30.5(4) 35.9(2) 120 (4) 91 (2) 2002-2003 1340 (4) 33.1 (4) 95 (4) 2003-2004 1482 (3) 35.2 (3) 90 (3) 1582 1474 31.9 34.5 116 90 MPJGK 4 2001-2002 1873 (5) 1626 (3) 32.6 (5) 35.5 (3) 115 (5) 100 (3) 2002-2003 1590 (6) 36.2 (6) - 112 (6) 2003-2004 1461 37.1 (6) - 106 (6) 1691 1626 35.3 35.5 111 100 MPJGK 5 2002-2003 1321 (7) 1684 (4) 31.8 (7) 30.3 (5) 113 (7) 93 (5) MPJGK 6 2002-2003 1524 (7) 1807 (4) 31.8(7) 30.8(5) 110(7) 89 (5) 2003-2004 1552 (3) 31.8 (3) 92 (3) 1524 1679.5 31.8 31.3 111 90 MPJGK 7 2003-2004 1510 (5) 1379 (6) 35.9(5) 35.8 (6) 110 (5) 86 (6) MPJGK 11 2003-2004 1577 (5) 1523 (6) 34.0 (5) 32.3 (6) 110 (5) 90 (6)

CZ = Central Zone SZ = South Zone Values in parenthesis (-) = Location

310 R - M R. solani ) ------3 1 - Bharari, ) Root rot ( RR M R. batatiola Dry root rot( ------RR M Collar rot ------RR M R Vascular wilt No. ofNo. No. of locationsof No. No. of locationsof No. No. of locationsof No. No. of locations locations found R or MR locations found R or MR locations found R or MR locations found R or MR 2000-04 11 - - Reaction of promising kabuli chickpea genotypes for multiple disease resistance over years at different locations JG62 JG K1MPJGK2MPJGK 3 2000-02 2001-02MPJGK 4 2001-04MPJGK 6 14 2003-04 11MPJG K7 11 2003-04MPJGK11 2 11 2003-04 - 2003-04 10 2(Scriptable check) 7 1 9Locations: 2 8 2 4Wilt - IIPR Kanpur, Delhi, Rahuri, ICRISAT, Junagadh, Bangalore, Ludhiana, Dholi, Faridkot, Sehore, Gulberga, Hisar, Badnapur, Kanke, Jabalpur, Berhampur. - 1 2 2 1Collar rot - Jabalpur, Raipur, Bharar 1 3Dry root rot - Jabalpur, Durgapura, Coimbatore, Sehore - 3 -Root rot - Ludhiana, Badnapur, Hisar - - - 1R - Resistant (< 10% mortality) MR - Moderately resistant (10-20% mortality) - - - 2 - 2 - 4 4 - - 2 2 Table 5. Table Genotypes Year

311 Table 6. Reaction of Kabuli chickpea genotypes against Gupta O, Babbar A (2003) Identification of desi and kabuli Helicoverpa armigera at locations chickpea genotypes for multiple disease resistance against three soilborne diseases. Indian J Pulses Genotypes Year No. of location PSR (1-9 scale) Res 19:129-130 Nene YL, Reddy MV (1987) Chickpea diseases and their JGK 1 2000-02 10 5 control. In: The Chickpea (Saxena M C and Singh K MPJGK 2 2001-03 8 3 B eds) ICARDA, CAB International Walling Ford MPJGK 3 2001-04 9 5 Oxon, UK pp 233-270 MNPJGK 4 2003-04 5 3 Sandhu JS, Sekhan HS, Singh G, Bains TS, Singh P (2003) MPJGK 6 2003-04 2 1 Exploitation of super early chickpea genotypes for L550 (check) 2000-04 10 - crop diversification. In: National Symposium on Pulses for Crop Diversification and Natural Resource MR - Moderately resistant (PSR -4) Management, ISPRD IIPR Kanpur pp 18: 40 Locations - Rahuri, Sehore, Badnapur, Junagadh, Raipur, Singh KB, Reddy MV, Malhotra RS (1985) Breeding kabuli Bharari, Bangalore, Lam, Coimbatore, Jabalpur chickpea for high yield stability and adaptation. In: Saxena M.C. and Verma eds. Proceedings, Faba beans, Kabuli chickpeas and Lentils in the 1980's References ICARDA Aleppo Syria pp 71-90 Yadav SS, Jens TNCB, Kumar J, Hedge VS, Kumar S (2003) Anonymous (2002) Annual Report of AICRP on Chickpea. Development of widely adopted kabuli cultivars. IIPR, Kanpur Proceedings International Chickpea Conference held at IGKVV Raipur pp 20-28 Dahiya BS, Lather VS (1990) A breakthrough in chickpea yields. International Chickpea Newsletter 22: 6-8 Gaur PM, Kumar J, Rao JVD (2003) Short duration chickpea (Manuscript Receivd : 15.10.2011; Accepted 03.04.2012) varieties for crop diversification opportunities. In: National Symposium on Pulses for Crop Diversification and Natural Resource Management. ISPRD, IIPR Kanpur 5: 41

312 JNKVV Res J 46(3): 313-316 (2012)

Correlation studies between morpho-physiological characters and yield of mungbean and urdbean in rainfed vertisols

K. Kanaka Durga Seed Research and Technology Centre ANGRAU, Rajendranagar Hyderabad 500 030 (AP)

Abstract processes like photosynthesis, respiration and nutrient metabolism resulting in poor growth and yield Three varieties of mungbean viz., LGG 407, LGG 450 and (Poehlman 1991). LGG 460 and two varieties of urdbean - LBG 20 and LBG 623 were evaluated in rainfed vertisols during rainy season for The extent of association between yield and its various morpho – physiological parameters and yield components is of great importance in selection program contributing characters. Moongbean registered higher root for improving seed yield. Large variation in yield and volume, root weight, lateral roots, shoot length, shoot weight, morpho – physiological characters have been reported leaf number, leaf weight and leaf area than urdbean. In in mungbean and urdbean (Bhattacharya 1998). Earlier mungbean, six parameters i.e., shoot length, leaf number, study revealed that correlations among traits might number of lateral roots, relative water content, specific leaf result from pleiotropy or physiological associations area and specific leaf weight showed significant positive association with seed yield, while root length had a significant among characters (Muehlbauer and Singh 1987). As negative association. In urdbean, root length showed urdbean and mungbean are the two major kharif pulse significant relationship with root volume and yield indicating crops an attempt was made to study the correlations that as the root length and root volume increases, seed yield between morpho – physiological characters and yield increases. in rainfed vertisols during rainy season.

Keywords : Mung bean, urid bean, vertisols Material and methods

Multiple regression analysis of mungbean showed that Three varieties of mungbean viz., LGG 407, LGG 450 leaf area index exerted maximum influence on yield and LGG 460 and two varieties of urdbean - LBG 20 indicating that a unit increase in leaf area, the expected and LBG 623 were sown in rainfed vertisols of Regional increase in yield could be around 294 g. While in Agricultural Research Station, Lam, Guntur at a spacing urdbean, root shoot ratio influenced the yield of 30 x 15 cm and were grown under recommended significantly indicating an increase in yield of 99.96 g crop management practices. The crops were subjected for every unit increase in root shoot ratio. to severe moisture stress during the first 38 days after Mungbean and urdbean are the two most sowing and only a rainfall of 21.4 mm was received important pulse crops of Andhra Pradesh cultivated in during this period. The crops thus experienced an area of 4.77 and 4.90 1 ha with a production of 1.79 prolonged dry spell coupled with high day temperature. and 2.88 l t, respectively. The average productivity of Five plants were selected randomly from each variety mungbean is 375 kg ha-1 while that of urdbean is 581 in four replications at 31 days after sowing. Rainfall of kg ha-1 (Annual Progress Report on Pulses, 2007-08). 15.5 mm was received in one rainy day during this The low productivity of the crops is attributed to several period. The data were recorded on root characters - biotic and abiotic factors. Among the latter, moisture volume, length, weight and number of lateral roots, shoot stress is the major production constraint. Moisture stress characters - weight and length, leaf characters - area, during the crop growth period affects various metabolic number and weight and other physiological parameters. They were subjected to analysis for coefficients of 313 yield

0.7739**

Seed

(g/plant)

Root yield

shoot

0.6338** 0.7913**

Relative

0.8374** 0.8202** 0.9587**

Specific Specific Seed

) content ratio

2

Relative

0.5218 0.4164 0.2678 0.4541

leaf water leaf leaf

Physiological parameters

/kg) (g/cm

2

shoot

0.3794 0.4963 0.3058 0.7363** 0.4589

leaf arealeaf leaf weight water

0.7358** 0.2698 0.8229** 0.6370** 0.9999** 0.7761**

laterals ratio content area weight

0.8256** 0.6069** 0.2848 0.6303** 0.4868 0.8229** 0.6248**

Number Root Root/

Root

0.3958 0.2709 0.3835 0.4465 0.2006 0.1744 0.2692 0.1151

Number of Weight Volume Specific Specific

Leaf Leaf area number of volume

Length

Weight

Shoot

lenght length

(cm) (g) (cm) Laterals) (g) (cc)

Length

Shoot Root Shoot

Leaf

area

0.32 7.90 0.90 16.06 4.92 0.53 1.04 49.00 0.22 77.50 0.58 6.57

index (no) (cm

weight weight

Leaf

Leaf Root

index

(cm) (g)

Number Area Weight Correlation coefficients among morpho-physiological and drought parameters of mungbean Estimates of root, shoot and leaf parameters yield components urdbean mungbean (31 DAS)

Crop

Mungbean 5.47 197.13 4.29 0.66 8.93 1.78 17.96 8.94 0.69 1.43 46.64 0.02 79.37 0.41 6.37 Urdbean 4.35 94.50 1.93 Difference % 26 109 123 110 13 85 12 82 31 38 -5 -89 2 -29 -3 t-Cal 2.76* 3.54* 4.14* 1.33 2.97* 3.67* 1.87 4.52* 2.23* 9.75* 0.50 0.08 1.13 4.15* 0.21

Character area

Leaf weight 0.0359 -0.2312 -0.5547 0.3474 -0.6267** -0.5820** -0.5459 -0.5518 -0.1869 -0.5165 -0.6376** -0.4729 -0.5490 -0.4841 Leaf area index -0.9592** -0.1552 -0.1005 0.0745 -0.2199 -0.2819 -0.2936 -0.4314 0.3337 0.2394 0.2235 -0.2960 0.3545 Root weight 0.3371 -0.0381 0.0755 0.3476 0.3562 0.4169 0.5290 -0.1333 -0.0840 -0.1509 0.4195 -0.2219 Shoot weight -0.0028 0.2320 0.4658 -0.0847 -0.0513 -0.0938 0.2226 0.0488 -0.1908 -0.0495 -0.2158 Root length -0.3088 0.0601 -0.4683 -0.6033** -0.5402 -0.3487 -0.6469** -0.1613 -0.6021** -0.6310** Shoot length 0.0461 0.5294 0.5639** 0.2114 0.4711 0.6928** 0.7057** 0.5615** 0.6023** Leaf area Leaf number Number of laterals Root volume Root/ Shoot ratio Relative leaf water content Specific leaf area Specific leaf weight Table 1. Table Table 2. Table

314 correlation and multiple regression from their respective components of variance (Snedecor and Cochran 1972).

yield

-0.1225 Results and Discussion

-0.9787** 0.2464 Mungbean registered higher root volume, root weight, lateral roots, shoot length, shoot weight, leaf number, leaf weight and leaf area than urdbean (Table 1).

Specific Specific Seed Mungbean recorded better root, shoot and leaf

-0.1080 0.1564 -0.0285 characters than urdbean, while root / shoot ratio was found to be better in latter.

Relative

0.1231 0.1567 -0.0925 -0.4710

leaf water leaf leaf Urdbean recorded significantly higher seed yield of 6.57 g per plant compared to 6.37 g per plant in mungbean. Increased seed yield in urdbean could be

0.1172 -0.3323 -0.0779 0.1941 0.5504 due to long duration (75-85 days) of the urdbean crop compared to mungbean (65-70 days) crop. Poehlman (1991) also reported that urdbean develop new flushes

0.1388 -0.0878 -0.1565 0.7932** -0.7517** 0.5034 of pods when the drought stress is relieved by late rains, while mungbean has already matured. Kanaka Durga et al. (2003) reported that short duration response of mungbean enabled it to grow on limited supply of stored

laterals ratio content area weight

0.7655** -0.0523 0.3305 -0.1465 0.7858** -0.7879** -0.0510 Number Root Root/ soil moisture. Out of fourteen morpho – physiological

0.7994** 0.7382** 0.0903 0.3445 0.1118 0.9258** -0.8613** 0.2681 number of volume shoot characters studied in mungbean, six parameters viz., shoot length, leaf number, lateral roots, relative water content, specific leaf area and specific leaf weight Leaf Leaf showed significant positive association with seed yield. The root length had significant negative association with lateral roots, relative water content of leaf, specific leaf weight and seed yield (Table 2). Thus tall plants with more shoot length, more number of leaves, specific leaf area and weight with more relative water content and

lenght length area number of lateral roots are the major yield contributing characters for rainfed vertisols. Significant correlations of mungbean and urdbean yield with harvest index, per day dry matter production and partitioning and biological

Shoot Root Shoot yield were reported by Bhattarcharya (2002). The root weight, root volume, shoot weight, leaf area and root shoot ratio did not exhibit significant correlations with weight weight yield or among themselves. Shoot length, leaf number and number of lateral roots exhibited significant positive correlation with relative water content.

Leaf Root

index Multiple regression analysis showed that all the morpho- physiological characters of mungbean accounted for total variation in yield. Of the 14 characters, leaf area index influenced maximum Correlation coefficients among morpho-physiological and drought parameters of urdbean variation in yield indicating that with unit increase in leaf area index, the expected increase in yield could be 293.68 g. Similarly, with unit increase in root volume,

Table 3. Table the expected increase in yield was 33.51 g.

Character area

Leaf weight 0.4458 0.2277 -0.1260 0.2836 -0.2560 0.4557 0.1674 0.0657 0.3744 0.4696 0.6475** 0.0930 0.0401 0.2162 Leaf area index -0.1394 -0.5698** 0.2751 0.1393 0.9996** 0.8017**-0.7399** 0.0930 0.3282 0.9870** 0.9289** -0.8678** 0.2708 Root weight 0.7746** -0.0452 0.1465 -0.1202 -0.0916 -0.5024 -0.1004 0.7986** 0.1359 -0.2424 0.3011 -0.5655** Shoot weight -0.2279 0.2903 -0.5560 -0.4952 -0.7184** -0.2853 0.2379 0.0897 -0.5559 0.5830** -0.4176 Root length -0.6203** 0.2872 -0.0830 0.3727 0.6113** 0.1474 -0.0320 0.2301 -0.0770 0.6819** Shoot length 0.1402 0.2559 -0.0158 -0.9240* -0.0513 0.2649 0.2829 -0.3670 -0.4503 Leaf area Leaf number Number of laterals Root volume Root/ Shoot ratio Relative leaf water content Specific leaf area Specific leaf weight

315 Thus the regression equation is represented as fofHké HkkSfrd&ckgjh rFkk mit lacf/kr xq.kksa ds vnsnutj j[kdj LGG 407, LGG 450 and LGG 460 Y= 373.94 – 11.14 x + 293.68 x – 39.84 x – 13.2 x – ew¡x dh rhu iztkfr;ka ¼ ½ 1 2 3 4 rFkk mM+n dh nks iztkfr;ksa (LBG 20 and LBG 623) dk ewY;kadu 2.13 x5 + 1.00 x6 – 0.64 x7 – 14.64 x8 + 6.16 x9 + 33.51 x10 + 63.96 x11 – 2.56 x12 – 1.98 x13 – 335.2 x14 ;g crkrk gS fd tM+ dk ?kuRo] tM+ dk otu] 'kwV dk otu] ?kuRo] Unlike in mungbean, root length showed i.kZ la[;k] otu] rFkk {ks=Qy ew¡x esa mM+n dh rqyuk esa vf/kd Fkk significant relationship with root volume and yield in A ew¡x Qly iztkfr;ksa esa mM+n esa tM+ dh yEckbZ rFkk ?kuRo dks vf/ urdbean indicating that as the root length and root volume increases, seed yield increases. Leaf weight, kd cht mit ls tksM+ ik;k x;k A root volume, root shoot ratio and relative water content neither showed significant correlations with yield nor References exhibited significant relationship among themselves (Table 3). Bhattarcharya (2002) reported significant correlation and regression of urdbean yield with seed Bhattacharya A (1998) All India Co-ordinate Research Project on Mungbean, Consolidated Report. Orissa filling period, pods per plant, pod weight, seeds per University of Agriculture and Technology plant, 100 seed weight, harvest index, dry mater Bhubaneshwar 249-264 partioning per day and seed yield. Leaf area index Bhattcharya A (2002) Effect of yield attributing traits on seed showed significant association with leaf area, relative yield of mungbean and urdbean. Indian J Pulses Res leaf water content, leaf number and specific leaf area 15(1): 23-27 while negative association with shoot weight, lateral Kanaka Durga K , Murali Rao M M , Reddy M V , Koteswara roots and specific leaf weight. The relationship between Rao Y( 2003) Effect of early drought stress on root weight and shoot weight indicated that as the root morpho-physiological characters and yield of weight increases shoot weight also increases mungbean and urdbean cultivars. Indian J Pulses consequently leading to increased root shoot ratio. Res 16 (2): 133-135 Muehlbauer F G, Singh K B( 1987) In: The Chickpea (Eds. Multiple regression analysis showed that all the Saxena MC ,Saxena K B) 99-125 morpho – physiological characters accounted for total Poehlman J M (1991) The Mungbean. Oxford and IBH variation in yield. Of the 14 characters studied, root Publishing Co Pvt Ltd Bombay shoot ratio influenced the yield significantly indicating Snedecor G W, Cochran W G (1972) Statistical methods an increase in yield of 39.96 g for every unit increase in applied to experiments in agriculture and biology shoot ratio. Similarly unit increase in root weight resulted Iowa State College USA in an yield increase of 33. 76 g. The regression equation is represented as (Manuscript Receivd : 01.07.2010; Accepted 08.12.2012)

Y= 22.49 + 13.50 x1 – 86.09 x2 – 84.11 x3 + 33.76 x4 +

2.53 x5 + 4.90 x6 + 0.15 x7 + 7.12 x8 - 4.47 x9 + 6.69 x10

+ 39.96 x11 – 0.57 x12 – 0.46 x13 – 1022.2 x14.

316 JNKVV Res J 46(3): 317-321 (2012)

Assessment of heritability and genetic advance in coriander germplasms

Beena Nair, S.K. Sengupta, A.K. Naidu, A.K. Mehta, Krishna Pal Singh and P.K. Jain Department of Horticulture Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract an important ingredient in various food preparations whereas; the leaves are often used for garnishing The highest phenotypic and genotypic coefficients of variation dishes. The leaves, stalks and seeds of coriander were recorded in chlorophyll content at 30 DAS. Heritability contain certain essential oils. The essential and fatty was observed to be high for chlorophyll content at 45DAS, oils of the fruits are used in industry, either separately number of fruiting nodes plant-1, chlorophyll content at 60DAS, or combined. days to 50% flowering, days to 80% maturity, number of umbels plant-1,1000 seed weight, plant height at maturity, leaf size, number of secondary branches plant-1, umbel diameter, Material and methods number of primary branches plant-1, seed yield plot-1, plant height at 60DAS, seed yield plant-1, plant height at 45DAS, vegetative yield plot-1, plant height at 30DAS and number of The present investigation was carried out during the fruits umbellet-1. However, high heritability coupled with high Rabi seasons of 2010-11 and 2011-12 respectively at genetic advance was observed for number of fruiting nodes Vegetable Research Farm, Department of Horticulture, plant-1, chlorophyll content at 45 and 60DAS, plant height at College of Agriculture, J.N.K.V.V., Jabalpur (M.P.). The -1 maturity, number of secondary branches plant , number of materials for the present study comprised of sixty four umbels plant-1, vegetative yield plot-1 and seed yield plant-1. germplasms of Coriander. The collections obtained from different coriander growing areas of the country were Keywords: variability, genotypic coefficient of variation, evaluated for their adaptability in Madhya Pradesh in heritability order to study their genetic variability. These lines were planted in Randomized Block Design which was Spices have been used in almost all countries in the replicated thrice. world for many years either in ethnic cuisines or for their medicinal values. Archaeologists estimate that from Results and Discussion as far back as 50,000 B.C. humans had used the special qualities of aromatic plants to help flavor their food. Variability refers to the presence of differences among Coriander (Coriandrum sativum L.) is an annual herb the individuals of plant population. Variability results in the family Apiaceae (Umbelliferae) and is known to due to the differences either in the genetic constitution be originated in the Mediterranean region (Hedburg and of the individuals of a population or in environment in Hedburg 2003). The term ‘Coriandrum’ is derived from which they are grown. The existence of variability is the Greek for a bug and refers to a shield-bug. The essential for resistance to biotic and abiotic factors as Egyptians called this herb the ‘‘spice of happiness”, well as for wide adaptability. Estimation of components probably because it was considered to be an of genetic parameters of variation of seed yield and its aphrodisiac. All parts of the plant are edible but it is attributes exhibited a wide range of variation for all the mostly grown for the green vegetable and seeds which when dried have a mild aromatic flavour. Thus it is traits under study. Results indicated that the value of mainly grown as a dual purpose crop for seeds (dry phenotypic coefficients of variation were of higher magnitude than that of genotypic variance and genotypic fruits) as well as for its leaves. The seeds are used as

317 coefficients of variation for all the traits showing that sense is high, it indicates that though the character is the environment had an important role in influencing least influenced by the environmental effects, the the expression of the traits. The highest phenotypic selection for improvement of such character may be coefficient of variation was recorded in chlorophyll useful, because broad sense heritability is based on content at 30 DAS (33.97) followed by number of fruiting total genetic variance which includes both fixable nodes (33.01), vegetative yield plot-1 (30.54) and (additive) and non fixable (dominance and epistatic) number of fruits umbel-1 (27.55). However moderate variances. Similar trend have been observed by Jain phenotypic coefficient of variation was observed for leaf and Dubey (1972); Mehta and Patel (1985); Sharma size (22.75) followed by plant height at 60 DAS (22.43), and Sharma (1989); Ali et al. (1993); Jain et al. (2002); days to 50% flowering (20.90) and number of umbellets Megeji and Korla (2002); Rajput et al. (2004) and Singh umbel-1(17.32). The results are in agreement with Singh et al. (2005). and Shah (2003) for days to flowering and plant height; Leaf size (66.66%) and diameter of fruits Jain et al. (2003) for number of days to 50 per cent (51.02%) exhibited a moderate value of heritability flowering, total plant height, number of umbellets however, it was observed to be low for the traits viz., umbel-1, number of fruits umbel-1; Sharma et al. (2004) number of umbellets umbel-1(40.81%), number of fruits for plant height, umbels plant-1, umbellets umbel-1 and umbel-1 (32.80%) and chlorophyll content at 30DAS seeds umbel-1 and Mengesha and Getinet (2010) for (30.70%). It reveals that the character is highly longest basal leaf length, days to start 50 per cent influenced by environmental effects and genetic flowering, umbellets umbel-1 and fruits umbellets-1. improvement through selection will be difficult due to Seed yield plant-1 (5.27), fruit size (6.72), days masking effects of the environment on the genotypic taken to 80% maturity (11.74), diameter of fruits (14.42) effects. The results of the present investigation are in and umbel diameter (15.81) showed the lowest confirmation with the findings of Sharma and Sharma estimates of phenotypic coefficient of variation. The (1989); Bhandari and Gupta (1997) and Sharma et al. probable reason might be due to the difference between (2004). the genotypic and phenotypic coefficient of variation In the present study genetic advance as being narrow, revealing low environmental influence and percentage of mean was estimated to be high for expressing the true genetic potential in varied number of fruiting nodes plant-1 (67.00%) followed by environments, which ultimately leads to limited scope chlorophyll content at 60DAS (54.47%), plant height at for improvement of such traits. Similar findings are maturity (50.74%), number of umbels plant-1 (50.42%), reported by Sharma et al. (2004). vegetative yield plot-1 (50.35%), 1000 seed weight High heritability in broad sense in helpful in (49.08%), chlorophyll content at 45DAS (48.42%) and identifying appropriate character for selection and number of secondary branches plant-1 (46.95%). enables the breeder to select elite genotypes from However, the estimates were moderate for the traits viz., diverse genetic populations. The heritability based on number of primary branches plant-1 (44.61%), leaf size two years pooled data ranged from 32.80% for number (43.50%), seed yield plot-1 (43.64%), days to 50% of fruits umbel-1 to 98.71 for chlorophyll content at flowering (42.66%), number of fruits umbellet-1 (40.34%); 45DAS. On the basis of pooled analysis the heritability plant height at 45 (39.99%), 60 (37.04%) and 30 DAS (broad sense) was revealed to be high for the characters (35.77%) and umbel diameter (28.98%) whereas, low viz., chlorophyll content at 45DAS (98.71%), number for days to 80% maturity (23.95%), chlorophyll content of fruiting nodes plant-1 (98.50%), chlorophyll content at 30DAS (21.48%), number of fruits umbel-1 (18.59%), at 60DAS (98.10%), days to 50% flowering (97.11%), diameter of fruits (15.15%), number of umbellets days to 80% maturity (97.01%), number of umbels umbel-1 (14.55%), fruit size (11.67%) and seed yield plant-1 (96.80%),1000 seed weight (96.20%), plant plant-1(8.59%). Similar findings have been elaborated height at maturity (95.24%), leaf size (92.82%), number by Krishnamurthy and Madalageri (2002); Choudhary of secondary branches plant-1 (89.75%), umbel diameter and Ramkrishna (2003); Rajput and Singh (2003); (87.27%), number of primary branches plant-1 (86.00%), Rajput et al. (2004); Ali et al. (2005); Zheljakov et al. seed yield plot-1 (79.65%), plant height at 60DAS (2008) and Mengesha and Getinet (2010). (79.01%), seed yield plant-1 (78.57%), plant height at High heritability coupled with high genetic 45DAS (78.13%), vegetative yield plot-1 (77.77%), plant advance indicates that most likely the heritability is due height at 30DAS (75.26%) and number of fruits to additive gene effects and selection may be effective. umbellet-1 (74.50%). If the value of heritability in broad

318 as %

) (%)mean of

2

(h

Heritability GA

Phe. Gen.

Coefficient of variations

2.73 0.21 22.75 21.92 92.82 43.50

Variance

3.38 2.52 0.86 26.27 22.68 74.50 40.34

0.32 0.16 0.16 14.42 10.30 51.02 15.15

1.93 1.86 0.07 24.78 24.30 96.20 49.08

Phe. Gen. Env.

25.75 20.12 0.24 24.36 24.25 78.13 39.99 98.87 78.12 0.43 22.43 22.38 79.01 37.04

40.04 39.46 0.59 33.01 32.77 98.50 67.00

49.76 48.18 1.57 25.27 24.87 96.80 50.42

93.23 30.54 62.69 27.55 15.77 32.80 18.59

686.66 654.54 1.12 25.86 25.84 95.24 50.74

262.76 257.34 2.42 20.90 20.81 97.11 42.66

4.00 0.09 0.06 0.05 6.72 6.66 66.66 11.67

Max.

604.17 12159.71 9806.34 38.36 23.89 23.85 79.65 43.64

Min.

6.83 28.63 17.92 5.50 12.42 33.97 18.82 30.70 21.48

G M Range

9.45 5.93 15.47 5.07 5.00 0.07 23.82 23.66 98.71 48.42 6.77 3.67 10.47 3.33 3.27 0.06 26.94 26.69 98.10 54.47

7.90 4.83 12.83 4.01 3.61 0.41 25.36 24.04 89.75 46.95

5.45 3.83 7.67 0.89 0.36 0.53 17.32 11.06 40.81 14.55

4.60 3.20 6.50 0.55 0.48 0.03 15.81 15.41 87.27 28.98 1.35 0.53 2.47 0.18 0.14 0.01 30.54 29.83 77.77 50.35 9.97 8.73 11.50 0.28 0.22 0.01 5.27 5.23 78.57 8.59

10.37 6.47 16.47 5.74 4.32 0.15 23.10 22.81 75.26 35.77

Plant height 30 DAS Plant height 45 DAS 20.42 10.77 29.03 Plant height 60 DAS 43.69 23.03 64.07 Plant height at maturity 101.32 55.77 144.30 Chlorophyll content 30 DAS 12.46 Chlorophyll content 45 DAS Chlorophyll content 60 DAS Leaf size (cm) 7.53 4.07 10.53 2.94 No. of primary branches primary of No. 8.25 4.83 12.17 4.32 3.71 0.61 25.19 23.35 86.00 44.61 No. of secondary branches No. of fruiting nodes 19.17 9.00 34.67 Days to 50% flowering 77.55 52.00 100.33 Estimation of genetic parameters of variations in coriander Days to 80% maturity 119.63 99.17 143.83 197.16 191.27 1.89 11.74 11.68 97.01 23.95 Characters No. of umbels/ plant 27.91 11.67 45.33 No. of umbellets/ umbel No. of fruits/ umbellet 6.99 4.67 11.33 No. of fruits/ umbel 35.04 21.67 47.17 Diameter of fruits (mm) 3.93 3.13 6.27 Fruit size (mm) 3.53 2.90 Umbel diameter (cm) Vegetative yield (kg) Seed yield/plant (g) 1000 seed weight (g) 5.61 3.27 8.23 Seed yield/plot (g) 419.79 253.33

319 In the present investigation high heritability coupled with Agro-Technology, Quality, Processing and Export of high genetic advance was observed for number of Spices held at K.N.K. College of Horticulture, fruiting nodes plant-1, chlorophyll content at 45 and Mandsaur, MP p 103 60DAS, plant height at maturity, number of secondary Bhandari M M, Gupta Adarsh (1997) Variation and association analysis in coriander, Euphytica 58(1):1-4 branches plant-1, number of umbels plant-1, vegetative yield plot-1 and seed yield plant-1. The high heritability Choubey P C, Sharma B R, Verma B K, Banafar R N S (1991) Variability in coriander (Coriandrum sativum L.). is being exhibited due to favourable influence of Scientia Horticul 2:137-144 environment rather than genotype and selection for such Choudhary Pradeep, Ramkrishna K (2003) An analysis of traits may not be rewarding. High heritability coupled polygenic variation in the M4 families of coriander with low genetic advance was observed for seed yield (Coriandrum sativum L.). Indian J Genetic Plant Br plant-1 and days to 80% maturity which is indicative of 63(2):181-182 non additive gene action. The low heritability is being Jain K K, Dubey C S (1972) Study of attributes and heritability exhibited due to high environmental effects. The present in some varieties of coriander (Coriandrum sativum findings are in confirmation with the earlier findings of L.). Madras Agric J 56: 193-194 Rajendran (1978); Rao et al. (1981); Jindla et al. (1985); Jain V K, Singh D, Jain S K (2002) Assessment of genetic Mehta and Patel (1985); Choubey et al. (1991); Jain et variability in coriander (Coriandrum sativum). Ann Pl Soil Res 4(2):329-330 al. (2002); Megeji and Korla (2002); Rajput and Singh Jain U K, Singh D, Amrita (2003) Correlation and path analysis (2003); Sharma et al. (2004); Singh et al. (2006) and for certain metric traits in coriander. Progressive Mengesha and Getinet (2011). Agricul 3(1/2): 86-88 Jindla L N, Singh T H, Rang Allah, Bansal M L (1985) Genetic variability and path coefficient analysis in coriander iz:ih vkSj thuksvkbi dh fofHkUurk dk mppre xq.kkad eku DyksjksfQy (Coriandrum sativum). Crop Improvement 12(2):133- lkexzh esa cqokbZ ds 30 fnuksa ckn esa ntZ fd, x, A mPp vkuqokaf'kdrk 136 DyksjksfQy lkexzh cqokbZ ds 30 fnuksa ckn] Qyu uksM~l dh la[;k izfr Krishnamurthy V, Madalageri M B (2002) Variability and correlation studies in ajowain (Trachyspermum ammi ikS/ks] DyksjksfQy lkexzh cqokbZ ds 60 fnuksa ckn] Qwy 50 izfr'kr] L.). J Medic and Aromatic Pl Sci 24(2):364-370 ifjiDork 80 izfr'kr] iq"iN= dh la[;k izfr ikS/ks] 1000 cht Megeji N W, Korla B N (2002) Heritability in coriander. Haryana otu] ikS/kksa dh Å¡pkbZ ifjiDork ij] iRrh dk vkdkj] n~forh;d J Horti Sci 31(3-4):292-293 Mehta K G, Patel R N (1985) Genetic variability and heritability 'kk[kvksa dh la[;k izfr ikS/ksa] iz"iN= O;kl ¼lseh½] izkFkfed 'kk[kkvkas in coriander. Indian Cocoa, Arecanut and Spices J dh la[;k izfr ikS/ks] cht mit izfr IykWV] ikS/kksa dh Å¡pkbZ 60 fnuksa 8(3):82-83 esa cqokbZ ds ckn] cht mit izfr ikS/ks] ikS/kksa dh Å¡pkbZ 45 fnuksa esa Mengesha Beemnet, Getinet al.emaw (2010) Variability in Ethiopian coriander accessions for agronomic and cqokbZ ds ckn] ouLifr mit izfr IykWV] ikS/kksa dh Å¡pkbZ 30 fnuksa esa quality traits. African Crop Sci J 18(2): 43-49 cqokbZ ds ckn vkSj Qy dh la[;k izfr NksVk N=d ds fy, ns[kk x;k Mengesha Beemnet al.emaw Getinet, Tesfaye Bizuayehu (2011) Genetic divergence in Ethiopian coriander Fkk] gkyk¡fd] mPp vkuqokf'kdrk ;qfXer ls mPp vkuqokaf'kd vfxze ds accessions and its implication in breeding of desired lkFk feydj ns[kk x;k dh y{k.k tSls Qyu uksbl dh la[;k izfr plant types. African Crop Sci J 19(1): 39-47 ikS/ks] DyksjksfQy lkexzh cqokbZ ds 45 vkSj 60 fnuksa ckn] ikS/kksa dh Rajendran A (1978) Variability studies in coriander (Coriandrum sativum L.). Madras Agricul J 63: 39- Å¡pkbZ ifjiDork ij] n~forh;d 'kk[kkvksa dh la[;k izfr ikS/ks] iq"iN= 42 dh la[;k izfr ikS/ks] ouLifr mit izfr IykWV vkSj cht izfr mit Rajput S S, Singh D (2003) Variability in coriander (Coriandrum ikS/ks fy, ns[kk x;k gS A sativum) for yield and yield components. South Indian J of Spices and Aromatic Crops 12(2):162-164 Rajput S S, Singhania D L, Singh D, Sharma K C, Rathore V References S (2004) Assessment of genetic variability in fennel (Foeniculum vulgare Mill). In: National Seminar on New Perspective in Commercial Cultivation, Ali S A, Mishra A K, Yadav L N, Maurya K N (1993) Variability Processing and Marketing of Seed Spices and and correlation studies in coriander (Coriandrum Medicinal Plants held at S.K.N. College of sativum L.). International J Tropical Agriculture 11(1): Agriculture, Jobner pp 10 40-42 Rao T, Sri Bama Babu M, Karund Karan, Bavgji J N (1981) Ali S A, Jaiswal R K, Barholia A K (2005) Variability High heritability and path coefficient analysis of seed performance of coriander in medium black soil of yield of coriander. Indian J Agric Sci 10:726-728 M.P. Extended Summary of National Seminar on

320 Sharma K C, Sharma R K (1989) Variation and character Singh S P, Prasad R, Singh R K (2005) Path coefficient association of grain yield and its component analysis of seed yield in coriander. International J characters in coriander. Indian J Genet 49(1):135- Agricul Sci 1(1):98-61. 139 Singh D, Jain U K, Rajput S S, Khandelwal V, Shiva K N Sharma K C, Meena B L, Singh D, Jakhar M I (2004) Genetic (2006) Genetic variation for seed yield and its variability, heritability and genetic advance in components and their association in coriander Coriander sativum L. germplasm. In: National (Coriandrum sativum L.) germplasms. J Spices and Seminar on New Perspective in Commercial Aromatic Crops 15 (1): 25-29 Cultivation, Processing and Marketing of Seed Zheljakov V D, Pickett K M, Caldwell C D, Pincock J A, Roberts Spices and Medicinal Plants held at S.K.N. College J C, Mapplebeck L (2008) Cultivar and sowing date of Agriculture, Jobner pp 9 effects on seed yield and oil composition of coriander Singh D, Shah M A (2003) Stability analysis for seed yield, its in Atlantic Canada. Industrial Crops and Products contributing traits and oil content in coriander 28: 88-94 (Coriandrum sativum L.). J Spices and Aromatic Crops 12(2): 165-170 (Manuscript Receivd : 11.01.2012; Accepted 20.04.2012)

321 JNKVV Res J 46(3): 322-327 (2012)

Beneficial effects of pre-harvest application calcium nitrate and gibbrellic acid on storage behaviour of guava fruits

Sharad Bisen and R.S. Thakur Jawaharlal Nehru Krishi Vishwa Vidyalaya Krishi Vigyan Kendra, Chhindwara

Abstract g, calcium 10.0-30.0 mg/100 g and iron 0.60-1.39 mg/ 100 g (Singh et al. 2003). It is grown across the country An experiment was conducted to study the effect on storage in the area of 204.8 thousand hectare producing 2462.3 behavior of guava (Psidium guajava) fruits cv. Allahabad thousand Metric tones along with average productivity Safeda by the pre-harvest foliar sprays of calcium nitrate and of 12 MT/ha. It grown in 9.7 thousand hectare area in gibbrellic acid in the Department of Horticulture experimental Madhya Pradesh with an average production of 280.8 orchard station (Imaliya farm), Ph.D. laboratory of the thousand metric tons with an average productivity of Department of Horticulture and Food Science & Technology, 29.0 MT/ha (Anon 2011). Under ambient conditions College of Agriculture, JNKVV Jabalpur (M.P.) during the year fruits become overripe and mealy within a week, 2009-2011.The experiment consist of 12 treatments whereas, in cold storage guava cv. 'Allahabad Safeda' combination and 4 replications in Factorial Randomized Block fruits maintained quality up to 15 days at 8-10 °C and Design and conducted in year 2009-10 and repeated in same manner in 2010-11. The storage studies include physiological 85-90% RH (Tandon et al. 1989). Therefore, it needs loss in weight (%), decay losses (%) at 2, 4 and 6 day's interval immediate marketing and utilization after harvesting. after harvesting. The lowest weight loss and decay loss was During marketing stage, the guava producers observed in T15 and T16 that comprise of higher rate of Gibbrellic acid and of calcium nitrate. may be faced with manifold problems which have direct bearing upon the prosperity of producers. The main marketing problems are storage, market finance, price Keywords: Physiological weight loss, Decay loss, Peel fluctuation etc. Even if the production technology is colour, Guava fruit, Gibbrellic Acid advanced, unless marketing is also improved simultaneously, efforts to increase the yield and Guava (Psidium guajava L.) is an important fruit crop of production may go waste. chemicals like calcium compounds and growth regulators like GA has various India. Because of its hardy nature of plant it can able to 3 survive in adverse climate and grows under a varied effects on Guava fruit with respect to its growth, yield, range of soils mainly from sandy loam to clay loam Quality like TSS, total sugar phenol, acidity, ascorbic (Dhaliwal and Singla 2002). Guava is generally acid, specific gravity reducing sugar and also on shelf consumed fresh as a dessert fruit, or processed into life. Calcium has been shown to affect a wide range of many products such as puree, juice, concentrate, jam, physiological processes in plants and fruits (Wyn-Jones jelly, nectar or syrup (Jagtiani et al. 1988). In India, it is and Lunt 1967) and to inhibit specific aspects of 6th most widely grown fruit, occupying an area of 1.8 abnormal senescence in numerous fruits (Shear 1975). lakh ha, with an annual production of 19.8 lacs MT (Anon Calcium compounds extend the shelf-life of fruits by 2011). There is an increasing demand of fruits for fresh maintaining firmness, minimizing rate of respiration, as well as processing purpose in domestic and protein breakdown, disintegration of tissues and disease international markets. Guava is rich in vitamin C (75- incidence (Bangerth et al. 1972) 260 mg/100 g pulp), pectin (0.5-1.8%), good source of Hence, the present studies were conducted to thiamine (0.03-0.07 mg/100 g pulp) and riboflavin (0.02- find out the effect of pre-harvest spray of calcium nitrate 0.04 mg/100 g pulp). Besides, guava fruit is also a good and gibbrellic acid alone and in combination on post source of minerals, like phosphorus 22.5-40.0 mg/100 harvest behaviour of Guava fruits during storage under

322 ambient storage conditions. Materials and method

The present investigation was carried out on guava fruits cv. Allahabad safeda" in the Department of Horticulture experimental orchard station (Imaliya farm), Ph.D. laboratory of the Department of Horticulture and Food Science & Technology, College of Agriculture, JNKVV Jabalpur (MP) during the 2009-2011. The plant were selected and maintained with uniform cultural operations throughout the experimentation. The selected trees had pre harvest spray with the Gibbrellic acid at the time of fruit set and 20, 10 days prior to harvesting with concentration of Calcium nitrate to find response of on shelf-life of fruits. The cultivar subjected was to treatments: that include calcium nitrate and Gibbrellic

acid sprayed in 12 treatment combination CO+GO,

CO+G1, CO+G2, CO+G3, C1+GO, C1+G1, C1+G2, C1+G3,

C2+G0 , C2+G1, C2+G2, C2+G3, C3+GO, C3+G1, C3+G2,

C3+G3 as Calcium Nitrate (0, 1, 1.5, 2 %) and Gibbrellic acid (0, 25, 50, 100 PPM). The experiment was framed in a Factorial Randomized Block Design and conducted in year 2009-10 and repeated in same manner in 2010- 11. The storage studies include physiological loss in weight (%), decay losses (%) at 2, 4 and 6 day's interval after harvesting.

Result and Discussion

Physiological loss

The weight loss increased with the increase in storage period in 2009-10. During initial period of storage the rate of weight loss was low and the differences between various treatments as well as control were also narrow but the differences become markedly wider with the

on Physiological loss in weight (%) at different storage observation increased period of storage. Pre-harvest application of 3 chemicals reduced the weight loss significantly as compared to control.

Physiological loss in weight (%)(%) loss Decay The least loss in weight was observed in

0.08 0.12 0.06 0.08 0.12 0.003 0.040 0.164 0.003 0.042 0.171

0.08 0.12 0.06 0.08 0.12 0.003 0.040 0.164 0.003 0.042 0.171

2009-10 2010-11treatment 2009-10 with (T15) (C2+G3) 2010-11 (2.71%), closely followed

by T14 (C1+G3) (2.83%) treatment whereas the maximum loss was recorded in control (3.55%) in 2009-10 and It

3.19 4.22 6.49 3.24 4.30 6.63 0.075 1.543 6.314 0.071 1.608 6.692 2.93 3.88 5.95 3.10 3.98 6.06 0.068 1.399 5.691 0.065 1.431 5.845 2.89 3.85 5.78 3.01 3.94 6.05 0.075 1.403 5.676 0.071 1.428 5.804

2.86 3.83 5.94 2.99 3.88 5.88 0.072 1.334 5.436 0.069 1.379 5.681

3.13 4.16 6.37 3.18 4.23 6.50 0.071 1.406 5.691 0.067 1.442 5.948 3.04 4.03 6.14 3.09 4.10 6.26 0.074 1.405 5.767 0.070 1.441 5.974

2.98 3.95 6.00 3.02 4.01 6.11 0.073 1.431 5.793 0.069 1.474 5.955 2.82 3.71 5.65is apparent 2.85 from 3.77 data given 5.76 in Table 0.073 1.436 2 that 5.866 lower 0.070 weight 1.479 6.147

2 DAH 4 DAH 6 DAH 2 DAH 4 DAH 6 DAH 2 DAH 4 DAH 6 DAH 2 DAH 4 DAH 6 DAH loss percentage (2.75%) found in T15 (C2+G3) followed

by T14 (C1+G3), T13, T10 and T16. The higher weight loss

(3.61%) found in control treatment T1 (C0+G0) at 2 DAH in the year of 2010-11.

0 1 2 3

0 1

2 3

C

C

C C

G

G

G

G

SEm ± 0.06 SEm ± 0.06 In case of data for 4 days after harvesting where

Treatment

CD @ 5% @ CD 0.17 0.22 0.35 0.17 0.23 0.35 NS 0.115 0.470 NS 0.119 0.487

CD @ 5% @ CD 0.17 0.22 0.35 0.17 0.23 0.35 NS NS NS NS NS NS

Table 1. Effect of Calcium Nitrate, GA Table the minimum weight loss 3.56% was recorded in fruits,

323 sprayed with T15(C2+G3) followed by T14, T13, T10, T12, T16

and T11. The higher weight loss (4.70%) found in control

treatment T1 (C0+G0) at 4 DAH in 2009-10 and minimum Weight loss percentage 3.60% was recorded in fruits,

sprayed with T15 (C2+G3) followed by T14, T13, T10, T16 and

T11. The r weight loss (4.79%) found in control treatment

2010-11 T1 (C0+G0).

The plants sprayed with C3 level of Calcium Nitrate maintained lower weight loss percentage 2.86%

during the 2 DAH in 2009-10 followed by C2, C1 and the

maximum weight loss percentage 3.19% found in C0

control concentration. The plants sprayed with C3 level of calcium nitrate maintained lower weight loss Decay loss (%) loss Decay percentage 2.99% during the harvesting time followed

by C2, C1 and the maximum weight loss percentage

3.24% found in C0 control concentration in the year of 2010-11.

NS NS NS 0.237 0.975

0.080 0.329 0.006 0.083 0.341

1.348 2.734 0.462 1.375 2.784

1.440 5.846 0.073 1.369 6.022 1.403 5.739 0.070 1.331 5.534

2009-10 The high concentration of Ca(NO3)2 in (C3) recorded 3.83% the minimum fruit Weight loss

percentage. It was followed by the C2 and C1 level respectively at 4DAH. The lower concentration of

Ca(NO3)2 at (C0) recorded 4.22% at the 4 days after

harvesting in 2009-10. The concentration of Ca(NO3)2

at (C3) gave significantly fruit Weight loss percentage

as compare to the concentration at C2, C1 and C0 level.

The high concentration of Ca(NO3)2 at (C3) level recorded 3.88% the minimum fruit Weight loss

percentage at 4 DAH. It was followed by the C2 and C1

level respectively. The lower concentration of Ca(NO3)2

2010-11 at (C0) recorded 4.30% at the 4 days after harvesting in

2010-11. The concentration of Ca(NO3)2 at (C3) gave significantly fruit Weight loss percentage as compare

to the concentration of at C2, C1 and C0.

The higher concentration of GA3 in (G3) recorded 2.82% the minimum weight loss percentage at 2 DAH.

It was followed by the G2 and G1 respectively. The

concentration of GA3 in (G3) gave significantly weight

interaction on Physiological loss in weight (%) and decay loss (%) at different storage observation 3 loss percentage as compare to the concentration of G2,

G1 and G0 in 2009-12 and the higher concentration of

Physiological loss in weight (%) GA3 in (G3) recorded 2.85% the minimum weight loss

percentage. It was followed by the G2 and G1 respectively. The concentration of GA in (G ) gave 2009-10 3 3 significantly weight loss percentage as compare to the

concentration of G2, G1 and G0 at 2DAH in 2010-11.

1.38 1.58 1.97 1.39 1.59 1.99

2 DAH 4 DAH 6 DAH 2 DAH 4 DAH 6 DAH 2 DAH 4 DAH 6 DAH 2 DAH 4 DAHThe 6 DAH high concentration of GA3 in (G3) recorded 3.71% the minimum fruit Weight loss percentage. It was

followed by the G2 and G1 respectively. The lower

) 2.84 3.77 5.75 2.88 3.83 5.86 0.071 1.327 5.373 0.068 1.466 5.968 ) 2.89 3.83 5.82 2.93 3.89 5.92 0.072 1.433 5.745 0.068 1.490 5.860 ) 3.04 4.00 5.99 3.07 4.05 6.10 0.075 1.449 5.910 0.071 1.463 5.910 ) 2.84 3.74 5.75 2.88 3.80 5.87 0.070 1.533 6.290 0.066 1.610 6.730 ) 2.83 3.73 5.69 2.87 3.78 5.80 0.074 1.366 5.587 0.070 1.407 5.867 ) 2.71 3.56 5.29 2.75 3.60 5.38 ) 2.89 3.83 5.88 2.92 3.88 5.99

) 3.55 4.70 7.23 3.61 4.79 7.39 0.079 1.583 6.491 0.075 1.647 6.816 ) 3.05 4.03 6.24 3.10 4.10 6.36 0.062 1.336 5.356 0.059 1.476 5.677 ) 2.98 3.94 6.02 3.02 4.01 6.14 0.066 1.327 5.347 0.063 1.453 5.560 ) 2.94 3.96 6.01 2.98 4.02 6.11 0.075 1.379 5.570 0.071 1.492 5.737 ) 3.22 4.27 6.56 3.28 4.35 6.71 0.077 1.536 6.328 0.073 1.597 6.708 ) 3.02 4.00 6.11 3.07 4.07 6.24 0.065 1.327 5.428 0.062 1.467 5.645 ) 2.98 3.95 5.99 3.02 4.01 6.10 0.086 1.413 5.766 0.081 1.442 5.939 ) 2.95 3.92 5.90 2.99 3.97 6.01 0.067 1.345 5.547 0.064 1.459 5.602 ) 3.15 4.18 6.43 3.20 4.26 6.56 0.075 1.518 6.146 0.071 1.578 6.515

2 2 2 3 3 3 3

0 0 0 0 1 1 1 1 2 concentration of GA3 (G0) recorded 4.16% at the 4 DAH

+G +G +G +G +G +G +G

+G +G +G +G +G +G +G +G +G

1 2 3 0 1 2 3

0 1 2 3 0 1 2 3 0 in 2009-10. The high concentration of GA3 (G3) recorded

CV

(C (C (C (C (C (C (C

(C (C (C (C (C (C (C (C (C 3.77% the minimum fruit Weight loss percentage. It was

SEm ± 0.12 0.16 0.24 0.12 0.16 0.25

1 2 3 4 5 6 7 8 9

10 11 12 13 14 15 16

Treatment

CD @ 5% 0.34 0.45 0.69 0.35 0.46 0.71

T T T T T T T T

T

T T T T T T T followed by the G and G respectively. The lower

Table 2. Effect of Calcium Nitrate, GA Table 2 1

324 concentration of GA3 (G0) recorded 4.23% at the 4 days nitrate results a lower cumulative physiological loss in after harvesting in 2010-11. Sardar guava. In case of data for 6 days after harvesting Present studies finding that the use of calcium declining trend commensurate with all treatment. The nitrate and GA3 at pre harvest than the PLW was reduced fruits sprayed with T15 (C2+G3) maintained lower Weight in both years. Similarly results found in guava [Singh loss percentage 5.29% throughout as compared to other (1988), Singh and Singh (1999), (Gupta et al. 1980)] in treatments. On the other hand, the control T1 (C0+G0) grapes and guava (Singh 1980) and in Strawberry fruits experienced the higher of Weight loss percentage (Asrey et al. 2004). Saran et al. (2004) observed that during storage that 7.23% in the year 2009-10. In case ber fruits of cv. Gola treated with calcium nitrate (1.5%) of data for 6 days after harvesting declining trend packed in perforated polyethylene bags recorded lowest commensurate with all treatment. The fruits sprayed with PLW during storage at ambient conditions (12- 28o C

T15 (C2+G3) maintained lower Weight loss percentage temperature and 65 + 3% RH) under semiarid 5.38% throughout as compared to other treatments. On environment of Gujarat. the other hand, the control T1 (C0+G0) fruits experienced the higher of Weight loss percentage during storage Decay losses (%) that 7.39% in the year of 2010-11.

The guava fruits sprayed with C also registered 3 The effect of various treatments on decay losses was lower and steadier loss in Weight loss percentage found at the time of 2 DAH to be non significant in 2009- 5.94% followed by C and C at 6 DAH in 2009-10. The 2 1 10. As apparent from Table there was non significant guava fruits sprayed with C3 also registered lower and difference recorded for GA3 and Calcium nitrate in year steadier loss in Weight loss percentage 5.88% followed of 2010-11. by C2 and C1 in 2010-11. The effect of various treatments on decay losses The high concentration of GA (G ) recorded 3 3 was found at the time of 4 days after harvesting to be 5.65% the minimum fruit Weight loss percentage. It was non significant in 2009-10. It is evident from the data followed by the G and G respectively. The lower 2 1 that the decay losses percentage, in general followed concentration of GA (G ) recorded 6.37% at the 6 days 3 0 a increasing trend commensurate with in storage period. after harvesting in 2009-10. The high concentration of In case of data for 4 DAH where the minimum decay GA (G ) recorded 5.76% the minimum fruit Weight loss 3 3 losses percentage 1.331% was recorded in fruits, percentage. It was followed by the G2 and G1 sprayed with T16(C3+G3) followed by T15, T14, T7, T8 and respectively. The lower concentration of GA3 (G0) T12. The higher weight loss (1.647%) found in control recorded 6.50% at the 6 days after harvesting in 2010- treatment T (C +G ) in 2010-11. 11. 1 0 0 Indusial effect of calcium nitrate was found It was observed that the weight loss of fruit significant differences between the different levels of decreased with the spray of nutrients and growth calcium nitrate. The high concentration of Ca(NO ) in substance. In the both years, it was observed that the 3 2 (C3) recorded 1.334% the minimum fruit decay losses weight loss of fruit decreased with the spray of nutrients percentage. It was followed by the C and C and growth substance. The weight loss under the 2 1 respectively. The lower concentration of Ca(NO3)2 (C0) influence of chemicals might have been used in recorded 1.543% at the 4 days after harvesting in 2009- respiration process. 10. The concentration of Ca(NO3)2 (C3) gave significantly The PLW of fruits resulted in shriveling, ultimately fruit Decay losses percentage as compare to the losing the freshness and quality of the fruits. The loss concentration in C2, C1 and C0. in weight is direct loss of saleable produce in economic The high concentration of GA3 gave non terms coupled with reduced acceptability of the produce. significantly fruit Decay losses percentage as compare The increased loss in weight during storage period and to the concentration of G2, G1 and G0 in 2009-10 and shelf life may be due to the upsurge in respiration rate 2010-11. and transpiration processes in fruits. These results are agreement with the findings of Chandra et al. (1999) The effect of various treatments on decay losses who observed that pre-harvest application of calcium was found at the time of 6 days after harvesting to be

325 non significant in 2009-10. It is evident from the data that the decay losses, Singh et al. (2002) in mango, the decay losses percentage, in general followed a Chaudhary et al. (2003) observed in sapota, Ben- increasing trend commensurate with in storage period. In Yehoshua et al. (1995) in citrus, Singh et al. (2000) in case of data for 6 days after harvesting where the minimum peach. decay losses percentage 5.534% was recorded in fruits, sprayed with T (C +G ) followed by T , T , T , T and T . 16 3 3 8 3 2 8 6 Psidium guajava cv The higher weight loss (6.816%) found in control treatment ,d iz;ksx ve:n Qy ds HkaMkj.k ds O;ogkj ij izHkko dk v/;;u djus ds fy, vk;ksftr fd;k x;k vkSj T1 (C0+G0) IN 2010-11. ckxokuh iz;ksxkRed ckxokuh LVs'ku ds foHkkx esa gibbrellic ,flM Indusial effect of calcium nitrate was found significant differences between the different levels of dSfY'k;e ukbVªsV ds iwoZ Qly ds i.khZ; Lizs }kjk bykgkckn lQsnk calcium nitrate. The high concentration of Ca(NO3)2 in ¼befy;k [ksr½] ih-,p-Mh- mn~;kfudh ,oa [kkn~; foKku vkSj izkSn~;ksfxdh]

(C3) recorded 1.334% the minimum fruit Decay losses 2009 ls 2011 o"kZ ds nkSjku dkWyst —f"k] t-us-—-fo-fo-] tcyiqj percentage . It was followed by the C and C 2 1 ¼e iz½ ds foHkkx dh iz;ksx'kyk] iz;ksx 12 mipkj la;kstu vkSj respectively. The lower concentration of Ca(NO ) in 3 2 Øexqf.kr ;kÌfPNd CykWd fMtkbu esa 4 vuqdj.k ls feydj curk (C0) recorded 1.543% at the 4 days after harvesting in gS vkSj o"kZ 2009&10 esa vk;ksftr dh tkrh gS vkSj 2010&11 esa 2009-10. The concentration of Ca(NO3)2 in (C3) gave significantly fruit Decay losses percentage as compare ,d gh rjhds ls nksgjk;k A HkaMkj.k v/;;u otu esa 'kkjhfjd gkfu to the concentration in C , C and C . Indusial effect of 2 1 0 ¼%½] 2 esa {k; ?kkVk ¼%½] 4 vkSj Qly dVkbZ ds ckn 6 fnu ds calcium nitrate was found significant differences varjky esa 'kkfey gS] lcls de otu ?kVkus vkSj {k; gkfu T vkSj between the different levels of calcium nitrate. The high 15 T16 fd Gibbrellic ,flM vkSj dSfY'k;e ukbVªsV dh mPp nj dk concentration of Ca(NO3)2 in (C3) recorded 1.379% the minimum fruit Decay losses percentage . It was followed lekos'k esa euk;k x;k A by the C2 and C1 respectively. The lower concentration References of Ca(NO3)2 in (C0) recorded 1.608% at the 4 days after harvesting in 2010-11. The concentration of Ca(NO3)2 in (C3) gave significantly fruit Decay losses percentage Anon (2011) Indian horticulture data base-2011. National Horticulture Board, Gurgaon, India as compare to the concentration in C2, C1 and C0. Indusial effect of calcium nitrate was found significant Asrey R, Jain RK and Singh R (2004) Effect of pre-harvest differences between the different levels of calcium chemical treatments on shelf life of 'Chandler' nitrate. The high concentration of Ca (NO ) in (C ) strawberry (Fragaria x ananassa). Indian J Agric Sci 3 2 3 74(9): 485-87 recorded 5.681% the minimum fruit Decay losses Bangerth F, Dilley DR, Dewey DH (1972) Effect of postharvest percentage. It was followed by the C and C 2 1 calcium treatments on internal breakdown and respectively. The lower concentration of Ca (NO3)2 in respiration of apple fruits. J Amer Sot Hort Sci 97:

(C0) recorded 6.692% at the 4 days after harvesting in 679-682

2010-11. The concentration of Ca (NO3)2 in (C3) gave Ben-Yehoshua S, Rodov V, De Qui Fang Jong Jin Kim (1995) significantly fruit Decay losses percentage as compare Performed antifungal compound of citrus fruits. Effect to the concentration in C , C and C . of post harvest treatment with heat and growth 2 1 0 regulators. J Agril Food Chem 43: 1062

The high concentration of GA3 gave non signifi- Chandra R, Gupta PN, Rajput CBS (1999) Influence of pre- cantly fruit Decay losses percentage as compare to the harvest application of calcium and alar on post- concentration of G , G and G in 2009-10 and 2010- harvest changes in cv. Sardar guava fruits. Trop Agric 2 1 0 (Trinidad) 76: 70 11. Choudhury S, Ray D P, Das B K Sahu G S (2003) Effect of Decay losses were recorded maximum in use of pre and post-harvest chemical treatments on control treatment and the effect of calcium nitrate and ripening, quality and storage life of sapota

GA3 with higher concentration reduced decay losses in (Manilkara achras Mill.) cv. Pala. Orissa J Hort 31(2): the both years. The similar resulted founded by Singh 54-57 (1988) observed that in guava cv. Allahabad Safeda Dhaliwal GS, Singla R (2002) Studies on the time of anthesis spray of gibbrellic acid and calcium nitrate at the rate and dehiscence in different genotypes of guava in of 20 and 40 ppm and 1% and 2% respectively reduced winter and rainy season crops. Indian J Hort 59:157- 161

326 Gupta OP, Singh BP, Gupta AK (1980) Studies on the shelf- Singh J P, Singh SP (1999) Effect of pre-harvest spray of life of different guava cultivars. J Res Haryana Agric calcium nitrate on shelf -life of guava (Psidium Univ 9: 247-250 guajava L.) Fruits cv. Allahabad safeda. J Applied Jagtiani J, Chan HT Jr, Sakai WS (1988) Tropical fruit Biol 9: 149-152 processing. Academic Press Inc New York 9-43 Singh K (1980) Effect of various chemicals as pre and post Saran PL, Lal G, Jat RG Singh RV (2004) Effect of pre-harvest harvest application on shelf life of guava at various application of different chemicals on shelf life and temperatures, Ph D Thesis, Haryana Agric Univ Hisar quality of ber (Zizyphus mauritiana Lamk.) cv. Gola India Haryana J Hort Sci 33(1/2): 71-73 Tandon DK, Singh BP, Kalra SK (1989) Storage behaviour of Shear CB (1975) Calcium-related disorders of fruits and specific gravity graded guava fruits. Scientia Hort vegetables. Hort Science 10: 361-365 41:35-41 Singh A (1988) Effect of calcium nitrate and plant growth Wvn Jones RG, Lunt OR (1967) The function of calcium in regulators on the storage of Allahabad Safeda guava. plants. Bot Rev 33:407-426 Indian J Hort 45 (1-2):45-50 Singh G, Mishra A K, Hareeb M, Tandon D K and Pathak R K. 2003. The guava. Extension Bulletin 17 CISH (Manuscript Receivd: 17.07.2012; Accepted: 20.12.2012) Lucknow

327 JNKVV Res J 46(3): 328-332 (2012)

Variability, heritability and genetic advance in fenugreek (Trigonella foenum graecum L.) germplasms

Krishna Pal Singh, P.K. Jain, S.K. Sengupta, A.K. Mehta and Beena Nair Department of Horticulture Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract one of the many ingredients that make up curry powders (Srinivasan 2006).

The highest values of phenotypic and genotypic coefficients of variation were observed for number of secondary branches Material and methods plant-1 followed by number of pods axis-1, number of pods plant-1, seed yield plot-1, seed yield plant-1, number of primary branches plant-1, nodulation of 60 DAS, chlorophyll content at The present study was carried out carried out in Rabi 60 and 45 DAS, number of seeds pod-1 and vegetative yield. season during the year 2009-10 and 2010-11 at High estimates of heritability were obtained for characters viz. Vegetable Research Farm, Department of Horticulture, seed yield plot-1, plant height at maturity and 60 DAS, JNKVV, Jabalpur (MP). The experimental material chlorophyll content at 60 DAS, seed yield plant-1, chlorophyll consisted of 102 genotypes of fenugreek including content at 45 DAS, diameter of stem, seed size and days to standard varieties as checks having distinct diversity 75 per cent maturity whereas, high heritability coupled with in morphology and performance were sown in a high genetic advance was observed for the traits viz., seed Randomized Block Design with three replications. The yield plot-1, seed yield plant-1, chlorophyll content at 60 and 45 DAS. variance components and coefficients of variation were determined according to Burton (1952). The heritability (broad sense) was calculated using formula proposed Keywords: Phenotypic coefficient of variation, by Hanson et al. (1956) and expected genetic advance heritability, genetic advance was worked out by Johnson et al. (1955).

Fenugreek (Trigonella foenum graecum L.), wild or Results and Discussion cultivated, is widely distributed throughout the world. It is an important leafy vegetable cum seed spice with medicinal properties belonging to the sub family Estimation of components of genetic parameters of Papilionaceae of the family Fabaceae. In parts of Asia, variation for yield and its contributing characters the young plants are used as potherbs and the seeds exhibited a wide range of variation for the characters as a spice or as herbal medicine (Lust 1986, studied. Results of the present study indicated that the Petropoulos 2002). It also serves as a soil renovating values of phenotypic coefficient of variation were of crop. Being a legume crop, its root nodules containing higher magnitude than that of genotypic coefficient of bacteria 'Rhizobium' improves the soil fertility by fixing variation for all the characters showing that the atmospheric nitrogen. Fenugreek, perhaps, is best environment had an important role in influencing the known for presence of the distinctive, pungent aromatic characters. The phenotypic coefficient of variation compounds in the seed (Max 1992) that impart flavour, ranged from 2.21 % for days to 75 per cent maturity to -1 color and aroma to foods, making it a highly desirable 148.57% number of secondary branches plant . The supplement for use in culinary applications. Majority of phenotypic coefficient of variation was high for -1 the Indian population belongs to vegetarian class. In characters like number of secondary branches plant -1 such a situation, a leafy vegetable like methi is of utmost (148.57%) followed by number of pods axis (148.17%), number of pods plant-1 (44.09%), seed yield plot-1 importance due to its high nutritive value, medicinal (42.93%), seed yield plant-1 (42.50%), number of primary importance and industrial uses. As a spice, it constitutes branches plant-1 (42.32%), nodulation at 60 DAS

328 as %

) (%)mean of

2

82.80 6.32

89.00 6.69 91.20 4.16

62.20 15.66

72.30 16.94

(h

Heritability GA

Phe. Gen.

Coefficient of variations

Variance

5.71 5.09 0.63 3.65 3.44 6.73 6.14 0.59 2.21 2.12

Phe. Gen. Env.

14.23 12.77 1.46 16.64 15.76 89.70 30.76 51.50 51.24 0.26 13.26 13.22 99.50 27.17 91.53 91.13 0.41 11.64 11.62 99.60 23.88

3.86 0.13 0.09 0.04 11.37 9.67

Max.

14.65 1.82 1.13 0.69 12.22 9.64 22.16 11.10 7.33 3.77 21.81 17.72 66.10 29.67

439.50 6486.44 6462.09 24.35 42.93 42.85 99.60 88.11

Min.

5.33 42.50 72.72 45.44 27.28 44.09 34.85 62.50 56.75

12.43 35.67 19.40 13.00 6.40 18.57 15.20 67.00 25.64 18.41 56.58 64.08 62.62 1.46 22.01 21.76 97.70 44.31 11.36 60.00 72.32 71.73 0.59 22.76 22.67 99.20 46.51

3.90 2.73 5.10 0.33 0.30 0.02 14.69 14.15 92.70 28.07

3.16 2.31

3.80 2.83 5.48 0.20 0.19 0.01 11.74 11.48 95.60 23.13 1.15 0.83 1.76 0.04 0.02 0.03 17.97 11.58 41.50 15.37

3.99 1.50 8.50 2.85 2.04 0.81 42.32 35.81 71.60 62.43 0.71 0.00 6.66 1.10 0.64 0.46 148.57 113.11 58.00 177.40 0.58 0.00 4.00 0.75 0.36 0.39 148.17 102.22 47.60 145.27

2.93 1.06 6.60 1.55 1.53 0.02 42.50 42.19 98.60 86.29

1.46 0.85 2.44 0.09 0.08 0.01 20.28 19.11 88.80 37.10

11.04 8.95

15.28 7.33

19.34

11.30 7.62 18.00 3.48 2.87 0.61 16.49 14.98 82.40 28.01

16.74 8.16 27.66 25.79 13.80 11.99 30.35 22.20 53.50 33.45

13.65 12.49 14.96 0.26 0.21 0.04 3.71 3.37

187.60 71.50

Estimates of genetic parameters of variations for different characters in fenugreek

Plant height 30 DAS Plant height 45 DAS 22.67 15.05 29.75 Plant height 60 DAS 54.14 41.61 77.71 Plant height at maturity 82.16 60.57 109.00 Chlorophyll content 30 DAS 23.72 Chlorophyll content 45 DAS 36.37 Chlorophyll content 60 DAS 37.36 Leaf size (cm) Diameter of stem (mm) Petiole length (cm) Nodulation at 60 DAS

Table 1. Table No. of primary branches No. of secondary branches Characters G M Range No. of pods/axis No. of pods/plant Pod length (cm) No. of seeds/pod Test seed weight Test Days to 50% flowering 65.50 61.50 72.16 Days to 75% maturity 117.13 111.83 123.69 Seed yield/plant (g) Seed size (mm) Vegetative yield (kg) Seed yield/plot (g)

329 (30.35%) chlorophyll content at 60 (22.76%) and 45 Heritability was medium for plant height at 45 DAS DAS (22.01%), number of seeds pod-1 (21.81%) and (89.70%), days to 50 per cent flowering (89.00%), vegetative yield (20.28%). Chlorophyll content at 30 vegetative yield (88.80%), test weight (82.80%), plant DAS (18.57%), petiole length (17.97%), plant height at height at 30 DAS (82.40%), leaf size (72.30%) and 45 (16.64%) and 30 DAS (16.49%), seed size (14.69%), number of primary branches plant-1 (71.60%). These plant height at 60 DAS (13.26%), pod length (12.22), findings are in close agreement with the findings of diameter of stem (11.47%), plant height at maturity Sharma et al. (1990) for plant height and number of (11.64%) and leaf size (11.37%) showed moderate branches plant-1; Hariharan and Vijaya Kumar (1997) phenotypic coefficient of variation. The findings of Datta for days to 50 per cent flowering and plant height; Kumar et al. (2005); Hariharan and Vijaya Kumar (1997); Saha and Choudhary (2003) for plant height, number of and Kole (2001); Koli and Sri Karan (2002); Kaushik et branches plant-1 and days to flowering; Verma and Korla al. (2001) are similar to that of the present findings. (2003) for 1000 seed weight and number of branches plant-1; Banerjee and Kole (2004) for plant height, days In the present investigation the difference to flowering and 1000 seed weight; Kole and Mishra between the genotypic and phenotypic coefficient of (2006) for 100 seed weight. While, low estimates of variation was narrow, revealing low environmental heritability was noted for chlorophyll content at 30 DAS influence and expressing the true genetic potential in (67.00%), number of seeds pod-1 (66.10%), number of varied environments, which lead to limited scope for pods plant-1 (62.50%), pod length (62.20%), number of improvement. However, low estimates of PCV and GCV primary branches plant-1 (58.00%), nodulation at 60 DAS was noted for characters viz., days to 75 percent (53.50%), number of pods axis-1 (47.60%) and petiole maturity, days to 50 per cent flowering and 1000 seed length (41.50%). These findings are in agreement with weight. Low value of PCV and GCV indicates that these the findings of Sharma et al. (1990) for number of characters exhibit low genetic variability. The findings branches plant-1 and pod length; Hariharan and Vijaya are in close harmony with the findings of Kohli et al. Kumar (1997) for number of branches plant-1 and (1988) and Sharma et al. (1990) for 1000 seed weight; number of pods plant-1. Hariharan and Vijaya Kumar (1997) for days to maturity and Chandra et al. (2000) for days to flowering. The highest estimate of genetic advance as percentage of mean was recorded for number of High heritability accompanied with high genetic secondary branches plant-1 (177.40%) followed by advance indicates that the heritability is due to additive number of pods axis-1 (145.27%), seed yield plot-1 gene effect and selection may be effective, while high (88.11%), seed yield plant-1 (86.29%), number of primary heritability coupled with low genetic advance, indicates branches plant-1 (62.43%), number of pods plant-1 predominance of non additive gene action, however, (56.75%), chlorophyll content at 60 (46.51%) and 45 low heritability is exhibited due to influence of DAS (44.31%). The results were in consonance with environmental interaction rather than genotype. Raghuwanshi and Singh (1982), Pant et al. (1984), Selection for such characters may not be rewarding. Chandra et al. (2000), Dash and Kole (2001), Kumar Heritability ranged from 41.50 % for petiole length to and Choudhary (2002), Kumar and Choudhary (2003) 99.60 % for seed yield plot-1 and plant height at maturity. and Balai et al. (2006) for number of pods plant-1; The value of heritability (broad sense) was found to be Baswana et al. (1985) for seed yield plant-1 and number high for seed yield plot-1 (99.60%), plant height at of branches plant-1; Mehta et al. (1992) and Berwal et maturity (99.60%) and at 60 DAS (99.50%), chlorophyll al. (1996) for number of pods plant-1 and seed yield -1 content at 60 DAS (99.20%), seed yield plant-1 (98.60%), plant ; Singh (1995), Hariharan and Vijaya Kumar -1 chlorophyll content at 45 DAS (97.70%), diameter of (1997) for number of branches plant and number of -1 stem (95.60%), seed size (92.72%) and days to 75 per pods plant ; Koli and Sri Karan (2002) and -1 cent maturity (91.20%). These findings are in agreement Gangopadhyay et al. (2009) for seed yield plant . with the findings of Gangopadhyay et al. (2009) for seed The genetic advance as percentage of mean was -1 yield plant ; Singh (1995), Verma and Korla (2003) for moderate for vegetative yield (37.10%), nodulation at plant height; Raguwanshi and Singh (1982) for seed 60 DAS (33.45%), plant height at 45 DAS (30.76%), -1 yieldplant , plant height and days to maturity; Baswana number of seeds pod-1 (29.67%), seed size (28.07%), et al. (1985), Mehta et al. (1992) and Koli and Sri Karan plant height at 30 (28.01%) and 60 DAS (27.17%), (2002) for plant height and seed yield; Hariharan and chlorophyll content at 30 DAS (25.64%), plant height at Vijaya Kumar (1997) for seed yield plant-1 and days to maturity (23.88%) and stem diameter (23.13%). The maturity; Kumar and Choudhary (2002) for plant height findings corroborated the earlier reports of Raguwanshi and days to maturity. and Singh (1982) and Balai et al. (2006) for plant height;

330 Kole and Mishra (2006) for number of seeds pods-1. ifjiDork ds fy, fnuksa] tcfd mPp vkuqokaf'kdrk ;qfXer ls mPp Low estimates of genetic advance as percentage of mean were observed for leaf size (16.94%), pod length vkuqoaf'kd vfxze ds lkFk feydj ns[kk x;k dh y{k.k tSls cht mit (15.66%), petiole length (15.37%), days to 50 per cent izfr IykWV] cht mit izfr ikS/ks] DyksjksfQy lkexzh 60 vkSj 45 fnu flowering (6.69%), test weight (6.32%) and days to 75 ds ckn ds fy, izkIr fd;k x;k A per cent maturity (4.16%). The findings corroborated with the earlier reports of Hariharan and Vijaya Kumar (1997) for days to 50 per cent flowering and days to 75 References per cent maturity. Balai O P, Singh D, Jain U K (2006) Genetic variation, High heritability coupled with high genetic character association among yield and yield related advance was observed for the traits viz., seed yield traits in fenugreek. Indian J Agri Re 40 (2):35-39 plot-1, seed yield plant-1, chlorophyll content at 60 and Banerjee Ananya, Kole P C (2004) Analysis of genetic 45 DAS. Gangopadhyay et al. (2009) observed the divergence in fenugreek (Trigonella foenum-graecum preponderance of additive genes in inheritance of these L.). J Spices and Aromatic Crops 13 (1): 49-51 traits. It also indicated higher response for selection of Baswana K S, Pandita M L, Malik Y S (1985) Variability studies high yield and associated characters for predominance in fenugreek (Trigonella foenum graecum L.). of additive gene actions. These findings were in Haryana J Hort Sci 13(1&2) 78-81 agreement to the findings of Baswana et al. (1985), Berwal K K, Singh J V, Jhorar B S, Lodhi G P, Kishor C (1996). Mehta et al. (1992), Berwal et al. (1996), Koli and Sri Characters association studies in fenugreek. Annals Karan (2002) and Gangopadhyay et al. (2009) for seed Agric Bio Res 1(1-2): 93-99 yield plant-1. High heritability supplemented with Burton G W (1952) Quantitative inheritance in grasses. Proc. moderate genetic advance as percentage of mean were 6th Int Grassland Cong 1:227 - 283 manifested by seed size, plant height at 60 DAS and at Chandra Kailash, Divakara Sastry E V, Singh D (2000). maturity and stem diameter, which might be due to the Genetic variation and character association of seed action of additive gene controlling expression of these yield and its component characters in fenugreek. traits hence, stratified phenotypic selection for their Agric Sci Digest 20 (2):93-95 amenability can be brought about. The findings were in Dash S R, Kole P C (2001) Studies on variability, heritability agreement to Raghuwanshi and Singh (1982) and Balai and genetic advance in fenugreek. J Interacademicia et al. (2006) for plant height. However, low heritability 5 (1):7-10 coupled with low genetic advance as percentage of Datta S, Chatterjee R, Mukherjee S (2005) Variability, mean was observed for days to 75 per cent maturity, heritability and path analysis studies in fenugreek. Indian J Hort 62 (1): 96-98 which indicated that this character was highly influenced by environmental effects and consequently its selection Gangopadhyay K K, Yadav S K, Kumar Gunjeet, Meena B L Mahajan R K, Mishra S K, Sharma S K (2009) would be ineffective. The findings corroborated the Correlation, path-coefficient and genetic diversity earlier reports of Hariharan and Vijaya Kumar (1997) pattern in fenugreek (Trigonella foenum-graecum). for days to maturity. Indian J Agri Sci 521-526 Hanson C H, Robinson H F, Comstock R E (1956) Biometrical studies of yield in segregating populations of Korean, iz:ih vkSj thuksvkbi dh fofHkUurk dk mPpre xq.kkad eku ik;k fd Lespedize. Agronomy J 48: 268-272 n~forh;d 'kk[kvksa dh la[;k izfr ikS/ks ml ds ckn Qyh dh la[;k izfr Hariharan K, Vijaya Kumar M (1997) Studies on the genetic v{k] Qy dh la[;k izfr ikS/ks] cht mit izfr IykWV] cht mit izfr variability in fenugreek (Trigonella foenum graecum L.). South Indian Hort 45 (3-4): 143-147 ikS/ks] izkFkfed 'kk[kvksa dh la[;k izfr ikS/ks] ek/;fed 'kk[kkvksa dh Johnson H W H F, Robinson, R F Comstock (1955) Genotypic la[;k izfr ikS/ks] fxYVhnkj 60 fnuksa ds cqokbZ ds ckn] DyksjksfQy and phenotypic correlations in soybean and their lkexzh 60 vkSj 45 fnu ds ckn] cht la[;k izfr Qyh vkSj ouLifr implications in selection. Agron J 47:477 - 483 Kaushik S K (2001) Correlation and path analysis in M7-lines dh mit feyh x;h A of fenugreek (Trigonella foenum-graecum L.). Annals of Agri Bio Res 7 (2): 165-170 Kohli U K, Sharma O P, Singh Jeet (1988) Genetic variability, vkuqokaf'kdrk dh mPp vuqeku ik=ksa uker mit izfr IykWV] ikS/ks dh correlation and path analysis in fenugreek (Trigonella Å¡pkbZ ifjiDork ij vkSj cqokbZ ds ckn 60 fnu] DyksjksfQy lkexzh foenum graecum L.). Indian J Hort 45:119-125 60 fnu cqokbZ ds ckn] cht mit izfr IykWV] DyksjksfQy lkexzh 45 Kole P C, Mishra A K (2006) Pattern of variability and associations among quantitative characters in fnu ds ckn] rus dk O;kl] cht ds vkdkj vkSj 75 izfr'kr fenugreek. Indian Agriculturist 50(3/4): 93-96

331 Koli N R, Sri Karan (2002) Estimation of genetic parameters fenugreek (Trigonella foenum graecum L.). Indian J in M2 generation of fenugreek (Trigonella foenum of Horti 29 (1-2): 134-138 graecum L.). Annals Biology 18 (2) pp 211-212 Saha A, Kole P C (2001) Genetic variability in fenugreek Kumar Mukesh, Choudhary B M (2002) Correlation and (Trigonella foenum graecum L.) grown in sub-humid Heritability studies of different characters in lateritic belt of West Bengal. Madras Agricul J 88 (4- fenugreek. Orissa J Horticulture 30 (2): 57-59 6): 348-350 Kumar Mukesh, Choudhary B M (2003) Studies on genetic Sharma K C, Sharma M M, Sharma R K (1990) Nature of variability in fenugreek (Trigonella foenum graecum variability and associations in fenugreek. Indian J L.). Orissa J Horticulture 31 (1):37-39 Genet 50 (3):260-262 Lust J B (1986) The Herb Book, Bantam Books Inc, New York Singh Mohinder (1995) Studies on genetic analysis for seed Max B (1992) This and that - the essential pharmacology of yield, fodder yield and their component characters herbs and spices. Trends in Pharmacological Sci in fenugreek. Food Technol 9 (1):67-71 13:15-20 Srinivasan K (2006) Fenugreek (Trigonella foenum-graecum): Mehta K G, Patel R H, Kachadia B T (1992) Genetic variability A review of health beneficial physiological effects. and path analysis in fenugreek. Indian Cocoa Food Reviews International 22:203-224 Arecanut and Spices J 15 (4): 114-117 Verma Rakesh, Korla B N (2003) Genetic variability in Pant K C, Chandel K P S, Pant D C (1984) Variability and fenugreek (Trigonella foenum graecum L.) grown path coefficient analysis in fenugreek. Indian J Agric under mid-hills of Himachal Pradesh. J Spices and Sci 54:655-658 Aromatic Crops 12 (1): 60-62 Petropoulos, GA (2002) Fenugreek, The genus Trigonella. Taylor and Francis, London and New York pp 255 (Manuscript Receivd : 11.01.2012; Accepted 15.05.2012) Raghuwanshi SS, Singh RR (1982) Genetic variability in

332 JNKVV Res J 46(3): 333-337 (2012)

Genetic variability, heritability and genetic advance in okra

D.P. Sharma, Meenakshi Dwivedi, Rajani Bisen and B.P. Bisen Krishi Vigyan Kendra Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract improvement through selection, therefore, study of genetic advance coupled with heritability are more useful in predicting the resultant effect of selection. Genetic In the present investigation an attempt has been made to evaluate the genetic variability of some yield contributing advance gives an idea about additive nature of gene action. characters of okra during Kharif 2011-12. Significant Nwangburuka et al. (2012) revealed that the high genotypic estimates of genetic variability for fruit yield and its coefficient of variability, % broad-sense heritability and components were observed for all the characters studied. genetic advance present in traits such as plant height, High values of GCV and PCV were observed for number of fresh pod length, fresh pod width, mature pod length, branches per plant at 60 DAS followed by number of branches branching per plant and pod weight per plant, suggesting per plant at 90 DAS and number of branches per plant at 30 DAS. Very High heritability was recorded for yield per plant, the effect of additive genes and reliability of selection plant height at 30 DAS, 60 DAS and 90 DAS, respectively. based on phenotype of these traits for crop improvement. However, it was recorded high for number of seeds per fruit and number of flowering nodes on main stem reflecting that the phenotypes were the representative of their genotypes Materials and methods and selection based on phenotypic performance would be reliable. Genetic advance (% of mean) were observed high The experiment was conducted at Vegetable Research for plant height at 30 DAS followed by number of seeds per fruit, branches per plant at 60 DAS, number of branches per Farm, Department of Horticulture, Jawaharlal Nehru Krishi plant at 90 DAS and plant height at 60 DAS. High heritability Vishwa Vidyalaya, Jabalpur (M.P.) in Kharif season during coupled with high genetic advance was recorded for plant the year 2011-12. The experiment was laid out in height at 30 DAS and 60 DAS, and number of seeds per fruit Randomized Complete Block Design (RCBD) in three suggesting the preponderance of additive genes. Thus, replications with. The experimental material for this study selection of these traits can be made for further improvement comprised of 20 genotypes with four checks HOK-152(C), in okra. Arka Anamika, Pusa sawani and SOH 152-RC(C) collected from different research institutes. One cross cultivation Keywords: Okra, genetic variability, heritability, genetic followed by two harrowing and one planking before sowing advance of seed was done to maintain good soil tilth. The irrigation was given to be as and when required. A basal dose of 120 kg N, 60 kg P O and 60 kg K O/ha along with 20 Okra [Abelmoschus esculentus (L.) Moench] is a 2 5 2 polyploid, an often cross pollinated crop belonging to the tonnes FYM/ha was applied. 1/3rd nitrogen and entire family Malvaceae. The productivity estimates of okra quantity of P and K was applied prior to sowing. Remaining indicate a declining trend. Hence, developing high yielding dose of nitrogen was applied in two splits at 30 and 60 varieties bestowed with fruits of high quantity as well as days after sowing. Five representative plants in each plot quality is of utmost importance. The genetic parameters were selected randomly and tagged for recording data for like heritability and genetic advance provide a clear insight various plant characters. The data based on the mean of into the extent of variability and a relative measure of individual plants selected for observation were statistically efficiency of selection of genotypes based on phenotype. analyzed to find out overall total variability, heritability and Heritability alone does not give true picture of genetic genetic advance present in the material under study for each character and for all the populations.

333 Result and Discussion proximation to that of Vijay and Manohar (1990) for plant height, Sood et al. (1995) for plant height and number of flowering nodes on main stem, Paiva et al. (1998) for plant Significant estimates of genetic variability for fruit yield and its components were observed for all the characters height, Bali et al. (2004) for number of seeds per fruit and studied. In general, the values of phenotypic coefficient yield per plant, Patro and Ravisankar (2004) for yield per of variation were of higher magnitude than that of plant, Verma et al. (2004) for number of seeds per fruit, genotypic coefficient of variation for all the characters Indurani and Veerargavathatham (2005) for plant height showing that the environment had an important role in and yield per plant, Singh and Singh (2006) for yield per influencing the expression of the characters. These plant, Singh et al. (2006) for number of seeds per fruit, findings are in agreement with the findings of Bendale et Sunil et al. (2007) for plant height, number of flowering al. (2003) and Singh et al. (2007). nodes on main stem and yield per plant, Pal et al. (2010), Ramanjinappa et al. (2011) for plant height and yield per Highest phenotypic coefficient of variation was plant. Higher values of heritability (broad sense) of these observed for number of branches per plant at 60 DAS characters expressed that they were least influenced by followed by number of branches per plant at 90 DAS, environmental modification. It reflected that the number of branches per plant at 30 DAS and plant height phenotypes were the representative of their genotypes at 30 DAS. Lowest phenotypic coefficient of variation was and selection based on phenotypic performance would observed for days to 50% flowering followed by days to be reliable. first picking, fruiting span, length of fruits and number of nodes to first flower. High value of genotypic coefficient of Days to 50% flowering, days to first picking, variation (GCV) suggested greater phenotypic and diameter of fruit, fruiting spans and length of internodes genotypic variability among the genotypes and exhibited moderate heritability which indicated that responsiveness of the attributes for making further selection based on phenotypic performance would be improvement by selection. However, low estimates of rewarding. phenotypic (PCV) and genotypic coefficient of variation GCV were noted for number of nodes to first flower which A low estimate of heritability was recorded for indicate that there is limited scope for improvement (Table length of fruits, number of branches per plant at 90 DAS, 1). number of branches per plant at 60 DAS, number of fruits per plant, weight of fruits, number of leaves per plant, Similar results have been reported by Vijay and number of branches per plant at 30 DAS and number of Manohar (1990) for number of branches per plant, Deo et nodes to first flower. This is indicative of the fact that al. (1996) for plant height and number of branches, Dhall characters are rather more influenced by the environment et al. (2003), Bali et al. (2004), Singh and Singh (2006), and may not respond much to selection. The findings are Singh et al. (2006) and Narayan et al. (2006) reported in agreement with findings of Sunil et al. (2007) for length high PCV for plant height and number of branches per of fruits. plant and low PCV for days taken to 50% flowering and Singh et al. (2007) for plant height. Heritability however indicates only the effectiveness with which selection of genotype can be based on phenotypic performance, but fail to indicate the genetic Heritability progress. Heritability estimates along with genetic gains are more effective and reliable in predicting the Heritability which denotes the proportion of genetically improvement through selection (Johnson et al. 1955). controlled variability is very important biometrical tool for Estimates of genetic advance predict the extent of guiding plant breeder for adoption of appropriate breeding improvement that can be achieved for improving the procedures. It was partitioned as very high (> 90%), high different characters. (70-90%) medium (50-70%) and low (<50%). Heritability ranged from 19.92% for number of nodes to first flower to Genetic advance 97.52% for yield per plant.

Result indicated that the heritability (broad sense) In the present study, the characters namely plant height was found to be very high for yield per plant, plant height at 30 DAS followed by number of seeds per fruit, branches at 30 DAS, 60 DAS and 90 DAS. However, it was recorded per plant at 60 DAS, number of branches per plant at 90 to be high for number of seeds per fruit and number of DAS and plant height at 60 DAS recorded higher value of flowering nodes on main stem. The results were in close

334 mean

advance of

(b.s. %)

Heritability Genetic GA as %

(GCV)

(PCV)

Coefficient of variation

Phenotypic Genotypic

Max.

Range

Min.

0.57 0.40 0.87 36.48 17.52 23.07 0.09 17.33 1.56 0.86 2.60 44.58 25.78 33.40 0.47 30.71

2.92 1.87 4.40 38.89 23.913 37.81 0.88 30.29

4.68 4.60 5.26 5.82 2.598 19.92 0.11 2.38

1.65 1.548 1.74 4.56 3.50 58.98 0.091 5.54

mean

32.14 28.47 38.26 9.99 5.285 27.98 1.85 5.75

18.68 17.13 21.86 7.11 6.016 71.57 1.95 10.48

14.37 11.67 17.30 14.001 10.06 51.70 2.14 14.91

46.03 44.67 48.00 2.39 1.99 69.28 1.57 3.42

52.40 50.33 55.00 3.48 2.73 61.60 2.31 4.41 45.63 43.00 47.67 3.99 3.06 58.71 2.204 4.83

16.42 15.45 17.78 5.54 3.58 41.84 0.78 4.77

15.39 12.09 17.88 13.48 7.58 31.66 1.35 8.79 63.95 54.86 74.26 10.33 3.39 82.68 11.25 47.59

23.03 19.40 26.60 9.94 5.70 32.85 1.55 6.73

39.860 19.13 62.46 35.35 34.89 97.43 28.28 70.95

259.54 232.67 303.00 7.58 7.49 97.52 39.55 15.23

General

117.376 91.60 148.67 13.72 13.50 96.77 32.11 27.35

159.725 144.33 187.00 7.47 7.29 95.35 23.44 14.67

Table 1. Estimates of genetic parameters for variations of nineteen characters in okra Table

Characters

Plant height at 30 DAS (cm)

Plant height at 60 DAS (cm)

Plant height at 90 DAS (cm)

No. of branches per plant at 30 DAS No. of branches per plant at 60 DAS

No. of branches per plant at 90 DAS

No. of leaves per plant

No. of nodes to first flower Flowering nodes on main stem

Length of internodes (cm)

Days to 50% flowering (days)

Days to first picking (days) Fruiting span(days)

Length of fruits(cm)

Diameter of fruits(cm)

Weight of fruits(g) No. of seeds per fruit

No. of fruits per plant

Yield per plant (Kg/ha)

335 genetic advance as percentage of mean. These findings References were similar to those reported by Panda and Singh (1997), Indurani and Veerargavathatham (2005), Pal et al. (2010) Akotkar PK, De D K, Pal A K (2010) Genetic variability and and Ramanjinappa et al. (2011) for plant height, Chandra diversity in okra (Abelmoschus esculentus L. et al. (1996) and Verma et al. (2004) for plant height and Moench). Electronic Journal Plant Breeding number of seed per fruit, Bali et al. (2004) for number of 1(4):393-398 seed per fruit. While, moderate value was observed for Bali SS, Raj Narayan, Ahmed N (2004) Genetic variability in number of branches per plant at 30 DAS followed by yield okra. Udyanika (Journal Horticultural Sciences) 10 per plant, length of internodes, plant height at 90 DAS (4): 33-35 and number of flowering nodes on main stem. These Bendale VW, Kadam SR, Bhave SG, Mehta J L, Pethe UB findings were similar with findings of Singh et al. (2007), (2003) Genetic variability and correlation studies in Sunil et al. (2007) for number of flowering nodes on main okra. Orissa J Horti 31(2):1-4 stem, length of internode and yield per plant. However, Chandra Deo, Singh K P, Panda PK, Deo C (1996) Genetic variability correlation and path analysis in okra. the estimates were low for weight of fruits, number of Environment and Ecology 14 (2): 315- 319 fruits per plant, number of leaves per plant, diameter of Dhall RK, Arora SK, Mamta Rani (2001) Study on variability, fruits, fruiting spans, length of fruits, days to first picking, heritability and genetic advance of generations in days to 50% flowering and number of nodes to first flower. okra (Abelmoschus esculentus (L.) Moench). The findings were similar to as reported by Vijay and Haryana J Horti Sci 30 (1-2) : 76 - 78 Manohar (1990) for length of fruit and diameter of fruit and Indurani C and D Veeraragavathatham (2005) Genetic Sunil et al. (2007) for plant height and length of fruit. variability, heritability and genetic advance in okra. Indian J Horti 62 (3): 303 - 305 High heritability coupled with high genetic advance Jeyapandi A and Balakrishnan R (1990) Correlation analysis for plant height at 30 DAS, plant height at 60 DAS and in bhindi. South Indian Horti 38 (2): 83 - 85 number of seeds per fruit suggested the preponderance Narayan Jaiprakash, Mulge R, Kotikal YK, Patil MP, of additive genes. It also indicated higher response for Madalageri MB and Patil BR (2006) Studies on selection of high yielding genotypes as these characters genetic variability for growth and earliness character are governed by additive gene actions. This result was in in okra. Crop Res Hisar 32 (3) : 411 - 413 close proximation to that of Jeypandi and Balakrishnan Nwangburuka C C, Denton O A, Kehinde O B, Ojo D K, (1992), Chandra et al. (1996), Panda and Singh (1997), Popoola AR (2012) Genetic variability and heritability Bali et al. (2004), Verma et al. (2004), Akotkar et al. (2010) in cultivated okra [Abelmoschus esculentus (L.) and Nwangburuka et al. (2012). Moench]. Spanish J Agri Res 10 (1): 123-129 Pal MK, Singh B, Rajendra Kumar, Singh SK (2010) Genetic High heritability supplemented with moderate variability, heritability and genetic advance in okra genetic advances as percentage of mean were manifested [Abelmoschus esculentus (L.) Moench]. CAB by yield per plant, plant height at 90 DAS and flowering Abstracts Environment and Ecology 28(1A): 469- nodes on main stem which might be due to the action of 471 additive gene controlling expression of traits hence, Panda PK, Singh KP (1997) Heterosis and interbreeding depression for yield and pod characters in okra stratified phenotypic selection for their amenability can [Abelmoschus esculentus (L.) Moench]. Journal be brought about. The findings were in agreement to the Maharashtra Agri Univ 23 (3): 149-151 findings of Sunil et al. (2007) for by yield per plant and Paiva WO, DE-costa, C P Da (1998) Genetic parameters in flowering nodes on main stem. okra. Pesquisa Agropecuaria Brasiterira 33 (5): 705- 712 Low estimates of heritability coupled with low genetic advances as percentage of mean were displayed Patro TS, Ravishankar C (2004) Genetic variability and multivariate analysis in okra [Abelmoschus by length of fruits followed by number of fruits per plant, esculentus (L.) Moench]. Tropical Agric Res 16: 99- weight of fruit, number of leaves per plant and no of nodes 113 to first flower indicating that these characters were highly Ramanjinappa V, Patil MG, Hugar P N A, Arunkumar K H influenced by environmental effects and consequently (2011) Variability, Correlation and Path Coefficient selection for these traits may not be rewarding. The Analysis in Okra (Abelmoschus esculentus L. findings were similar to as reported by Sunil et al. (2007) Moench). Environment and Ecology 29 (2A): 778- for length of fruits. 782

336 Singh AK, Ahmed N, Rajnarayan, Chatoo MA (2007) Genetic Sunil Kumar, Yadav JR, Gaurav Mishra, Sanjeev Kumar, Variability, correlations and path analysis in okra Singh B (2007) Estimation of heritability and genetic under Kashmir conditions. Indian J Horti 64 (4) : advance in okra. Plant Archives 7 (2): 923 - 924 472 - 474 Verma BK, Srivastava RK, Sharma BR, Amar Chandra (2004) Singh B, Pal AK, Sanjay Singh (2006) Genetic variability and Variability studies of yield components in okra. First correlation analysis in okra. Indian J Horti 63 (3) : Indian Horticulture Congress Horticultural Society 281 -285 of India New Delhi, 6-9 Nov 2004, pp 84-85 Singh SP, Singh JP (2006) Variability, heritability and scope Vijay O P, Manohar S C (1990) Studies on genetic variability, of improvement for yield components in okra. correlation and path analysis in okra. Indian J Horti International J Plant Science Mujaffarnagar 1 47 (1) : 97 - 103 (2):154-155 Sood S, Arya PS, Singh Y (1995) Genetic variability and correlation studies in okra. Advance Horti and (Manuscript Receivd: 25.09.2012; Accepted: 27.12.2012) Forestry 4: 109-118

337 JNKVV Res J 46(3): 338-342 (2012)

Biochemical and proximate studies of growth promoters on Aswagandha

K.C. Meena, A.L. Birla, A.S. Gontia, U.S. Mishra, Anubha Upadhyay and S.Rao Department of Plant Physiology Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract this investigation has been made to justify the role of Growth Promoters in relation to proximate and biochemical constituents of Aswagandha. The present investigations entitled "Biochemical and Proximate studies of Growth- Promoters on Aswagandha (Withania somnifera L.Dunal)" were conducted under Material and methods Department of Crop and Herbal Physiology J.N.K.V.V., Jabalpur (M.P.) during rabi season of 2007-08. The growth promoters methanol, salicylic acid, ascorbic acid, and humic This experiment was conducted in a randomized block acid were sprayed as foliar. Salicylic acid has increased design (RBD) with four replications and five treatments Chlorophyll -a, Chlorophyll - b, root length, crude fiber, i.e. foliar application of Methanol @ (30g/litre), Salicylic carbohydrate, ash, dry root yield, phosphorus, and seed yield. acid@ (14 mg/liter), Ascorbic acid @ (200 mg/liter), and Ascorbic acid has increased the carotene, fat and potassium Humic acid @ (100 mg /lit.) and without growth content. The protein, nitrogen and moisture percentage were regulators. The seeds of Aswagandha (Jawaharlal found to be increased due to the spray of methanol. Humic Ashwagandha-20) were sown @ 8 kg/ha by hand acid and ascorbic acid have increased the Withanolide A and Withaferin A in leaves. Methanol and humic Acid have dibbling at a depth of 5 cm in open furrows. Thinning increased the Withaferin A and Withanolide A in Roots. was carried out manually after germination to maintain the uniform plant population. First and second hand weddings were done manually 20 and 40 days after Key words: Methanol, Salicylic acid, Ascorbic acid, and germination to minimize crop weed competition for light, Humic acid Withaferin A and Withanolide A, Withania space, moisture and nutrients. Five plants were somnifera. randomly selected from each treatment for determining various proximate and biochemical constituent's. One Aswagandha (Withania sominifera L. Dunal) is an sq. meter area was exclusively protected for obtaining important cultivated medicinal crop of Madhya Pradesh the root yield at maturity. Analysis of different variables which belongs to the family solanaceae. Aswagandha was carried out to know the degree of variation among is a small or middle sized, erect shrub growing up to all the treatments. The pooled data was statistically 1.5 meter high. Its stem and branches are covered with analyzed through randomized block design. minute star shaped hairs. It has egg-shaped hairy leaves up to 10 cm long. Small pale green flowers in cluster, Results and Discussion fruits are smooth spherical red or orange enclosed in light green calyx. The seeds are yellow in color and are of rain form shape. Phytohormones are very much Impact of growth -promoters on biochemical and involved in directing the plant growth, in a coordinated proximate parameters viz; Chlorophyll - a and fashion in association with metabolism that provides Chlorophyll- b showed the significant differences over energy and the building blocks to develop the form that control. The maximum Chlorophyll a and b was found we recognize as plant. Out of the recognized hormones, on spray of salicylic acid (1.14,0.0388) followed by attention has largely been focused on Salicylic Acid, ascorbic acid (1.02,0.382) (Fig-1,2). (Mahgoob et al. Methanol, Ascorbic acid and Humic acid that could be 2002) found that applications of salicylic acid increase raised to the status of the phytohormones. An effort, in the chlorophyll concentration. (Ombase et al. 2003) also

338 Fig- 4 Root Lenght 10.0 8.0 6.0

cm 4.0 2.0 0.0 MeOH Control Sal. A cid A sc. A cid Humic Acid Humic Growth Prpmoters

Fig Influence of growth promoters on biochemical constitutes in Ashwagandha

339

Fig-15 Seed Yield Fig-14 Root yield

2.5 2.5

. 2.0 2.0 1.5 1.5 1.0 1.0 q perq ha 0.5 Qha. per 0.5 0.0 0.0 Acid Hum. Acid MeOH Hum. MeOH Control Control Sal.Acid Asc.Acid Sal.Acid Asc.Acid Growth Promoters Growth Promoters

340 reported the same pattern of findings in groundnut crop. The maximum seed yield was recorded on spray Ascorbic acid (0.281) has increased the carotene of Salicylic acid (12.44) followed by Ascorbic acid content followed by salicylic acid (0.279) (Fig-3). (12.81) Fig-15. (Fariduddin et al. 2003) found pods and (Kalarani et al. 2002) and (Moharekar et al. 2003), the seed yield increased due to spray of SA in mustard reported the same findings. and (Kachroo 1999) also reported the same findings. The maximum root length was found on use of Withaferin A in roots was quantified through salicylic acid (9.32) followed by ascorbic acid (8.15), HPTLC method and it was found that Methanol respectively (Fig-4). The maximum development of root (0.00287) and Humic acid (0.00231) have increased in length was recorded between 75 and 90 DAS. Withaferin A in Root over non spray of any Growth (Vasudevan et al. 1997) and David et al. (1994), Promoters. Humic acid (0.0211) and Ascorbic acid reported such effects. (0.0205) have increased Withafein A in leaf over control. The results are depicted in Table 1. Withanolide A in The maximum carbohydrate was recorded due leaf was quantified with same method and it was found to spray of salicylic acid (12.93) followed by ascorbic that Ascorbic acid (0.0242) and Humic acid (0.0236) acid (Fig-5). (Kalarani et al. 2002) and (Tarraf et al. 1999) have increased over non spray of any growth promoters. reported the same trend. The maximum Crude Fiber Maximum Withanoloid A in root was found on spray of reveled was found due to spray of Salicylic acid (21.37) Humic acid (0.00782) followed by Methanol (0.00514) followed by Ascorbic acid (20.87) (Fig-6). (Tarraf et al. and Salicylic acid (0.00429) Table 2. 1999) supports the findings. All the growth promoters have significantly influenced the Protein content over control. The maximum protein content was found due Table 1. Influence of growth promoters on Withaferine to spray of Methanol (12.61) followed by Ascorbic acid A in leaf and root of Ashwagandha (12.25) (Fig-7). Growth promoters have influenced the Treatment Withaferine A in (%) fat content over control. The maximum Fat was Leaf Root quantified due to spray of Ascorbic acid (2.33) followed Methanol 0.0146 0.00287 by Salicylic acid (1.99) (Fig-8). The data for Nitrogen Salicylic Acid 0.0100 0.00205 content (%) showed that there are no statistically differences in the treatments. However, Methanol (2.01) Ascorbic Acid 0.0205 0.00221 followed by Ascorbic acid (1.98) have increased the Humic Acid 0.0211 0.00231 Nitrogen numerically (Fig-9). All the growth promoters Control 0.0190 0.00200 have influenced the Moisture content (Fig-10) supports the findings. The maximum Ash was found due to spray Table 2. Influence of growth promoters on Withanolide of Salicylic acid (5.22) followed by Ascorbic acid (4.85) A in leaf and root of Ashwagandha (Fig-11). (Tarraf et al. 1999) reported the same trend. All the growth promoters had significantly influenced Treatment Withanolide A in (%) the Phosphorus over control (Fig-12). The maximum Leaf Root Phosphorus was found due to spray of Salicylic acid Methanol 0.0177 0.00514 (0561) followed by Ascorbic acid (0.535) (David et al. Salicylic Acid 0.0129 0.00429 1994). No one growth promoters could significantly influence the Potassium over control. However, the Ascorbic Acid 0.0242 0.00411 maximum Potassium content was found due to spray of Humic Acid 0.0236 0.00782 Ascorbic acid (1.02) followed by Salicylic acid (0961) Control 0.0153 0.00391 (Fig-13). (David et al. 1994), the addition of 1280 mg ha./liter significant increases accumulation of Potassium and Phosphorus in shoots. —f"k egkfo|ky;] tcyiqj ds ikni dk;Zdh; foHkkx ds vUrxZr o"kZ All the growth promoters had significant influence 2007&08 ds jch lhtu esa v'oxa/kk Qly ij ikni o`f) izorZd on the root yield, maximum dry root yield (Fig-14) was found due to spray of Salicylic acid (2.35) followed by dks tSo jklk;fud vkSj fudVre dk v/;;u fd;k x;kA ikni o`f) Ascorbic acid (2.16) per hectare. (David et al. 1994) izoRkZd ds vUrxZr esFkuky] lsfylfyd] ,Ldksjfod ,oa g;wfed vEy found that an addition of 1280 mg ha/liter significantly dk i.khZ; fNMdko fd;k x;kA lsfylfyd vEy ds fNMdko ls increased fresh and dry weight of roots. (Tattini et al. 1991) and (Padem et al. 1999) also reported the same DyksjksfQy ,] DyksjksfQy ch] tM dh yEckbZ] dPpk js'kk] 'kdZjk] pattern. jk[k] 'kq"d tM dh mit] QkLQksjl dh ek=k vkSj cht dh mit c<+h

341 gSA ,Ldksjfod vEy ls dsjksVhu] olk] vkSj iksVk'k dh ek=k esa o`f) Ombase AR, Adsule RN, Amrutsagar VM (2003) Influence of foliar spray of methanol on growth, nutrient uptake gqbZA esFksuky ds fNMdko ls izksVhu] ukbVªkstu vkSj ueh izfr'kr vf/ and yield of summer groundnut. J Maharashtra Agri kdre ik;k x;kA g;qfed vEy vkSj ,Ldksjfod vEy ls iRrh esa Univ 28(3): 262-265 ohnkfQfju , vkSj ohnsuksykbM , dh ek=k c<+h gSA esFkuky vkSj Padem H, Ocal A, Alan R, Tuzel Y, Burrage SW, Bailey BJ, Gul A, Smith AR, Tuncay O (1999) Effect of humic g;qfed vEy tM+ esa ohnkQsfju , vkSj ohnsuksykbM , dh ek=k dks acid added to foliar fertilizer on quality and nutrient c<+krk gSA content of eggplant and pepper seedlings Proceedings of the international symposium on greenhouse management for better yield and quality References in mild winter climates, Antalya, Turkey, 3-5 November, 1997. Acta Horticulturae 491:241-246. Tarraf SA, EI Din KMG, Balbaa LK (1999) The response of David PP, Nelson PV, Sanders DC (1994) A humic acid vegetative growth, essential oil of lemongrass improves growth of tomato seedling in solution (Cymbopogon citratus Hort.) to foliar application of culture. J Plant Nutrition 17(1): 173184 ascorbic acid nicotinamide and some micronutrients. Dileep Kachroo (1999) Effect of humic acid on cotton (G. Arab Universities. J Agri Sci 7(1): 247-259 hirsutum L.). Annal Agri Res 20:(3) 372-373 Tattini M, Bertoni P, Laudi A,Traversi ML (1991) Effect of humic Kalarani MK, Thangaraj M, Sivakumar R, Mallika V (2002) acids on growth and biomass partitioning of Effects of salicylic acid on tomato (Lycopersicon container-grown olive plants. Acta-Horticulturae esculentum Mill.) productivity. Crop Res Hisar 23:(3) (294): 75-80 486-492 Vasudevan SN, Virupakshappa K, Venugopal N, Bhaskar S Mahgoob AEA, Zaghlool SAM (2002) Effect of salicylic and (1997) Response of sunflower (Helianthus annuus) jasmonic acids on the response of tomato plants to to phosphorus, sulphur, micronutrients and humic root knot nematode Meloidogyne incognita, infection. acid under irrigated conditions on red sandy-loam Annal Agri Sci Cairo 47(3): 1107-1119 soil. Indian J Agri Sci 67(3): 110-112. Moharekar ST, Lokhande SO, Hara T, Tanaka R, Tanaka A, Chavan PO (2003) Effect of salicylic acid on chlorophyll and carotenoid contents of wheat and (Manuscript Receivd : 17.07.2012; Accepted 20.09.2012) moong seedlings. Photosynthetica 41 (2): 315-317

342 JNKVV Res J 46(3): 343-345 (2012)

Influence of growth promoting substances and PGRs on fruit retention, drop and yield of acid lime var. Kagzi (Citrus aurantifolia Swingle) under Kymore plateau of Madhya Pradesh, India

Neha Patel and S.K. Pandey College of Agriculture, Department of Horticulture Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract regulators are known to control fruit drop by balancing the internal status of auxin responsible for inhibiting the formation of abscission layer in citrus fruits and improve Investigations indicate that foliar application of urea (1,2,3 the productivity as well as quality of acid lime (Jain percent), NAA (10,20,30 ppm), GA3 (25,50,100 ppm) and 2,4- D (10,15,20 ppm) sprayed at full bloom and pea stage of fruit, 2010). significantly increased the fruit retention at various stages of With increasing emphasis on increased fruit growth and development over unsprayed. Maximum production along with improved fruit quality compatible (62.59) fruit retention was noted with the application of NAA 20 ppm at harvest followed by urea 2 percent (52.10). Among at international levels and subsequently keeping eye various treatments, minimum fruit drop was noted with 20 on global market for export in coming years. It is ppm NAA followed by Urea 2 percent in all three waves of necessary to control fruit drop which is major constraint fruit drop. Highest (33Kg) fruit yield per tree was recorded associated with citrus production in India. An with the application of 20 ppm NAA which was found to be investigation was, therefore, made . significantly superior over control and all the other treatments, followed by urea 2 percent (29.22Kg). Material and methods

Keywords: Acid lime, foliar application, fruit retention, fruit drop. The experiment was carried out at the experimental orchard of Fruit Research Station, Imaliya, Department of Horticulture, Jawaharlal Nehru Krishi Vishwa Acid lime (Citrus aurantifolia Swingle) is the third Vidyalaya, Jabalpur during 2010-11. Fourteen years old important citrus fruit crop in India next to mandarins trees of Kagzi lime were selected for the study. Since and sweet oranges. It is grown under both tropical and the trees varied in blossom density, group of trees with subtropical climatic condition. It is a good source of vit- same average blossom density were selected for each C and also contain vit- B, pectin, organic acids, minerals treatment. All the trees were subjected to identical and other nutritive substances, required for human standard cultural practices. Treatments were, T - water health. 1 spray (control), T2- Urea (1%), T3- Urea (2%), T4- Urea (3%), T - NAA (10ppm), T - NAA (20ppm), T - NAA Fruit drop is a very common in the citrus family. 5 6 7 (30ppm), T - GA (25ppm), T - GA (50ppm), T - GA It starts with the flowering and continuous till the time 8 3 9 3 10 3 (100ppm), T - 2,4-D (10ppm), T - 2,4-D (15ppm) and of harvest. It is one of the most serious problems in 11 12 T - 2,4-D (20ppm). Aqueous solution of the chemicals citrus becoming limiting factor for increasing fruit 13 production. Drop of fruits is said to be influenced by an were sprayed at full bloom and again repeated at pea abscission mechanism, which is controlled by a larger size stage of citrus fruits. Spraying was done on the number of cells in the pedicel of the fruits. The formation tree canopy as foliar feeding by the foot sprayer. The and development of this layers of cells is held under experiment was laid out in Randomized Block Design check by a series of physiological processes. Growth with three replications, one plant was taken for each

343 treatment in each replication. Twelve tags were tied on rises rapidly which is helpful in mobilization of food the shoots of the tree; tags were tagged soon after fruit material (Chacko et al. 1972). At this stage the set. Six shoots were selected randomly for observations. competition among developing fruits starts and the fruits Total number of fruit on the tagged shoots were counted which complete less successfully are forced to drop. soon after the fruit set and regularly at monthly intervals Foliar application of NAA at this stage proved beneficial to determine initial fruit set and number of fruits retained with to encourage fruit retention. Plant regulators seem after 30, 60, 90, 120 and 150 days of fruit set. The fruit to have many fold function e.g. increasing the number retention and fruit drop was calculated on the basis of of flowers, provision of growth factors for the ovary initial number of fruits and number of fruit retained after development and inhibiting the shedding of flowers 30, 60, 90, 120, and 150 days of fruit set. which are finally responsible for fruit retention. Urea increases the auxin synthesis and reduces the formation of abscission layer which helps in strong attachment of Results and Discussion fruit with the stalk.

Fruit retention Fruit drop

Application of NAA at 20 ppm concentration showed All the growth promoting substances significantly significantly higher fruit retention at all the stages as decreased the percentage of fruit drop in all the three compared to the rest of the treatments and over control, stages i.e. pin-head size, pea size and pre harvest fruit followed by Urea 2% (Table 1) . It was also noted by drop. Minimum fruit drop was noted with 20 ppm NAA Yadav et al. (2004) in ber and Singh et al. (2007) in followed by Urea 2 percent in all the three stages of Aonla. fruit drop and maximum drop in control. Beneficial effect Auxin content in fruits during 2-3 weeks after of NAA application in reducing fruit drop may be pollination is low and the ability of fruits to mobilize food explained from the fact that it maintain the on going material is poor due to low auxin level that results to physiological and bio-chemical process of inhibition of drop of fruits. As the fruit develops the amount of auxin abscission (Tomaszewska and Tomaszewaska 1970).

Table 1. Influence of growth promoting substances and PGRS on fruit retention percentage at various stages Fruit retention percentage after fruit set (at 30 days interval) Treatment 30 60 90 120 150 Control 68.26 55.31 34.58 22.65 18.15 Urea (1%) 90.25 74.13 59.52 51.55 42.43 Urea (2%) 91.09 85.03 67.25 59.26 52.10 Urea (3%) 87.47 70.47 48.13 32.64 28.35 NAA (10 ppm) 88.15 74.11 48.51 39.39 32.57 NAA (20 ppm) 93.25 88.45 77.66 71.33 62.59 NAA (30 ppm) 86.05 76.43 47.35 40.19 33.41 GA3 (25 ppm) 88.30 79.21 49.09 39.37 33.05 GA3 (50 ppm) 89.19 80.49 61.22 53.17 44.53 GA3 (100 ppm) 85.65 68.65 47.05 37.62 30.41 2,4-D (10 ppm) 90.15 85.05 64.10 57.00 51.03 2,4-D (15 ppm) 87.07 78.09 55.51 46.06 38.49 2,4-D (20 ppm) 89.17 73.49 53.21 41.15 34.33 S.Em± 0.08 0.10 0.11 0.11 0.11 CD at 5% level 0.24 0.30 0.31 0.33 0.32

344 Table 2. Influence of growth promoting substances and protoplasm and is helpful in chlorophyll synthesis, the PGRs on fruit drop percentage and yield increased photosynthetic activity of leaves and consequently the yield as a result of urea application. Fruit drop percentage Moreover, increased fruit set reduced fruit drop as a Treatment Pin Pea Pre Yield per result of urea spray could give higher number of fruits head size harvest tree (kg) consequently the yield. The present findings are in Control 29.4 39.43 28.29 13.22 conformity with the result reported by Shinde et al. (2006) Urea (1%) 7.14 23.07 13.25 22.22 and Singh et al. (1994) in mango. Urea (2%) 5.19 17.65 9.14 29.22 Urea (3%) 13.66 29.23 14.47 18.22 References NAA (10 ppm) 9.52 27.22 12.47 25.00 NAA (20 ppm) 4.50 10.47 7.33 33.00 Bal J S, Singh S N, Randhawa J S, Jawanda J S (1984) Effect of growth regulators on fruit drop, size and quality of NAA (30 ppm) 11.60 26.62 14.23 25.22 ber (Zizyphus mauritiana Lamk.) Indian J Hort 41:182-185 GA3 (25 ppm) 10.30 29.51 15.40 22.22 GA (50 ppm) 8.46 24.61 12.36 28.00 Chacko E K, Singh R N, Kachro R B (1972) Studies on the 3 physiology of flowering and fruit growth in Mangifera GA3 (100 ppm) 12.01 28.27 14.58 23.00 Indica L. VI. Hormonal control of fruit development 2,4-D (10 ppm) 6.28 19.33 11.14 28.44 and its possible significance of biennial bearing. Acta 2,4-D (15 ppm) 9.36 27.49 12.46 23.44 Hort 24: 115-163 Haidary G A, Jalal-ud-Din B, Ghaffo A, Munir M (1997) Effect 2,4-D (20 ppm) 10.41 28.49 13.48 18.44 of naphthelene acitic acid on the fruit drop, yield and S.Em.± 0.07 0.09 0.07 0.08 quality of mango (Mangifera Indica L.) cv. "Langra". CD at 5% level 0.20 0.26 0.20 0.24 Scientific Khyber (Pakistan) 10: 13-20 Jain V K (2010) Fundamentals of Plant Physiology S Chand & company LTD, New Delhi Similar findings were made by Rajpal et al. (2001) in ber Rajpal S, Godhra N R, Rajbir S, Dahiya S S (2001), Responses NAA improved the internal physiology of developing fruits of Foliar application of growth regulators and nutrient in Ber. Haryana J Hort Sci 30: 161-164 in terms of better supply of water, nutrients and other bio- compounds like auxins vital for their proper growth and Shinde A K, Patil B P, Pujari K H, Jadhav B B, Chandelkar A B, Khandalkar M P (2006) Investigations on the development which resulted in more fruit retention and control of fruit drop in Alphanso Mango. Indian J Pt reduce fruit drop as compared to control. Application of Physio 11:93-99 NAA 20 ppm concentration highly minimized the fruit drop Singh B, Rethy P (1996) Effect of certain micronutrients and at all the stages of development and gave maximum fruit NAA on the yield of kagzi lime (Citrus aurantifolia retention at maturity has been reported by Haidry et al. Swingle). Advances Hort and Forestry 5: 43-49 (1997) in mango support the results. Singh J K, Prasad J, Singh H K (2007) Effect of micro-nutrients and plant growth regulators on yield and physico- Fruit yield chemical characteristics of aonla fruits in NA-10. Ind J Hort 64:216-18 Tomaszewska E, Tomaszewska M (1970) Endogenous growth Maximum fruit yield was noted with 20 ppm NAA regulators in fruit and leaf abscission Zeszyty Nank followed 2% Urea. Increasing number of fruit, inhibiting Biol. Copernicus Univ Torun Pol 23: 45-53 the shedding of fruits, increasing fruit retention Yadav B, Rana GS, Bhatia SK (2004) Response of percentage, decreasing fruit drop percentage ultimately naphthalene acetic acid, urea and zinc sulphate on resulted into higher yield as compared rest of fruit drop in ber (Zizyphus mauritiana Lamk). Haryana treatments. Similar results was also obtained by Singh J Hort Sci 33: 181-182 and Rethy (1996) in Kagzi lime and Bal et al. (1984) in Ber. Since nitrogen is an important constituent of (Manuscript Receivd : 30.07.2012; Accepted 15.10.2012)

345 JNKVV Res J 46(3): 346-349 (2012)

Growth and yield response of rice in relation to different thermal environments at Kymore plateau zone of Madhya Pradesh, India

Sandip Silawat and K.K. Agrawal Department of Physics and Agrometeorology College of Agricultural Engineering Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract on idea that plants have definite temperature requirement before they attain certain phenological stages (Chakarvortory and Shastry 1983). Under An Investigations were carried out at Research field, Department of Physics and Agrometeorology, Jawaharlal delayed transplanting in central part of India, the Nehru Krishi Vishwa Vidyalaya, Jabalpur, Madhya Pradesh maturity of rice is delayed due to onset of gradual during kharif season of the year 2005 and 2006. The decrease in ambient temperature. Hence it becomes experiment comprises of three planting times (23 July, 2 imperative to have knowledge of exact duration of August and 12 August) and four rice varieties including inbred development phases in a particular environment and (Kranti and IR-36) and hybrid (PA 6201, JRH- 5). Various heat their association with yield, determinates for achieving summation indices viz., Growing Degree Days (GDD), higher seed yield. Information available on the effect of Heliothermal units (HTU), Photothermal units (PTU) and Heat environment on the different phases and seed yield of use efficiency (HUE) in relation to different rice varieties of rice under field condition is meager. Therefore the study inbred and hybrid under different planting times. All the yield attributing character viz., tiller hill-1, dry matter (g hill-1), No. was under taken to assess the influence of date of panicles hill-1, panicles length (cm), panicle weight (g), test transplanting on phenological stages, growing degree weight (g) and seed and straw yield was also higher under -days and seed yield of rice. early planted crop with hybrid rice PA 6201. Higher values of agroclimatic indices were observed for July planted rice cultivars to attain physiological maturity. Hybrid rice PA 6201 Materials and methods accumulated higher value of all the heat units. The highest values of HUE for biomass and grain yield was recorded for The field experiment was conducted during Kharif (rainy) July planted crop. Among different varieties hybrid PA 6201 season of 2005 and 2006 at research field of noted higher value of HUE than other varieties. Heat units can be used to develop model for predicting the different Department of Physics and Agrometeorology, phenophase. Jawaharlal Nehru Krishi Vishwa Vidhyalaya Jabalpur (230 09'N, 790 58' E and at altitude of 411 M above mean sea level). The soil was clay loam in texture having pH Keywords:Date of sowing, GDD, HTU, PTU, HUE. 6.7. The treatments comprised of three transplanting dates, viz., last week of July, first week of August and Duration of different phenological stages of rice (Oryza second week of August as main plot treatment and sativa L.) shows a wide range of diversity, depending varieties, two varieties viz., Kranti and IR 36 and two on the genotypes and environment has significant effect hybrid viz., PA 6201, and JRH 5 in sub plots in split plot on seed yield. Change in ambient temperature during design with three replications. The hybrid JRH-5 vegetative and reproductive stages affect the onset and developed by University was included in the second duration of phenological stages and hence the yield of year of the investigation. The nursery was raised by crop (Pal et al.1996). The effect of temperature on plant putting the seed in staggered manner and 25 days old growth and phenological development can be inferred seedling were used in each date of transplanting. The by way of accumulated heat unit system which is based seedling (one of hybrid and 2-3 inbred) were

346 transplanted with distance of 20 cm row to row and 15 HTU = GDD x (Actual sunshine hours) cm plant to plant. The crop was raised with recommended agronomic package of practices. The PTU = GDD x (Day length) daily maximum and minimum temperature were Heat use efficiency (HUE) for biomass and economic recorded from Agromet Observatory of University. yield were also computed to compare the relative Accumulated growing degree days were computed for performance of different cultivars and planting dates different phenological stages taking a base temperature with respect to utilization of heat using the formula as of 100C by following formula as suggested by Nuttonson suggested by Rao et al. (1999). (1955). Total dry mater, grain yield (kg/ha) Accumulated growing Tmax. + Tmin. HUE = ------= Σ ------Tb 0 Degree-Days 2 Accumulated heat unit ( C) where, Result and Discussion T. max. - daily maximum temperature (0C) T. min. - daily minimum temperature (0C) Yield attributes Tb, base temperature (0C)

Heliothermal units (HTU) and Photothermal units (PTU) All the yield attributing characters like tillers, panicles, were computed on daily basis as follows (Rajput 1980) panicle length and panicle weight were significantly

Table 1. Agro climatic indices of Inbred and hybrid rice under different planting dates

Treatments Accumulated GDD Accumulated HTU Accumulated PTU (0C day) (0C day hours) (0C day hours) 2005 2006 2005 2006 2005 2006 Planting dates

D1 - 23 July 2792 2706 12955 13114 35512 35994

D2 - 02 August 2699 2556 14364 13079 33076 33323

D3 - 12 August 2420 2290 13896 12913 31441 29566 Varieties Hybrid

V1 - PA 6201 2668 2606 14006 13724 33697 33954

V2 - JRH 5 - 2450 - 12501 - 32064 Inbred

V3 - IR 36 2578 2456 13264 12582 32662 32139

V4 - Kranti 2664 2558 13946 13333 33671 33688

Table 2. Heat use efficiency (HUE) of inbred and hybrid rice under different planting dates

Treatments Grain yield Straw yield HUE of biomass HUE of grain (kg ha-1) (kg ha-1) with GDD yield with GDD (kg ha-1 per 0C day) (kg ha-1 per 0C day) 2005 2006 2005 2006 2005 2006 2005 2006 Planting dates

D1- 23 July 6151 7156 8032 109.1 2.88 4.33 2.20 2.64

D2- 02 August 5602 6603 7427 105.1 2.75 4.12 2.07 2.58

D3- 12 August 5267 5334 7087 992.4 2.92 4.03 2.17 2.32 Varieties Hybrid

V1 PA-6201 5892 7299 7764 108.8 2.91 4.15 2.20 2.80

V2 JRH-5 - 6713 - 102.9 - 4.20 - 2.74 Inbred

V3 IR-36 5299 4955 7115 99.13 2.76 4.04 2.05 2.01

V4 Kranti 5829 6514 7666 107.15 2.78 4.18 2.10 2.55

347 higher under July planted rice whereas, lowest was under the crop planted in the in the second week of August. Sterility percent was lower in early planted crop

(g) whereas higher sterility percent was noted in the crop

est weight planted in the second week of August and also resultant to lower test weight (Table 3). This might be attributed to lower temperature that coincides with delayed planting. Similar results were also noted by Yoshida (1978).

Heat indices

Different heat unit i.e. GDD, HTU and PTU were computed for rice genotypes under different sowing dates (23 July, 02 August and 12 August) form nursery to physiological maturity of crop. Heat units showed (g) appreciable variation due to planting time and varieties. Crop transplanted in last week of July accumulated higher values (2792 and 2706 GDD) of agro climatic indices (Table 1) to attain physiological maturity, similar findings were also reported by Chopra and Chopra (2009). However, as transplanting was delayed after July comparatively lower value (2420 and 2290 GDD)

(cm) of heat indices were recorded to attain physiological maturity of rice. Among different rice cultivars hybrid

25.07 23.9 5.61 4.10 7.10 7.36 25.76 25.37 22.94 23.2 4.24 3.79 8.11 9.32 24.49 24.85 21.44 22.5 3.64 3.27 12.14 11.23 23.64 23.54 PA 6201 accumulated higher value (2668 and 2606 GDD) of heat units for physiological maturity compared

-1 to cv. Kranti, IR-36 and hybrid JRH 5. Lowest GDD (2450) were with JRH 5 cultivar. Similar results were also reported by Agrawal (2008).

No. of Panicle length Panicle weight Sterility % T

Panicles hill Dry matter, grain yield and heat use efficiency

-1 Rice crop transplanted early in the July month accumulated higher dry matter yield (74.41 and 98.41 g/hill) as compared to late transplanting. Lowest dry matter yield (58.32 and 82.16g/hill) was recorded with

13.15 13.4 10.13 11.15 26.26 25.4crop 4.60 transplanted 3.81 8.04 8.86 in the 23.93 21.57 second week of August. Among the different rice cultivars, hybrid PA 6201 accumulated higher dry matter (69.01 and 105.00 g/hill) as compared

) to other cultivars (Table 3). Seed yield was highest in

-1 87.00 8.75 9.04the 6.88 crop 7.68 planted 21.27 21.4 in July 5.06 4.05(6151 10.35 10.57and 28.627156 28.46 kg/ha) as compared to crop planted in August (5267 and 5334

(g hill

- 100.77 - 11.92 - 10.33 - 24.4 - 4.16 7.50 7.38 - 27.38

Dry matter Tillers hill kg/ha). However, higher seed yield (5892 and 7299 kg/

0.14 0.49 0.41 0.06 0.23 0.044 0.18 0.01 0.07 0.02 0.30 0.28 0.07 0.04

0.27 0.39 0.28 0.128 0.32 0.14 0.14 0.01 0.13 0.02 0.078 0.87 0.14 0.05 0.83 1.17 0.86 0.40 0.98 0.43 0.42 0.03 0.41 0.06 2.54 2.68 0.42 0.15

2005 2006 2005 2006 2005 2006 2005 2006 2005 2006 2005 2006 2005 2006

58.14 73.00 12.23 95.28 9.61 8.23 21.92 21.7 3.82 2.86 11.09 10.96 21.35 20.92 64.33 ha) was obtained with hybrid rice PA 6201 than other cultivars. Lowest seed yield (5299 and 4955 kg/ha) was noticed in IR 36 (Table 2). In both, years HUE for biomass (2.88 & 4.33 kg Yield attributing characters of rice cultivars as influenced by planting time ha-1 per 0C day) and grain yield (2.22 & 2.64 kg ha-1 0C day) was recorded with July planted crop. Among

-23 July 70.41 98.41 12.20 11.90 10.24 10.13 -02 Aug. 62.74 94.33 11.71 10.88 8.76 9.41 -12 Aug. 58.32 82.16 10.22 9.94 7.63 8.50

PA-6201 69.01 105.00 JRH-5

IR-36 Kranti

1 2 3

1 2

3 4 different rice cultivars hybrid rice PA 6201 accumulated

Planting dates D

Table 3. Table Treatments

D D SEm± CD at 5% at CD 0.57 2.43 1.40 0.26 0.91 0.16 0.71 0.05 0.26 0.07 1.20 1.00 0.30 0.18 Varieties Hybrid V

V Inbred V

V

SEm± CD at 5% at CD

348 higher HUE for both biomass (2.91 & 4.15 kg ha-1 per Chopra Kumar Neelam, Chopra Nisha (2004) Influence of 0C day ) and grain yield (2.20 & 2.80 kg ha-1 per 0C day) transplanting dates on heat- unit requirement of in both years, respectively as compared to other rice different phenological stages and subsequently yield cultivars (Table 2). These findings are in close agreement and quality of scented rice (Oryza sativa) seed. Indian J Agric Sci 74 (8): 415-9 of Hundal et al. (2005) as observed under north Indian condition. Hundal SS, Kaur Prabhjyoti, Dhaliwal LN (2005) Growth and yield response of rice (Oryza sativa) in relation to temperature, photoperiod and sunshine duration in HkkSfrdh ,oa ekSle foKku foHkkx tokgjyky usg# fo'o fo|ky; esa o"kZ Punjab. J Agrometeorol 7 (2): 255-61 Nuttonson MY (1995) Wheat climatic relationship and use of 2005&2006 esa iz{ks= iz;ksx fd;s x;sA iz;ksx esa 3 cqvkà dh frfFk;¡k phenology in ascestaining the thermal and photo- ,oa 4 /kku dh ladj ,oa mUur fdLeksa dk lekos'k fd;k x;kA iz;ksx thermal requirements of wheat. American Institute of Crop Ecology, Washington.D.C. ds vk/kkj ij ekSleh; lwpdakd (Heat indices) ,oa m"ek n{krk Pal SK, Verma UN, Singh MK, Thakur R (1996) Heat unit (Heat use efficieny) dh x.kuk dh xà x.kuk ds urhts ;g crkrs requirement for phenological development of wheat gSa /kku dks tqykà ds eghus esa yxkus ij lHkh okafNr mit nsus okys ?kVd (Triticum aestivum) under different level of irrigation, seeding date and fertilizer. Indian J Agric Sci 66 (7): (yield attributes) ,oa nkus dh mit vf/kd ikà xà gSa lkFk gh 397-400 ekSleh; m"ek n{krk Hkh vf/kd jgh gS /kku dh ladj iztkfr PA6201 Rao VUM, Singh Diwan, Singh Raj (1999) Heat use efficiency nwljh iztkfr;ksa dh rqyuk esa vf/kd mit] ekSleh; lwpdakd ,oa m"ek of winter crop in Haryana. J Agrometeorol 1 (2): 143- 148 n{krk ikà xÃA ekSleh; lwpdakd dk mi;ksx /kku dh Hkfo";ok.kh ds Rajput RP (1980) Response of soybean crop to climatic and Model fodkl esa mi;ksx fd;k tk ldrk gSA soil environments. Ph. D Thesis IARI New Delhi. Yoshida S (1978) Tropical climate and its influence on rice. IRRI Research Paper Series No.: 20 References

Agrawal KK (2008) Agrometeorological indices for rice (Manuscript Receivd : 22.12.2011; Accepted 03.08.2012) varieties under different nitrogen levels. JNKVV Res J 42 (2): 209-211 Chakarvortory NVK, Shastry PSN (1983) Phenology and accumulated heat unit relationship in wheat under different planting date in Delhi region. Agricul Sci Progress 1: 32-42

349 JNKVV Res J 46(3): 350-354 (2012)

Effect of plant spacing and nitrogen levels on phenophasic developments and physiological attributes of kalmegh (Andrographis paniculata Nees)

Abha Tripathi, Sathrupa Rao, S.K. Dwivedi and A.B. Tiwari Department of Plant Physiology Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482004 (MP)

Abstract variability and yield differences among the germplasm lines. However the co-ordination of the phenophasic An investigation on the Effect of plant spacing and nitrogen stages with the environmental status of soil is also of levels on phenophasic developments and physiological utmost importance, that decides the planting value and attributes of Kalmegh was conducted in the Research Farm nutrient requirement of the crop, Hence an attempt was of Department of Plant Physiology, JNKVV, Jabalpur. The made to achieve the goal with an objective to evaluate experiment was laid out in split plot design replicated thrice. the effect of plant spacing and variable nitrogen levels

Five plant spacing of 20 (S1) 30 (S2) 40 (S3), 50 (S4), 60 (S5) on phenophasic developement and physiological cm and four nitrogen levels of N (Control), N (30 kg N/ha), 0 1 attribute of Kalmegh under agroclimate conditions of N (45 kg/ha) and N (60 kg/ha) were applied, with spacing as 2 3 Kymore plateau zone of Madhya Pradesh. main treatment and nitrogen level as sub -treatment. Plant to plant spacing of 50 cm and nitrogen application @ 60 kg / ha had a significant effect on phenophasic development as flower Material and methods initiation, 50% flowering, physiological maturity and physical maturity. Among the physiological attributes stomatal conductance, transpiration rates, net photosynthesis CO2 and The present investigation was made during kharif

H2O utilization was the maximum which had affected the yield season of 2010-2011 at the Research Farm, Department parameters. of Plant Physiology JNKVV, Jabalpur (MP). The research experiment was laid out in a split plot design replicated thrice. Five plant spacing viz, 20 (S ), 30 (S ), Keywords: Stomatal conductance transpiration rate 1 2 40 (S ), 50 (S ), 60 (S ) and 4 levels of nitrogen viz; N photosynthetically active radiation 3 4 5 0 (Control), N1 (30), N2 (45), N3 (60 kg/ha) were choosen as Main and Sub- treatments, respectively. The seeds The plants with medicinal values play an important role of Kalmegh were sown @ 2 kg/ha by direct sowing in in the lives of rural people particularly in the remote open furrow at a depth of about 2.5 cm. Healthy parts of the country where the health facilities are seedlings were picked up for transplanting in to the field meager. These plants are also being utilized as prepared for experimentation after about 40 day of sweeteners, spices, natural colouring agents and for sowing in nursery with varying plant to plant distance germicidal purpose etc. Kalmegh (family Acanthacae) and plant population was maintained accordingly. is a naturally grown plant in India and other Asian countries. Considering to medicinal importance it is being cultivated in large scale and has been Result and Discussion domesticated. Cultivation of any species requires quality seed production and this depends upon the capacity of Phenophasic development the plant to acquire photosynthates, and its ability for partitioning and translocation of photo assimilates towards the developing sink. These are achieved due The study of the relations between seasonal climatic the photosynthetic area, utilization of photosynthetically changes i.e. in temperature day length and precipitation active radiation within the crop canopy, genetic and periodic biological phenomena such as flowering,

350 fruiting, leaf flushing and dormancy is known as moisture and nitrogen conditions intercepted more light Phenology. A significant variation was noted due to and produced more biomass compared to stressed plant spacing and nitrogen levels in relation to days crops Singh et al. (2003). required for their phenological development. S4 (50cm plant spacing) recorded the maximum days for flower Higher magnitude for stomatal conductance was initiation, 50% flowering, physiological maturity and noted in various phenophases viz., vegetative, flowering, fruiting stage at plant spacing S (128.02, physical maturity, Similar results were obtained by Jirali 4 2 et al. (1988). They showed that the kalmegh produced 121.15, 123.96 m.mol/m /s), with nitrogen level N3 2 maximum number of flowers at 106 DAT after flower (131.52, 123.91, 125.40 m.mol/m /s) and a treatment combinations of S ×N (144.43, 134.45, 138.56 m.mol/ produced the maximum yield. Salim and Saxena (1993) 4 3 2 noticed that early flowering was associated with high m /s). Stomatal conductance was obtained in vegetative stage with the S treatment and S showed the harvest index, large number of pods and high seed 4 1 mass. significantly lowest value. Miyashita et al. (2005) noted that the stomatal conductance decreased rapidly by withholding water in kidney bean. Recovery of stomatal Physiological parameters conductance decreased gradually as the days without watering became longer. Higher stomatal conductance Quantification of various physiological traits indicated is a beneficial trait for gases exchange during higher photosynthetically active radiations (PAR) photosynthesis and respiration and facilitates transpiration as long as the water availability is in absorption in plant spacing S4 (1084.77, 1068.32, and 1072.09 µmol/m2/s) at vegetative, flowering, fruiting abundance on the other hand when the water availability is in scarcity higher stomatal conductance with higher stage, nitrogen level N3 (1076.44, 1059.32 and 1065.43 2 rate of transpiration will create water deficit in stomata µmol/m /s) and interaction S4×N3 (1167.52, 1134.35 and 1142.45 µmol/m2/s) at vegetative, flowering, fruiting guard cells resulting in plant system reducing the phases of the crop. PAR was recorded at vegetative, photosynthesis. flowering & fruiting stages.(Table 3,4) The maximum PAR Rate of transpiration was maximum at 50 cm plant 2 was obtained in vegetative stage with S4 (50cm plant spacing (3.13, 3.54, and 3.29 m.mol/m /s) at vegetative, spacing treatment). PAR interception and its utilization flowering of fruiting stage, 60 kg/ha (3.09, 3.51 and 3.26 have a great influence on the productivity which is an m.mol/m2/s) and interaction S4×N3 (3.44, 3.83 and 3.55 interaction between plants and environment through the m.mol/m2/s). The higher transpiration rate was at modification and interception of fluxes of radiation heat, vegetative stage with plant spacing 50cm (S4). The CO etc. The PAR interception by the whole canopy 2 lowest rate was observed in S1 with 20cm. Increased was maximum in the morning and afternoon during CO2 concentration of air to 400 ppm reduced the tomato fruit development stage of the crops Mukherjee transpiration rate of corn and sorghum by causing the et al. (2003). The crop growth under non stressed stomata to close completely Pollas et al. (1975). The

Table 1. Effect of spacing and nitrogen levels on phenophasic development of Kalmegh Treatments Flower initiations 50% flowering Physiological maturity Physical maturity Main Treatments S1 (20 cm) 91.50 101.75 143.08 162.91 S2 (30 cm) 92.50 104.50 145.41 164.66 S3 (40 cm) 91.58 105.25 146.08 165.08 S4 (50 cm) 93.00 106.75 148.25 167.08 S5 (60 cm) 93.00 106.66 147.33 166.08 SEm ± 0.39 0.58 0.83 1.25 C.D. 5% 1.29 1.89 2.71 4.07 Sub Treatments N0 (Control) 91.53 99.73 141.20 161.20 N1 (30 kg/ha) 91.66 103.00 143.66 163.00 N2 (45 kg/ha) 93.40 110.06 146.40 164.80 N3 (60 kg/ha) 93.46 111.13 152.86 172.20 SEm ± 0.36 0.56 0.65 0.76 C.D. 5% 1.05 1.64 1.89 2.20

351

1200

1150

1100

1050

1000

950

900 S1N S1N S1N S1N S2N S2N S2N S2N S3N S3N S3N S3N S4N S4N S4N S4N S5N S5N S5N S 5 0 1 2 3 0 1 2 3 0 1 2 3 o 1 2 3 0 1 2 3 Veg 1002 1017 1036 1036 1003 1040 1042 1044 1011 1045 1053 1053 1012 1057 1157 1168 1011 1060 1064 10 Flw 1000 1012 1018 1019 1002 1022 1026 1029 1005 1031 1037 1037 1005 1038 1129 1134 1010 1049 1043 10 Fru 1003 1012 1016 1021 1003 1029 1030 1030 1004 1042 1036 1045 1008 1043 1127 1142 1006 1034 1052 10

Effect of Plant Spacing and Nitrogen levels on Photosynthesis Active R ad ia tio n (P A R ) (m m o l/m 2 /s) various stages

160 140 120

100 80 60 40

20 0 S1N0 S1N1 S1N2 S1N3 S2N0 S2N1 S2N2 S2N3 S3N0 S3N1 S3N2 S3N3 S4No S4N1 S4N2 S4N3 S5N0 S5N1 S5N2 S5 Veg 101.2 117 118.4 122.5 106.9 120.8 124.2 125.2 109 128.2 118.1 130.2 105.2 136.2 138.2 144.4 110.2 134.4 132.1 13 Flw 100.9 110.4 111.8 117 102.2 118.6 119.9 119.3 102.4 122.7 112 123.4 104.5 126 129.9 134.5 105.9 125.6 126.7 12 Fru 101.2 111.3 112.4 112.5 102.4 116.5 116.8 113.3 103.4 119.3 122.5 122.8 104.5 125.9 130.6 138.6 106.7 127.8 126.9 13

Effect of plant spacing and nitrogen levels on stomatal conductance (mmol/m2/s) various stages

4

3.5

3

2.5

2

1.5

1

0.5

0 S1N0 S1N1 S1N2 S1N3 S2N0 S2N1 S2N2 S2N3 S3N0 S3N1 S3N2 S3N3 S4No S4N1 S4N2 S4N3 S5N0 S5N1 S5N2 S5 Veg 2.4 2.507 2.68 2.687 2.443 2.697 2.8 2.92 2.433 2.527 3.163 3.251 2.497 3.337 3.413 3.44 2.507 3.247 3.333 3.2 Flw 2.947 3.283 3.323 3.363 0 3.4 3.46 3.437 3.02 3.46 3.467 3.433 3.167 3.74 3.657 3.833 3.07 3.357 3.383 3.5 Fru 2.537 2.953 2.93 3.05 2.753 3.133 3.137 3.227 2.753 3.143 3.263 3.233 2.843 3.443 3.507 3.557 2.853 3.36 3.243 3.2

Effect of plant spacing and nitrogen levels on transpiration rate (mmol/m 2 /s) various

stages

352

25

20

15

10

5

0 S1N S1N S1N S1N S2N S2N S2N S2N S3N S3N S3N S3N S4N S4N S4N S4N S5N S5N S5N 0 1 2 3 0 1 2 3 0 1 2 3 o 1 2 3 0 1 2 Veg 14.1 16.7 16.9 17.4 14.2 18.5 18.8 19.3 15.3 19.8 20.7 20.7 15.4 20.5 21.8 21.9 15.6 20.3 20.7 Flw 14.2 16.8 16.9 17.6 14.3 17.7 18.5 18.9 15.4 19.3 20 20.5 15.4 20.8 20.9 21.8 15.7 20.5 20.6 Fru 14 16.4 16.6 17.3 14 17.3 18.2 18.5 15.1 19.1 19.6 20.1 15.1 20.6 20.3 21.7 15.2 20.3 20.3

Effect of plant spacing and nitrogen level on Net Photosynthesis (mmol/m2 /s)

various stages

74 72 70 68 66 64 62

60 S1N S1N S1N S1N S2N S2N S2N S2N S3N S3N0.5S3N S3N S4N S4N S4N S4N S5N S5N S5N S 0 1 2 3 0 1 2 3 0 1 2 3 o 1 2 3 0 1 2 0.4 Veg 64.5 67.5 68.4 68.6 65.2 69.8 69.8 68.4 65.8 68.3 69.7 70.2 66.3 70.6 71.8 72.5 66.5 70.4 70.4 7 Flw 64.5 67.8 68.7 68.9 65.9 69.4 69.9 70.7 66.5 70.70.3 70.8 68.8 66.6 70.9 72.3 72.7 66.8 70.5 69.8 6 Fru 64.8 67.9 68.1 68.9 66.1 68.9 69.7 69 66.8 69.9 70.1 70.8 66.8 70.8 72.1 72.9 66.9 71 70.9 7 0.2

Effect of plant spacing and nitrogen level on CO U tiliz a tio n (p p m ) vario u s 0.1 2 stages 0 NS1N S1 S1N S1N S2N S2N S2N S2N S3N S3N S3 0 1 2 3 0 1 2 3 0 1 2 Veg 0.294 0.38 0.381 0.384 0.319 0.393 0.394 0.418 0.322 0.425 0.4 Flw 0.275 0.338 0.351 0.369 0.295 0.368 0.376 0.396 0.304 0.395 0.4 Fru 0.259 0.323 0.348 0.352 0.276 0.343 0.368 0.384 0.293 0.345 0.3 Effect of Plant Spacing and Nitrogen Level

stages

353 reduction in transpiration rate was observed half at 25% fdyksxzke izfr gsDVs;j dh nj dk dkyes?k ds fQuksQsfld fodkl ,oa light intensity by Bhatt (2006). The higher N level is chiefly associated with leaf area development and dk;Zdh; iSekus ,oa mRikndrk ij iM+us okys izHkko dks Kkr djus gsrq chlorophyll synthesis traits beneficial for PAR fd;k x;kA interception. The PAR interception beyond certain limit sometimes proves to be negative due to increase in leaf temperature which causes an increase in rate of ikS/ks ls ikS/ks dh nwjh 50 ls-eh- ,oa u=tu dh 50 fd-xzk- izfr transpiration. The excess water loss causes stomatal gsDVs;j ek=k gCkZy mRiknu gsrq loksZRre Fkk ftldk dkj.k iq"iu] 50 closure thereby reducing further transpiration with CO 2 izfr'kr iq"iu] dk;Zdh; ,oa HkkSfrd ifjoDrk dk 'kh?kz gksrk gS] assimilation. dk;Zdh; iSekuksa esa 'kq)ykHk izdk'k la'ys"k.k] okrja?kz lapkyu] mRlosnu Similarly maximum net photosynthesis was nj] dkCkZuMkbvkWDlkbM ,oa ty mi;ksx {kerksa dk vf/kd gksuk ik;k observed in plant spacing S4 (18.73, 18.78 and 18.49 µm.mol/m2/s), N levels in (20.79, 20.87 and 20.58 x;k tks mRikndrk lwpdksa dks izHkkfor fd;kA 2 µm.mol/m /s) and treatment combination S4×N3 (21.77, 21.83 and 21.65 µm.mol/m2/s) during the above References mentioned phenophases. A significantly maximum net photosynthesis was observed at flowering in S4 spacing. Bhatt RK, Tiwari HS, Vandana, Mishra PL (2006) Kalpana et al. (2003) noted that the net photosynthesis Photosynthesis and shade tolerance in tropical range were maximum at flowering stage and declined at grasses and legumes. Indian Grassland and Fodder cowpea pod development stage. Singh et al. (1997), Research Institute Jhansi UP. Indian J Plant Physiol Concluded that the rate photosynthesis was positively 11(2) : 172-177 correlated with stomatal conductance, rate of Jirali DI, Panchal YC, Janardhan KV, Janagoudar BS, Patil transpiration, leaf temperature and grain yield. The BC (1988) Studies on flowering pattern and yield of 60kgN/ha is the optimum requirement for exploitation chickpea (Cicer arietinum L.) under receding soil of solar radiation reflected in maximum net moisture condition. Indian J Pl Physiol 31(3):293- photosynthesis. Total photosynthesis was increased as 296 a result of increase in leaf area Richards (2000) Kalpana M, Chetti MB, Ratnam BP (2003) Phenological changes in photosynthetic rate, transpiration and stomatal conductance and their relationship with CO2 utilization was maximum in various stages and a plant spacing of S (69.85, 70.23 and 70.17 ppm), seed yield in cowpea. Indian J Plant Physiol 8 (2): 4 160-164 N3 (70.7, 71.07 and 71.13ppm) and interaction S4×N3 (72.46, 72.69 and 72.90ppm). CO and H O utilization Miyashita Oichi, Shigemi Tanakamary, Toshihiko Maitani, 2 2 Kazuyoshi Kimura (2005) Recovery responses of recorded at vegetative, flowering & fruiting stages. The photosynthesis, transpiration and stomatal maximum CO2 utilization was obtained in flowering stage conductance in kidney bean following drought stress. with the S4 (50cm plant spacing) treatments. The dry Experiment Bot 35 : 205-241 matter yield enhanced with doubled CO2 concentration Mukherjee J, Sastri CVS (2003) PAR distribution and radiation in cotton plant Wong et al. (2005). use efficiency in tomato crop canopy. J Agrometrol 5 (2): 62-67 The H O utilization was observed to be maximum 2 Pollas JE (1975) Transpiration and stomatal opening with in the phenophasic stages with a plant spacing of 50cm changes in carbon dioxide content of the air. Crop

(0.41, 0.39 and 0.37kpa), and N3 (0.44, 0.42 and Sci 15: 793-797

0.40kpa) in combination of S4×N3 (0.47, 0.45 and Richards RA (2000) Selectable traits to increase crop

0.40kpa). The maximum H2O utilization was at photosynthesis and yield of grain crops. J Experimental Bot 51(9001): 447-450 vegetative stage in S4 spacing. H2O utilization is associated with enzymatic reactions required for every Salim SN, Saxsena MC (1993) Adaption of spring sown chickpea to Mediterranean basin. ll. Factors physiological mechanism. Low H2O use may be a result in retardation of electron transport process needed for influencing drought. Field Crop Res 34(2) 137-146 production of ATP and NADPH2 which are required for Singh AK, Singh HP, Singh A, Gupta MM (1997) CO reduction in dark reaction of photosynthesis. Domestication and evaluation of Kalmegh 2 populations. CIMAP Lucknow India izLrqr iz;ksx tokgj yky usg: d`f"k fo'ofo|ky; ds ikni dkf;Zdh Wong, Suan Chin (2005) Interactions between elevated atmospheric concentration of CO2 and humidity on foHkkx tcyiqj ds vuqla/kku iz{ks= esa fLifyV IykV fMtkbu ds plant growth. J Plant Ecol 104-105 (1): 211-221 vraxZr 5 ikS/k drkj varjksa dze'k% 20] 30] 40] 50 ,oa 60 lsUVhehVj ,ao 4 u=tu ek=kvksa dze'k% 0] 30] 45 ,oa 60 (Manuscript Receivd : 10.05.2012; Accepted 09.08.2012) 354 JNKVV Res J 46(3): 355-359 (2012)

Assessment of productivity and economics of various soybean + pigeon pea intercropping system under rainfed condition of Rewa region of Madhya Pradesh

P.S. Yadav and B.M. Maurya Department of Agronomy, College of Agriculture Jawaharlal Nehru Krishi Vishwa Vidyalaya Rewa 486001 (MP)

Abstract proved successful without any adverse effect on pigeon pea (Ahlawat et al. 1982, Prasad et al.1985; Maurya 2000 ; Maurya and Rathi 2000). Soybean has more The present experiment was taken under All India Co- coordinated Research Project on Dry land Agriculture, Kuthulia rapid growth rate than pigeon pea and there-fore could Farm, JNKVV, College of Agriculture Rewa, during Kharif efficiently utilized the vacant spaces of pigeon pea. More 2008. The results indicated that pigeon pea crop had teletoxic over soybean with higher harvest index can complete effect on soybean in intercropping. The yield reduction of its life cycle faster than pigeon pea. Soybean as an soybean varied from 6% in 4:2 and 9% in 2:1 system of inter crop with pigeon pea may fulfill this requirement intercropping as compared its plant population. The soybean because growth habit of soybean is mostly suited for had also teletoxic effect on pigeon pea in intercropping, modification in planting systems. The optimum row ratio particularly in 2:1 system in which the yield reduction was for soybean and pigeon pea in intercropping has not 43% as compared to its plant population. The cultivation of been decided for Kymore plateau and Satpura hills sole pigeon pea was more profitable than sole soybean. Intercropping of soybean and pigeon pea gave LER 1.47 in region of Madhya Pradesh. Further, as the soybean 2:1, 1.31 in 3:2 and 1.28 in 4:2. Among different intercropping genotype suitable for sole cropping may not be suitable systems 2:1 and 3:2 gave maximum LER while pigeon pea for intercropping. Keeping above facts in view present equivalent yield, net profit and B: C ratio were maximum in experiment was taken under rainfed condition. 3:2 system of intercropping. The soybean variety JS 93-05 was better for intercropping with pigeon pea than JS 335. Material and Methods

Keywords : Intercropping system, rainfed The present field study was made under All India Co- coordinated Research Project on Dry land Agriculture, Soybean is an important crop of Madhya Pradesh which Kuthulia Farm of JNKVV, College of Agriculture Rewa, occupies an area of 4.5 million hectares with the during Kharif season of 2008.-09 in which five cropping production of 4.85 m t. The average yield of soybean is systems (sole soybean, sole pigeon pea, two row of 1078 kg/ha. Soybean is generally grown in sole as well soybean in between the rows of pigeon pea as 2:1, as in mixed and intercropping with pigeon pea in Rewa four rows of soybean followed by two rows of pigeon region of Madhya Pradesh (Anonymous 2008). The pea as 4:2 and three rows of soybean followed by two perception value of intercropping has changed radically rows of pigeon pea as 3:2) were tried with the soybean over the year (Anonymous 2008). Experimental findings variety JS 93-05 and JS 335 in a three replicated suggest that intercropping can provide substantial yield randomized block design. advantage compared to sole cropping. This advantage may be especially important because they are achieved The experiment was shown on 30th June in the not by means of costly inputs but by the simple expedient year 2008 manually with uniform application of 20 kg of growing crops together (Willey1979). N, 60 kg P2O5 and 20 kg K2O/ha on the basis of per row in both components crop. The seed rate was kept 100 Intercropping of pigeon pea with soybean has kg/ha for sole soybean and 20 kg/ha for sole pigeon

355 pea. In intercropping the seed rate was kept as per proportionate area under both components crop. The pigeon pea variety was Asha (ICPL 87119) in pure and in intercropping. Soybean varieties were JS 93-05 and JS 335 in sole and in intercropping. The row to row spacing of soybean was kept 30 cm apart while pigeon

(kg/ha) index pea crop was sown at 60 cm row to row spacing in sole. Pigeon pea spacing was kept as decided under different intercropping systems. The soil of the experimental area

yield

Biomass Grain yield Harvest was silt clay loam in texture, neutral in reaction (pH- 7.15), electrical conductivity (0.3 dsm-1), medium in organic carbon (0.53%), low in available nitrogen (233.2 Seed kg/ha) and phosphorus(12.54 kg/ha) and medium in available potassium(229.6 kg/ha). The total rainfall received during the crop season was 709.6mm distributed in 42 rainy days. All other recommended packages of practices under rainfed condition were adopted.

plant plant plant (g) (kg/ha) (%)

1.18 1.55 0.76 145 25 0.85

0.83 1.99 0.53 102 18 0.60

g podes/ seed/ yield/ Results and Discussion

plant

nodes/

Number of Number of Number of pod bearin Effect of pigeon pea on soybean in intercropping

per plant

Number of The initial plant population of soybean was 100% in 2:1, 66.66% in 4:2 and 71.03% in 3:2 system of intercropping in comparison to 100% in sole soybean (Table 1). The various observations on growth parameters like pod bearing nodes and increase in height of first pod bearing nodes clearly indicated that there was etiolated growth of soybean in 2:1 system of intercropping. Etiolated growth of soybean was also responsible for poor development of reproductive organs like increase in height of first pod bearing node, reduction in pod bearing nodes, number of pods per

DAS (cm)

PP% Mortality% Plant height Branches at 20harvest at plant per nodes of plant and number of seeds per plant (Table 1). Consequently, the seed yield per plant in association

2 of pigeon pea was reduced by 2.1% in 2:1 system and 8.8% in 3:2 system of intercropping in comparison to sole soybean. The reduction in grain and biomass yield of

Plant population/m 41.01 39.9 100 2.70 66.93 3.46 15.03 14.00 42.66 64.40 7.12soybean 5427.1 1560.0 28.75 in intercropping with pigeon pea particularly in 2:1 and 3:2 system is explained on the basis of combined effect of poor development of pods and

grains. Grain yield of soybean was 91% in 2:1, 59% in 4:2 and 53% in 3:2 system of intercropping in comparison to 100% in sole soybean. The adverse effect of pigeon pea on growth and yield of soybean Growth parameter of soybean as influenced by intercropping with pigeon pea has also been reported by Nimje (1995), Jadhao et al. (1992); Maurya (2000); Maurya and Rathi (2000) ; Lakhena and Maurya (2009). Among the two soybean

Sole soybean Soybean + Pigeonpea (2:1) 41.11 37.49 100 8.57 68.30 2.03 13.86 10.63 36.43 62.90 6.97 4933.2 1429.1 29.15 Soybean + Pigeonpea (4:2) 27.34 25.42 66.66 6.99 60.20 3.66 14.43 13.63 40.30 93.40 8.05 3599.0 921.1 25.87 Soybean + Pigeonpea (3:2) 29.13 28.13 71.03 3.42 56.91 2.50 12.56 12.00 31.63 86.53 6.49 3110.0 836.3 27.13

1 3 4 5

Table 1. Table Treatment

C C C

C S.Em± - - - - 0.71 0.34 0.35 0.64 C.D. at 5% - - - - 2.18 1.05 1.07 1.94 3.59 4.70 2.31 440 78 2.58 Soybean JS 93-05 34.76 32.81 - 5.63 58.08 2.93 13.03 12.93 38.86 86.61 7.16 4170.2 1222.1 2.26 JS 335 34.48 32.66 - 5.20 66.79 2.90 147.91 12.20 36.65 77.00 7.15 4365.3 1151.0 26.19 S.Em± - - - - 0.50 0.24 0.25 0.45 C.D. at 5% - - - - 1.54 0.74 0.76 1.37 2.54 3.32 1.63 311 55 1.82 Cropping system 20 DAS At harvest varieties tried in intercropping with pigeon pea the

356 soybean variety JS 93-05 was found better than soybean varieties JS 335 that gives 6.16 % higher yield in intercropping. The yield attributing characters of JS 93-05 was also found superior than soybean variety JS 335. It may be due early maturity and dwarf plant type which are desired characters of soybean for intercropping with pigeon pea. Similar findings were also

yield yield index

Biomass Grain Harvest reported by Singh et al. (1991) and Lakhena and Maurya (2009).

seeds/ Effect of soybean on pigeon pea in intercropping

Seed No of

plant (g) plant (kg/ha) (kg/ha) (%)

/ yield / Pigeon pea crop was grown in association with soybean with 100% rows, in 2:1, 64.3% in 4:2 and 79.58% in 3:2 system of intercropping in comparison to 100% in sole pigeon pea (Table 2). The mortality of pigeon pea plants

plant plant

pods / grains was 20.65% in 2:1, 8.99% in 4:2 and 12.2% in 3:2 system of intercropping, while it was only 4.8% in sole pigeon pea. This indicated the teletoxic association of otal Noof No of soybean with pigeon pea which was more pronounced in 2:1 than 4:2 and 3:2 system of intercropping. This was reflected by plant height, branches per plant, number of pods per plant and number of grains per plant of pigeon pea in 2:1 system of intercropping. The increase in the extent of adverse effect of soybean on growth of pigeon pea was observed up to 90 days stage 18.87 9.44 28.31 167.71 391.88 40.82 2.33 10250.0 2014.1 19.69 with slight recovery there after. Therefore the grain yield of pigeon pea on the basis of per plant was reduced by 8.05% in 2:1 and 3.52% in 4:2 system of intercropping

(cm)

2.02 0.49 0.20 0.56 1.64 10.61 1.02 0.09 236 58 1.26 in comparison to 100% in sole pigeon pea. Grain yield of pigeon pea in association with

(%) height at branches/ branches/ branches/ 14.20 175.44 14.97 8.58 23.67soybean 169.81 390.21 39.05 has 2.40 6362.1 been 1635.1 26.18 given in table 2. it is evident from the results that grain yield of pigeon pea was reduced

100 4.80 224.10 DAS harvest plant plant plant by 44% in 2:1 system of intercropping as compared to PP (%) Mortality Plant Productive Unproductive T its plant population 100%. The reduction in grain yield

2 of pigeon pea in 2:1 system of intercropping was attributed to the combine effect of harvested plants and

73.39 - - 2.47 0.60seed 0.25 yield 0.69 per 2.01 plant. 13.00 1.26 Which 0.110 289 was 71 due 1.55 to reduction in number of pods, pod yield/plant, high mortality of pigeon pea plants and reduction in yield/plant? The adverse

8.94 6.93 100 20.65 172.55 15.33 5.94 21.27 145.16 339.82 37.53 2.47 4234.1 1148.2 27.16 5.89 5.36 64.30 8.99 179.10 14.94 6.44 21.38 183.27 413.55 39.38 2.25 5462.1 1400.1 25.49 7.29 6.4 79.58 12.2 172.76 14.80 9.10 24.07 185.99 437.11 41.05 2.36 6442.2 1577.0 24.99 Plant population/m effect of soybean on pigeon pea in 2:1 system of intercropping was also reported by Tomar et al. (1987), Maurya and Rathi (2000) and Lakhena and Maurya

(2009). But in case of 4:2 and 3:2 system of intercropping, pea 9.16 8.72 the grain yield of pigeon pea was higher than its plant

Growth parameter of pigeon pea as influenced by intercropping with different varieties of soybean population. This showed a positive effect of soybean on pigeon pea. Similar results have also been reported by Tomar et al. (1987);Billore et al. (1993) ; Lakhena

Sole pigeon Soybean + Pigeon pea (2:1) Soybean + Pigeon pea (4:2) Soybean + Pigeon pea (3:2)

2 3 4 5

Table 2. Table Treatments

C

C C C S.Em± - C.D. at 5% - - - - 7.51 1.82 0.77 2.10 6.12 39.43 3.82 NS 877 217 4.71 Soybean variety JS 93-05 1.36 6.27 - JS 335 7.24 6.19 - 13.69 174.17 15.07 5.73 20.80 173.14 403.44 39.58 2.32 4397.2 1115.2 25.58 Cropping system 20 DAS At harvest at 20 S.Em± - - - - C.D. at 5% - - - - 6.13 1.48 0.62 1.71 4.99 32.20 3.12 NS 716 177 3.85

357 Table 3. Effect of different cropping systems on pigeon pea equivalent yield (q/ha), cost of cultivation, gross monetary return and net monetary return (Rs/ha), B: C ratio and LER Treatment LER Pigeon pea Cost of GMR NMR B:C ratio Soybean Pigeon pea Total equivalent yield cultivation (Rs/ha) (Rs/ha) Cropping system (q/ha) (Rs/ha)

C1 Sole soybean 1.00 - 1.00 10.28 12933 25870 12937 1.99

C2 Sole pigeon pea - 1.00 1.00 20.14 9556 52465 42909 5.49

C3 Soybean + Pigeon pea (2:1) 0.91 0.56 1.47 20.9 17631 54022 36391 3.06

C4 Soybean + Pigeon pea (4:2) 0.59 0.69 1.28 19.92 15112 52056 36944 3.44

C5 Soybean + Pigeon pea (3:2) 0.53 0.78 1.31 21.15 15244 54801 39557 3.59 S.Em± - - - 0.72 - --- C.D. at 5% - - - 2.15 - --- Soybean variety JS 93-05 - - - 20.25 15230 51899 36669.75 3.33 JS 335 - - - 15.95 15230 41475 2624.25 2.70 S.Em± - - - 0.51 - --- C.D. at 5% NS NS - 1.52 - ---

and Maurya (2009). lks;kchu dk mRiknu 6 izfr’kr 4%2 drkj i)fr esa rFkk 9 izfr’kr The effect of different soybean varieties on growth 2%1 drkj i)fr ?kVrk gSA lks;kchu dh Qly vUrjorhZ [ksrh esa and yield of pigeon pea in intercropping have been given vjgj ij 2%1 drkj i)fr esa foijhr izHkko Mkyrh gSA ftlls in Table 2. It is clear from the results that soybean variety vjgj dk mRiknu 43 izfr’kr rd ?kVrk gSA fofHkUu drkj i)fr esa JS 93-05 had lesser teletoxic effect on pigeon pea lks;kchu ,oa vjgj dh vUrjorhZ [ksrh ysus ls Hkwfe rqY;kadh growth than JS 335. It may be due to early maturity and 1 28 1 47 dwarf habit of JS 93-05 than JS 335. Similar findings vuqikr - ls - izkIr gqvkA lks;kchu ,oa vjgj dh were also reported by Singh et al. (1991) and Lakhena vUrjorhZ [ksrh 3%2 drkj i)fr esa ysus ls vjgj lerqY; mIiknu and Maurya (2009). ¼21-15 fDoVy@gs-½ ’kq) ykHk ¼:- 39557@gs-½ ,oa vk; O;; 3 59 93 05 Evaluation of different cropping system vuqikr - izkIr gqvkA lks;kchu dh fdLe ts- ,l- & vjgj ds lkFk vUrjorhZ [ksrh esa lks;kchu dh fdLe ts- ,l- 335 The data pertaining to pigeon pea equivalent yield, LER, dh rqyuk esa vPNk mRiknu ,oa ykHk nsrh gSA NMR and B: C ratio has been given in Table 3. It is observed that intercropping of soybean and pigeon pea References gave LER 1.47 in 2:1, 1.28 in 4:2 and 1.31 in 3:2 systems. Pigeon pea equivalent yield was in 3:2 system followed by 2:1 system of intercropping. The cultivation Ahlawat IPS, Singh A , Mehta NK (1982) Studies on weed control in solid and mixed stands of pigeon pea of sole pigeon pea was more profitable than sole and soybean. Indian J Agron 27(2): 191-193 soybean. The benefit cost ratio 3.59 was in 3:2 system Anonymous (2008) Annual progress report. All India followed by 3.44 in 4:2 system of intercropping. The Coordinated Research Project on Dry land intercropping of soybean variety JS 93-05 with pigeon Agriculture. College of Agriculture JNKVV Rewa MP pea was remunerative than JS 335. Billore SD, Singh K , Bargale Mridula , Nahatkar SB (1993) Economics of pigeon pea (Cajanus cajan) and soybean (Glycine max) in intercropping at varying orZeku iz;ksx vf[ky Hkkjrh; lefUor ’kq"d Hkwfe vuqla/kku ifj;kstuk fertility levels. Indian J Agron 38(3): 365-369 ds dqBqfy;k iz{ks= ij [kjhQ _rq esa o"kZZ 2008 esa fd;k x;kA ifj.kke Holkar S, Jagtap JG, Billore SD, Mishra VK (1991) Evaluation ls Kkr gksrk gS fd lks;kchu dh rqyuk esa vjgj dh [ksrh ykHknk;d of soybean (Glycine max) and pigeon pea (Cajanus cajan) genotypes grown in intercropping system. gSA lks;kchu ,oa vjgj dks vUrjorhZ [ksrh esa lkFk&lkFk yxkus ij Indian J Agri Sci 61(2):93-96

358 Jathao SL, Kharkar RT, Turkhede AB ,Shinde VV, Daterao Prasad K, Gautam RC, Mehta NK (1985) Studies on weed SH(1992) Row proportion and fertilizer management control in Arhar (Cajanus cajan) and soybean studies in pigeon pea - soybean intercropping (Glycine max) as influenced by planting pattern, system. PKV Res J 16(1): 21-25 intercropping and weed control methods. Indian J Lakhena KK , Maurya BM (2009) Intercropping of soybean Agron 30(4): 435-439 and pigeon pea under rainfed condition. Mysore J Singh A, Prasad R, Sharma RK (1991) Studies on Agric Sci 43(2): 369-373 intercropping of soybean (Glycine max) cultivars in Maurya BM (2000) Growth and yield of pigeon pea as pigeon pea (Cajanus cajan). Indian J Pulse Res influenced by association of soybean and 4(1):61-64 phosphorus application. GAU Res J 25(2):15-19 Tomar SS, Upadhyay MS, Sharma RA (1987) Effect of planting Maurya BM, Rathi KS (2000) Growth and development of pattern in pigeon pea (Cajanus cajan) + soybean soybean as influenced by intercropping with pigeon (Glycine max) intercropping system. Indian J Agron pea and phosphorus level. GAU. Res J 26(1) 1-5 32(4): 322-325 Nimje PM (1995) Effect of spatial arrangement and Willey RW (1979) Intercropping its importance and research phosphorus fertilizer in pigeon pea (Cajanus cajan) needs part 2. Agronomy and Research approach. + soybean (Glycine max) intercropping systems. Field Crop Abstract 32(1&2):1-10 and 73-85 Indian J Agron 40(3): 380-385 (Manuscript Receivd : 18.01.2011; Accepted 18.06.2012)

359 JNKVV Res J 46(3): 360-364 (2012)

Soil properties of Bheeta village Jabalpur and its land capability classification

B.S. Dwivedi*, B.K. Dixit**, P.C. Amule and N.K. Khamparia*** *Krishi Vigyan Kendra, Rewa 486001 (MP) **College of Agriculture, Tikamgrah 472001 (MP) ***College of Agriculture, Rewa 486001 (MP)

Abstract Material and methods

Twenty surface soil samples were collected from various fields The study area lies between 230-9’-45” N latitude and of Bheeta village Jabalpur district depending upon colour, 790-48’-30” E longitude with an elevation of 358 m above texture and slope were analysed to study for physicochemical MLS. The general topography of the Bheeta village properties, available nutrients and land capability classification. Jabalpur district is nearly level except in the vicinity of The results indicated that soils of village were clay to clay river Narmada and its streams. The soils of village have loam in texture. The soil reaction (pH) was found to range formed from horizontally bedded basaltic lavas and from 6.6 (slightly acid) to 7.9 (moderately alkaline) with normal alluvium. The climate of the area is hot subhumid with electrical conductivity. The soils were low in organic carbon well expressed summer (April to June), rainy season and available nitrogen and medium to high in available (June to September) and winter season (October to phosphorus and high in available potassium, while available March). The mean annual precipitation is 1333 mm of S and Zn were found low to medium. The soils were classified which more than 85 per cent is received during monsoon into B, A and E soil irrigability classes. Land with irrigability season. Soil moisture regime is Ustic along with classes 2 and 3 were most dominant. The area of Bheeta Hyperthermic soil temperature regime. village has been classified into four classes IIs1, IIs2, IIIe3 and VIs. Land with capability classes IIs1 and IIIe3 were most Twenty surface soil samples were collected from dominant in a substantial area under cultivation. different locations depending upon colour texture and slope. The soil samples were analyzed in the laboratory for physicochemical properties and available nutrients Keywords: Surface soil samples, available N, P, K, S, using standard procedures such as particle distribution Zn and land capability classification. by Bouyoucos Hydrometer method (Bouyoucos 1927), bulk density by tapping method (Johnson 1979), pH and The fertility status of soils is of prime importance for its EC (Piper 1966). Calcium carbonate was estimated by appropriate use and increased crop production. Soils acid titration method (Piper 1966). The cations of Bheeta village of Jabalpur district are probably less exchange capacity (CEC) and exchangeable cations fertile. The soil and land use survey helps to define were determined as described by Bower et al. (1952) and demarcate the extent and location of soil types. and Black (1965), respectively. Available nutrient were Land evaluation techniques have the best potential for analyzed as N (Subbiah and Asija 1956), P (Olsen et identifying agricultural suitability of land consequently al. 1954), K by extraction with neutral normal ammonium for the transfer of agro technology. Land capability acetate and estimate through flame photometer, classification is an interpretative grouping of soils mainly available S by turbidity method and available Zn using based on the inherent soil characteristics, external land DTPA extraction as described by Lindsay and Norvell features and environmental factors that limit the use of (1978). The soils were grouped according to their land. Information on fertility status and land capability characteristics for soil irrigability, land irrigability and classification of these soils is lacking. In view of this land capability classes in order to judge the existing the present investigation was undertaken. limitations for crop production.

360 Results and Discussion

Physical properties of soil

} The data presented in Table 1 indicate that the soil texture of surface soils of Bheeta village varied from clay to clay loam with dominance of clay (Figure 1). The bulk density varied from 1.29 to 1.42 Mgm-3 and {cmol (p+) kg-1 -3

Exchangeable cations particle density form 2.29 to 2.41 Mg m . The highest

Ca++ Mg++ Na+ K+ values of bulk density and particle density were found in field No. 188 and field No. 99, respectively. Trivedi et

]

-1 al. (2007) also reported such high amount of clay in the black soils.

[cmol(p+) kg

) Chemical properties of soil

-1

OCCEC The soil reaction (pH) was found to range from

3 ) (g kg 6.6 (slightly acid) to 7.9 (moderately alkaline) with a

-1 mean value of 7.2 (neutral). The electrical conductivity

CaCO of soils was found normal and varied from 0.04 to 0.16 dSm-1. The content of CaCO in the soils ranged from ) (g kg 3 -1 5.10 to 41.00 g kg-1. It was found higher in clay loam

(dSm soils. Similar results were reported by Tripathi et al. (2004). Organic carbon varied from 3.2 to 7.3 g kg-1 with an average of 4.8 g kg-1. Cations exchange capacity of soils ranged from 27.41 to 42.93 cmol (p+) kg-1 (1:2.5) (Table 1).

)

-3 Fertility status soils

Particle pH EC

) (mg m -3 The data presented in Table 2 indicate that the available -1

Bulk nitrogen varied from 151.20 to 270.90 kg ha with a density density mean value of 213.10 kg ha-1. Generally the presence of low amount of available nitrogen in soils might be due to its removal by the crops, transformation to exture elemental nitrogen etc. (Dwivedi et al. 1998). Available phosphorus in the soils samples ranged from 8.0 to 11.2 kg ha-1 and its status was medium to high. The status of

Clay T available potassium was found high and varied from 495 to 945 kg ha-1 with mean value of 727.87 kg ha-1 (Bhatta et al. 2005). The available sulphur in surface (%) (%) (USDA) soil samples varied form 3.1 to 18.0 mg kg-1 with an average of 6.24 mg kg-1 and available Zn ranged from 0.50 to 1.08 mg kg-1 with mean value of 0.78 mg kg-1.

Soil mapping units

Avg. 32.30 22.48 45.12 - 1.34 2.34 7.2 0.10 15.3 4.8 37.18 24.52 9.79 0.60 0.53

Field Sand Silt The soil mapping units fixed after physical and chemical studies of the Bheeta village soils are depicted in Figure 2. The characteristics were fine texture (C), deep (5),

Table 1. Physicochemical properties of surface soil samples Table Surface

S1 140 33.42 22.04 44.54 c 1.36 2.36 7.4 0.05 8.0 4.0 39.65 26.00 11.06 0.63 0.45 sample No.S2 (%) 180 39.65 22.70 37.65 cl 1.40 2.38 7.3 0.16 37.0 6.5 27.41 18.04 5.53 0.53 0.39 S3 11 28.40 23.85 47.75 c 1.31 2.32 6.5 0.05 6.2 5.0 40.34 26.67 11.14 0.64 0.47 No.S4 188 38.81 22.94 38.25 cl 1.42 2.39 (mg m 7.9 0.16 35.0 3.2 28.05 19.38 5.62 0.61 0.38 S5 20 30.75 19.20 50.05 c 1.33 2.34 7.1 0.05 7.0 7.3 42.93 26.58 12.06 0.65 0.60 S6 86 28.76 24.52 46.72 c 1.35 2.34 7.1 0.14 6.5 4.2 40.11 26.94 10.65 0.56 0.43 S7 171 37.35 22.68 39.97 cl 1.40 2.36 7.5 0.13 36.7 4.0 29.21 19.48 6.78 0.57 0.50 S8 30 29.62 24.15 46.23 c 1.33 2.32 6.7 0.12 7.5 4.0 39.74 26.12 10.83 0.59 0.49 S9 41 28.94 22.42 48.14 c 1.29 2.30 6.8 0.04 6.5 6.5 41.05 26.73 11.17 0.63 0.46 S10 176 38.24 22.80 38.96 cl 1.41 2.35 7.9 0.14 38.3 4.3 28.74 21.20 6.55 0.62 0.37 S11 25 30.72 19.70 49.58 c 1.35 2.34 6.5 0.04 6.1 5.0 42.12 26.12 11.87 0.64 0.52 S12 59 30.21 22.62 47.17 c 1.36 2.33 7.1 0.19 5.7 4.2 40.20 25.96 11.64 0.58 0.63 S13 100 29.10 22.30 48.60 c 1.32 2.32 7.1 0.14 6.8 4.5 41.00 27.18 11.14 0.64 0.63 S14 54 30.25 20.40 49.35 c 1.31 2.30 7.0 0.05 5.7 6.5 42.06 28.61 10.36 0.66 0.67 S15 153 37.52 22.70 39.78 cl 1.33 2.33 7.8 0.13 25.6 4.3 29.14 19.34 6.62 0.58 0.62 S16 99 27.95 23.30 48.75 c 1.35 2.41 7.1 0.15 7.0 5.2 41.14 27.43 11.50 0.62 0.65 S17 82 28.60 24.45 46.95 c 1.35 2.36 6.5 0.06 8.0 4.0 40.07 25.85 11.58 0.59 0.63 S18 194 38.71 21.84 39.45 cl 1.37 2.32 7.9 0.14 41.0 4.0 28.87 20.23 6.44 0.58 0.57 S19 108 29.25 22.85 47.90 c 1.31 2.37 7.3 0.06 7.0 5.2 40.77 25.87 11.64 0.62 0.64 S20 74 29.75 21.65 46.60 c 1.34 2.30 7.2 0.04 5.1 4.3 41.07 26.70 11.76 0.64 0.58

361 vertic (V) and moderately well drained (4) in case of Soil irrigability classification SCS and fine texture (c), nearly level(A) and slight erosion (e1) in case of SP. As regard SSP, pedon1 The soil have been evaluated for their irrigation existed under moderately fine (e), pedon 2 under fine suitability and were classified into B, A and E (Table 3) (c) and pedon 3 fine loamy (m) with ground water soil irrigability classes. It was observed that soil with between 50 and 100 cm depth (W). Pedon 4 indicated irrigability classes B and A were most dominant covering moderately fine (E), medium (4), cambic horizon (B), large cultivated area. Clay texture and available water well drained (5) and slightly calcarious and its amount holding capacity often in combination may create increased with depth (C1) in case of SCS, moderately drainage problems thus are the limitations. The fine (e), gently slopping (C) and severe in erosion (e3) remaining area under classes E is non-irrigable. in case of SP, and moderately fine loamy (l) with ground water is between 50 and 100 cm depth (W).

Table 2. Available nutrients status of surface soil samples

Surface Field Av.-N Av.-P Av.-K Av.-N Av.-N sample No. No. (kg ha-1) (kg ha-1) (kg ha-1) (kg ha-1) (kg ha-1) S1 140 189.00 11.2 753.75 3.8 0.52 S2 180 255.15 11.2 573.75 3.5 0.72 S3 11 223.65 8.0 776.25 17.0 1.02 S4 188 151.20 8.0 652.50 3.1 0.70 S5 20 270.90 8.2 955.00 3.6 1.02 S6 86 195.30 8.8 720.00 3.9 0.81 S7 171 189.00 9.6 562.50 5.3 0.74 S8 30 189.00 8.8 776.25 18.0 0.86 S9 41 255.15 9.6 821.25 4.2 1.02 S10 176 207.90 11.1 596.25 4.0 0.64 S11 25 223.65 9.3 798.75 15.70 0.76 S12 59 195.30 8.5 855.00 3.0 0.78 S13 100 207.90 8.3 675.00 8.7 0.60 S14 54 255.15 8.0 866.25 4.0 0.70 S15 153 198.65 10.2 855.00 3.2 1.06 S16 99 226.80 8.4 663.75 8.7 0.86 S17 82 189.00 8.4 708.75 4.0 0.50 S18 194 189.00 8.2 495.00 3.0 0.70 S19 108 226.80 8.8 686.25 8.7 1.08 S20 74 223.65 8.3 776.25 3.6 0.59 Avg. 213.10 9.0 727.87 6.4 0.78 Av.-N: Available nitrogen, Av.-P: Available phosphorus, Av.-N: Available Potassium, Av.-N: Available sulphur and Av.-N: Available zinc

Table 3. Soil mapping units, soil irrigability, land irrigability and land capability classes

S.N. Pedon Soil mapping units Soil Land Land Production SCS SP SSP irrigability irrigability capability potential classes classes classes

1 P1 C5/ V4 cAe1 eW B 2s IIs1 Medium 2 P2 C5/ V4 cAe1 cW B 3s IIs1 Medium 3 P3 C5/ V4 cAe1 mW B 2s IIs2 Medium 4 P4 E4/ B5(c1) eCe3 lW A 3t IIIe3 Low 5 P5 L3/ B5 lDe4 lW E 5st - -

SCS-Series Control Section, SP- Surface phase, SSP-Substratum phase

362 Land irrigability classification country. The area under investigation has been classified into four classes II s1, IIs2, IIIe3 and VIs. Land The area under Bheeta village has been classified into with capability classes II s1 and IIIe3 were most 2, 3 and 5 (Table 3) land irrigability classes. Land with dominant covering large cultivated area of the village. irrigability classes 2 and 3 were most dominant covering Clay texture, soil depth, erosion, often in combination large cultivated area (Figure 3). Soil constraints (s) and are the limitations. The rest of the area under class VIs topographic position (t) often in combination are the is not suitable for agriculture and require to be used for limitations. The rest of the area under class 5 is pastures or forestry. The production potential were rated temporarily non- irrigable (unclassified). Similar findings from low to medium. Similar results were also reported were also reported by Sharma et al. (2004). by Sahoo et al. (2009).

Land capability classification HkhVk xkWo ls tgkW jax] xBu ,oa

363 fd, x;s ,oa v/;;u fd;k x;kA e`nk xBu dh n`f"V ls e`nk;sa fpduh Johnson IJ (1979) Introductory soil science- A study guide and laboratory manual. Macmillan pub Co Inc USA ls fpduh nqeV jghaA e`nk vfHkfØ;k ¼ih-,p-½ 6-6 ¼gYdh vEyh;½ pp 69-71 ls 7-9 ¼e/;e {kkjh;½ jghaA e``nk dh fo|qr pkydrk lkekU; ,oa Lindsay WL, Norvell WA (1978) Development of DTPA test lsUnzh; dkcZu fuEu ik;k x;kA e“nkvksa dks esa miyC/k u=tu fuEu] for Zn, Fe, Mn and Cu. Soil Sci. Soc Am J 42: 421- 428 miyC/k LQqj e/;e ls vf/kd ,oa miyC/k iksVk’k vf/kd ik;k x;k Olsen SR, Cole CV, Watanabe FS, Dean LA (1954) Estimation tcfd miyC/k xa/kd ,oa ftad fuEu ls e/;e jgkA e`nkvksa dks B, of available P in soils by extraction with NaHCO3. USDA Circ No 939 A ,oa E e``nk flapkbZ Jsf.kvksa esa oxhZ—r fd;k x;kA Hkwfe flapkbZ Piper CS (1966) Soil and plant analysis. Hans Publishers Jsf.kvksa esa 2 ,oa 3 lcls vf/kd izHkkoh ns[kh x;hA HkhVk xkWo ds {ks= Bombay dks pkj Hkwfe {kerk Jsf.kvksa IIs1, IIs2, IIIe3 ,oa VIs esa oxhZ—r Sahoo AR, Sarkar Dipak, Gangopadhyay SK, Butte PS (2009) IIs1 IIIe3 Soils of Lohardaga District, Jharkhand-Their fd;k x;kA Hkwfe n{krk Jsf.k;kW ,oa cgqr izHkkoh jgh ,oa characteristics, Potentials and Limitations towards foLr`r —f"kr {ks= esa QSyh gqbZ ik;h x;hA Optimizing land use. Abstract. Platinum Jubilee Symposium on Soil Science in Meeting the Challenges to Food Security and Environmental References Quality dated on 22-25 Feb 2009 at IARI, New Delhi, pp 7-8 Bhatta A, Roy GB, Saha D (2005) Study on Soil of Sharma VK, Sharma PD, Sharma SP, Acharya CL, Sood RK Budhabudhiani Irrigation Project in Nayagarh District (2004) Characterization of Cultivated Soils of Neogal of Orissa: I. Characterization and classification of Watershed in North-West Himalayas and their Soils and their Productivity Potential. J Indian Soc Suitability for Major Crops. J Indian Soc Soil Sci 52 Soil Sci 53 (2) : 163-171 (1) : 63-68 Black CA (1965) Method of soil analysis. Part I & II. Agronomy Subbiah BV, Asija GL (1956) A rapid procedure for the series No 9 Amer Soc Agro Inc Madison, Wisconsion, estimation of available N in soil. Curr Sci p. 25 USA Tripathi PN, Gupta GP, Dwivedi BS (2004) Characterization Bouyoucos GJ (1927) The hydrometer as a new method for and classification of soils of Jawaharlal Nehru Krishi the mechanical analysis of soil. Soil Sci 23:343-353 Vishwa Vidyalaya Farm Jabalpur Madhya Pradesh. JNKVV Res J 38(2) : 22-26 Bower CA, Reitemeier RF, Fireman M (1952) Exchangeable cation analysis of saline and alkali soils. Soil Sci Trivedi JPN, Gupta GP, Trivedi Archana (2007) Pedogenesis 73:251-261 and Taxonomy of some pulse growing soils of Narsinghpur district Madhya Pradesh. Ann Pl Soil Dwivedi BS, Tembhare BR, Gupta GP (1998) Vertical Res 9(2) : 122-125 distribution of available nutrients in Haplusterts and Haplustepts of Bheeta village, Jabalpur Madhya Pradesh. JNKVV Res J 32:59-61 (Manuscript Receivd : 13.10.2012; Accepted 07.05.2012)

364 JNKVV Res J 46(3): 365-367 (2012)

Isolation of salt tolerant cyanobacterium Synechococcus spp. and its use for reclamation of salt affected agricultural soil

S.S. Yadav, V.S. Chauhan and Bhanumati Singh Department of Biotechnology Bundelkhand University Jhansi 284304 (UP)

Abstract (Yancey et al. 1982). The osmoprotectant is synthesized in response to the stress and is localized in the + - Salinity is a serious agro-economical problem which leads to cytoplasm; inorganic ions such as Na and Cl are metabolic alterations and graded reduction in the plant growth. preferentially sequestered into the vacuole (Flowers et The ability of cells is to survive and flourish in saline al. 1977); (Bohnert et al. 1995); (Glenn et al. 1999). environment is reduced under the influence of salt stress Thus, this leads to turgor maintenance for the cell under condition. Isolation of salt-tolerant mutant which can withstand osmotic stress. high salt concentration may be helpful in reclamation of salt- affected soil. The present investigation is carried out to isolate a NaClr mutant strain of adiazotrophic unicellular Material and methods cyanobacterium Synechococcus spp. with the help of chemical mutating agent NTG and grown under various NaCl concentrations (100mM, 200mM, 300mM and 400mM). study Organism and culture conditions shows that NaCI at 100 mM concentration hardly had any r significant effect on survival of both wild-type and NaCl mutant Cyanobacteria Synechococcus spp. Obtain from BGA strains. Whereas, in medium containing 400 mM NaCl survival Department IARI New Delhi and its NaCl tolerant mutant of NaClr mutant strains was more, however, at this concentration survival of wild-type was reduced to 50%. were grown in BG-11 medium by maintaining the culture at 24±1°C with a photosynthetic photon flux density of approximately 40 μmol m-2 sec-1 and a light regime of Keywords: Cyanobacteria, salt-stress, mutation and 18 hr light 6 hr dark. NaClr mutant

Mutagenesis and isolation of NaCIr mutant strain Salt stress is a major environmental factor that limits plant growth and productivity (Boyer 1982); (Pitman and Läuchli 2002). Reductions in plant growth under salt Exponentially growing cells of Synechococcus spp. were stress conditions are often associated with a decrease harvested by centrifugation and resuspended in 10 mM in photosynthetic activity and often occurs in many HEPES/NaOH. NTG was added to make a final plants (Munns et al. 2006); (Chaves et al. 2009) Salinity concentration of 250 ug mI-1 (Chauhan et al. 1999b). stress is the major factor to limit plant growth and This suspension was incubated at 30 0C for 4 h in light productivity in many areas of the world (Allakhverdiev (50 μmol m-2s-1) with shaking. Treatment was terminated et al. 2000); (Ashraf 2009). Cyanobacteria is a group of by washing cells three times with BG-11 medium and plants. These groups of ancient autotrophs, more known resuspending them in the same medium. It resulted in as blue-green algae, have an oxygen-evolving 1% survival of cells. In order to isolate mutant resistant photosynthetic apparatus similar to plants and they are to NaCl, mutagenized cells were grown considered to be the ancestors of plant chloroplasts photoautotrophically for several generations, sonicated (Rodriguez-Ezpeleta et al. 2005). Plants reveals that as above, and plated onto BG-11 medium solidified with cyanobacteria under stress accumulats. Marine algae, 1.5% agar (w/v), containing 400 mM NaCl; a bacteria and other organisms accumulate organic concentration which completely arrested growth of wild- solutes such as sugar, alcohols, amino acid, proline, type strain. Plates were then incubated at 24±1oC and sulphonium compounds in response to osmotic stress at a photon fluence rate of 50 umol m-2 s -1 to allow colony

365 development. Colonies resistant to NaCl were taken up and NaClr mutant strains. Whereas, in medium and are streaked five times on a selective medium, prior containing 400 mM NaClr, survival of NaClr mutant strain to culturing in liquid BG-11 medium containing 10 mM was more. However, at this concentration survival of HEPES/ NaOH and 400 mM NaCl. Strain, thus isolated wild-type was reduced to 50%. Many workers reported showed more tolerance towards NaCl and the same that halotolerant cyanobacterium can grow in a wide was designated as NaClr. This mutant strain was range of salinity (0.25 to 3.0 M NaCl) as well as at routinely cultured and used for further studies. alkaline pH conditions (Kanteera Soontharapirakkul et al. 2011). We have, therefore chosen this concentration of NaCl and employed in all experiments, NO /NO Measurement of growth 3 2 uptake assay and nitrogenase acticity (Data not shown).

Growth was monitored by measuring increase in chl a and protein content and was expressed in terms of specific growth rate (µh-1). The specific growth rate constant (µ) corresponds to In 2/td, where td is the doubling time (Mackiney 1941); (Lowry et al. 1951).

Percent survival

Percent survival of wild-type Synechococcus spp. and its NaClr mutant strain was determined by growing both the strains in liquid BG-11 medium containing different concentrations of NaCl (100, 200, 300, 400, 500 mM). Growth of both the strains in terms of chl a was recorded after 7 days and expressed in terms of percent survival against NaCl-untreated cells as control (Chauhan et Figure 1. Effect of NaCl (in term of percent of survival) al. (1999a). on wild-type and NaClr mutant strain of Synechococcus spp. Results and Discussion Yko.krk ,d xHkhj Ñf"k vkfFkZd leL;k gSA ftlesa ikS/kk esa izeq[krk ls The growth of Synechococcus, adapted to 400 mM NaCl in response to various NaCl concentration ratio was p;kip; fØ;k esa Qsjcny rFkk ikS/kksa dh o`f) ij izfrdwy vlj studied by measuring the change in cell number in iMrk gSA Yko.kh; Ik;kZoj.k esa dksf'kdkvksa dk thfor jguk ] iuiuk culture medium (Fig. 1). The NaCIr mutant strain of rFkk mldh {kerk ij izfrdwy izHkko fn[krk gSA Yko.k lgu'khy adiazotrophic Cyanobacterium Synechococcus spp. by NTG mutagenesis and screened for growth in medium mRifjorZu ls izFkDdj.k uLy tks fd mPp yo.krk ls izHkkfor Hkwfe containing 400 mM NaCl, concentration at which growth dks lq/kkjus esa lgk;d gks ldrh gSA orZeku esa fd;s x;s "kks/k ls irk of its wild-type in liquid medium was completely arrested pyrk gS fd yo.k lgu'khy mRifjofrZr uLy vMk;tksVªkfid within 2 weeks (Chauhan et al. 1999b). A wide range of mutagens has been used to induce mutations in ,ddksf'kdh; uhy gfjr "kSoky Lusdksdksdl uLy ftls jklk;fud Cyanobacteria Synechococcus spp. (Delaney et al. mRifjorZd dkjd ,u-Vh-th-@bZ-,e-,l- dh lgk;rk ls izkIr fd;k 1976). x;k vkSj bUgsa fofHkUu yo.kh; lkUnzrk okys ek/;e ¼ƒ00 fe-eks-] In order to select a mid-inhibitory survival "00 fe-ek-] …00 fe-eks- rFkk †00 fe-eks-½ esa mxk;k x;k gSA concentration of NaCI for wild-type and also to see its impact on survival of NaClr mutant strain, both these v/;;u fn[kkrk gS fd ƒ00 fe-eks- yo.kh; lkUnzrk okys ek/;e esa strains were exposed to various concentrations of NaCI dksf'kdk;sa cMh eq'kfdy ls thfor jgus dk izHkko fn[krh gSA tcfd (100, 200, 300, 400 and 500 mM) for 7 days. Their †00 fe-eks- yo.kh; lkUnzrk okys ek/;e esa mRifjofrZr uLy growth in liquid medium was recorded (in terms of chI a) and expressed in terms of percent survival (Fig 1). It vklkuh ls thfor jgus dk izHkko iznf'kZr djrh gSA ;/kfi bl lkUnzrk is evident that NaCI at 100 mM concentration hardly okys ek/;e esa oU; izdkj dh dksf'kdk;ksa esa flQZ ‡0 izfr'kr dh deh had any significant effect on survival of both wild-type gksrh gSA

366 References Glenn EP, Brown JJ, Blumwald E (1999) Salt tolerance and crop potential of halophytes. Critical Reviews in Plant Science 18 Allakhverdiev, SI, Sakamoto A, Nishiyama Y, Inaba M, Murata Kanteera Soontharapirakkul (2011) Halotolerant N (2000) Ionic and osmotic stress effect of NaCl- Cyanobacterium aphanothece helophytica contains induced inactivation of photosystem I and II in a NA+- dependent F1F0- ATP synthase with potential Synechococcus sp. Plant Physiol 123: 1047-1056 role in salt-stress tolerance. JBC Papers in Press. Ashraf M (2009) Biotechnological approach of improving plant Published on January 24, 2011 as Manuscript salt tolerance using antioxidants as markers. M110.208892 Biotechnol. Adv 27: 84-93 Lowry OH, Rosebrough NJ, Farr AL, Radall RJ (1951) Protein Bohnert HJ, Nelson DE, Jensen RG (1995) Adaptations to measurement with the folin-phenol reagent. J Biol environ-mental stresses. The Plant Cell 7: 1099-1111 Chem 193: 265-275 Boyer JS 1982 Plant productivity and environment. Science Mackiney G (1941) Absorption of light chlorophyll solution. J 218: 443-448 Biol Chem. 140: 315-22. Chauhan VS, Singh S, Pandey PK, Bisen PS (1999a) Isolation Munns R, James RA, Lauchli A (2006) Approaches to and partial characterization of NaCl-tolerant mutant increasing the salt tolerance of wheat and other strain of Anabaena variabilis with impaired cereals. J Exp Bot 2006 57: 1025-43 gluatamine synthetase activity. J basic Microbiol 39: Pitman MG, Lauchli A (2002) Global impact of salinity and 219-226 agricultural ecosystems. In: Lauchli A, Luttge E, Chauhan VS, Singh S, Bisen, PS (1999b) Development of editors. Salinity: environment-plants-molecules. NaC-resistant mutant strain of the diazotrophic Dordrecht: Kluwer Academic Publishers 2002: P. 3- Cyanobacterium Anabena variabilis having 20 depressed nitrogenase and impaired glutamine Rodriguez R, Redman R (2005) Balancing the generation and synthesis activities. Physiol Mol Biol Plant 5: 33-36 elimination of reactive oxygen species. Proc Natl Chaves MM, Flexas J, Pinheiro C (2009) Photosynthesis under Acad Sci USA 102: 31756 drought and salt stress regulation mechanisms from Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN whole plant to cell. Ann Bot 2009 103: 551-60 (1982) Living with water stress: Evolution of osmolyte Delaneys F, Herdmanm, Carr, NG (1976) Genetics of blue- systems. Science 217: 1214-1222 green algae. In Genetics of Algae, pp. 7-29. Edited by R A Lewin. Oxford: Blackwell Scientific Publications (Manuscript Receivd : 30.10.2011; Accepted 02.03.2012) Flowers TJ, Troke PF, Yeo AR (1977) The mechanisms of salt tolerance in halophytes. Annual Review of Plant Physiology 28: 89-121

367 JNKVV Res J 46(3): 368-370 (2012)

Application of biochemical parameters for characterization of soybean mutants and elite lines

S.S. Sawarkar, A.N. Shrivastava, M.K. Shrivastava and Stuti Mishra Department of Plant Breeding and Genetics Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482004 (MP)

Abstract Peroxidase activity test

Among four biochemical tests only two, namely peroxidase Seed coat of 10 randomly selected healthy seeds of activity and sodium hydroxide test were found to be effective each variety was removed with the sharp razor blade in characterizing the soybean genotypes. No variation among and placed in test tubes without any portion of the soybean genotypes was observed for KOH-bleach test cotyledon.10 drops 0.5% guaicol solution was added and phenol colour test. Peroxidase activity test was found in each test tube. After 10 minutes, 2-3 drops of 0.1% present in only one mutant of JS 335, none from JS 93-05 hydrogen peroxidase was added in each test tube and the varieties were classified based on the intensity of and seven of NRC 37 have showing difference from their colour developed in the solution as high peroxidase parents. On the basis of sodium hydroxide test, nine mutants activity. of JS 335, nine of JS 93-05 and nineteen mutants of NRC 37 showed positive response differencing from their parents. Phenol colour test Key words: Soybean, biochemical, mutants, elite lineªª Water soaked seeds (18 hr) were arranged in the petriplates with two layers of filter paper. In each Soybean (Glycine max L.) Merrill is the most importance petriplates 4 ml of 1%solution (v/v) of carbolic acid was oilseed crops in India. It is a major rainy season crop of added and the intensity of colour developed on the the rainfed agro-ecosystem of India. Significant seeds was observed visually after 4 hrs (Walls 1963) contribution of MP in area and production of soybean as black (++++), brown (+++), light brown (++) and no recognized MP as “Soya State”. In view of this aspect, reaction (-). seeds of soybean cultivars viz., JS 335, NRC 37, and JS 93-05 irradiated with 250 and 300 Gy doses of KOH- bleach test gamma- rays. Several mutants have been isolated and their diversity studies based on breeding behavior has been conducted. Biochemical parameters are found well Randomly selected 10 seeds of each variety were to access genetic variability in soybean cultivars. In immersed in KOH-bleach solution (1:5 W/V) for 10 soybean, different cultivars have been characterized minutes and were gently swirled, periodically. The seeds from time to time on the basis of biochemical studies were rinsed and observed after drying for development (Buttery et al. 1968, Payne 1976). In the present study, of colour to categorize the varieties as positive (red biochemical parameters have been used to access the colour) and negative (no reaction). (Payne et al.1980). variability among mutants and elite lines of soybean. Sodium hydroxide test Material and methods Seeds washed with distilled water, and soaked in 5% Different biochemical parameters have been used as sodium hydroxide (AR grade) solution for 30 minutes, mentioned below after the treatment, seeds washed again with distilled

368 Table 1. Characterization of soybean mutants and elite lines based on biochemical tests

Mutants/Variety Peroxidase KOH NaOH Phenol Mutants/Variety Peroxidase KOH NaOH Phenol activity bleach test test activity bleach test test test test test test JS 335 (250 GY) JSM 224 Absent Absent Absent Absent JSM 3 Absent Absent Absent Absent JSM 226 Absent Absent Present Absent JSM 5 Absent Absent Absent Absent JSM 227 Absent Absent Absent Absent JSM 7 Absent Absent Absent Absent JSM 228 Absent Absent Absent Absent JSM 13 Absent Absent Absent Absent JSM 229 Absent Absent Absent Absent JSM 17 Absent Absent Absent Absent JSM 230 Absent Absent Present Absent JSM 117 Absent Absent Absent Absent JSM 232 Absent Absent Present Absent JSM 184 Absent Absent Absent Absent JSM 236 Absent Absent Absent Absent JS 335 (300 GY) JSM 276 Absent Absent Absent Absent JSM 16 Absent Absent Absent Absent JSM 277 Absent Absent Present Absent JSM 20 Absent Absent Absent Absent JSM 281 Absent Absent Absent Absent JSM 119 A Absent Absent Present Absent JSM 283 Absent Absent Absent Absent JSM 119 B Absent Absent Absent Absent JSM 284 Absent Absent Absent Absent JSM 120 A Absent Absent Present Absent JSM 298 Absent Absent Present Absent JSM 120 B Absent Absent Absent Absent NRC 37 (300 GY) JSM 122 Absent Absent Present Absent JSM 115 Absent Absent Absent Absent JSM 126 Absent Absent Present Absent JSM 155 Absent Absent Absent Absent JSM 127 Present Absent Present Absent JSM 160 Present Absent Present Absent JSM 185 Absent Absent Absent Absent JSM 170 Absent Absent Absent Absent JSM 188 Absent Absent Present Absent JSM 171 Absent Absent Present Absent JSM 189 Absent Absent Present Absent JSM 175 Absent Absent Absent Absent JSM 191 Absent Absent Absent Absent JSM 238 Present Absent Present Absent JSM 195 Absent Absent Present Absent JSM 239 Absent Absent Present Absent JSM 265 Absent Absent Absent Absent JSM 240 Absent Absent Absent Absent JSM 266 Absent Absent Present Absent JSM 242 Absent Absent Present Absent JSM 310 Absent Absent Absent Absent JSM 245 Absent Absent Absent Absent JS 93-05 (250 GY) JSM 246 Absent Absent Absent Absent JSM 30 Absent Absent Absent Absent JSM 248 Absent Absent Present Absent JSM 35 Absent Absent Absent Absent JSM 250 Absent Absent Absent Absent JSM 37 Absent Absent Present Absent JSM 256 Absent Absent Absent Absent JSM 45 Absent Absent Absent Absent JSM 259 Absent Absent Present Absent JSM 52 Absent Absent Absent Absent JSM 285 Absent Absent Present Absent JSM 60 Absent Absent Present Absent JSM 286 Absent Absent Absent Absent JSM 131 Absent Absent Absent Absent JSM 287 Present Absent Absent Absent JSM 135 Absent Absent Absent Absent JSM 288 Present Absent Absent Absent JSM 138 Absent Absent Present Absent JSM 290 Absent Absent Absent Absent JSM 196 Absent Absent Absent Absent JSM 294 Absent Absent Absent Absent JSM 200 Absent Absent Absent Absent JSM 299 Absent Absent Absent Absent JSM 202 Absent Absent Present Absent JSM 300 Absent Absent Absent Absent JSM 214 Absent Absent Absent Absent JSM 301 Absent Absent Present Absent JSM 139 Absent Absent Present Absent JSM 302 Absent Absent Absent Absent JSM 146 Absent Absent Absent Absent JSM 306 Absent Absent Absent Absent JSM 203 Absent Absent Present Absent JSM 307 Absent Absent Present Absent JSM 207 Absent Absent Present Absent Elite lines JSM 212 Absent Absent Absent Absent JS 335 Absent Absent Absent Absent JSM 269 Absent Absent Absent Absent JS 93-05 Absent Absent Absent Absent JSM 271 Absent Absent Present Absent JS 95-60 Absent Absent Absent Absent JSM 272 Absent Absent Absent Absent JS 97-52 Present Absent Present Absent JSM 275 Absent Absent Present Absent SL 96 Present Absent Present Absent JSM 297 Absent Absent Absent Absent SL 710 Absent Absent Absent Absent NRC 37 (250 GY) SL 744 Present Absent Absent Absent JSM 104 Absent Absent Present Absent SL 747 Absent Absent Present Absent JSM 149 Absent Absent Present Absent SL 790 Present Absent Absent Absent JSM 151 Absent Absent Absent Absent PK 768 Absent Absent Absent Absent JSM 152 Present Absent Present Absent SPC 175 Absent Absent Absent Absent JSM 154 Present Absent Absent Absent NRC 37 Absent Absent Absent Absent JSM 220 Absent Absent Present Absent JSM 222 Absent Absent Absent Absent JSM 223 Present Absent Absent Absent

369 water and observed the change in colour of seed coat. mRifjorhZ vkSj NRC 37 ds 7 mRifjorhZ izHkkoh ik, x, A lksfM;e The varieties with reddish brown colour of seed coat 335 grouped as positive (+) response, whereas without gkbZMªksDlkbM ijh{k.k ds vk/kkj ij] ts ,l ds ukS] ts,l change in colour grouped as negative (-) response 93&05 ds ukS vkSj NRC 37 ds mUuhl mRifjorhZ;ks us vius tudksa (Chemelar et al.1938). ls ldkjkRed fofHkUurk fn[kkbZ A

Results and Discussion References

Based on the activity of enzyme peroxides in the testa Buttery BR, Buzzell RI (1968) Peroxidase activity in seeds of of varieties, two categories are formed, the coloration soybean varieties. Crop Sci 8 (6):723-725 due to peroxidase activity was observed as absent [-] Chemelar F, Mostovoj K (1938) On the application of some and present [+]. Peroxidase activity was found absent old and on the introduction of new methods for testing in most of the mutants of JS 335 and NRC 37. Whereas, genuineness of variety in the laboratory. Prac. Int it was found present in only one mutant of JS 335 and Seed Testing Association 10:68 - 74 seven mutants of NRC 37. In case of JS 93-05 and its Da costa MP, Pereira LAG, Franca JDB neto (1979) all mutants, absence of peroxidase activity was Peroxidase activity as and aid for the identification observed. Peroxidase activity was found to be absent of soybean cultivars. Revista Brasileira de Sementes in elite genotypes namely JS 95-60, SL 710, SL 747, 1(1): 89-91 PK 768, SPC 175 and JS 20-09, whereas, it was present Lamani MR, Singh KP, Gaur AK and Prasad R (2003) in JS 97-52, SL 96, SL 744 and SL 790. It supports the Morphological and biochemical characterization of soybean (Glycine max) cultivars in central Himalayas. observation of Buttery and Buzzell (1968), Sader et al. Indian J Agric Sci 73(4): 215-218 (1987), Lamani et al. (2003) and Rani et al. (2004). Leenakumari SG, Zacharian Valarmath G, Francies RM (2000) On the basis of the intensity of colour developed Induced mutagenesis for rice improvement in Kerala. on seed. The varieties with reddish brown colour of seed In: proceeding of DAE-BRNS symposium on the use coat are grouped as positive (+) response, whereas of Nuclear and Molecular Techniques in crop improvement. Mumbai, India Dec 6-8 47-50 change in colour are grouped as negative (-) response. Payne RC (1976) Seed coat peroxidase activity as an aid in Reddish brown colour (positive) is developed on nine differentiating soybean cultivars AOSA Newsletter mutants of JS 335 different from parent (negative). In 50 (1): 43-45. case of JS 93-05, nine mutants recorded positive Payne RC, Koszykowski TJ (1980) An evaluation of the KOH- reaction to sodium hydroxide test, nineteen mutants bleach test of use in sorghum cultivar identification. showed positive response to sodium hydroxide test. AOSA Newsletter 62(1): 47-49 Reddish brown colour is developed on the seeds of elite Rani A, Kumar V and Hussain SM (2004) Identification of genotypes viz., JS 97-52, SL 96, SL 747 and JS 20-09 soybean cultivars using biochemical and whereas elite lines JS 95-60, SL 710, SL 744, SL 790, morphological characteristics at seed and seedling PK 768, SPC 175 recorded negative reaction to sodium stage. Indian J Plant Genet Resources 17(1): 205 - hydroxide test. No variation among the soybean mutants 206 and their parents is observed for phenol colour test. All Sader R, Rassini JB (1987) Assessment of varietal mixtures the genotypes under study showed negative response in soybean cultivars by peroxidase method. Rev Bras (no reaction) to test. Similarly, no variation among the Sem 9(3): 65-68. genotypes was observed for KOH-bleach test. All the Walls WE (1963) A standardized phenol method for testing genotypes exhibited negative response. wheat seed for varietal purity. AOSA Hand book 28 lks;kchu tuiz:i ij pkj tSo jklk;fud ijh{k.k fd;s x, ftl esa (Manuscript Receivd : 15.062012; Accepted 20.09.2012) ls dsoy nks] vFkkZr~ isjksfdlMst xfrfof/k ijh{k.k vkSj lksfM;e gkbZMªksDlkbM ijh{k.k izHkkoh ik, x, A lks;kchu thuiz:i ds chp ds vks ,p Cyhp ijh{k.k vkSj Qsuksy jax ijh{k.k esa dksbZ fofHkUurk ugha ikbZ x;h A isjksfDlMst xfrfof/k ijh{k.k esa] ts ,l 335 ds dsoy ,d

370 JNKVV Res J 46(3): 371-375 (2012)

Management of root knot nematode in lentil through the application of botanicals and biopestcides

Jayant Bhatt, S.P. Tiwari and Kamlesh Pawar Department of Plant Pathology Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract Material and methods

Management of root knot nematode in lentil was attempted Efficacy of botanicals against M. incognita through the application of botanicals and biopesticides under glasshouse conditions. The crushed and dried leaf powders Fresh and healthy leaves of ten plants belonging to of Datura, Neem and Lantana were effective in enhancing different families and with antinemic properties, were growth parameters. Reduced gall formation was noticed in dried ground and sieved through 25 mesh sieve. Trechoderma viride and Pseudomonas fluorescens. Increased Powdered leaves were homogeneously mixed with the plant growth parameters such as plant height, root length, sterile soil composite at 2.5, 5 and 10 g/kg soil and and fresh and dry weights of plant and decreased number of filled in 10 cm earthen pots containing 500 cm3 soil. galls on lentil roots as compared to check. The soil in pots was irrigated with fresh tap water to facilitate proper decomposition of leaves. One seed of Keywords: Meloidogyne incognita, plant powders, lentil (JL3) was sown per pot. On establishment of roots biological control the pots were inoculated with 1000 freshly hatched and surface sterilized second stage juveniles of M. incognita. Root-knot nematode, Meloidogyne incognita (Kofoid and Experiment was terminated 30 day after inoculation. White 1919) Chitwood, 1949, was encountered in the lentil (Lens culinaris) growing areas and plays as one Efficacy of different bio control agents against M. of the limiting factors affecting crop growth and profitable incognita production. Yield losses due to the nematode was estimated to 5 percent (Haider et al. 2003). The fungus P. lilacinus multiplied on wheat bran and The application pattern of chemical pesticides to commercial formulations of Pseudomonas fluorescens manage the nematode has increased particularly where and Trichoderma viride with 2 × 107 colony forming units production methods were intensified to increase were mixed with the 10 cm earthen pot with 500 cm soil agricultural output. Use of chemicals is costly, harmful @ 2 g/pot individually. for the microflora and fauna with long residual effects. Amendment of soil with decomposable organic matter Surface sterilized seeds of lentil (JL 3) were sown singly/pot. On establishment of roots seedlings were and bio-control agents is recognized as the most inoculated with 1000 freshly hatched second stage effective methods of changing soil and rhizosphere juveniles of M. incognita. Plants (without bio-agent) by environments there by adversely affecting the life cycle inoculating 1000 second stage juveniles of root-knot of pathogens and enabling the plant to resist attack of nematodes were also maintained that served as control. pathogens through better vigor and/or altered root physiology. Result and Discussion The present investigation was undertaken to determine and identify the alternative ecofriendly measures. Influence of botanicals on plant growth parameters

371 Table 1. Influence of botanicals on plant growth parameters and reproduction of root-knot nematode

Treatment Dose (g) Shoot ht Root Shoot wt (g) Root wt No. of No. of Nematode population (cm) length (g) galls egg (cm) Fresh Dry masses Soil Root Total Azadiracta indica 2.5 13.00 6.67 0.31 0.14 0.27 38.67 33.00 326.67 243.33 573.00 (6.26) (5.79)* (17.93) (15.45) (23.85) 5 14.33 10.00 0.42 0.21 0.39 30.33 23.67 309.33 255.00 570.00 (5.55) (4.91) (17.49) (15.81) (23.82) 10 17.67 11.67 0.64 0.37 0.62 30.33 19.67 296.67 263.67 551.67 (5.55) (4.49) (17.23) (16.22) (23.42) Pongamia pinnata 2.5 13.33 7.00 0.25 0.15 0.22 71.00 35.67 753.33 625.00 1378.33 (8.45) (6.01) (27.29) (25.00) (37.10) 5 15.33 8.33 0.45 0.26 0.42 65.33 35.33 633.33 535.00 1168.33 (8.11) (5.98) (25.07) (23.14) (34.13) 10 18.33 11.33 0.60 0.33 0.58 48.33 30.67 416.67 429.67 846.33 (6.99) (5.58) (20.12) (20.73) (28.97) Ocimum sanctum 2.5 13.00 7.67 0.39 0.18 0.33 69.00 38.33 663.33 580.00 1243.33 (8.34) (6.23) (25.72) (24.07) (35.25) 5 15.00 10.00 0.48 0.25 0.44 66.67 31.33 610.00 570.00 1180.00 (8.20) (5.64) (24.71) (23.88) (34.36) 10 19.33 13.67 0.72 0.37 0.67 56.67 31.00 510.33 450.00 953.33 (7.56) (5.61) (22.44) (21.22) (30.88) Hibiscus rosasinensis 2.5 12.67 7.67 0.40 0.18 0.38 61.33 32.67 603.33 525.00 1128.33 (7.86) (5.76) (24.52) (22.92) (33.56) 5 15.00 10.00 0.46 0.23 0.46 49.00 26.67 500.00 396.67 896.67 (7.03) (5.21) (22.30) (19.88) (29.91) 10 17.33 13.00 0.79 0.43 0.72 35.33 20.33 333.33 230.00 563.33 (5.99) (4.56) (18.15) (15.15) (23.67) Lantana camera 2.5 11.67 7.00 0.39 0.20 0.34 73.33 37.00 730.00 631.67 1361.67 (8.59) (6.12) (26.96) (25.14) (36.89) 5 13.67 10.33 0.48 0.27 0.42 52.67 25.33 563.33 480.00 1043.33 (7.29) (5.08) (23.72) (21.90) (32.30) 10 18.00 12.67 0.77 0.39 0.71 42.67 21.33 450.00 336.67 786.67 (6.57) (4.67) (21.19) (18.34) (28.03) Datura metal 2.5 9.67 8.67 0.37 0.19 0.33 72.33 37 763.33 615.00 1378.33 (8.53) (6.15) (27.62) (24.81) (37.13) 5 15.00 10.33 0.54 0.30 0.48 61.67 30.67 680.00 543.33 1223.33 (7.88) (5.58) (26.05) (23.31) (34.95) 10 18.33 12.33 0.70 0.35 0.65 48.33 31.00 540.00 436.67 976.67 (6.99) (5.59) (23.02) (20.67) (30.96) Jatropha curcas 2.5 10.00 8.67 0.40 0.17 0.25 68.33 37.67 723.33 516.67 1240.00 (8.30) (6.18) (26.89) (22.72) (35.20) 5 15.00 11.00 0.46 0.22 0.45 57.00 35.00 586.67 411.67 998.33 (7.58) (5.96) (24.17) (20.27) (31.56) 10 18.33 14.00 0.84 0.42 0.78 50.33 32.33 550.00 340.00 890.00 (7.13) (5.73) (23.44) (18.37) (29.83) Eucalyptus fereticornis 2.5 10.33 8.33 0.40 0.18 0.34 70.33 40.33 683.33 606.67 1290.00 (8.43) (6.39) (26.11) (24.63) (35.90) 5 15.00 10.67 0.42 0.22 0.40 63.67 36.67 633.33 486.67 1120.00 (8.01) (6.10) (25.11) (22.05) (33.46) 10 18.67 12.33 0.71 0.34 0.67 59.67 30.33 600.00 316.67 916.67 (7.76) (5.55) (24.46) (17.40) (30.12) Ricinus communis 2.5 10.00 8.67 0.38 0.19 0.36 74.00 36.00 680.00 558.83 1238.33 (8.63) (6.04) (26.07) (23.64) (35.19) 5 16.00 11.67 0.50 0.23 0.44 55.33 30.67 536.67 413.33 950.00 (7.47) (5.56) (23.17) (20.33) (30.82) 10 20.00 12.67 0.74 0.38 0.69 37.33 24.33 386.67 256.67 643.33 (6.15) (4.98) (19.61) (15.83) (25.37) Calotropis procera 2.5 10.33 8.67 0.30 0.15 0.29 67.33 35.33 616.67 486.67 1093.33 (8.24) (5.99) (24.83) (22.05) (33.03) 5 16.00 11.67 0.60 0.32 0.55 54.33 27.33 566.67 476.67 1053.33 (7.40) (5.27) (23.67) (21.77) (32.38) 10 19.33 13.67 0.77 0.37 0.73 32.00 15.67 340.00 283.33 623.33 (5.70) (4.02) (18.34) (16.51) (24.78) Control 9.67 6.67 0.29 0.15 0.27 74.00 42.33 923.33 576.67 1500.00 (8.63) (6.54) (30.38) (23.99) (38.74) 1.32 1.07 0.06 0.04 0.04 0.08 0.13 1.23 1.09 1.24 3.73 3.73 0.17 0.11 0.11 0.23 0.36 3.46 3.08 3.50 * Figure in parentheses are square root transformed values 372 The treatments significantly improved the plant height Influence of botanicals on gall formation except Datura metal (2.5 g), Ricinus communis (2.5 g) and Jatropha curcas (2.5 g). Maximum (19.33cm) plant The lower doses of R. communis, L. camera, D. metal, height was recorded with Calotropis procera (10 g), P. pinnata and Eucalyptus fereticornis were found to be Ocimum sanctum (10 g) and Ricinus communis (10 g) non significant as compared to control. Rest of as compared (9.67 cm) to control. However, all the treatments were superior over control. The root length treatments inhibited the number of galls/plant was significantly increased in all the treatments except significantly. However, A. indica at higher dose (10g) in Azadiracta indica (2.5 g) and Lantana camera (2.5 g) drastically decreased (30.33) the galls followed by C. but these treatments were observed to be superior over procera (10 g) control (9.67cm). Maximum (14.0 cm) root length was The botanicals at lower doses, although recorded with Jatropha curcas (10 g) followed by C. significant in reducing the egg masses numbers/plant, procera (10 g), O. sanctum (10 g) and H. rosasinensis but were not superior over middle and higher doses. (10 g). Drastic gall reduction was noted in the pots where soil Mixed reaction was exhibited when fresh shoot was amended by higher doses of C. procera (15.67) weights of plant were compared with control. Higher followed by A. indica (19.67) and H. rosasinensis doses of Jatropha curcas showed maximum (0.84 g) (20.33). Middle doses of A. indica gave 23.67 egg fresh shoot weight followed by C. procera (0.77 g) and masses/plant followed by L. camera (25.33) and C. R. communis (0.74 g). procera (27.33). All the doses of L. camera, higher doses of H. All the treatments significantly reduced number rosasinensis and lower doses of D. metal exhibited of nematode population in pot soil except the lower significant differences in dry shoot weight of lentil. doses (2.5g) of D. metal, L. camera and P. pinnata. However, most of the lower doses of organic Least (296.67) number of nematode population in pot amendments did not show any effect on improving dry soil was recorded in A. indica (higher dose) followed by shoot weight. Similar observations were also noticed C. procera (340.00) and H. rosasinensis (333.33) at with 5 g of botanicals except D. metal and C. procera. higher doses. Rest of the treatments were observed to be effective in reducing the number of nematode All the treatments significantly improved fresh root population in pot soil as compared to control where weight. Maximum (0.78 g) root weight was recorded with maximum (923.33) eggs were recorded. Minimum highest dose (10 g) of J. curcas followed by higher dose nematode population (root + soil) was recorded in all of C. procera (0.73 g) and lower of H. rosasinensis (0.38 g), R. communis (0.38). the doses of A. indica (Table 1).

Table 2. Efficacy of bio-control agents on plant growth and nematode multiplication

Treatment Shoot ht Root Shoot wt (g) Root wt No. of No. of Nematode population (cm) length (g) galls egg (cm) Fresh Dry masses Soil Root Total Trichoderma viride 20.20 13.40 0.51 0.27 0.38 8.40 10.00 101 93 194 (2.96)** (3.23) (9.99) (9.66) (13.90) Pseudomonas fluorescens 17.00 11.00 0.42 0.24 0.28 18.00 18.6 226 321 547 (4.29) (4.36) (14.56) (16.98) (22.87) Paecilomyces lilacinus 16.20 9.40 0.45 0.26 0.28 27.2 28.00 850 792 1642 (5.17) (5.28) (29.07) (28.02) (40.48) Control 10.60 9.20 0.27 0.12 0.20 57.00 59.00 1096 1072 2168 (7.54) (7.69) (32.91) (32.46) (46.41) SEm ± 1.71 1.23 0.04 0.03 0.04 0.34 0.26 1.47 1.73 1.66 CD (P=0.05) 5.14 3.69 0.11 0.08 0.12 1.01 0.79 4.41 5.18 4.99

** Figure in parentheses are square root transformed value

373 The results are in accordance with the findings recorded in control. of Singh and Sitaramaiah (1967) on tomato and okra Jain and Trivedi (1997) on chickpea and Ramakrishnan Effect of biocontrol agents on nematode multiplication et al.(1997) on Okra.

Increase in plant height may be attributed to the Treatments with biocontrol agents were noted to be fact that the treatment enriched the soil with their significantly superior in increasing dry shoot weight over nutrients apart from their effects on M. incognita control. Maximum (0.27 g) dry shoot weight was (Adekunle and Fawolf 2002). Khan et al. (1973) reported recorded in T. viride followed by P. lilacinus (0.26 g) that amino acids released during decomposition of and P. fluorescens (0.24 g). Minimum (0.12 g) dry shoot organic amendments are toxic to nematodes. Prassd weight was observed in control. (1997) while working with the management of plant parasitic nematodes on groundnut reported that C. Significantly superior fresh weight of root was procera released some alkaloid during decomposition recorded in T. viride (0.38 g). Other treatments were which might have been toxic to nematode and at the non significant but superior over control (0.20 g) in same time enriched microbial population in the soil increasing fresh root weight. besides supplying major elements required for the plant growth. Significant reduction in galls/plant was observed in all the treatments. Number of egg masses/plant was Least proliferation of nematodes in neem (A. reduced in T. viride (10) followed by P. fluorencens indica) could be due to liberation of ammonia (Khan et (18.6) and P. lilacinus (28.0). Control plants recorded al. 1974) and fatty acids during decomposition which is 59 egg mass/plant. Similar findings have also been detrimental for nematode development. Apart from this recorded by Sankarnarayan et al. (1999) Sobita Devi neem contained formaldehyde which is another factor and Dutta (2000) reported improved plant growth and for nematode control. (Sitaramaiah and Singh 1978). reduced gall formation in sunflower and Glycine max respectively treated with T. viride. Improvement in plant Besides the nematode properties of indigenous growth parameters and reduction in nematode plants tested there could be other factor responsible multiplication was also noted in pots treated with P. for nematode control. It may be due to increase in the fluorscense and P. lilacinus. Improvement in plant height predaceous and parasitic activity of soil biota inimical and reduction in root knot multiplication were also to nematode (Linford 1987), increase in the host recorded by Jaikumar et al. (2002) on cotton infected resistance (Alam et al. 1980) or the toxicity of the with Rotylenchulus reniformis. Similarly the affectivity decomposition products of the additives (Alam et al. of P. lilacinus against reproduction of M. incognita and 1979). improvement in plant growth was reported by Khan and Goswami (2000). Efficacy of bio-control agents on plant growth ouLifr ,oa tSo fu;a=dks }kjk elwj ds tM+xazFkh lw=d`fe dk izca/ku The bio control agents improved the plant height. djus ds fy;s iz;ksx dkap/kj okrkoj.k esa fd;k x;kA /krwjk] uhe ,oa Significant increase was recorded in Trichoderma viride (20.20 cm) followed Pseudomonas fluorescens (17.00 ckjgeklh dh ifRr;ksa ds 'kq"d pw.kZ }kjk elwj ds ikni xq.kksa esa o`f} cm) over control. Treatment with Paecilomyces lilacinus ikbZ xbZA VªkbdksMekZ fofjMh ,oa L;wMkseksukl yksjkslsal }kjk tM+xazfFk;ks attained minimum (16.20 cm) height amongst the dh la[;k esa deh] ikS/ks ,oa tM+ksa dh yackbZ ,oa ikS/ks ds rkts o 'kq"d treatments but superior over control. Hkkj esa o`f} rFkk tM+ks esa tM+xzafFk;ksa dh la[;k esa fu;a=d dh rqyuk Increased root length (13.40 cm) was recorded esa deh vkdh xbZA in T. viride which was significantly superior over control. Rest of the treatments i.e. P. fluorescens (11.00 cm) and P. lilacinus (9.40 cm) were non- significant over References control but superior in improving the root length. All the treatments were found significantly Adekunle OK, Fawolf B (2002) Chemical and non-chemical superior in improving the fresh shoot weight over control. control of Mieloidogyne incognita under field conditions. Indian J Nematol 31:1-8 Maximum (0.51 g) shoot weight was recorded with T. viride followed by P. fluorescens (0.42 g) and P. lilacinus Alam MM, Ahmad Khan AM (1980) Effect of organic amendments on the growth and chemical (0.45 g). Minimum (0.27 g) fresh shoot weight was composition of tomato, egg plant and chilli and their 374 susceptibility to attach by Meloidogyne incognita. Ramakrishnan S, Gunasekaran CR, Sivagami Vadivlu Plant Soil 57:231-236 (1997)Control of Meiloidogyne incognita on okra Alam MM, Khan AM, Saxena S K (1979) Mechanism of control through botanicals as soil amendments. Indian J of Plant Parasitic nematodes as a result of the Nematol 27:24-27 application of organic amendment to the soil. Vrore Sankaranarayanan CS, Hussaini S, Kumar PS, of phenolic compounds. Indian J Nematol 9:136-142 Rangeshwaran R Kaushal KK (1999) Antagonistic Haider MG, Dev LK, Nath RP (2003) Comparative effect of Trichoderma and Gliocladium spp. against pathogenicity of root-knot nematode (Meloidogyne root-knot nematode (Meloidogyne incognita) on incognita) on different pulse crop. Indian J Nematol sunflower. Proc. of National Symposium on Raitonal 33:152-155 Approaches in Nematode Management for Jain Charu, Trivedi PC (1997) Nematicidal activity of certain Sustainable Agriculture, Anand, India 23-25 Nov. pp: plants multiplication of Meloidogyne incognita 25-27 infecting chickpea (Cicer arietinum), Ann Pl Protec Singh RS, Sitaramaiah K (1967) Effect of decomposing green Sci 5:171-174 leaves. Saw dust and urea on the incidence of root- Khan MR, Goswami BK (2000) Effect of different doses of knot nematode on okra and tomato. Indian, Paecilomyces lilacinus isolate 6 on Meloidogyne Phytopath 20:349-355 incognita infecting tomato. Indian J Nematol 30:5-7 Sitaramaiah, K, Singh RS (1978) Effect of organic amendment Khan MW, Alam AW, Saxena SK (1973) Influence of certain on phenolic contents of soil and plant and response oil cake amendments on nematodes and fungi in of Meloidogyne javanica. Labdev J Sci Tech 913:203- tomato field. Indian J. Nematol 3:148 205 Khan MW, Alam MM, Khan AM, Saxena SK (1974) Effect of Sobita Devi, Dutta U (2000). Effect of Pseudomonas water soluble fractions of oil cake and bitter principles fluorescens on root-knot nematode (Meloidogyne of neem on some fungi and nematodes. Acta Bot incognita) of okra plant. Indian J Nematol 32:215 216 Indica 2:120-128 Linford MB (1987) Stimulated activity of natural enemies of (Manuscript Receivd : 16.062012; Accepted 30.10.2012) nematodes, Science 85:123-124 Prasad D (1997) Assessment of groundnut yield loss due to plant parasitic nematodes in National symposium on Recent Advances in Diagnosis and Management of important Plant Disease CSAUA&T U PKanpur, 84- 85 (Abst)

375 JNKVV Res J 46(3): 376-381 (2012)

Diversity in isolates of Rhizoctonia bataticola causing dry root rot in chickpea from central India

Om Gupta, Surendra Patel and Madhuri Mishra Department of Plant Pathology Jawaharlal Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract of 25-70 per cent in chickpea production due to this disease in India has been reported (Ahmed et al. 1986, Pandey and Singh 1990). The pathogen over-winters Forty isolates of Rhizoctonia bataticola (Macrophomina as sclerotia in soil and upon germination may penetrate phaseolina Taub.) Butler causing dry root rot of chickpea collected from four major chickpea growing states viz., Madhya roots and lower stems during growing season. A Pradesh, Chhattisgarh, Gujarat and Maharashtra of Central characteristic sign is the presence of numerous, minute India were highly variable in their cultural, morphological and and black sclerotia particularly on diseased plants, pathogenic characteristics and were grouped into 24 groups. exhibited straw colour appearance with blackened roots Based on cultural characteristics, isolates were divided into which latter on becomes brittle in dry soil. eight number of groups i.e. G1 to G8. Six isolates produced highest number of sclerotia (18-23) of bigger size (103.3 to The present study deals with the variability in 117.2 x 90.1- 106.5 µm). Whereas 23 isolates produced different isolates of Rhizoctonia bataticola with respect minimum number of sclerotia (8-13) that too with smaller size to cultural, morphological and pathological (72.7-87.5 x 57.1-73.5 µm). Based on sclerotial morphology characteristics. two groups of isolates could be formed, one with oblong shape having irregular edges and the other being round with regular edges. The virulence study of the isolates tested on a chickpea Material and methods susceptible variety BG 212 through blotter paper technique grouped them into two pathotypes which were related to central region of the country. The highly virulent isolates from Chickpea plants showing symptoms of dry root rot were Madhya Pradesh, Chhattisgarh, and Maharastra were fast collected from the diseased plants at flowering and pod growing isolates and exhibited largest sclerotia. The significant formation stage from the 40 locations of 23 districts findings of the present investigation revealed that sclerotial surveyed in four major chickpea growing states viz., size and number of sclerotia of R. bataticola isolates viz., 20, Madhya Pradesh, Chhattisgarh, Maharashtra and 21, 24, 25 had positive correlation with virulence. Gujarat of India. To ascertain the variability with respect to cultural, morphological characteristics among the Keywords: Cicer arietinum, Dry root rot, Macrophomina isolates of Rhizoctonia bataticola the studies were phaseolina, Variability conducted on potato dextrose agar medium (PDA). For grouping the isolates, observation on cultural Dry root rot of chickpea is one of the important disease characteristic viz., mycelial growth, colour of colony and which mostly occurs under drought conditions and size of colony (growth rate) were recorded after 7 days prevail at flowering and podding stage of the crop. The of incubation while for morphological characteristics viz., disease is favoured by high soil temperature (>300C) size of hyphal width, size of sclerotia, number of and low soil moisture condition. sclerotia, colour of sclerotia and shape of sclerotia were recorded after 10 days of incubation (Dhingra and The first report of occurrence of dry root rot in Sinclair 1978). chickpea alongwith wilt was made by Padwick (1948). Disease incidence of root rot ranging from 3.5 to 20.6 The pathogenic nature of the isolates was percent in 30 villages of Northern Madhya Pradesh has ascertained by inoculating on susceptible chickpea been reported (Gupta et al. 1983). Significant reduction variety BG 212 for dry root rot by using blotter paper

376 technique as described by Nene et al. (1981). Inoculated isolates (Table 1, 2 and Fig. 1 & Plate 1). These results plants alongwith the suitable control were placed in an confirm the observations made by Byadgi and Hegde incubator at 350C for 8 days with 12 hr artificial light. (1985) who reported fluffy, dark brown mycelium, partial Moistened the blotters adequately on alternate day and fluffy mycelium and appressed light brown mycelium examined the seedling for the extent of root damage. growth on different isolates of R. bataticola. The disease rating scale 1 to 9 was used (Nene et al. 1981). While another two groups from colony colour represented as G4 and G5 i.e. dark black and grayish Rating scale cottony were observed within 38 highly virulent and 02 virulent isolates. With respect to colony diameter the

isolates were categorized in three groups (G6 to G8 Rating Symptoms of Dry root rot Per cent groups) and colony diameter was ranged from 70 to 90 th 1 No infection on roots 0.0 mm growth at 4 day of incubation. The data denotes that the slow growth (70-76 mm) has been obtained in 3 Very few small lesions on roots < 10 7 highly virulent isolates belonging to Madhya Pradesh, 5 Lesions on roots clear but small, 11-20 Chhattisgarh, Maharashtra and Gujarat states. Eight new roots free from infection highly virulent isolates and one virulent isolate no. 11 7 Lesions on roots many, new roots 21-50 from Chhattisgarh state grouped as medium growth generally free from lesions (77.8 mm). Rest of 23 highly virulent and one virulent 9 Roots infected and completely > 51 isolates (G8 groups) were found fast growing having discolored 84-90 mm (fast growth) colony diameter. The isolate no. 3 from Madhya Pradesh had maximum (59 mm) growth and the minimum growth (26 mm) was observed Reaction Rating scale Percent mortality in Gujarat isolates no. 38 which belong to vadodara districts. Monga and Sheo Raj (1994) who observed Least virulent (1-5) < 20 Per cent that Rs-2 group of isolates was fastest in mycelial growth Virulent (6) 21-50 Per cent and Rs-4 was slow growing among all the four groups Highly Virulent (7-9) > 51 Per cent of isolates on potato dextrose agar medium. Aghakhani and Dubey (2009) reported that on the basis of colony Percent mortality was calculated by using the following diameter, the isolates were grouped into four categories formula and each group had the isolates from different areas of the country. Number of diseased plants Percent mortality = ———————————— x 100 Morphological variability Total number of plants Large variation in size of hyphal width (mm), colour, Results and Discussion shape, size and number of sclerotia was observed in

different isolates of R. bataticola, represented as G9 to G from the highly virulent and virulent isolates. It is Cultural variability 22 evident from the data presented in Table 1, 2 and Plate 1 that wide range of variations has been observed in Based on cultural and morphological variability 40 size of hyphal width, 18 highly virulent isolates were isolates were placed in 24 groups and referred to as G1 classified in very thin (5.2-6.5 mm), 17 highly virulent to G24. Among 40 isolates, thirty eight are designated and 2 virulent isolates come under thin (6.6-7.9mm) size as highly virulent and two as virulent isolates, and of hyphal width, while only three highly virulent isolates showing eight groups on the basis of cultural from Chhattisgarh and Gujrat were exhibited (8.0- characteristics i.e. type of mycelial growth, colour of 9.3mm) thick hyphal width. None of the virulent isolates colony and radial growth of isolates. Based on type of belong to thick size hyphal width. Present observations mycelial growth and colony colour the culture were coincide with the observations of Sobti and Sharma assigned to five groups viz., G1 fluffy (9 highly virulent (1992) who reported that the width of hyphae varied isolates), (G2) partial submerged (11 highly virulent from 4.16-8.48mm. Jharia (1985) observed the hyphal isolates) and in G3 groups, submerged type of growth width range between 3.00-4.50mm. were found from 18 highly virulent and 02 virulent

377 Category

H. virulent

H. virulent

H. virulent

H. virulent

H.virulent H. virulent H. virulent

H. virulent

Disease

Oval 7.3 H.virulent

Round 7.4 H.virulent Round 8.3 H.virulent Round 8.6 H.virulent

Round 8.8 H.virulent Round 7.2 H.virulent Round 8.5 H.virulent Round 7.5 H.virulent

Round 8.7 H.virulent Round 8.4 H.virulent Round 8.4 H.virulent Round 8.7 H.virulent Round 8.3 H.virulent Oval 9.0 H.virulent Round 7.3 H.virulent Round 8.2 H.virulent Round 8.1 H.virulent

Round 8.4 Oval 8.9 H.virulent Round 8.6 Round 8.5 H.virulent Oval 8.6 H.virulent

Round 8.5 H.virulent

Round 8.3 H.virulent Oval 8.4 H.virulent

Round 8.4 H.virulent

Oval 8.1

Oval 8.7 H.virulent

Round 8.6 Round 8.2

Round 6.6 Virulent Round 6.7 Virulent Oval 8.0

Round 8.7 H.virulent Round 7.8 H.virulent

brown

brown

Brown Oval 8.3 H.virulent

D. brown

D. brown

D.brown

D. brown

Brown Round 8.7 Brown Oval 7.9 H. virulent

D. brown

D. brown Brown Oval 7.3

Brown Oval 8.8 H.virulent

10.2 D. brown 09.9 D. brown 11.1 D. brown

19.2 D. brown

09.7 Black

10.2 D.brown 08.1 D. brown 11.0 D. brown 17.9 D. brown 11.4 Brown 08.5 D.brown

16.5 D.brown

10.6 Black 14.2 Black

13.5 D. brown

08.1 D. brown

18.8 D.brown

17.2 D.brown

18.7 Black

14.8 D. brown 16.1 D. brown

sclerotia sclerotia sclerotia rating

No. ofof Colour of Shape

Rhizoctonia bataticola

63.9 12.8 D.

85.2 11.7

75.7 12.6

70.7 22.3

72.4 12.8 D.

x 90.2 x 99.2

x 73.6 09.2 Black

x 73.6 10.0 x 77.1 11.3 Black

x 85.3 12.7

x 72.3 10.8 x 71.7 14.4 Black x 76.3 13.7 Black

x 75.1

x 69.7 16.2

x 86.8 10.8 Black

91.5

82.3

99.0 x 89.3 86.7 x 89.0

72.7 x 59.6

90.8 x 73.8

92.8 x 76.0 100.4 x 76.2

76.2 x 65.9 18.5 89.9 x 79.4 12.1 Black

85.6 96.0

79.3

73.8 x 73.8

89.0 x

89.9 x

77.6 x

87.5 87.8

78.8

84.2 x

106.2 105.7

sclerotia (µm)

78.5 x 67.2

103.7 x 90.1

117.2 x 104.0 113.2 x 106.5 88.7 x 79.5

89.2 x 76.1

103.3 x 90.2 98.2 x 88.2 12.6

73.0 x 62.1

102.2

92.8

87.5 x 68.2 14.0 99.1 x 76.9

92.1 x 85.5 74.5 x 64.0 19.2 83.6 x 71.2 87.8 x 77.1

7.1 5.6 7.1

Size of Size of hyphal width (µm)

5.7

5.4 6.8 7.0

8.7

78 5.8

90 6.6

75 76

Growth 4th day

70 8.2

71 5.7

Black 70

Black 90 5.6

Black 79 6.4 Black 87 5.7 Black 90 6.5 Black 90 5.2

Black 90

Black 90 7.4

Black 90 5.5

Black 90 7.6

Black 80 7.0

G.cottony

G.cottony 90 G.cottony 90

Colony

D. Black 79 7.5

D. Black 90 7.2 D. Black 88 7.6

G.cottony 90 6.2

G.cottony 77 7.6 G.cottony 90 6.7

D.

D.

D.

G.cottony 85 5.2 G.cottony 90 6.8 G.cottony 90 7.6

G.cottony

Fluffy

Submerged D. Black Submerged D. Black

Submerged D. Black 80 5.7

Fluffy

Fluffy

Fluffy

Fluffy

Submerged

Partial sub. D. Black 70

Partial sub

Fluffy

Fluffy

Type of mycelial colour growth

Submerged D.

Submerged D. Black 80 6.2 Submerged D. Black 81 6.6

Submerged D. Black 90 6.4 Partial sub. D. Black 90 6.1

Submerged D. Black 71 7.8 Submerged D. Submerged D. Partial sub. D.

Fluffy Fluffy Partial sub. D. Black 79 Partial sub

Submerged D.

Submerged Submerged Partial sub G.cottony Partial sub D. Black 90 7.6

Partial sub. G.cottony

Submerged D. Black 90 6.5 Submerged D. Black 84 7.2 Submerged D.

Submerged D.

Submerged D. Partial sub. G.cottony 87 9.3

Submerged

Partial sub.

Dark Black Grayish cottony

Madhya Pradesh

Maharashtra

Gujrat

Chhattishgarh

5 Surat

40 Dahod

37 Vadodara 38 Vadodara 39 Dahod

Table 1. Cultural, morphological and Pathogenic characteristics of various isolates of Table

Isolate Districts No. / States

1 Jabalpur

17 Dhmtari 18 Mahasamund 19 Kawardha

20 Dhule 21 Dhule 22 Amravati 23 Amravati 24 Amravati 25 Akola 26 Hingoli 27 Aurangabad 28 Aurangabad 29 Parbhani

31 Parbhani 32 Jalna 33 Jalna 34 Jalna

3

36 Valsad

*Average of 10 observations. D.Black G.cottony H.virulent Highly virulent D.brown Dark brown

2 Dindori 3 Dindori 4 Dindori 5 Panna 6 Betul

30 Parbhani

7 Raisen 8 Raisen 9 Katni

10 Raigarh

11 Bilaspur 12 Bilaspur 13 Bilaspur 14 Bilaspur 15 Bilaspur 16 Raipur

378 06

06

11

15

10

11

03

06

Total

isolates

-

-

35

39

39

39

40

35

35,40 24

39,40 12

39, 4039, 13

36, 4036, 09

37, 39 18

35,37,38 20

36,37, 3836,37, 07

36, 38,4036, 19

35,36,37,38 24

34

26,27,28

31

24

32, 34,

23, 26 23,

Gujarat

22, 27, 33 39 09

-

31,

25, 29, 31,

23, 27, 30, 31

23, 25, 29, 33, 34

Highly virulent

24, 30, 31, 32

20,22,

21, 24, 25, 28, 29,30,

19, 20, 21, 24, 25

22, 28, 29, 32, 33,3438,40 35,36,37, 19

21,

20, 21, 22, 23, 24,26,37,38 35,36, 28

19, 24, 25, 32, 33, 34

19, 27, 28, 32, 33, 34 33, 32, 28, 27, 19,

21, 22, 23, 24, 25, 26, 27,39,4037,38, 35,36, 38

19,20, 21, 22, 24, 25,39,40 36,37,38, 23

20,

20, 21, 22, 23, 27, 28,29,

20,

20, 21, 22, 23, 25, 26,29,30, 31 20, 21, 22, 23, 25,

-

-

-

-

-

10

11

11

10

10

M.H

10,11

10, 11

10, 11

10, 11 10,

30, 31, 34

31, 32, 34

26,29,32,33

Highly virulent

27,28, 30, 32, 33

28, 29, 30, 31, 32, 33, 34

27, 28, 29, 30, 33, 35, 36

-

16

13

18, 1911 10, 20, 21, 22, 23, 24, 25, 26,38 37, 27

C.G.

12,16

17,18

14,15 23, 27, 28, 30, 34

12,13

12, 16

13, 15 13,

12,13,16

12

14,17,18,19

12,13,14,15

12,13,14,15,

on the basis of cultural and morphological characteristics

8, 919, 14,15,16,17,18,

6, 7,8,9

virulent Virulent

-

- - 10,11 - - 02

4

6

2 17,18,19 11

2

5,6

4, 5

Isolates

M.P

2,3,4 12,13,14,15,16,

3,4,7

4,7,8

9

2,4,6,7

1,4,7,9 13,18

1,2,3,9

3, 5, 6, 8 14,15,17,

1,5,6,7,8,9 17,

1, 3, 5,

1, 2, 5, 6, 8 14,15,16,17,18

1, 2, 3,7,8,9

16, 17,18,19 16,

1,3,5,6,7 8,9 1,3,5,6,7

Highly

1,2,3, 4, 5,

Rhizoctonia bataticola

Pathogenicity

Cultural characters

Highly virulent

Fluffy Partial submerged Submerged

Dark black

Grayish black

Slow growth (70-76 mm) Medium growth (77-83 mm) Fast growth (84-90 mm)

Very thin (5.2-6.5 µm)

Thin (6.6-7.9 mm) (6.6-7.9 Thin Thick (8.0-9.3 mm)

Minute (72.7-87.5 X 57.1-73.5 µm) 4,5, 6,7,10 13, 14, 16,17 Medium (87.6-103.2 X 73.5-90.0 mm) 1, 3, 8, 918 12,15, Bold (103.3-117.2 X90.1-106.5 mm) X90.1-106.5 (103.3-117.2 Bold

Minimum (8-13)

Medium (13-18) Maximum (18-23)

Brown Dark brown Dark Black

Oblong shape Round shape Round

Virulent ( < 7.0) Highly virulent ( > 7.0)

Morphological characters

Grouping of isolates of

1 2 3

4

5

6 7 8

9

10 11

12 13 14

15

16 17

18 19 20

21 22

23 24

G

G

G

G

G

G G

G

G

(F) Number of sclerotia

(A) Mycelial growth

(B) Colony Colour

(H) Shape of sclerotia

(C) Growth rate

(D) Size of hyphal width

G G

G G

G

G

G

G

G

G

G

G

G

G

(G) Colour of sclerotia G

(E) Size of sclerotia

Table 2. Table

Groups Characteristics

379 Size of sclerotia varied form 72. 117. 2 x 57.1 – 106.5 isolate produced highest number of sclerotia (180.3

µm having three groups viz., minute size (G12) (72.7- sclerotia /9 mm disc and 52 / microscopic 10X field)

87.5 x 57.1 – 73.0), medium size (G13) (87.6 – 103.2 x whereas Coimbatore isolate produced minimum number 73.5 - 90) and bold (103.3 – 117.2 x 90.1 – 106.5) size of sclerotia (169 sclerotia). Based on the colour and of sclerotia belongs in G14 groups. During course of shape of sclerotia the isolates were assigned to three investigation bold size of sclerotia was observed in six different colour i.e. brown (G18), dark brown (G19) and highly virulent isolates belong to Madhya Pradesh and black colour (G20). Out of 40 isolates 6 (15%) isolates Maharashtra. Rest of the thirty two highly virulent and were found as brown, 24 (60%) isolates were found as two virulent isolates placed in minute and medium size dark brown and 10 (25 %) isolates were found as black of sclerotial belong to G12 and G13 groups. The above colour of sclerotia. Brown to black and light to dark findings were also reported that the sclerotial size range brown colour of sclerotia have been also reported between 66.14-128.25mm and 122-188 x 77-127mm (Byadgi and Hegde (1985) and Ratnoo et al. (1997) . from root isolates Mandal et al. (1998). Shape of sclerotia was also observed for each isolates

2 day 4 day 100

90

80

) 70

60

50

Mycelial growth (mm. growth Mycelial 40

30

20

10

0 12345678910111213141516171819202122232425262728293031323334353637383

Isolates Fig 1. Growth rate of isolates of Rhizoctonia bataticola at different intervals

Three groups i.e G , G and G were identified 15 16 17 and classified into two groups namely oblong (G21) and on the basis of no. of sclerotia per microscopic field round shape sclerotia (G22) from 38 highly and two ranged from 8.1 to 22.3. The six highly virulent isolates virulent isolates. These results are in agreement with form Madhya Pradesh, Chhattisgarh, Maharashtra were those reported by Mandal et al. (1998), who observed found under maximum no. of sclerotia (18-23) while irregular and round to elongate sclerotial shape. Results none of them found in virulent isolates belongs to G17. of other workers Jharia (1985) and Dhingra and Sinclair However, minimum number of sclerotia (8-13) were (1973) were also in agreement with the present findings. encountered from 21 highly virulent and 02 virulent isolates (G ) while medium no. of sclerotia (13-18) was 15 Pathological variability in 11 highly virulent isolates (G16). Among all, the isolate no. 6 from Madhya Pradesh belong to Betul district produced maximum no. of sclerotia (22.3 sclerotia) and Forty isolates of R. bataticola induced variable reaction isolate no. 21 exhibited minimum no. of sclerotia (8.1 on variety BG 212 (Susceptible) of chickpea on Blotter per microscopic field) which belongs to Maharashtra paper technique (Nene et al. 1981). Based on the states. These results are confirmed with the findings of disease rating and maximum mortality after inoculation, Shekhar et al. (2006) who reported that Hyderabad all the isolates caused varying degree of incidence on

380 variety and found two pathotypes i.e. virulent (02 References isolates) from Chhattisgarh and highly virulent (38 isolates) from Madhya Pradesh, Chhattisgarh, Aghakhani M, Dubey SC (2009) Morphological and Maharashtra and Gujarat states of India (Table 1and 2). pathogenic variation among isolates of The disease reaction of the isolates varied from Rhizoctonia bataticola causing dry root rot of chickpea 62 (2):183-189 6.6 – 9.0 on a scale of 1-9. Out of 40 isolates, 38 isolates categorized as highly virulent as the disease rating Ahmed Q, Abu MAO, Mohammad A (1986) Losses in yield due to Rhizoctonia root rot of chickpea in Bihar. Indian score was 7.0 to 9.0. however, only two isolates i.e. Phytopath 39: 590-592 isolate no. 10 and 11 come under virulent group where Byadgi AS, Hegde RK (1985) Variation among the Isolates of the disease rating ranged from below 7.0 score. The Rhizoctonia bataticola (Taub.) Butler, Macrophomina perusal of the data indicated that among the isolates, phseolina (Tassi.) Goid from different host Plants. the isolate no. 25 belong to Akola exhibited highest Indian Phytopath 38 (2): 297-301 virulence had disease rating 9.0 followed by parbhani Dhingra OD, Sinclair JB (1972) Variation among the isolates isolate no. 31 (8.9 rating) from Maharashtra state, of M. phaseoli (R. bataticola) from the same soybean Chhattisgarh isolate no. 13, 16 (8.8 rating) and Madhya plant. Indian Phytopath 62: 1168 Pradesh isolates no. 3, Chhattisgarh isolate no. 14, Gupta RN, Gupta JS, Sharma BL (1983) Studies on wilt and Maharashtra isolates no. 20, 23 (8.7 rating) which prove root rot incidence of Cicer arietinum of Madhya high level of virulence. Pradesh. Indian Phytopath 36(1): 82-84 Mandal R, Sinha MK, Ray MKG, Mishra CBP, Chakrabarty However, minimum 6.6 disease rating was NK (1998) Variation in M. phaseolina causing stem observed in isolate no. 10 belongs to Raigarh and at rot of jute. Environment and Ecology 16: 424-426 par with Bilaspur isolate no. 11 from Chhattisgarh state Monga D, Sheo Raj (1994) Cultural and pathogenic variation were found to be virulent on cultivar BG 212. Based on in the isolates of Rhizoctonia species causing root the degree of aggressiveness (Shekhar et al. 2006) rot of cotton. Indian Phytopath 47: 403–408 reported pathogenic behavior of M. phaseolina and Nene YL, Haware MP, Reddy MV (1981) Chickpea diseases grouped as most virulent and least virulent isolates. resistance screening Techniques, Information Three groups i.e. virulent, intermediate and mild on the Bulletin, ICRISAT (10) : 10 basis of pathogenicity has been reported by Byadgi and Padwick GW (1948) Plant protection and food crops of India, Hegde (1985). Other workers have also reported the plant pest and disease at rice, wheat, sorghum and differential reaction by the isolates of R. bataticola in gram. Imperial J Exp Agri 16: 55-64 chickpea (Ratnoo et al. 1997 and Monga and Sheo Raj Pandey G, Singh RB (1990) Survey of root disease of chickpea 1994) and found considerable variation among the in Allahabad region. Current Nematology 1: 77-78 isolates. Ratno RS, Jain KL, Bhatnagar MK (1997) Variation in Macrophomina isolates of Ashy-gray stem blight of Present studies conducted on various aspects cowpea. J Mycol Pl Pathol 27: 91-91 of variability in the isolates of R. bataticola led to be Sobti AK, Sharma SL (1992) Cultural and Pathogenic variation conclusion that the isolates pertaining to fast growth in isolates of Rhizoctonia bataticola from groundnut rate (83.3%), partial submerged (90.1%), very thin in Rajasthan. Indian Phytopath 45: 117-119 hyphal width (88.8%) sclerotial bold size (83.3%) and Sobti AK, Bansal RK (1988) Cultural variability among three dark brown (78.1%) and production of sclerotia (100%) isolates of Rhizoctonia bataticola from groundnut. is positively correlated with the virulence as is reflected Indian Phytopath 41: 149-151 by isolates No. 1 to 9 from Madhya Pradesh, 12 to 18 from C.G., 20 to 34 from and Gujrat isolate No. 35 to (Manuscript Receivd : 17.01.2012; Accepted 05.04.2012) 34. The reaction produced by these isolates with inoculating highly susceptible variety BG 212 giving disease rating of 7-9. Similar conclusion was drawn by Monga and Sheuraj (1994) in case of Cotton root rot incited by M. phaesolina.

381 JNKVV Res J 46(3): 382-384 (2012)

Pest complex and their succession of Kharif castor at Kampasagar conditions of Nalgonda District, Andhra Pradesh

R. Muralidhar Naik, P. Rajanikanth, L. Krishna, Md. Latheef Pasha and D. Bhadru Agricultural Research Station, Kampasagar Acharya N.G. Ranga Agricultural University Nalgonda District 508207 (AP)

Abstract like pest and disease incidence. The factors like drought can be mitigated by adoption of various agronomic An experiment was conducted to identify the pest complex practices but managing pest infestation needs a and their succession on castor crop during 2006, 2007 and thorough study. It is well known that several insect pests 2008 kharif at Kampasagar conditions of Nalgonda district of are known to infest castor at different times of plant Andhra Pradesh. Ten species of insect pests were recorded growth. However, the intensity of pest incidence is built at various stages of crop growth in an overlapping manner of up in relation to other competitive pests, stage of the which, two species of insects were found infesting castor plant, natural enemies population and most important during early stage of crop, jassid, Empoasca flavescens is weather conditions prevailing during the crop season. Fabricus and serpentine leaf miner, Liriomyza trifolii Berges A thorough understanding of these aspects can help in but their infestation continued throughout the crop season. forecasting the out breaks of insect pests and finally in Grass hopper, Chrotogonus trachypterus Blanch, castor white the evolution of integrated control schedule. For fly, Trialeurodes ricini Misra; castor spiny caterpillar, Ergolis evolving pest management practices which are merionae Linneaus castor semilooper, Achoea janata ecologically sound, economically feasible and Linneaus and green stink bug, Nezara viridula activity was sociologically acceptable, information on the pattern of observed during the months of September and October at pest complex and their succession are a pre-requisite. active vegetative stage but their damage was not appreciable hence classified as minor pests. The major pests which cause With the introduction of high yielding varieties and economic damage to castor viz., Tobacco caterpillar, with the improved methods of cultivation, the pest Spodoptera litura Fabricius; Mesta hairy caterpillar, Euproctis complex of different crops seems to have changed to sp. Linnaeus and castor shoot and capsule borer, Conogethes the extent that some of the insects which were appearing punctiferalis Guenee incidence was noticed during flowering casually have assigned the status of major pests where and spike formation stages of which Spodoptera litura and as other which were never known, have appeared on a Conogethes punctiferalis incidence was noticed till the harvest crop. This calls for a continuous review of the pest of the crop and caused much economic damage to the crop. complex of crop under an agro climatic condition in order to fix the priorities and for evolving suitable pest Keywords: Castor, insect pest management practice. Castor crop being an important oilseed crop in Nalgonda district makes the study necessary for continuous monitoring of pests at the Castor is an important non-edible oilseed crop. It is study area. grown especially in arid and semi arid regions. India produces 8 to 8.5 lakh tonnes of castor seed annually, and accounting for more than 60% of the entire global Material and methods production. India is also the biggest exporter of castor oil and its derivatives at 87% share of the international The study on incidence of pest complex and their trade in this commodity. Though castor is an important succession on pest was conducted at Agricultural oil seed crop because of its export potentiality, its area Research Station Kampasagar during three consecutive is being reduced year after year due various reasons kharif seasons, 2006, 2007 & 2008. The Castor variety these include abiotic factors like drought, biotic factors Kranti was sown on July 22nd, 29th and 25th respectively

382 with a gross plot size of 50x25 m with a buffer strip of 50cm all around the plot. A distance of 90 cm was maintained between row to row as well as plant to plant. The experimental area was kept free from insecticidal spray throughout the crop season. Weekly observations were recorded on randomly selected five plants and in case of white flies the number of nymphs and adults were recorded during early morning from three leaves on top, middle and bottom canopy of plant for recording leaf miner infestation, Number of mined and healthy

November last week last November

1st week of October

December 1st & 2nd week Last week of October of week Last leaves were recorded based on which per cent damage was calculated. The absolute larval population / five Plants was recorded in case of Leaf eating caterpillars while the percent damage of capsules per spike was recorded for identifying the intensity of pest damage in case of shoot and capsule borers .

Results and Discussion

Insect population during Peak incidence

5 -6Larvae/ Spike -6Larvae/ 5

peak infestation

2 Adults /1250sq.mts areaSeptember of week 1st

1 Larvae/ 2 plants 3rd week of October 5-7 Adults/ Plant Various insect pests causing damage to castor at different stages of crop growth are listed below. All insects were noticed in all the three years. Jassids, Empoasca flavescens Fabricius and serpentine leaf miner, Liriomyza trifolii Burgess were found their activity starting from cotyledonary stage. E. flavescens attained peak during active vegetative stage and were present in field till maturity of the crop, where as Liriomyza trifolii activity attained its peak during active vegetative stage and there after it disappeared. Grass hopper, Chrotogonus trachypterus Blanch; castor semilooper, Achoea janata Linn; castor spiny cater pillar, Ergolis merione L. and mesta hairy

Crop stage

Seedling active vegetative stage 20-25% damage of leaf August 2nd and 3rd weeks

Active vegetative & Flowering stage 2-3 Adults/Plot

Vegetative & Reproductive stage 3 Larvae/1250sq.mts area 2nd and 3rd weeks of November Active vegetative stage

Active Vegetative stage Active Vegetative stage cater pillar, Euproctis sp. activity attained its peak during active vegetative stage.Green stink bug, Nezara viridula Linnaeus; white fly, Trialeurodes ricini Misra; tobacco

Blanch Active Vegetative stage caterpillar, Spodoptera litura Fabricius and castor shoot Guenee Vegetative & Reproductive stage 1-3 Larvae/ Spike and capsule borer, Conogethes punctiferalis Guenee Fabricius Seedling & active vegetative stage 10 - 15 Adults/ Plant October 2nd week activity was found from active vegetative stage to flowering

Fabricius Vegetative & Reproductive stage 2 Egg Masses/ Plants 1st week of November

Misra L. and spike formation stage. However Nezara viridula activity

Burgess

Linnaeus Linn disappeared after flowering but the activity of Spodoptera litura and Conogethes puntiferalis activity was much sp pronounced to spike formation stage. The economic damage in kharif castor during the years 2006, 07 and 08 was mainly due to Spodoptera litura with average of 2

Empoasca flavescens Liriomyza trifolii

Chrotogonus trachypterus Trialeurodes ricini

Achoea janata

Nezara viridula Spodoptera litura Ergolis merionae

Euprotics Conogethes punctiferalis egg masses / plant and Conogethes puntiferalis with (1- 3 larvae/spike). The pests causing much pronounced economic damage in castor i.e. Tobacco cp, Spodoptera litura peak activity was noticed during first week of November and castor shoot and capsule borer activity was noticed during December first and second weeks. The succession and pest complex observed in the present studies were more are less similar to those of

Pest complex of Castor at Agricultural Research Station, Kampasagar

Common Name Scientific Name

Jassid Serpentine leaf miner

Grass hopper Castor whitefly

Castor semilooper

Green stink bug Tobacco Caterpillar Tobacco Spiny caterpillar

Mesta hairy caterpillar Castor shoot and capsule borer

383 Satyanarayana et al. (2000) and also Chakravarthy et al. complex in Rabi castor in Mahabubnagar Dist of (1997). Andhra Pradesh. Insect Environment. 5 (4): January- March

References

(Manuscript Receivd : 15.06.2012; Accepted 30.19.2012) Chakravarthy AK, Shivanna S L , Naik Chandrappa H , Naik L(1997) Insect pests of castor (Ricinus communis), in Karnataka. Insect Environment 2(4)135 Satyanarayana J, Singh TVK, Bapi Reddy T, (2000) Pest

384 JNKVV Res J 46(3): 385-389 (2012)

Scenario of bee-flora in Vindhyan plateau, Madhya Pradesh

Rajesh Verma Fruit Research Station, Berasia Road Entkhedi, Bhopal 462038 (MP)

Abstract Flower the mainstay of the bee’s life from flowers bee obtained nectar and pollen. For commercial beekeeping large crop acrease with good bee floral flowers qualities Bee floral Survey was conducted in Vindhyan plateau of is required Mishra (1997). Bee floral calendar with 116 Madhya Pradesh .Comprising six districts. Floristic status and important plants as bee forage for both nectar and pollen density supported from cropping system, forest plantation and sources was prepared for Bangalore area by Sekhar vegetables was not adequate for commercial beekeeping . and Gowda (2006). A.cerana gathered pollen and nectar The potential area for small beekeeping Hirapur Malthone throughout the year irrespective of climatic and floral (Sagar) ,Barna &Bareli (Raisen) ,Shahganj,Pilikarar ,Rithi and condition.( Sekhar and Bat 2006) In Madhya Pradesh commercial beekeeping is confined to north west area Rala (Sehore),Tendukheda ,Hata (Damoh). In vindhyan Plateau of the state were bee flora is a part of the cropping 11 species of high, 21 species and 27 species of medium system but in other part of the state the beekeeping is and 39&33 species of low pollen and nectar produsing plants still in beginning stage due to lack of knowledge about were recorded respectively. availability of the bee flora. Knowledge of status of bee flora is essential to evaluate the potential locality for beekeeping, as the floristic and climatic situation varies Keywords: Bee flora, Survey, Vindhyan Plateau, in different regions with this view present studies were Madhya Pradesh. carried out. Various districts of Vindhyan Plateau of Madhya Pradesh.

385 Table 1. Bee Flora Table Vindhyan plateau of Madhya Rai Brassica junea P2,N2 Nov.-Dec Pradesh Caster Ricinus communis P1,N1 Sept.- May Alsi Linum usitatissimum P2,N Jan.-Dec Niger Sesamumindica PN Jan.-Feb Local Name of Scientific Name Source Flowering period Chulai Amaranthus P3,N Jan.-Dec plant Pollen/ Nectar Water melon Cucumis spp. P2,N2 March- July Mirchi Capsicum spp. N2,P1 Jan.- Dec Mango Mengifera indica P3,N3 Jan-March Chaulai Amaranthus Spp. N1 August-Dec. Sharifa Annona squamosa N May-June Musk melon Cucumis melo P2,N2 April-June Papaya Carica Papaya PN Jan-Dec Cucumber Cucumis sativus P3,N3 March- June Anola Emblica offcinatis P2,N2 Mar-April, July- Kaddu C.pepo P2,N3 April - Sept. Sep Louki Lagenari siceraria P2,N1 Feb.- April Imli Tamarindus Indica N1 April -July Karela Mamordica charantia P3,N1 Jan.-Dec Jack fruit Arto carpus heterophyllus PN Jan-Feb Tinda Praecitrullus fistulosus P1,N1 April- Sept. Gular Ficus glomerata N1 March-July Cauliflower Brassica oleracea PN Feb.- April Mulberry Morus alba N Jan-Dec Cabbage Brassica capilata P2,N2 Nov.- March Banana Mausa paradisica N Jan-Dec Radish Raphanus sativus P2,N2 Nov.- March Bel Aegle marmelos PN April -May Onoin Allium cepa P2,N2 Nov.- Dec. Guava Psidium guajava P2, N2 Jan-Dec Bhindi Abelmoschus esculentus P3,N3 Dec.- Feb. Jamun Syzygium cumini P1,N1 Feb-April Sohjana Moringo oleifera P3,N3 Jan.-Dec Date palm Phoenis sylvestris P April -May Tomato Lycopessicum esculentum P3,N3 March- Oct.-May Anar Punica granatum P Feb-April ,July, Brinjil Solenum melongena P Jan.-Dec Aug Carrot Dancus carota P3,N3 June-Nov. Ber Zinziphus maurlltina P3,N3 July-Sep Saf flower Carthamus finctorius P,N3 Nov.-April Lime Citrus aurantifolia P2,N2 Jan-Dec Sun flower Heltanthus annuus P2,N3 July-Oct. Sour orange Citrus auraniticum PN Feb-March Corinder Corindrum rativum P2,N Jan.-Dec Lemon Citrus Limon P1,N1 Jan-Dec Methi Trigonella corniculata P2,N2 Jan.-March Chakotra Citrus maxima PN March Dhadhali Sonchus oleraceus PN March-April Gulmohar Painciana regia P3, N3 May-June Merrigold Tagetes errecia PN June-Nov. Aak Calotropis procera P1 Sep-March Wild merrigold T.minuta N1 Sept.-Nov. Semal Bombex ceiba P2,N2 Feb-March Zinnia Zinnia elegans P Sept.-Nov. Arjun Terminalia Arjuna P, N1 April-June Lajwanti Biophytum N2 July-Oct. Ageratum Ageratum conyzoides P3, N3 Oct-March Dhatun Dathura metal P3 July-August Neem Azadirachta indica P3, N1 Jan- April Congress grass Pathenium hysterophorus P1 Jan.-Dec Toon Toona ciliata N1 March-May Berseem Trifolium alexandrinum P1,N1 April Bootle brush Callistemon P, N1 March- May Rox Rosa indica P3 Jan.-Dec Nilgiri Eucalyptus spp. P1,N1 Dec-Feb Chilli Capsicum annum P3 June-Oct, Dec- Sandal Santalum album P3,N3 March-May March Teak Tacfona grandis P,N3 August-Sep Kachnar Bauhinia vareigata P,N2 Jan-Dec Mahua Madhuia tatifolia N2 May-June Khair Acatia catechu P1,N2 June- July Achar Buchanania langh P2,N2 Feb-March Subabool Leucaena spp. P1 Feb -March Jungle Jalebi Pithecelobisum duice P2,N2 Feb-March Falsa Grewia spp. P2,N2 Feb -March Babool Acacia nilotica P2,N2 Jan-Aug Lasuda Cordia dichotoma P2,N2 Oct-Feb Palash Butea frandosa P ,N2 March -April Ritha Eriglossum rubiginosum N2 August-Dec Sirish Albizia labeck P2,N2 April-June Har singar Lagerstromia spp. N3 Sept.- October Karanja Pongamia glabra N2 Feb-April, Aug.- Kadamba Anthocephalus Kadamba P1, N1 July- August Sep. Sal Shorea robusta N3 May-June Red Gulmohar Delonix regia P3 May -June Mithi neem Muraya coinizai P2, N1 April Shisham Dalbegia sisoo P3,N3 April -May Shahtut Morus indica N1 Oct.-Nov. Amaltash Cassra fistula P2 Jan-Feb Madhukamini Muraya exotica N1 July-Dec. Silver Oak Grevillea robusta P3,N3 Jan-Feb, April May Basant Rani Tebebubia Rosea N1 Oct.- Dec. Pili kaner Thevetia peruviana N1 Jan-Dec Merigold Tridex procumbens N3, P2 Oct.- Nov. Wheat Trticum aestivam P .Dec- Jan Gallardia Gallardia picta N3 March- May Maize Zeamays P Jan.-Dec Rose Rosa spp. N1, P2 Jan.- Dec. Rice Oryza sativa P2 Aug.-Sep. Cosmos Cosmos bipinnatus P1, N1 Aug.- Feb. Gram Cicer arictinum P3,N3 Jan.-March Calandula Calandula officinalis P1,N1 Nov. - Jan. Arahar Cajanum cajan P3,N3 Feb.-March Tendu Diasporus perigrina N2 February Sem Dolichos lablas PN Oct.-Nov Vilaity Imli Pithislobium dulse N2 August- Dec. Soyabean Glycine max PN August-Sept. Holyhock Althaea rosea P2,N2 Nov.-Feb. Lentil Lens culinaris PN Sept.- May Guldaudi Chrysanthemum Spp. P2 Nov.-Feb. Pea Pisum sativam P3 Nov.-Dec Dehlia Dahlia variabiles P2 Dec.-Feb. Field pea Pisum arvense N Nov.-Dec Cow pea Vigna sinensis PN Sept.- May P-Pollen, P- Normal, P1 High, P2 Moderate, P3 Low Mustard Brassica compestris P2,N2 Nov.-Dec N-Nectar, N- Normal, N1 High, N2 Moderate, N3 Low

386 Table 2. Common pollen and nectar supplying plants in Vindhyan Plateau

Potentiality Fodder/Crops/ of source Trees Fodder/Crops/Vegetables Vegetables

Pollen

High pollen Jamun, Nilgiri, Ask, Gular Sorghum ,Makka, Sem, Caster, Lemon, Karela Congress producer Grass

Medium Amaltas, semal, Imli, Mung, Coriender, Barseem, Brinjal, Frenchbean, Mustard Genda Pollen Siris aak,Gular Gazar, Rice, Guava, Aonla, Rai, Alsi, Cauliflower, Producer Cabbage, Radish, Sunflower

Low pollen Babool, Arjun, Neem , Neebu, Anar, Arhar, kasturi, Methi, Chaulai, Cotton, Dudhi, dahutra, Producer Silveroak, Shesham, Kusum, Chilli, Gram, Pea, Onion, Bhindi, Palak, Ber, Kamini, balsam Bottle brush, Khajur, Mango, Lentil, Cowpea, Sohajana, Brinjil, Carrot Motha, Cosmos Arand, Gulmohar, Sagona, Sandel, Imli Nectar

High pollen Nilgiri, Arjun, Neem, Caster, Barseem, Karela Pili Kaner Producer Imli, Bottle brush,Toon

Medium Karanja semal,Mahua Mung,Massor ,Coriender, Barseem, Frenchbean, Mustard, Lajwanti, Pollen Imli, Gulmohar, Palash Gazar, Rice, Guava, Aonla, Rai, Alsi, Cauliflower, Kamin, Genda producer Siris Jamun Cabbage, Radish, Sunflower Chiraya

Low pollen Babool, Mango, Kund Neebu, Arhar, Kala kasturi, Methi, Chaulai, Cotton, Kusum, Balsam Producer Silveroak, Shesham, Chilli, Gram, Pea, Onion, Bhindi, Palak, Ber, Mango, Lentil Cosmos Ber Sagona, Sandel Cowpea, Sohajana, Brinjil, Carrot, Lentil Cowpea

Table 3. Bee floral plants nectar / pollen availability of the year

Plants No. Pollen plants availability of the Year Jan. Feb. Mar. Apr. May Jun. July Aug. Sep. Oct. Nov Dec. Total No of months 353 35 42 45 38 31 28 27 29 30 26 26 28 12

Plants No. Nectar plants availability of the Year Jan. Feb. Mar. Apr. May Jun. July Aug. Sep. Oct. Nov Dec. Total No of months 356 29 37 42 40 32 28 25 24 23 24 27 25 12

Material and methods Result and Discussion

Survey was conducted in Vindhyan plateau of Madhya In Sehore district forest area was mostly confined in Pradesh covering blocks of six district viz, Sehore , southern part adjoining to Hosangabad and part of the Raisen, Bhopal, Vidisha , Sagar and Damoh. The survey Harda and western part adjoining to Dewas. The forest spots were selected randomly at nearly equal distance. was deciduous type predominance of Teak (Ticlona Each spots were observed for bee floral plants including grandis ), Palash (Bute frandosa), Achar (Buchanania forest, social forestry plantation, field crops, vegetation langh), Khair (Accacia catechu), Arjuna (Terminalia and orchards weeds present in the area, according to arjuna), and Neem (Azadirachta indica), Eucalyptus spp, the availability of flower plants and its density flora in Mahua (Mahuia tatifolia), Jungle Jalebi (Pithecelobisum particular spot it was categorized into low, medium and dulee), Gulmohar (Dleonix regia)and babool (Acacia high for bee floral status. nilotica) on field bunds provide bee pasturage, While the

387 crop support for pollen and nectar were also fulfil the food forest area around river side were suitable for requirements of the bees .But over all potentially for beekeeping viz. Halla, Washipur, Tejgarh, Tendukheda beekeeping in district was poor .Because low density of and Parata forest plantation was provides congenial forest Plantation contributing floral support in certain condition for multiplication of bee colonies in spring localities. While it was poor in other blocks. Similarly season and maintaining also river side forest plants are cropping support was found in moderate. The overall major source of bee flora. Neem (Azadirachta indica), potentially of commercial beekeeping is found poor in the Gulmohar (Dleonix regia), Babool (Acacia nilotica) and district. Jamun (Syzygium cumini) was also supplying food to the bees. Orchards like guava (Psidium guajava), Citrus In Raisen district. Forest flora present in southern (Citrus aurantifolia), Ber (Zinziphus maultina), Mango part of the district from Obedullaganj to Devri along the (Mangifera indica), Khair (Acacia catheu) Imli bank of Narmada river adjoining to Hoshngabad and (Tamarindus indica) plantation and crops provide bee Narsingpur district provides pollen and nectar pasturage and fully floral support for pollen and nectar throughout the year except in the month of June and and also sufficient of fulfil the food requirement. October – November. Road side plantation of Babool Potentially beekeeping moderate in district. (Acacia nilotica), Neem (Azadirachta indica), and Eucalyptus spp. are also beneficial to the bees. The The data of common pollen and nectar supplying area was the most potential areas for small beekeeping. plants for bees in Vindhyan plateau of Madhya Pradesh Because flora available through out the year. Overall revels that in all 11, species of high. Pollen producing potentiality for the beekeeping was moderate and not plants 21 species of medium pollen producing plants suitable for commercial beekeeping. and 39 species of low pollen producing plants were observed and 10 species of high nectar producing In Bhopal district Eucalyptus was the main source plants, 27 medium nectar producing plants and 33 of bee flora ,Beside these the road side plantation of species of low nectar producing plants were observed. Neem (Azadirachta indica), Arjuna (Arjuna In all 114 floral plants including forest .Social forest terminalia),Gulmohar (Dleonix regia), Babool (Acacia trees, Fields crops vegetables and fruit trees were nilotica) and Jamun (Syzygium cumini)was also observed and categorised for pollen and nectar source supplying food to the bees. Orchards like guava presented .Data further indicated that maximum pollen (Psidium guajava), Citrus (Citrus aurantifolia), Ber producing flowers were available in January to April 35- (Zinziphus maultina), Mango (Mangifera indica) coupled 45 total number of pollen producing in rest of the year with inter space cultivation of soyabean, Mustard and maximum pollen availability was in May (31plants) to Barseem provides floral support to the bees. Forest September (30 plants ) depending up on the weather plantation flora from was dominant in the of Bhopal .all condition. While in other months in ranged 26-29. status of bee flora, Forest plantation medium to rich Availability of pollen in June to August, and October to and crops growing areas in Bhopal district was medium. December was low. but overall potentially beekeeping was moderate in the district. Similarly maximum number of nectar producing plants was available in February to May (32-42 floral In Sagar district the Northern east part of the plants). Nectar availability was also moderate during district was relatively more suitable for beekeeping. The July to June requires introduction of more flowering major source of bee flora was the forest area. In Sagar plants to increase density of flowering plants to increase district Khandari, Banda, Hirapur, Shahgarh, Rampur density of flowering plants in these parts of the season and tigoda were moderately suitable for Bee keeping. for the continuous availability of sufficient quantity of In Vidisha district as whole was not much suitable nectar (Table 2). for beekeeping . Plantation is moderate in the district but beekeeping is not possible in all Vidisha district. Become bee flora situation was poor in almost all the location, Number natural bee hives of Apis dorsata was e/;ins’k ds foU/;u IysVq {ks= esa iq"iksa dk loZs{k.k N% ftyksa esa fd;k also less. x;kA O;olkf;d e/kqeD[kh ikyu gsrq e/kq iq"iksa dk Lrj ,ao l|urk i;kZIr ugh ikbZ xbZ A ou o`{kksa rFkk m|kfudh Qlyksa ls y/kq Lrj ij In Damoh district as a whole had great diversity as for as bee flora is concerned 30% area mixed forest ekSu ikyu gsrq ghjkiqj] ekYFkksu] ckjuk rFkk cjsyh ¼jk;lsu½] 'kkgxat] areas provide tremendous potentiality for beekeeping ihyhdjkj] jhBh jkyk ¼lhgksj½ rsanq[ksMk rFkk gVk ¼neksg½] mi;wDr ik;s .Almost are part of the district especially adjoining areas x,A foU/;u IysVq {ks= esa ijkx.k ,ao usDVj mRiknu djus okys to the Chattarpur, Panna, Katni and Jabalpur district,

388 ikS/kksa dh Øe’k 11 iztkfr;kW vf/kd mRiknu djus okys ikS/kksa dh] 21 Sekhar P, Gowda Gavi (2006) Bee floral calendar of Bangalore and its impact on Bee keeping Insect ,ao 27 iztkfr;kW e/;e ,ao 39 o 33 iztkfr;kW de mRiknu djus Envi 12(1) P 9-10 ikS/kkssa dh ikbZ xbZ gSA Sekhar P, Bhat NS (2006) Foraging behaviour of Apis cerana Fab. During different seasons in Bangalore region References Insect Envi 12(1) : 10-112

Mishra RC, Kumar R (1997) Bee flora and bee-keeping maps (Manuscript Receivd : 30.05.2010; Accepted 10.05.2011) of India. Perspective in Indian Apiculture / AgroBotanica : 40-65

389 JNKVV Res J 46(3): 390-393 (2012)

Multimedia Software for Integrated Pest Management of Oilseeds and Pulse Crops (e-IPM) in Central India

Gigi Annee Abraham and Sharad K. Jain* Krishi Vigyan Kendra, Jabalpur *Instrument Development and Service Centre Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract Intensive agriculture supported with the uncontrolled use of pesticides has increased agriculture production dramatically but on the other hand it has created serious Sustainable crop production and stability is the need of the hour, all this is possible only through practicing health, ecological and environmental problems. The environmentally sustainable pest management techniques greatest risks are those to humans who are exposed to available to us. Integrated Pest Management is the main toxic concentrations of pesticides. According to the World key component in the battle for sustainable production of Health Organization, more than 3 million people are agricultural crops Integrated Pest Management has the severely sickened and 220,000 die from pesticides each potential to substitute the chemical pesticides in the cost year worldwide. Poisoning from pesticides affects 68,000 effective manner, without any adverse effect on crop yield. farmers and workers every day; annually, an estimated Research in Integrated Pest Management has resulted in 25 million workers suffer from pesticide poisoning the development of an immense knowledge database that throughout the world. In India, the monetary values of requires modern computer-aided methodologies for its losses due to insects pests is estimated to be Rs. 29,000 proper integration, interpretation and extension. If IPM is to crores in 1996 and current losses in field crops alone is enjoy widespread approval and adoption, it must be clearly estimated to the tune of Rs.45,000 crores (Dhaliwal et al, defined, should be economic and socially acceptable and 2003). Pests can also become resistant to pesticides, moreover it should be available ready hand at the farmers increasing control costs, crop losses or other pest doorstep. The future need in plant protection technologies for agriculture crops is to extend the use of already developed damage. Many natural enemies of pests are killed by Integrated Pest Management (IPM) techniques to the farmers pesticides. so that the IPM technologies can be adopted at a very large Today one can observe that progress in information scale by all crop-producing persons. Integrated Pest technology (IT) is affecting all spheres of our life. In any Management (IPM) is the main key component in the battle sector information is the key for its development. for sustainable production of oilseeds and pulses. Integrated Pest Management in modern times should be socially Information and Communication Technology is ruling the acceptable, technically feasible, environmentally friendly, world at present, but Indian farmers are still unable to get ecologically useful and economical for crop protection for benefit from the Information Technology. By giving the pest. The information system on pest management relevant and right information in right time to farmers can technologies (e-IPM) provides a comprehensive source of help agriculture a lot. Insects, pests and diseases have information and pest knowledge material for improving the always been a major constraint in agricultural crop management of crop pests interactively by the combination production. In spite of all the advances made in oilseed of digital video, images, hypertext links and interactive keys and pulse crop protection technologies, losses caused provides a unique way of accessing the wealth of material by insects, pests have increased with modernization in contained on the Compact Disc (CD). agriculture. The information available reveals that the losses due to insects, pests are more in our region as Keywords : Sustainable, IPM, Multimedia, Oilseed, compared to other parts of the world. Pulse, Information system The concept and philosophy of Integrated Pest Management (IPM) have been largely accepted in modern

390 times. But, its implementation is highly complex and faces The major feature of this interactive knowledge numerous practical potential problems. At present there management tool is that users will be able to navigate is a great need of an intuitive knowledge based system, through the content in any way they want to meet their which suggests suitable insect, pest, disease control own, specific information and learning needs. The measures at the doorstep of farmers. Conventional combination of digital video, images, hypertext links and methods of extension consume a lot of time and interactive keys provides a unique way of accessing the resources; also they have limited reach and are not wealth of material contained on the Compact Disc (CD). available round the clock. Information technology can solve Best management practices for Integrated Pest this problem to a very great extent. At present there is a Management (IPM) in crops involve the correct need for an unconventional method to transfer the identification of pests (insects, diseases and weeds) and knowledge of experts in certain domain to the general of beneficial or natural enemies that can predate or public of farmers. parasitize these pests. Research in Integrated Pest Management (IPM) has resulted in the development of an immense knowledge Integrated Pest Management (IPM) includes database that requires modern computer-aided methodologies for its proper integration, interpretation and • Monitoring the pest population in the crop field and extension. The concept and philosophy of Integrated Pest adjoining areas Management (IPM) have been largely accepted in modern times. But, its implementation is highly complex and faces • Correct identification of the pests (insects, diseases numerous practical potential problems. Integrated Pest and weeds) Management (IPM) in modern times should be socially • Determining injury levels Aesthetic Injury Level, Eco- acceptable, technically feasible, environmentally friendly nomic Injury Level (EIL) and Economic Threshold Level and ecologically useful and should offer cost-effective (ETL) practical crop protection from pest. • Scheduling the treatment to get maximum advantage. This a multimedia software package (e-IPM) for Spot-treating for the pests (insects, diseases and disseminating the available Integrated Pest Management • (IPM) packages to the farmers and to motivate them to weeds) adopt recommended Integrated Pest Management • Selecting the least-damaging strategy strategies so that they can ensure optimum crop Evaluating the effectiveness of Integrated Pest Man- production with minimal losses through pests. The • information is available in single CD-ROM/DVD-ROM. The agement (IPM) strategies so that future strategies give software is bilingual i.e. in Hindi and English. This will better results provide them ready hand information of available Integrated • Creating awareness among all crop growers/farmers Pest Management techniques of major oilseed and pulse involved with the pest (insect, diseases and weeds) crops of Central India and will assist in improving the quality related problems. and quantity of produce. This software is a resource package for oilseed and pulse crop growers/farmers By the use of software, farmers can know about new researchers, advisors and students of agriculture. The tolerant and resistant varieties particularly about those software will provide a comprehensive source of information crops that suit according to his agro climate zone. The and pest knowledge material for improving the software will have various search options, the details on management of crop pests (insects, diseases & weeds) any aspects of IPM of various crops can be searched by and nutritional disorders. giving suitable key words. Similarly various control measures can also be searched. It also provides the The farmer/grower needs to know about resistant education on the correct methodology of Integrated Pest and tolerant varieties of various crops particularly about Management (IPM) essential for sustainable crop those, which offer resistance or tolerance towards production. endemic pests and biological/biochemical methods of pest control. The software is a user interactive resource Information Technology (IT) can play a pivotal role package for crop growers/farmers, researchers, advisors in agricultural extension activities, as most of the blocks and students of agriculture. This software provides a and panchayats are going to be equipped with computer comprehensive source of information and pest knowledge and Internet facility. E-IPM is complete knowledge based material for improving the management of crop pests user-friendly, interactive software database on major (insects, diseases and weeds) and nutritional disorders. oilseed and pulse crops suited for Central India. The

391 software consists of Integrated Pest Management (IPM) • Trapping, suction devices, collecting machines package of following major Kharif and Rabi crops: Physical soybean, cotton, sunflower, safflower, groundnut, sesame, Heat niger, mustard, arhar, moong, urd and chickpea. • • Cold Material and methods Biological • Augmentation of natural enemies Data are collected from the farmers by on site • Introduction of parasites or predators inspection of fields and from secondary sources like expert Chemical interviews, internet and literatures and manuals. • Herbicides, Insecticides, Fungicides Information starting from sowing, key pest, disease and • Matricides, Nematicides, Rodenticides, Avicides weeds of each crop and its resistant and tolerant varieties (blackbirds) and friend pest and various general practices are collected. Digital photos of different stages are collected for • Biological pesticides identification of pest, symptoms of disease and weeds. Source of bio-agents, fertilizers, resistant seeds are About e-IPM software collected. Movies of various cultural, mechanical and biological control practices are collected. The e-IPM has e-IPM is developed in visual basic 6.0 as front end and multimedia facilities like animations, audio, video, interactive and linked features. MS access 2000 as backend. It is multimedia bilingual (English/Hindi) software developed for pest, disease, Data collected are compiled and edited using nematode, weeds, and nutrient disorder management of different development tools like Macromedia Director, major oilseed and pulse crops of central India. In the e- Dream weaver, Flash, Adobe Photoshop, Adobe Illustrator, IPM, each crop module is separate and includes 3D effects, Corel Draw, Aver Magic, Ulead Photo Studio, information pertaining to integrated pest management of Windows Movie Maker, Sound-edit etc. Data are stored D ata collection in database, this act as back end of our system. The database is developed using MS Access. The graphical user friendly and interactive information system can be Database design developed using VB 6. The e-IPM is tested and distributed through CD-ROM. S y stem desig n Strategies for Integrated Pest Management (e-IPM) Technologies F ront p a g e desig n

Cultural (agronomic practices) Coding • Selecting plant resistant varieties • Crop rotation Connectivity • Cultivation, tillage practices • Variation of planting or harvesting dates • Plant spacing Testing • Fertilization level • Sanitation M aintaining • Planting pest-free seed • Planting trap crops D istribution Mechanical • Cultivation • Hand weeding Exclusion using screens or barriers Fig 1. Various steps for the development of e-IPM Software

392 the selected crop. The e- IPM incorporates information managing pests by combining biological, cultural, physical on natural enemies, resistant varieties, agronomic and chemical tools in a way that minimizes economic, practices and ipm modules of each crop. health and environmental risks. e-IPM is a user friendly software and a person having simple basic knowledge of computer can browse Acknowledgement the contents of the software. It has multimedia effects like audio, still photos with zooming effects, movies, and This project is funded by Department of Scientific life cycle diagrams. It includes a user interactive diagnosis & Industrial Research, Ministry of Science & Technology, module for pest and disease problem and a search module Government of India New Delhi. with different searching options using common name or scientific name for pest management. Apart from all these, References it is a resource of information regarding seeds, fertilizers, bio-pesticides centers, storage and technical enquiry. Buick RD, Youngman RR, Stone ND (1993) VICE-Corn: An The software is having mechanism for updating and Expert System for Insect Pest Management in Corn. incorporating new technologies as and when needed. Information Series - Virginia Polytechnic Institute Efforts have been made to cover most of the aspects of and State University, College of Agriculture and Life integrated pest management of groundnut, cotton, Sciences. No. 93 - 2, 9 pp soybean, sunflower, safflower, mustard, sesamum, niger, Chandrashekar K, Kumar ARV, Shaanker Uma R, Ganshaiah KN (2001) Forecast Models for Crop chickpea, moong, urd and pigeon pea. The information Pest and Diseases Based on Spatially Explicit and given are reviewed and edited by plant protection experts. Dynamic Database. Paper presented at the 1st National Conference on Agro-Informatics, held during 3-4 June 2001 at University of Agricultural Sciences, Dharwad Dhaliwal GS, Arora Ramesh, Dhawan AK (2003) Crop Losses due to Insect Pest and Determination of Economic Threshold Levels. Paper presented at the NATP Interactive Workshop on IPM, held during 26-28 Feb 2003 at National Centre of Integrated Pest Management, PUSA, New Delhi Garg DK, Verma PV, Pathak Mahesh, Jeswani MD (2003) Database on Pest of Rice-Wheat Cropping System: Computer Software for Resource Personnel in IPM. Paper presented at the 6th Agricultural Science Congress, held during 13-15 Feb 2003 at Indian Institute of Soil Science, Bhopal Girardot B (1995) COTON Doc: An Encyclopaedic Software Tool for Cotton Pest Control. Agriculture-et- Fig 2. e-IPM Software Development. No 5 : 47-50 Janet J Knodel (1999) Integrated Pest Management in North Conclusions Dakota, Crop Protection Specialist, North Central Research Extension Center Marcia P McMullen, Extension IPM Coordinator, Department of Plant In this paper, we make an effort to improve the Pathology pp 863 utilization and performance of agriculture technology by Singh SK, Sharma OP, Garg DK, Trivedi TP (2005) Handbook exploiting recent progress in Information technology by of Plant Protection Recommendations for introducing multimedia database system software 'e-IPM'. Vegetables, Spices, Medicinal and Aromatic Crops The future need in plant protection technologies for in India-Part III, NCIPM agriculture crops is to extend the use of already developed IPM Systems in Agriculture, Directorate of Plant Protection, Pest Management techniques to the farmers so that these Faridabad, Haryana sustainable technologies can be adopted at a very large Poisoned and Silenced by pesticides by Gopal Krishna scale by all crop-producing persons. The e-IPM may work published in toxics link.org. as an assist to develop knowledge based society (mainly farmers and experts) through Integrated approach to (Manuscript Receivd: 25.09.2012; Accepted: 27.12.2012)

393 JNKVV Res J 46(3): 94-397 (2012)

Evaluation of culinary oil after deep frying of traditional food

Deepali Agrawal and Anubha Upadhyay* Krishi Vigyan Kendra, Damoh (MP) *Department of Plant Physiology Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract Extensive work has been done on deep fat frying characteristics of potato chips, French fries and meat patties (Pravinsani and Calvelo 1986, Gamble and Rice Refined groundnut, soybean and rice bran oils were used for 1987, Hack et al. 2009). However, very scanty deep frying of besan pakodas. The same batch of oils were used for frying on consecutive eight days and heated in an information are available on characteristics of oils used open frying pan ( Iron kadai ) at a constant temperature ( 1800 for repeated deep frying of Indian traditional food C) each day and pakodas were deep fried and tested for products. Present communication throws light on the organoleptic and moisture loss , oil absorption and peroxide changes in physico-chemical properties of the edible value. Moisture loss and oil absorption differed (50.70%, oils used for the repeated deep frying pakodas and the 46.64%) significantly in deep fried pakodas. Based on peroxide acceptability of fried food products. value (13.0 meq O2/kg oil ) and the mean values of acceptability (6.10 ) refined soybean oil after 6th day frying and refined ground nut oil and refined rice bran oil after 7th Material and methods day frying may be discarded as the development of rancid flavors took place in the products and they became Refined groundnut oil (RGNO), soybean oil (RSBO) and unacceptable. rice bran oil (RRBO) of commercial grade and the other ingredients such as Besan (Chickpea flour), salt, hot Keywords : Oil, Peroxide value, Rancidity, Free fatty chili powder, coriander leaves, green chilies were acids, Oxidation, Deep frying purchased from the market.

Oils and fats are extensively used for the preparation Preparation of pakodas of fried products and such products make important item in Indian cousins. Major portion of edible oils and fats are consumed in the form of deep fried foods (Sulthana Standard traditional procedure was employed for and Sen 1979). It is common practice of the households, preparation of pakodas, 2.5 L of oil was taken separately 0 road side vendors and small hotels to use the same in to an iron frying pan heated to a temperature of 180 C. batch of oil for preparation of food on number of times, Pakodas were fried for about 60 min each day in the spread over some days or even weeks. When oils are same lot of oil. After cooling, oil was stored in a glass repeatedly or continuously heated at elevated jar. The left over oil measured each day (Table 2) and temperature, various chemical changes like hydrolysis, used for frying up to 8th consecutive days. Fried oxidation, polymerization & fission takes place (Nawar pakodas were subjected for organoleptic evaluation. 2000). This may results in the accumulation of Moisture content and oil content of pakodas were decomposed products, reduction of unsaturated fatty measured by standard AOAC (1980) method. For the acids, formation of peroxides & polymerization of fatty estimation of peroxide value (PV), of the oil from fried 0 acids. Which may causes deterioration in the quality of pakodas was extracted with petroleum ether ( 60-80 C) oil & products being fried in such oils, may cause health and estimated by the method as described in AOAC hazards (Fristch 1981). (1980).

394 For sensory evaluation the pakodas were placed increased extraction of fat soluble materials, in a paper plate with tomato sauce and served to a panel polymerization of fat and formation of high molecular of 10 experienced trained judges. The overall weight compounds. Al-Khatani (1991) Bouchon P. acceptability of the product was judged on 9 point (2009) and Sukumar et al. (2011) observed same type hedonic scale ranging from like extremely (9) to dislike of results. However, the abnormal trend in the moisture extremely (1) based on all the sensory quality attributes loss of pakoda fried in soybean refined oil was attributed of pakodas eg. shapes, Size, appearance, colour, to repeatedly for frying. The loss in moisture content in texture, taste and after taste feeling according to the fried pakodas recorded a general increase in all the method as described by Amerine et al. (1965). Statistical oils however the trends is somewhat different in various methods were employed for valid conclusions. oils. The content of oil absorbed by pakoda recorded Results and discussion a gradual increase (39.57- 65.07, 42.19 -60.40, 40.69- 56.90) for second day to eight day for all types of oil The moisture content of raw and fried pakodas were (Table 2). However the increase in oil absorption was estimated to determine the loss of moisture content in more pronounced in the oils i. e. refined groundnut oil fried pakodas. The percent loss of moisture content of (from 6.83-20.00) and rice bran oil (from 7.40-21.80) fried pakodas exhibited marked decline from 1st day to where absorption at first day of frying was markedly 8th day in all the oils (Table 1). When pakodas were lower than the oil absorbed in soybean refined oil (from fried in the fresh oil the moisture loss was low (38.60%) 11.00-27.40). However, the oil absorbed was and after consecutive heating the moisture loss significantly higher (8.90-20.00) by soybean refined oil increased significantly (50.70%) after each day frying. (11.00-27.40). No, further explanation of such type of This variation in moisture content may be due to the variation in oil absorption in different types of oil content initial moisture content of pakoda mix and extent of is possible. However variation in oil absorption might frying. show it's influence on the acceptability of pakoda which will be discussed in later part of this paper. Rai and As the frying proceeds, the rate of moisture loss Narayan (1984) also reported increase in oil absorption decreased due to the formation of hard crust on the of the pakoda deep-fried repeatedly in the same oil. product surface (Neelima and Sarojini 1991). Choudhary et al. (1985) described the phenomenon, due to Peroxide values (PV) of the oil present in the pakoda fried in different oils for eight days showed a gradual increase in all the oil from first day to eight day Table 1. Variation in moisture content of pakoda mix (Table 2). These findings confirmed the earlier reports and deep fried pakoda by various workers including more latest those by Kotwal Moisture loss (%) deep fried pakoda (2000) and Kaur et al. (1997), although the pakodas Days of frying RGNO RRBO RSBO fried in refined groundnut oil showed minimum peroxide Ist day 38.60 32.00 32.04 value (from 2.80-10.10) on all the eight days in compared to other two oils. However, intensity of IInd day 42.19 40.69 39.57 increase was about five times as compared from 1.8 to IIIrd day 43.72 45.82 42.19 3.0 times in all the other oils. Increase in peroxide values th V day 51.68 47.02 45.98 may be having bearing for deterioration of quality of th V day 54.88 48.68 51.32 fried product. Among the common chemical tests used VIth day 56.77 50.11 52.38 for groundnut oil, PV may be commonly fixed at a limit VIIth day 57.35 51.92 58.00 of 10 as indicative of quality of the codex Alimentarius VIIIth day 60.40 56.90 65.07 (Codex Alimentarius commission 1993). PV is the G. mean 50.70 46.64 48.32 measure of initial and primary products of lipid oxidation, S. Em. 1.991 0.580 0.841 frequently been used in predicting quality of edible oils CD 5% 5.916 1.725 2.50 like soybean, safflower, corn oil. However, observation have also been made that PV usually means poor RGNO - Refined Groundnut Oil flavour score but low PV does not necessary means RRBO - Refined Rice Bran Oil high flavour score, indicating low correlation (Narsimhan RSBO - Refined Soybean Oil et al.1986 ).

395 Table 2. Physico-chemical properties of oil after deep frying

Parameters Oil absorption (%) of deep Peroxide value of Pakodas fried Pakodas oil (meqO2/ kg oil) Day's of frying Volume of each oil RGNO RRBO RSBO RGNO RRBO RSBO after frying (lt) Control oil* - - - - 2.80 5.00 8.80 Ist day 2.5 6.83 7.40 11.00 3.50 7.50 9.20 IInd day 2.3 8.90 8.60 12.17 4.80 9.50 10.80 IIIrd day 2.0 11.20 8.80 15.80 4.90 10.62 11.50 Vth day 1.6 14.50 9.10 19.00 6.10 11.80 12.20 Vth day 1.4 16.20 12.80 19.20 7.20 12.50 13.00 VIth day 0.8 18.10 15.94 19.76 8.80 13.00 14.00 VIIth day 0.4 18.10 20.00 20.40 9.20 14.05 15.50 VIIIth day - 20.00 21.80 27.40 10.10 15.25 16.58 G. mean - 14.23 13.055 18.10 7.175 12.40 13.94 SEm - 0.197 0.993 0.620 0.061 0.074 0.0318 CD 5% - 0.587 2.952 1.843 0.181 0.221 0.945 *Control oil : Without frying of pakoda

onward. However, the pakodas was of acceptable Table 3. Acceptability of deep fried pakodas quality upto seventh day when fried in rice bran refined oil. The variation in the acceptability of the fried pakoda Parameters Acceptability of pakodas in different oil could be explained under the light of the after frying data of peroxide value and the fat absorbed. As peroxide Oils/Days of Frying RGNO RRBO RSBO values recorded a remarkable increase when the same Ist day 9.00 8.30 8.20 oil was used repeatedly for frying. IInd day 8.40 8.20 7.90 Similarly, the quantity of oil absorbed was also rd III day 8.00 8.00 7.40 increasing gradually on every subsequent day of frying. Vth day 7.60 7.60 7.00 These two factors could be ascribed responsible for Vth day 7.40 7.20 6.80 the disliking of the pakoda by the consumer. VIth day 7.20 7.00 6.40 It was concluded from sensory evaluation of VIIth day 7.00 7.00 6.10 Pakoda the soybean oil after 6th day frying and refined th VIIIth day 6.70 6.60 5.50 groundnut and rice bran oil after 7 day frying should be discarded as there was a development of rancid G. mean 7.66 7.490 6.912 flavor in the fried products. S. Em. 0.123 0.139 0.150 CD 5% 0.347 0.394 0.424 rhu rjg ds [kk| rsy e¡wxQyh] lks;kchu o pkoy dh Hkwlh ds rsyksa dk mi;ksx rFkk cslu ds idksM+ksa dks ryus ds fy, mlh rsy dks The results of sensory evaluation test to ascertain yxkrkj vkB fnuksa rd idksM+ks dks ryus ds mi;ksx esa yk;k x;kA rsyks the acceptability of the fried products revealed all the dks ,d yksgs dh dM+kbZ esa ,d fuf'pr rki rd xeZ dj idksM+ks dks four types of edible oils could provied pakodas of highly ryk x;kA idksM+ks dk vkdyu HkkSfrd o jlk;fud xq.kksa ds vk/kkj ij acceptable Table 3. However mean scores for acceptability registered a continuous decline on the fd;k x;kA fofHkUu rsyksa esa gq, idksM+ks dh ueh esa deh o 'kksf"kr rsy subsequent days in all the three types of oils. Fried dh ek=k esa mYys[kuh; varj ik;k x;kA ijkDlkbM eku o Lohd`fr product became unacceptable 6th day onward. Soybean ds vkSlr eku ds vk/kkj vkdyu fd;k x;k fd lks;kchu ds rsy dk th refined oil fried pakodas was unacceptable from 5 day 6 fnu o e¡wxQyh ds rsy vkSj pkoy dh Hkwlh ds rsy dk 7 fnu ds 396 ckn iz;ksx ugh djuk pkfg,A ,sls idksM+ks esa jsfUlM nqxZa/k o Lokn ds Hack DM, Bordi PL Jr, Hessert SW Jr (2009) Nutrition, sensory evaluation, and performance analysis of [kjkc gksus ds dkj.k Lohdk;Z ugh jgrsA vr% ,sls rsy dks bLrseky hydrogenated frying oils. Int J Food Sci Nutr 60:647- ugh djuk pkfg,A 61 Kour A, Hira C K and Raheja R K (1997) Frying in fats-nature of fats after use and fat absorbed. J Food Sci Technol References 34(1): 54-55 Kotwal D (2000) Mahua- Nutritional aspects, Manohar Al- Khatani H A (1991) Survey of quality of used frying oils publication 1:97-100 from restaurants. J Am Oil Chem Soc 68: 857-863 Nawar W W (2000) Lipids. Ch. 5 In " Food Chemistry" 3rd Ed. Amerine M A, Pangborm R M, Roessler E B (1965) Principle O. R. Fennema Marcel Dekker Inc New York 225- of sensory evaluation of food. Academic Press New 319 York and London Narsimhan S, Raghuveer K G, Argumughan C, Bhat K K, A O A C (1980) Official methods of Analysis 23rd Ed. Sen D P (1986) Oxidative rancidity in groundnut oil- Association of official Analytical Chemists evaluation by sensory and chemical indices and their Washington D C correlation. J Food Sci Technol 25 ( 5) : 237-247 Choudhary N M, Rajgopal M V, Ray S P, Mudhambi S P (1985) Neelima A, Sarojini G (1991) Quality of extracted oil from some Effect of incorporating papad khar (crude sodium commercially sold deep fat fried snacks and used carbonate) in papad doughs on the physico-chemical oil. J Food Sci Technol 28 (2): 108-109 properties of the frying medium. J Food Sci Technol Pravisani C l, Calvelo A (1986) Minimum cooking time for 22 (2): 119-122 potato strip frying. J food Sci. 51:614-617 Codex Alimentarius commission (1993) Report of the Rai T, Narayanan K M (1984) Effect of intermittent frying on fourteenth session of the Codex committee on fats the physico-chemical constant of ghee and refined and oils London 27 sep-1 october 95/A Rome FAO/ groundnut oil. J Food Sci Technol 21(6): 400-402 WHO. www.codexalimentarius.org Sulthana S N and Sen D P (1979) Studies on deep fat frying Fristch C W (1981) Measurement of frying oil deterioration. J ; changes during heating of oil. J Food Sci Technol Am Oil Chem Soc 58: 272-274 16:208-213 Gambel M H , Rice P (1987) Relationship between oil uptake and moisture loss during frying of potato slices. Int J (Manuscript Receivd : 20.12.2011; Accepted 07.05.2012) Food Sci Technol 22:233-241

397 JNKVV Res J 46(3): 398-399 (2012)

Constraints in empowering the women with reference to Jabalpur district of Madhya Pradesh

Monika Chaturvedi, M.K. Dubey, S.R.K. Singh* and Shashi Gaur** Department of Extension Education *Zonal Project Directorate, Zone VII, ICAR **Krishi Vigyan Kendra Jawaharlal Nehru Krishi Vishwa Vidayalaya Jabalpur 482 004 (MP)

Abstract academic and totally related to a specific trade, occupation or vocation. It is sometimes referred to as technical education as the trainee directly develops Vocational training are the important tool to prepare trainees for job that are based on manual or practical activities expertise in a particular group of techniques or traditionally non-academic and totally related to a specific technology. Realizing the crucial role of farm women, trade, occupation or vocation. The Indian council of Agriculture the Indian Council of Agricultural Research (ICAR) has Research (ICAR) has also identified the farm women and also identified the farm women and launched farm launched farm women empowerment training programme women empowerment training programme through through Krishi Vigyan Kendras (KVKs) conducting location - Krishi Vigyan Kendras (KVKs) conducting location - specific and need-based training programmes for empowering specific and need-based training programmes for the farm women with a view to equipping the technological empowering the farm women with a view to equipping skill, income and employment generation. The 90 rural women the technological skill, income and employment has been trained in the KVK Jabalpur on different agricultural aspects particularly fruits and vegetable preservation out of generation with reprise to agriculture and allied sectors. which cent per cent women trainees has been consider as a The study was carried out in Jabalpur district of sample size through census study. The majority problems Madhya Pradesh. The 90 rural women weretrained in reported for women empowerment are inadequate marketing facilities , where lack of follow up , lack of transport facility , at KVK Jabalpur on different agricultural aspects field visit for demonstration units and progressive farm are particularly fruits and vegetable preservation out of not undertaken as desired , lack of capital to start work ranked which cent per cent women trainees has been consider , complex loan procedure, higher rate of interest on credit, as a sample size through census study. The data were lack of infrastructural facilities for using the technological skill collected through personal interview by using pre- on occupational basis at the home town/ village level, less Structured Interview Scheduled. The constraints were number of trials and demonstrations and complex learning given the rank order according to the frequency of procedure were reported, statements of respondents. Out of the total respondents, majority (82.23%) Keywords : Women improvement reported inadequate marketing facilities as the main problem ranked I, whereas 75.56 per cent reported lack Empowerment in the context of women development is of follow up ranked II, followed by lack of transport facility a way of defining challenging and overcoming barriers ranked III (68.89%), field visit for demonstration units in a women life through which she increase her ability and progressive farm are not undertaken as desired to shape her life and environment. It is an active, multi- ranked IV (57.78%), lack of capital to start work ranked dimensional process which should enable women to V (47.78%), complex loan procedure ranked VI realize their full identity and power in all spheres of life. (42.23%), higher rate of interest on credit ranked VII India envisions a future in which Indian women are (38.89%), lack of infrastructural facilities for using the independent and self reliant. Vocational training are the technological skill on occupational basis at the home important tool to prepare trainees for job that are based town/ village level ranked VIII (35.56%), less number on manual or practical activities traditionally non- of trials and demonstrations ranked IX (31.12%) and

398 Table 1. Constraints in empowerment of women Constraints Number Percentage Rank Lack of follow up 68 75.56 II Complex learning procedure 25 27.78 X Lack of capital to start work 43 47.78 V Less number of trials and demonstrations 28 31.12 IX Lack of transport facility 62 68.89 III Higher rate of interest on credit 35 38.89 VII Inadequate marketing facility 74 82.23 I Complex loan procedure 38 42.23 VI Field visit for demonstration units and progressive farm are not 52 57.78 IV undertaken as desired Lack of infrastructural facilities for using the technological skill 32 35.56 VIII on occupational basis at the home town/ village level

complex learning procedure ranked X (27.78%) were Masure SB, Ashalata KV (2001) KVK training for farm women reported, respectively. Kanaujia et al. (2003), Masure, - an analytical study. Karnataka J Agril Sci 14 (3) : and Ashalata (2001), Belwanshi (2007) also observed 39-42 the similar constraints for women empowerment. Belwanshi E (2007) A study on impact of vocational training programme for women empowerment by Krishi Vigyan Kendra, Chhindwara M Sc (Ag) Thesis References JNKVV Jabalpur

Kanaujia Seema, Kanwar Neelam Devi Mirdula (2003) Impact (Manuscript Receivd : 30.04.2012; Accepted 20.08.2012) of institutional training on knowledge and skill of rural women of Raebareli (U.P.). Indian J Extn Edu 3(2) : 89-91

399 JNKVV Res J 46(3): 400-402 (2012)

Sustainable income generation through non wood forest products in Mandla district of Madhya Pradesh

A.N. Gautam and B.B. Beohar Department of Agricultural Economics and Farm Management Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract Methodology

Madhya Pradesh has the largest tribal population (23.27%) The present study was conducted during 2008-09 at of India. Forest product plays an important role to generates purposively selected Mandla district of Madhya employment opportunities, particularly in the non agricultural Pradesh. Mandla district is situated between 220 -21 seasons. The tribal dependency is on non wood forest North latitude and 800-18 East to 800-51 East longitude. products. In the present study was observed that the total The total geographical area is 8771 sqkm. It is situated annual income through crop production at Chhiwla, Chauba, at the bank of Holi River Narmada. Mandla is covered Surheli and Bania village were Rs 34700, 24825, 18500 and 16845 respectively by trials. While the total annual income with full of dense forest and tribal dominated population. through minor forest product by tribal, at village Chauba, Four villages were randomly selected for study purpose. Bania, Surheli and Chhiwla village were Rs 25575, 20245, Therefore ten tribals from reach village were selected 17600 and 13850 respectively. They aforesaid one inadequate as respondent. Primary data were collected by survey to the requirement of family needs, for hence they are from sampled tribals through personal interview and dependant on wages and collection of minor forest products group discussion. While secondary data from published for selling. records. Sample average and percentage were used as statistical tools to analyse the collected data. Keywords: Minor forest products, trials population Result and Discussion Madhya Pradesh has the largest tribal population of India. The population of scheduled tribes in the State is The tribals at study area were minor forest products in 154.04 lakhs (23.27 per cent of the total population of great quantity and sell it to either retailers or whole 661.81 lakhs). The tribal area covered an area of 25652 sellers, they fetch money to be used for basic needs. square miles which is approximately 15% of the area of The availability at minor forest products show that, how state. One third of the tribal population of the State lives they are important in tribal routine life. The tribal were in scheduled areas. Out of the total 459 development block of the State, 177 development blocks have been Table 1. Collection of minor forest products in selected designated as tribal development block, with 50% village (2008-09) population of the blocks are from tribal population Name of Botanical Name Plant par Yearly (Beohar 2004). MFPs used collection (kg) Forest product not only plays an important role Aomla Ambibalca officinalis Fruit 1115 in the remote areas economy, but also generates employment opportunities, particularly in the non Gond Sturcoolia yearns Exudate 135 agricultural seasons (Purohit 1997). The forest products Chakoda Pharia tora Seed 13300 are categorized into wood based forest products and Bhilva Golti Semicarpus anacardium Fruit/Seed 2500 non-wood products. The tribal dependency is on non- Mahuaphool Mandhuca indica Flower 4580 wood forest products. Char-chironji Seed 91.50

400 collected Chakoda (13300 kg) in maximum quantity by Chhiwla village 84.2 per cent and Bania village 82.6 followed by Mahua Phool (4500 kg), Bhilva Golti (2500 per cent. It was concluded that selected villages were kg), Aomla (1115 kg), Gond (135 kg) and Chirongi per found representative at tribal dominated villages. year. Thus, it revealed from the given Table 1, Chokoda, Mahua, Bhilva, Aomla and Chirongi were major minor Tribal having tinny holdings resulting poor forest products. The similar finding were also found by productivity. The land/field of the study area are hilly/ Rao (1996). sloppy, stony, with the soil having poor fertility and no technology application because of capital. The tribal are illiterate, no welfare program have reaches up to Table 2. Selection of villages feet. The table indicated that the total annual income of Village Population % of ST of TP crop production at Chhiwla, Chaaba, Surhali and Bania villages were Rs 34700, 24825, 18500 and 16845 Bania 961 82.6 respectively by tribals. Certainly these amounts will not Chauba 1240 90.3 fulfill the requirement of family needs for survival and Surheli 1436 90.3 to fulfill their needs, they have to depend on wages and Chhiwala 882 84.2 collection of minor forest products. The similar finding were also found by Beohar (2004). (Source: Census 2001) Minor forest products become one of the biggest sources of income for tribal community (Table 4). Forest The village wise population status of study area and tribal are complementary to each other. On an were showed that Chauba and Surheli village having average the selected tribal of Chauba Village gets some maximum tribal population 90.3 per cent followed

Table 3. Status of Agriculture of selected village (average of 10 farmers/tribals) Name of crops Name of Villages Bania Chauba Surhali Chhiwla Area Prod. Value Area Prod. Value Area Prod. Value Area Prod. Value Rice 2.82 21 8400 3.62 21.5 8600 2.92 21.5 8600 5.44 40 16000 Maize 1.61 8 1600 3.22 16 3200 1.61 8 1600 3.42 17 3400 Kodo 0.42 3 300 2.42 18 1800 1.91 13 1275 2.02 15 1500 Kutki 1.61 8 1200 6.05 30 4500 1.11 5.5 825 4.43 22 3300 Niger - - - 0.85 4 1000 - - - 1.41 7 3250 Wheat 1.71 9 2125 1.01 6 1250 1.21 6 1500 2.62 12 2800 Chickpea 0.96 5 1920 0.70 3.5 1400 1.01 5 2000 1.41 7 2800 Mustard 0.75 4.50 1295 0.51 2.50 875 1.21 6 2700 1.21 6 2700 Total Rs. 16845 24825 18500 34700

Table 4. Yearly income of tribal from minor forest product Minor forest product Name of village Bania Chauba Surhali Chhiwla Quantity Amount Quantity Amount Quantity Amount Quantity Amount (kg) (Rs) (kg) (Rs) (kg) (Rs) (kg) (Rs) Chakoda 3700 7400 5500 11000 2300 4600 1800 3600 Bhilva 875 2625 575 1725 700 2100 350 1050 Aomla 180 1800 385 3850 210 2100 340 3400 Gond 135 2700 ------Mahua 1280 5120 1650 8250 750 3000 900 3600 Char Chironji 6 600 7.5 750 58 5800 20 2000 Total income 20245 25575 17600 13850 Average income 2024.5 2557.5 1760 1385

401 maximum return from minor forest products (Rs.2557.5) yksxksa dh okf"kZd vk; dscy 34700 : Fkh] tcfd pksok dh 24825 followed by Bania (2024.5), Surhali (1760.00) and 18500 16845 Chhiwala (1385) per year (Arnold 2009). :] lqjgyh dh vkSj okfu;k dh : Fkh A y?kqouksit ls izkIr vk; okfudk xkao dh 20245] pksok 25575] lqjgyh dh In Bania and Chauba village, the main sources 17600 13850 of income are minor forest products. In these villages, vkSj fNyok xkao dh : gS A v/;;u esa ik;k x;k the agriculture income is less (45.42% and 49.26%) than fd y?kqouksit ds }kjk okfu;k vkSj pksok xkao dh vk; Qly mRiknu minor forest products income (54.58% and 50.74). The ls vf/kd Fkh A vr% vkfnokfl;ksa ds thou esa vk; dk eq[; L=ksr agriculture and minor forest products income shared y?kqouksit gSA vr% bu {ks=ksa esa y?kqouksit dh egRo iq.kZ Hkwfedk gSA (51.25%) almost same amount (48.75%) in Surhali village. The tribal of Chhiwala village earn about 3/4 share of their annual income (71.48%) from agriculture References because of not having dense forest and unavailability of minor forest products. The annual income of minor Arnold JEM (2009) Socio-economic benefits and issues in forest products was above the 50 per cent of total annual non-wood forest product use. In report of the income, which was ultimately greater than the annual International Expert Consultation of non-wood forest income through agriculture. The similar findings were products. Food and Agriculture Organization of the reported by Purohit (1997). United Nations Rome : 89-123

Table 5. Contribution of agriculture and minor forest products in annual income (Amount of Rupees) Source Name of villages Bania Chauba Surheli Chhiwala Agriculture 16845 24825 18500 34700 Percent of total income 45.42 49.26 51.25 71.48 minor forest products 20245 25575 17600 13850 Percent of total income 54.58 50.74 48.75 28.52 Total income (Rs) 37090 50400 36100 48550 100 100 100 100

Low Productivity of crops resulted low income, Beohar Bipin (2004) Contribution at minor forest product in pushed tribals to step up toward forest for earning to tribal economy of MP - As study at tribal district. J MP meet family needs. Minor forest products are richest Eco Assoc : 109-113 source of income other than agriculture and wages. It Dube BK, Bahodar (2006) A study at the tribal people and the concluded from the study that income from minor forest tribal area of Madhya Pradesh tribal Research and products Supplements a lot to fulfill tribal basic needs. Development Institute Bhopal Purohit Mamta (1997) Employment income generating MFP species for woman collection, processing and e/;izns'k esa Hkkjr dh tula[;k dk 23-27% tula[;k dsoy marketing. Vaniki Sandesh 21(1) : 7-13 Rao A, Ratan, Singh BP (1996) Non-wood forest product vkfnoklh; tutkfr dh gS] tks fd taxyks esa fuokl djrh gS rFkk bu contribution in tribal economy. Indian Forester 122(4) {ks=ksa esa jgus okys yksxksa dh vFkZO;oLFkk lq/kkjus ,oa jkstxkj mRiUu : 337-347 djus dk vPNk lk/ku gS A y?kqouksit dh miyC/krk v/;;u {ks= esa i;kZIr ikbZ xbZ gS A Qly mRiknu esa fNcyk xkao ds nl pqus gq;s (Manuscript Receivd : 24.12.2011; Accepted 07.08.2012)

402 JNKVV Res J 46(3): 403-406 (2012)

A discrete probability distribution for describing the pattern of four major insects on pigeonpea crop

Manoj Kumar, H.L. Sharma and S.B. Das* Department of Mathematics and Statistics *Department of Entomology Jawaharlal Nehru Krishi Vishwa Vidhyalaya Jabalpur 482 004 (MP)

Abstract 5 to 95 per cent damage to the crop (Bindra and Jakhmola 1967). In this paper, we present a discrete probability distribution The losses caused by major insect pests are i.e., a Poisson distribution for describing the pattern of four about 30-40% (Lal and Yadava 1988) and cause major insects on pigeonpea crop. Three methods have been adequate economic damage leading to very low yield employed to estimate the parameter of this distribution and of 500-800 kg/ha as against the potential yield of 1800- at the end; some illustrative examples have been added. 2000 kg/ha (Lal et al.1997).

Keywords: Poisson distribution, Methods of Due to the changing climatic conditions in the movements, Method of proportion of zeroth cells, MLE farming situations, information on pest complex gradual, seasonal abundance of major insect pests and efficacy of new insecticides is a pre-requisite for developing Pigeonpea, [Cajanus cajan (L.)] is the second most successful IPM practices particularly under late sown important pulse crop in India. In India, pigeonpea conditions. occupies an area of about 3.38 million ha with a total production of 2.2 million tonnes (Rao et al. 2007). A number of probability prediction models were Pigeonpea is mainly grown in Madhya Pradesh, suggested to describe the variation in the population Maharashtra, Uttar Pradesh, Karnataka, Andhra on various crops. Pradesh, Gujarat and some parts of Rajasthan which The elementary distributions such as binomial, covers about 87 per cent of the area and contributes Poisson and negative binomial may describe the pattern about 83.8 per cent of the production (Meena et. of pest population. In this paper, attempts are made to al.2006). Much of the area under pigeonpea is covered propose a Poisson distribution for knowing the clustering by medium and long duration regional and landrace pattern or grouping pattern to a large class of data with cultivars, which are harvested in about 220-280 days. three methods of estimation. In Madhya Pradesh, pigeonpea crop is cultivated in an area of 4.1 lakh ha with a total production of 2.6 Material and methods lakh tonnes and an average productivity of 925 kg/ha (Verma 2008). Abiotic and biotic stresses are the most limiting factors in pigeonpea production. Among the The observation were made from research experimental biotic pressures, large number of insect pests have been field of Department of Entomology, Adhartal, JNKVV, identified to infest pigeonpea. The low yields of Jabalpur (MP), during Kharif Season 2009-2010. The pigeonpea crop are due to pod borer complex and sowing of pigeonpea (variety ICPL- 88039) was done physiological shriveling. Gram pod borer, (Helicoverpa on 11th July 2009, with row to row distance 0.6 m, plot armigera) ; Tur pod bug, (Clavigralla gibbosa); Tur pod to plot distance 0.2 m and plot size 10 × 12m, following fly, (Melanagromyza obtuse); Tur plume moth, (Exelastis a randomized complete block design (RCBD) with 9 atmosa) etc. These major pests are reported to cause treatments and 3 replications. The recommended

403 fertilizer dose of 18:46:00 kg/ha (N: P: K) was applied Poisson distribution is fully discussed in Johnson and respectively. One weeding was done.Through Poisson Kotz (1969). distribution with three methods of estimation of the parameter. The occurrence of pod fly, pod borer, pod bug and tur plume moth recorded from the incidence of Method of maximum likelihood pest. Observations of different insect pests were recorded on 25 tagged plants twice in a standard week. Consider a sample consisting of N observations of the Poisson distribution is a discrete probability random variable X with probability mass function (2.1) distribution and is very widely used in statistical work. in which n0 designates the number of zero observations,

It was developed by a French Mathematician Simeon n1 the number of one observations and N the number Denis Poisson (1781-1840) in 1837 and he obtained of total observations. The values chosen as the distribution by considering the limiting form of the binomial distribution. Poisson distribution may be L = (e-λ)no (λe-λ)n1 (1-e-λ -λe-λ)N-no-n1 ...(2.4) expected in cases where the chance of any individual event being a success is small. It is also called the probability distribution of rare events. In recent years, Taking natural logarithms of equation (2.4) gives the Poisson distribution has been used to way markedly following. increasing number of application, in the great majority of cases. Poisson distribution often serves as a standard -no+n /l-n +(N-n -n )/(1-e-l -e-l)X le-l =0, ...(2.5) form. 1 1 o 1

A random variable X is said to have a Poisson Differentating with respect to l and setting the derivatives distribution wiht parameter l if it assumes only non- equal to zero gives the following estimating equation. negative values and its probability mass function as function. We have, P (x = k) = e-λ λκ/κ!, K = 0,1,2 ...(2.1) Results and Discussion 0, otherwise The distribution of observed and expected number of Estimation plants according to the number of tur pod bug on the observation recorded from 11th Aug. to 5th January. The This distribution cotains one parameters l. It is estimated distribution was fitted by method of proportion of zeroth by method of proportion of zero cells, emthod of moments and maximum likelihood. cell, method of moments, method of maximum likelihood.

Method of proportion of zero th cell (MPZC) Distribution of observed and expected number of plant according to number of pigeonpea tur pod bug.

It is estimated by equating proportion of zero cell with their corresponding theoretical values. No. of Observed Poisson distribution insects frequency MPZC MM MLE

λ (i.e.) no/N = e- 0 830 800.00 825.003 821.762 (i.e.) l = -In (no/N) ...(2.2) 1 255 262.271 265.653 267.832 2 45 37.775 39.128 40.017 Method of moments 3 5 4.954 5.214 5.389 Total 1135 1135 1135 1135 The parameter l in Poisson distribution is estimating by λ 0.3107 0.3167 0.320 method of moments which is given below : Estimate of χ2 1.58 1.346 1.344 λ = m1' ...(2.3) parameter df 2 2 2 Where m1' is the observed mean.

404 The estimates of λ by three methods were found to be The distribution of observed and expected 0.3107, 0.3167 and 0.32 respectively. The estimates number of plants according to the number of tur plume of λ by the mthod of MPZC, MM and MLE were slightly moth on the observation recorded from 11th Aug to 5th differing from each other. The values of χ2 at 5% level January (Table 3.2). The distribution was fitted by method of significance at respective degree are non-significant. of proportion of zeroth cell, method of moments and method of maximum likelihood. The estimates of λ by three methods were found Fig.3.1 Fitting of Poisson distribution under to be 0.1434, 0.1396 and 0.1345 respectively. The MPZC, MM and MLE for tur pod bug in Pigeopea estimates of λ by the method of MPZC, MM and MLE

900 were slightly differing from each other. The values of 800 χ2 at 5% level of significant and respective degrees of Observed frequency n 700 freedom are found to be non-significant (Table 3.2 and 600 500 Poisson distribution Figure 3.2). 400 MPZC 300 Poisson distribution MM No. of pla No. of 200 Distribution of observed and expected number of plant 100 according to number of pigeonpea tur pod fly. 0 Poisson distribution 1234 MLE The distribution of observed and expected No. of insects number of sites according to the number of tur pod fly on the observed recorded from 22nd Dec to 5th January (Table 3.3).

Distribution of observed and expected number of plant according to number of pigeonpea tur plume moth. Table 3.3. Distribution of observed and expected number of plant according to number of pigeonpea tur pod fly

th Fig. 3.3 Fitting of Poisson distribution under The distribution was fitted method of proportion of zero No.MPZC, of MM Observed and MLE for tur pod flyPoisson in Pigeopea distribution cell, method of moments, method of maximum likelihood. insects frequency MPZC MM MLE The estimates of λ by three methods wer found to be 450 400 No of insects 0.1434, 0.1396 and 0.1345 respectively. The estimates 0 350 401 401.000 395.756 393.812 of λ by the method of MPZC, MM and MLE were slightly 1 300 155 161.274 164.286 163.685 250 Observed frequency χ2 differing form each other. The values of at 5% level 2 200 30 26.105 27.861 27.505 of significance and respective degrees of freedom are 150 Poisson distribution 3 No . ofp l100 ants 8 5.62MPZC 6.095 5.998 found to be non-significant (Table 3.1 and Figure 3.1). 50 Poisson distribution MM Total0 594 594 594 594 1234 λ 0.3877Poisson 0.4011 distribution 0.3984 No. of Observed Poisson distribution No. of insects MLE insects frequency MPZC MM MLE Estimates of χ2 1.83 1.356 1.405 parameter df 2 2 2 0 984 984.00 987.788 984.102 1 143 139.163 135.939 139.077 2 8 11.836 11.272 11.821 Total 1135 1135 1135 1135 λ 0.1434 0.1396 0.1433 Estimates of χ2 1.344 1.329 1.345 parameter df 1 1 1

The distribution of observed and expected number of sites according to the number of tur pod fly on the observation recorded from 22th dec. to 5th January.

405 The distribution was fitted method of proportion were slightly differing form each other. The values of χ2 of zeroth cell, method of moments, method of maximum at 5% level of significance and respective degrees of likelihood. The estimates of l by three methods wer freedom are found to be non-significant (Table 3.4 and found to be 0.3877, 0.4011 and 0.3984 respectively. Figure 3.4). The estimates of l by the method of MPZC, MM and MLE were slightly differing form each other. The values of c2 at 5% level of significance and respective degrees In present investigation, attempts have been made to of freedom are found to be non-significant (Table 3.3 advocate the suitable probability distribution which can and Figure 3.3). be described the spatial pattern of tur pod bug ,pod borer, pod fly and tur plume moth on pigeon pea crop. The distribution of observed and expected In order to identify the spatial pattern of tur pod bug, number of sites according to the number of tur pod borer pod borer, pod fly and tur plume moth, Poisson on the observed recorded from 11th August to 5th distribution is proposed. The estimates of parameter January (Table 3.4). involved in the probability distribution have been determined by the method of moments, method of proportion of zeroth cell and method of maximum Table 3.4 Distribution of observed and expected number likelihood estimation method. It may be concluded that of plant according to number of pigeonpea tur pod borer the pattern of clustering of tur pod bug, pod borer, pod No. of Observed Poisson distribution fly and tur plume moth on pigeonpea crop can be insects frequency MPZC MM MLE adequately described by Poisson distribution.

0 345 345.000 344.372 338.024 References 1 100 102.954 103.34 107.67 2 25 22.045 22.243 24.306 Bindra OS, Jakhmola SS (1967) Incidence and losses caused Total 470 470 470 470 by some pod in festing insects in different varieties λ of pigeonpea in Madhya Pradesh. Indian J agri Sci 0.312 0.314 0.332 37(3)177-186 Estimates of χ2 0.48 0.449 0.708 Lal SS, Yadav CP, Ahmad R (1997) Insect pests of short parameter df 1 1 1 duration pigeonpea - A review. Plant Protection Bulletin 49(5) 32 Meena RS, Srivastava CP, Joshi N (2006) Bioefficacy of some newer insecticides against the major insect pests of short duration pigeonpea. Pestology 30(7) 13-16 Fig. 3.4 Fitting fo Poisson distribution under Rao Y Koteswara, Reddy MV, Rao Ch Mallikarjuna (2007) MPZC, MM and MLE for the tur pod borer in Stability for seed yield in pigeonpea. J Food Legumes Pigeopea 20(2) 207-208 Thakur RC, Nema KK, Singh OP (1989) Losses caused by 350 No of insects pod fly, Melanagromyza obtusa (Mall.) and pod borer, 300 n Helicoverpa armigera (Hub) to pigeonpea in Madhya 250 Observed frequency Pradesh. Bhartiya Krishi Anusandhan Patrika 4(2) 200 107 150 Poisson distribution Verma HD (2008) Krishi Vishwa Kharif Visheshank, Sanchar 100 MPZC

No. of pla No. of Kendra, JNKVV, Apr-Jun 2008, 37(2) 18 50 Poisson distribution MM 0 Yadav LS, Chaudhary JP (1993) Estimation of losses due to 123 pod borers in pigeonpea. Indian J Ent 55(4) 375- Poisson distribution 379 No. of i nse ct s MLE

The distribution was fitted method of proportion of zeroth cell, method of moments, method of maximum (Manuscript Receivd : 18.06.2012; Accepted 30.09.2012) likelihood. The estimates of λ by three methods wer found to be 0.312, 0.314 and 0.332 respectively. The estimates of λ by the method of MPZC, MM and MLE

406 JNKVV Res J 46(3): 407-413 (2012)

Prioritization of sub-watersheds based on morphometric analysis using Remote Sensing and GIS Technique

S.K. Sharma, R. Pathak and S.Suraiya Department of Soil and Water Engineering College of Agricultural Engineering Jawaharlal Nehru Krishi Vishwa Vidayalaya Jabalpur 482004 (MP)

Abstract watershed into sub-watershed (30-50 km2), mini- watershed (10-30 km2), and sub-watershed (5-10 km2) (Chopra et al. 2005). Watershed prioritization has gained importance in natural resources management, especially in the context of watershed Morphometric analysis of a watershed provides management. Morphometric analysis has been commonly a quantitative description of the drainage system which applied to prioritization of watersheds. The presents study is an important aspect of the characterization of makes an effort to prioritize sub-watersheds based on watersheds (Strahler 1964). Morphometric analysis morphometric analysis using remote sensing and GIS techniques in Barchha Nala watershed of Narsingpur district, requires measurement of linear features, areal features, of Madhya Pradesh. Various morphometric parameters, gradient of channel network and contributing ground slope of the drainage basin (Nautiyal 1994). The remote namely bifurcation ratio (Rb), form factor (Rf), elongation ratio sensing technique is convenient method for (Re), circulatory ratio (Rc), drainage density (Dd), stream frequency (Sf), relief ratio (Rh), ruggedness number (RN), and morphometric analysis as the satellite images provides relative relief (Rr), have been determined for each sub- a synoptic view of a large area and is very useful in the watershed and assigned ranks on the basis of value/ analysis of drainage basin morphometry. Pioneering relationship so as to arrive at a computed value for final ranking work on the drainage basin morphometry has been of the sub-watersheds. Out of six sub-watersheds of study carried out by Horton (1932, 1945), Miller (1953), Smith area sub-watershed 5 is on top priority based on the (1950), Strahler (1964) and others. In India, some of morphometric analysis, so soil and water conservation should the recent studies on morphometric analysis using be started from this sub-watershed. remote sensing techniques were carried out by Nautiyal (1994), Srivastava (1997), Nag (1998) Srinivasa et al., Keywords: GIS, Watershed and Prioritization (2004). More recently, Chopra et al., (2005) have carried out morphometric analysis of sub-watersheds in A watershed is an area from which runoff resulting from Gurdaspur district, Punjab. A study on characterization precipitation flows past a single point into large streams, and management of watersheds in Ganeshpur rivers, lakes or oceans. Thus, a watershed is the surface watershed of Nagpur district was carried out by Solanke area drained by a part or the totality of one or several et al. (2005). given water courses and can be taken as naturally Prioritization of sub-watersheds based on occurring hydrologic unit characterized by a set of morphometric analysis of drainage basin using remote similar topographic, climatic and physical conditions. sensing and GIS techniques, was attempted by Biswas Various terms have been used in order of their rank/ et al. (1999). Nooka Ratnam et al. (2005) carried out hierarchy, i.e., sub-watershed, watershed, sub-basin check dam positioning by prioritization of micro- and basin. The Watershed Atlas prepared by AIS&LUS watersheds using Sediment Yield Index (SYI) model and (1990), describes the mean area of watershed as being morphometric analysis using remote sensing and GIS less than 500 km2 (±50%). The National Remote in Midnapur district of West Bengal. Arun et al. (2005) Sensing Agency (1995) has further classified the attempted a rule-based physiographic characterization

407 of a drought prone watershed applying remote sensing Base Map of the study area is prepared using Survey and GIS techniques in Gandeshwari watershed in of India (SOI) toposheet 55N/14 and 55N/15 on 1:50000 Bankura district of West Bengal. In the present study, scale. These toposheets were imported in EDRAS efforts were made to prioritize the sub-watersheds of imagine 9.1 software. Subsequently toposheets were Barchha nala watershed for soil conservation. georeferenced using (Projection and Coordinate System) conic (Geographic Coordinate System) GCS Indian 1975. Georefrenced toposheets were mosaiced Materials and methods to have final base map. Further processing was done in Arc-GIS. Satellite data of LANDSAT row & path 144/ Study area 044 was downloaded from GLCF (Global Land Cover Facility), for 29th December 2000 used in this study to prepare updated drainage layer. Fig 2 and 3 presents The study area Barchha nala watershed which lies FCC (False Colour Composite) and drainage map within the Narmada river basin is situated between 22° respectively. Contour map is showed in Fig 4. 34' 18.70" to 22° 26' 56.64"latitude N and 78° 54' 59.44" to 78o 51' 25.47"E longitude (Fig 1) with elevation range between 680 to 1020 m above mean sea level (MSL) and extends a total area of 66.85 Km2. Barchha nala Watershed situated in Narsinghpur district of Madhya Pradesh. The study area belongs to Central Narmada valley, agroclimatic zone VI of MP. It has a typical sub humid climate with hot dry summers and cool dry winters. Temperature extremes vary between the minimum of 8.2 0C during December or January months to the maximum of 42.5 0C in May or June. Average annual precipitation is 1192 mm, which is concentrated mostly between mid June to mid September with scattered winter rains during late December and January months.

Fig 2. FCC of Study area

Fig 3. Sub watershed and Drainage map of study Fig 1. Location map of Study area area

408 stream of each of the sub-watersheds are shown in Table 2. Computed morphometric parameters are presented in Table 3.

Morphometric parameters

Bifurcation ratio (Rb)

Horton (1945) considered bifurcation ratio as an index of relief and dissection. Strahler (1957) demonstrated

that Rb shown only small variation for different region on different environment except where powerful

geological control dominates. Lower Rb values are the characteristics of structurally less disturbed watershed without any distortion in drainage pattern (Nag 1998).

The sub-watershed 6 has maximum (Rb = 4.62) while

sub-watershed 3 has minimum (Rb = 3.45). Rb characteristically ranges between 3.0 and 5.0 for watershed where the influence of geological structure Fig 4. Contour map of study area on the drainage network is negligible (Verstappen 1983).

The delineated watershed boundary was further Relief ratio (Rh) subdivided into the sub watershed. Sub watershed boundary along the drainage network was selected for Schumn (1956) defined relief ratio as the ratio of morphometric analysis. The input parameters for maximum relief to horizontal distance along the longest morphological studies such as area, perimeter, dimension of the basin parallel to the principal drainage elevation, stream length etc. were obtained in GIS line. It measures the overall steepness of a drainage environment and other parameters were calculated basin and is an indicator of the intensity of erosion using standard formulae (Table 2) based on input values. processes operating on the slopes of the basin. In the present study the R values of the sub-watersheds vary The morphometric parameters values were h calculated using formulae given in Table 1. Prioritization from 0.02 to 0.06 (Table 2) suggesting gentle slope of rating of all the sub-watersheds of Barchha Nala the Barchha Nala watershed. watershed was carried out by calculating the compound parameter values. The micro-watershed with lowest Relative relief (Rr) compound parameter value was given the highest priority. The values relative relief varies from 0.01 to 0.02 for

the Sub-watersheds. Sub watershed with high Rr are Result and Discussion consider critical form erosion point of view and should be provided with suitable soil and water conservation The designation of stream order is the first step in measures. morphometric analysis of drainage basin, based on the hierarchical making of stream proposed by Strahler Drainage density (Dd) (1964).The sub-watershed 1, 2, 3, 4 and 5 are of forth order and sub-watershed 6 is fifth order. The whole Barchha nala watershed is of fifth order. The updated It indicates the closeness of spacing between channels drainage and sub-watershed map of Barchha Nala and is measure of the total length of the stream segment watershed is presented in Fig 3. of all orders per unit area. It is affected by factors such as resistance to weathering, permeability of rock The fundamental parameters namely; stream formation, climatic, vegetation etc. In general, low value length, area, perimeter, basin length, and number of 409 Table 1. Formula for computation of morphometric parameters Morphometric Parameters Formula Reference

Bifurcation Ratio (Rb)Rb = Nu/ Nu+1

Where, Rb = Bifurcation Ratio

Nu = Total number of stream of segment of order u

Nu+1 = Total number of stream of segment of next Schumn (1956) higher order

Drainage density (Dd)Dd = Lu/A

Where, Dd = Drainage density

Lu = Total stream length of order u A = Area of basin (km2) Horton (1945)

Stream Frequency (Sf)Sc = Nu/ A

Where, Nu = Total number of streams of all order A = Area of basin (km2) Horton (1945) 2 Form factor (Rf)Rf = A/ Lb

Where, Rf = Form factor A = Area of basin (km2)

Lb = Length of basin (km) Horton (1945) 2 Circulatory ratio (Rc)Rc = 4 Π A / P

Where, Rc = Circulatory ratio A = Area of basin (km2) P = Perimeter (km) Miller (1953) Elongation ratio (R )R = (2/L ) * (A/ )0.5 Schumn (1956) e e b Π Ruggedness Number (RN) RN = H × Dd

Where, RN = Ruggedness Number H = Maximum watershed relief (m)

Dd =Drainage density

Relief ratio Rh = H × Lb

Where, Rh = Relief ratio H = Maximum watershed relief (m)

Lb = Length of the basin

Relative relief Rr = Rh × P

Where, Rr = Relative relief

Rh = Relief ratio P= Perimeter of the basin

Table 2. Morphometric parameters of sub-watersheds computed in GIS environment Sub-watershed Perimeter Area Elevation Total No. of Max length Total No. (km) (km2) (m) relief streams watershed stream (m) (km) length Max. Min. 1 19.45 9.93 1020 740 280 57 7.01 35.68 2 15.16 8.48 1000 740 260 50 5.63 31.89 3 15.76 13.91 1020 740 280 42 4.99 60.45 4 14.92 9.27 956 700 256 106 4.89 43.47 5 9.22 3.94 860 700 160 79 3.69 19.55 6 32.09 21.31 880 680 200 185 8.20 92.29

410 Table 3. Computed morphometric parameters of sub-watersheds

Sub watershed No. Sf Dd Rr Rh RN Rf Re Rc Rb 1. 5.74 3.59 0.014 0.040 1.006 0.202 0.507 0.330 3.833 2. 5.89 3.76 0.017 0.046 0.977 0.268 0.584 0.464 3.574 3. 3.02 4.34 0.018 0.056 1.217 0.559 0.844 0.704 3.452 4. 11.43 4.69 0.017 0.052 1.200 0.388 0.703 0.523 4.438 5. 20.04 4.96 0.017 0.043 0.794 0.290 0.607 0.583 4.449

represents an elongated shape. Dd are the characteristics of regions underlain by highly permeable materials with vegetative cover and low relief. Whereas, high values of D indicate region of d Elongation ratio (R ) weak and impermeable subsurface material, sparse e vegetation and mountainous relief (Nautiyal 1994). The The values of elongation ratio (Re) generally vary from Dd values of sub-watersheds suggests that the Barchha Nala watershed as a whole is underlain by highly 0.6 to 1.0 associated with a wide variety of climate and permeable material and represents low relief. geology and can be grouped into three categories i.e., circular (>0.9), oval (0.9-0.8) and less elongated (<0.7). Re values of sub-watersheds indicate that sub-

Stream frequency (Sf) watershed 3 is circular whereas rest of the sub- watersheds fall in the elongated category. Stream frequency is the total number of stream Prioritization of sub-watersheds segments of all orders per unit area (Horton 1932). Sf values indicate positive correlation with the drainage density of all the sub-watersheds suggests increase in The morphometric parameters i.e. bifurcation ratio, relief stream population with respect to increase in drainage ratio, relative relief, drainage density, stream frequency, density. circulatory ratio, form factor and elongation ratio are also termed as erosion risk assessment parameters and Form factor (R ) have been used for prioritizing sub-watersheds (Biswas f et al. 1999). The linear parameters such as drainage density, stream frequency, bifurcation ratio, relief Form factor is defined as the ratio of basin area to the parameters such as relief ratio and relative relief have square of the basin length (Horton 1932). The value of a direct relationship with erodibility, higher the value, form factor would always be less then 0.7854 (perfectly more is the erodibility. Hence for prioritization of sub- for circular basin). Smaller the value of form factor, more watersheds, the highest value of linear and relief parameters was rated as rank 1, and second highest elongated will be the basin. Lower Rf values of the sub- watersheds in study area indicates elongated shape value was rated as rank 2 and so on, and the least and suggests lower peak flows of longer duration. value was rated last in rank. Shape parameters such as elongation ratio, circulatory ratio and form factor have an inverse relationship with erodibility (Nooka Ratnam Circulatory ratio (R ) c et al. 2005), lower the value, more is the erodibility. Thus the lowest value of shape parameters was rated Circulatory ratio is the ratio of the area of a basin to the as rank 1, next lower value was rated as rank 2 and so area of a circle having the same circumference as the on and the highest value was rated last in rank. Hence, perimeter of the basin (Miller 1953). It is influenced by the ranking of the sub-watersheds has been determined the length and frequency of streams, geological by assigning the highest/rank based on highest value in case of linear and relief parameters and lowest value structures, land use/land cover, climate and slope of in case of shape parameters (Table 4). the basin. The circulatory ratios of sub-watersheds range from 0.26 to 0.7 indicating sub-watershed 3 After the ranking has been done based on every nearing circle wheras all the other sub-watersheds single parameter, the ranking values for all the linear,

411 Table 4. Priorities of sub-watersheds and their rank Sub watershed no Sf Dd Rr Rh RN Rf Re Rc Rb Cp Final priority 1 5 6 5 5 3 1 1 2 4 3.556 3 2 4 5 4 3 4 2 2 3 5 3.600 4 3 6 3 1 1 1 6 6 6 6 4.000 6 4 2 2 3 2 2 5 5 4 3 3.111 2 5 1 1 2 4 6 3 3 5 2 3.000 1 6 3 4 6 6 5 4 4 1 1 3.777 5 relief and shape parameters are added up for each of the okVj'ksM vkSj vkSlr jSadks ds fy, fu/kkZfjr dh xbZ gSaA ekjQksesfVªd sub-watersheds to arrive at compound value (C ). Based p 6 5th on average value of these parameters, the sub-watershed fo'ys"k.k ds vk/kkj ij lc okVj'ksM es ls lc okVj'ksM dks having the least rating value was assigned highest priority, 'kh"kZ izkFkfedrk ij j[kk x;k gSA ftlls e`nk vkSj ty laj{k.k ds next higher value was assigned second priority and so dk;Z bl lc okVj'ksM ls izkjaHk fd;k tkuk pkfg,sA on. The sub-watershed which got the highest Cp value was assigned last priority. Hence, on the basis of morphometric analysis sub-watershed 5 fall in the top References priority and sub-watershed 6 on the last priority to start the soil conservation work in Barchha Nala watershed. AIS, LUS (1990) Watershed Atlas of India, Department of Agriculture and Cooperation. All India Soil and Land Use Survey IARI Campus New Delhi The present study demonstrate the utility of remote Arun PS, Jana R, Nathawat MS (2005) A rule based sensing and GIS technique in prioritizing sub-watersheds characterization of a drought prone watershed based on morphometric analysis. This study has found applying remote sensing and GIS. J Indian Soc that sub-watershed 5 fall on the top priority; hence, this Remote Sensing 33(2):189-201 prioritization may be taken for soil conservation measures Biswas S, Sudhakar S, Desai VR (1999) Prioritization of by planners and decision makers for locale-specific Subwatershed based on Morphometric Analysis of planning and development. Drainage Basins - A Remote Sensing and GIS Approach. J Indian Soc Remote Sens 27(3): 155- 166 izkd`frd lalk/kuksa ds izca/ku esa okVj'ksM (Watershed) izkFkfedrk Chopra R, Dhiman RD, Sharma PK (2005) Morphometric dh egRrk c<+rh tk jgh gSA fo'ks"k :i ls ty izca/ku ds lanHkZ esa analysis of sub-watersheds in Gurudaspur district, Punjab using remote sensing and GIS techniques. J ekjQksesfVªd (Morphometric) fo'ys"k.k lkekU;r% okVj'ksM dh Indian Soc Remote Sens 33(4):531-539 izkFkfedrk r; djus ds fy, fd;k tkrk gSA e/;izns'k ds ujflagiqj Horton RE (1932) Drainage basin characteristics. Trans Am ftys ds cjNk ukyk okVj'ksM esa lqnwj laosnu vkSj th-vkbZ-,l- Union 13:350-361 Horton RE (1945) Erosional development of streams and their rduhd dk mi;ksx djrs gq,s ekjQksesfVªd fo'ys"k.k ds vk/kkj ij lc drainage basin hydrological approach to quantitative okVj'ksM (Sub Watershed) dh izkFkfedrk r; dh xbZ gSA fofHkUu morphology. Geol Soc Am Bull 56: 275-370 ekjQksesfVªd ekinaMksa vFkkZr ck;Qjds'ku js';ks (Bifurcation Ratio)s] Miller VC (1953) A quantitative geomorphic study of drainage basin characteristics in the Clinch mountain area QkeZ QsDVj (Form Factor), byksXus'ku js';ks (Elongation Ratio)] Virginia and Tennesses. Deptt. of Navy, Office of ljdqysVªh js';ks (Circulatory Ratio)] Msªust MsfUlVh (Drainage Naval Res., Technical Report 3, Project NR 389-042, Washington DC. Density)] LVªhe fQDosUlh (Stream Frequency)] fjyhQ js';ks Nag SK (1998) Morphometric analysis using remote sensing (Relief Ratio), jxusl uacj (Ruggedness Number)] vkSj techniques in the Chaka Sub-Basin, Purvlia District, fjysfVo fjyhQ (Relative Relief) ds vk/kkj ij lc okVj'ksM West Bengal. J Indian Soc Remote Sens 26(1-2): 69-76 vafre jSafdx ij igqpus ds fy, ewY;@laca/kksa ds vk/kkj ij lc

412 Nautiyal MD (1994) Morphometric analysis of a drainage Srinivasa VS, Govindainah S, Home Gowda H (2004) basin using arial photographs: A case study of Morphometric analysis of sub watersheds in the Khairkuli basin District Deharadun. J Indian Soc Pavagada area of Tumkur district South India using Remote Sens 22(4): 251-262 remote sensing and GIS techniques J Indian Soc Noorkaratnam K, Shrivastava YS, Venkateshwara Rao V, Remote Sensing 32(4):351-362 Amminedu E, Murthy KSR (2005) Check dam Srivastava VK (1997) Study of drainage pattern of Jharia coal positioning by prioritization of micro watershed using field (Bihar) India through remote sensing technology SYI model and morphometric analysis - remote 25(1):41-46 sensing and GIS perspective. J Indian Soc Remote Strahler AN (1964) Quantitative geomorphology of drainage Sens 33(1) : 25-38 basins and channel networks, Handbook of Applied NRSA (1995) Integrated Mission for Sustainable Development, Hydrology: Ed. By Ven Te Chow, McGraw Hill Book Technical Guidelines, National Remote Sensing Company, New York pp 55-67 Agency, Department of Space, Government of India, Verstappen H Th (1983) Applied Geomorphology- Hyderabad Geomorphology Surveys for Environmental Schumm SA (1956) Evaluation of drainage system and slopes Development. Elsevier Science Publishers B.V. in bed lands at Perth Ambry, New Jersy Geolo Soc Amsterdam, The Netherland pp 66-71 Am Bull 67:597-646 Smith KG (1950) Standards for grading textures of erosional topography. Am Jour Sci 248:655-668 Solanke PC, Srivastava R, Prasad J, Nararaju MSS, Saxena (Manuscript Receivd : 20.04.2012; Accepted 10.08.2012) RK, Barthwal RK (2005) Application of remote sensing and GIS in watershed characterization and management. J Indian Soc Remote Sensing 33(2):239-244

413 JNKVV Res J 46(3): 414-418 (2012)

Land use pattern changes during past decade for crop and agricultural in Betul tehsil, Madhya Pradesh

V.K. Verma*, N.K. Khare, D.P. Rai and K.K. Saxena *Programme Coordinator Krishi Vigyan Kendra, Betul Jawaharlal Nehru Krishi Vishwa Vidyalaya Jabalpur 482 004 (MP)

Abstract population on arable land even of marginal type. This complex pattern has been brought out even on the generalize land use map. The arable land under the In present study conducted during 2000-2010 in Betul Tehsil plough having small patched of cultivable waste and based on the scientific information recorded from the various th sources and verbal statements of the local people for critical fallow land have taken up about 3/5 of the total area of th analysis of gathered data and to draw logical conclusions. India. In the similar way 1/5 of land's surface is covered The baseline data obtained from various government with forest. The cropping patterns of the area are the organizations revealed a change that has accrued in the cumulative results of the past and present decision by overall land use land classification including agricultural land individuals or government and their decisions. The use pattern. The total sown area was 86128 ha in the year decisions are usually based on experience, traditions, 2000-01 which increased to 9032 ha in the year 2010-11. An expected profit, personal preference and resources, overall increase of 4.53 per cent in the total cultivated sown social and political pressure. Crop combination, the area was recorded. It is indicated that there was marginal increase in the area. There was a shift from traditional kharif farming system, climate, soil, inputs availability including crops to soybean which is being economical viable and market irrigation, fertilizers, mechanization etc. change in demand driven cash crop. In the last decade it was observed cropping patterns is also caused in response to change that there was very minor fluctuation in the total non agricultural in one or more of the factors. In addition to this the land including fellow lands. The area of rice crop was almost socio economic condition also plays a significant constant as it is cultivated in only submerged witty land and contribution in adopting new cropping system and there was no significant variation in the area of chick pea sometimes ignoring the essential parameters required while the area of pigeon pea declined in last decade due to its being a long duration crop and infestation of insect pest. In for agro ecological balance. Developmental Planning the study the major sources of irrigation viz. ponds, wells and in a complex process of decision making based on tube wells were also included to record their potentiality in information about the status of resources, socio- coverage of the area under irrigation. The above observation economic conditions and institutional constraints. of the study highlighted that in Betul Tehsil, there was marginal Reliability of the data base, both the spatial and non- increase in the total sown area and the land available for spatial, is therefore, crucial to the success of the cultivation is almost saturated. There was increase in developmental planning. Equally important is the timely grassland under forest but the area under barren land inflow of information to serve planning needs. Remote decreased. The study focused that the area which was under traditional kharif crops viz. jowar, maize has been replaced sensing technology which meets both the requirements by soybean crop. It has become the most favored kharif crop of reliability and speed is an ideal tool for generating of the farmers due to its comparatively more profitability. The spatial information bases. The data bases are meant to area under irrigated wheat declined due to non-availability of serve and efficient system of information gathering, adequate irrigated water as the rainfall pattern was un-uniform. compiling classification, transformation, storage, However, the area under chickpea remained constant. retrieval and synthesis/ analysis system. Cultivation of sugarcane, pigeon pea crops also declined due to long crop duration and input exhaustive crops. The conventional methods of data collection by simple survey method to systemic land use surveys are India has a very complex land use pattern due to the generally costly and time consuming. In Betul district, fragmentation of land and the extreme pressure of no viable methodology for integrating spatial and non

414 spatial data base is developed for future planning. The the farmers, local governing bodies and personnel. It present investigation were carried out to (1) study the included RAEO, Patwaries, Sarpanch and Agriculture crop and agricultural land use pattern during past Extension Officers etc. Fifty different villages of the Tehsil decade (2) study the market driven land utilization lying in different direction were randomly surveyed. practices and its pattern with special reference to These villages surveyed were later used for remote agriculture during past decade in the selected area and sensing studies as well. The information regarding the (3) to assess the suitability of the present agriculture change in agricultural mechanization, fertilizer and plant land use pattern/practices. protection methods were collected through these villages. Also the causes and concern for these changes was discussed with the farmers and related authorities. Material and methods Data regarding agriculture Land Use Land Cover(LULC) pattern, crop cultivation, water resources etc. were The study was conducted in Betul tehsil of Betul District. produced through various government and semi Betul tehsil is situated in Satpura Mountain running east government organization including District planning and to west Satpura hills, Sapura Plateau, Satpura plains. Statistic Department, Betul; State Land Record The tehsil is categories under agro climatic zone Department, Betul; National Informatics Center, Betul, Satpura Plateau Zone and has basically agriculture Agriculture Department, Soil testing Laboratory, Betul. oriented economy. It receives monsoon rains during June to October The average rainfall of the district Result and Discussion 1083.9 mm in 57 rainy days. Betul tehsil is situated in the south central part of the Madhya Pradesh with head quarter at Betul under Bhopal division. It is bounded The present study was conducted in Betul Tehsil covering northwest by Hoshangabad district in southwest by the period of last decade from the year 2000-2010. It is Khandwa District in the east by Chhindwara district of based on the scientific information recorded from the Madhya Pradesh and in south by Amravati District of various sources and verbal statements of the local Vidarbha region of Maharastra state. The tehsil is people for critical analysis of gathered data and to draw located between 210-220 to 220-240 North latitude and logical conclusions of the study. The baseline data 740-04 to 780-330 East latitude the general elevation is obtained from various government organizations 700-800 meters above mean see level (MSL). The revealed a change that has accrued in the overall land profile of study area s given under Table 1. use land classification including agricultural land use pattern. Table 2 showed total area under agriculture of An extensive survey of the Tehsil was carried out Betul Tehsil during last decade showing a trend of to collect relevant information for present study. No change in once sown, twice sown and total sown area questionnaire based study was carried out but under various crops. It is recorded that the total sown information was collected through formal interviews of area was 86128 ha in the year 2000-01 which increased

Table 1. Profile of the study area Table 2. Total land area under agriculture of Betul dur- ing 2000-10 Area(ha) District Tehsil Geographical Area 724771 206418 Years Once Sown Twice sown Total Sown Cultivated Area 401026 146210 2000-01 54497 31631 86128 Cultivable Area 22827 6217 2001-02 52461 30986 83447 Cultivable waste 19605 3716 2002-03 53986 31654 85640 Current Fallow 32282 9433 2003-04 54683 31672 86355 Barren & uncultivable land 25942 6745 2004-05 55641 31645 87286 (Waste land) 2005-06 56432 31689 88121 Forest Area 283353 72673 2006-07 56892 31552 88444 Reserve Forest 283029 72453 2007-08 57264 31486 88750 Pasture 27466 7299 Irrigated Area 101709 22427 2008-09 57654 31643 89297 Double crop Area 128490 23419 2009-10 58350 31682 90032

415 Table 3. Area under cereals and coarse crops cultivation at Betul during 2000-10

Years Wheat Sorghum Maize Rice Minor Millets Total 2000-01 28630 7434 16162 2237 54463 28630 2001-02 25860 7231 16265 2260 51616 25860 2002-03 26341 7056 16120 2254 51771 26341 2003-04 24560 6952 16358 2280 50150 24560 2004-05 26450 6530 15400 2340 50720 26450 2005-06 27845 6241 15850 2310 52246 27845 2006-07 23956 5630 15895 2345 47826 23956 2007-08 26512 5426 15920 2382 50240 26512 2008-09 24392 5324 15931 2354 48001 24392 2009-10 23121 4986 15947 2406 46460 23121

to 9032 ha in the year 2010-11. An overall increase of The shortfall in the area as discussed by the local 4.53 per cent in the total cultivated sown area was farmers indicated that the sorghum crop was not recorded. It is indicated that there was marginal increase remunerative and the area was replaced by soybean. in the area. It shows that the area which was under Further, it was recorded that in rice crop and other minor cultivation, well saturated and there was hardly any millets, there was very marginal change in last decade. scope for bringing more area under crops. The area of rice crop was almost constant as it is cultivated in only submerged witty land. The cultivation A very marginal increase has been recorded in of minor millets was confined to marginal and less total area not available for agriculture in the tehsil. The productive land mostly preferred by tribal farmers. above increase could be attributed to the increase of the land for settlement and other development activities Area under pulse crop cultivation of Betul Tehsil such as road, construction of houses etc. The data during last decade. It was recorded that there was no obtained in study (Table 3) indicated other non significant variation in the area of chick pea while the agricultural land use in grassland/grazing land, scrub area of pigeon pea declined in last decade due to its land and other agriculturable barren land. In case of being a long duration crop and infestation of insect pest. grassland there was an increase of 10.14 per cent while The area of pigeon pea has been covered by soybean the area under agri-culturable barren was decreasing. crop, fetching good price. In case of spices and fruits & The total non agriculture land including the fellow land decreasing marginally in last decade and the area under scrub land remain constant. The decrease in barren Table 4. Area under pulse crop cultivation at Betul (in land may be attributed to adoption of modern agricultural hectare) during 2000-10 practices and facility of proper irrigation. The information Years Chick pea Pigeon pea Total gathered through personal discussion with the local farmers and officials of agriculture department 2000-01 7210 4781 11991 supported the trend of agricultural pattern change. 2001-02 7150 4562 11712 There was a shift from traditional kharif crops to soybean 2002-03 7065 4394 11459 which is being economical viable and market demand 2003-04 7250 4130 11380 driven cash crop. In the last decade it was observed that there was very minor fluctuation in the total non 2004-05 7015 4062 11077 agricultural land including fellow lands (Table 4). The 2005-06 6850 3865 10715 data also indicates area under cereal and cash crops 2006-07 6500 3684 10184 during the last decade. It was recorded that there was 2007-08 6632 3551 10183 decline and slight fluctuation in the wheat area due to uneven rainfall pattern. In case of sorghum crop, it was 2008-09 6540 3426 9966 observed a substantial decrease in the area (32.93%). 2009-10 6729 3341 10070

416 vegetables crops it was observed that there was almost received. Farmers were of the opinion sugarcane crop very insignificant change in the area under these crops. was quite remunerative, but requires high cost of inputs During the discussion with the farmers it was pointed and irrigation which depends upon the rainfall. The out that the area of sugarcane declined due to lack of areas under edible crops remained almost unchanged. irrigation, higher cost cultivation and non availability of The irrigated area under important pulse crop indicating labours while area of fruit & vegetable increased due that gram was the most important pulse crop and its to market demand and more profitability in comparison area under 2000-01 was 825 hectare and in the year to other crops. The data on area under oilseed crop 2009-10 the crop was cultivated in 815 hectare. This cultivation in Betul Tehsil. It is pointed out that soybean leads to the conclusion that there was no significant crop had a unique position in the study area; its area change in the area under gram crop in last one decade. has increased every year due to continuous increasing The same trend was also recorded in all other pulse market demand in oil sector while area of groundnut crops. Irrigated area under important oilseed crops, it and Ramtil crop remained unchanged. The farmers were was pointed out that there was an increasing trend in of the opinion that in groundnut crop, there was no area due to market demand and fetching remunerative change in varieties and other package of practices; price, development agencies were motivating farmers thereby the yield potential of the crop remained towards oilseed cultivation in the study area. unchanged. Ramtil crop was preferred by tribal farmers only grown on undulating and less productive soils in In the study the major sources of irrigation viz. limited area (Table 5). The study highlighted the irrigated ponds, wells and tube wells were also included to record area under wheat crop which is one of the most their potentiality in coverage of the area under irrigation. important inputs for rabi crops cultivation. It was The number of ponds in the tehsil were 14 which could recorded that the area under irrigation was fluctuating irrigate 83 hectare of land. There was no increase in every year in the last decade. There was decline trend the number of ponds and coverage of area under in the area of irrigated wheat. The farmers of the area irrigation in last decade. In case of number of well, it viewed that the pattern of rainfall was not uniform was recorded that there were 16582 wells in the year indicating reduction trend in most of the years under 2000-2001 covering an area 20886 hectare under study which resulted in decline of water table every year. irrigation. It is interesting to note that the number of The sources of irrigation water normally were exhausted well increased up to 17289 in one decade but the area just after sowing. The irrigated area under important under irrigation has been reduced to 17215 hectare due edible crops cultivation, it was observed that sugarcane to less intake of water in wells as rainfall pattern was is important crop of the area. In the year 2000-01 its towards decline trend. The tube wells are the major area was 3298 hectare and it fluctuated slightly and source of irrigation in the area, it was observed that in reduced to 2964 hectare in the year 2009-10 due to the year 2000-01 the number of tube wells were 1557 scarcity of irrigation water. In some of the years there which increased up to 2564(64%) in the year 2009-10. was increase in area also whenever, good rainfall was The potential of tube-well in irrigating the crops was

Table 5. Area under Other crop cultivation at Betul (in Table 6. Area under oilseed crop cultivation at Betul (in hectare) during 2000-10 hectare) during 2000-10 Years Sugarcane Spice Fruits & Total Years Soybean Groundnut Ramtil Others Total Vegetables 2000-01 58390 173 299 6134 64996 2000-01 3298 583 3412 7293 2001-02 58690 180 305 6012 65187 2001-02 3198 546 3326 7070 2002-03 58780 172 284 6140 65376 2002-03 3364 546 3456 7366 2003-04 58960 165 291 5885 65301 2003-04 3120 536 3415 7071 2004-05 59640 172 287 5960 66059 2004-05 3052 518 3462 7032 2005-06 59450 184 279 5974 65887 2005-06 3046 542 3474 7062 2006-07 3012 584 3382 6978 2006-07 59740 191 282 6112 66325 2007-08 3140 523 3452 7115 2007-08 60420 187 293 5898 66798 2008-09 3041 558 3510 7109 2008-09 61240 174 282 6421 68117 2009-10 2964 514 3508 6986 2009-10 61356 168 296 6023 67843

417 explored, apparently resulted in increase in irrigated area dh vof/k T;knk gksus ,oa dhV O;kf/k;ksa ds izdksi ds dkj.k blds {ks=Qy from 5109 hectare in the year 2000-2001 to 7150 hectare esa deh ns[kh xbZ A rkykc] tyk'k;] dqvka ,oa V~;wcosy vkfn bl ftys in the year 2009-10 which was almost 40% and given a good boost in increase of crop yields of tehsil. esa flapkbZ ds izeq[k lk/ku gSA dqy cqokbZ ds {ks= esa vkaf'kd o`fn~/k gqbZ gS ftlesa vkxs o`fn~/k gksus dh laHkkouk cgqr de gS ou {ks=ksa esa ?kkl ;qDr The above observation of the study highlighted that in Betul Tehsil, there was marginal increase in the total Hkwfe ds {ks=Qy esa o`fn~/k gqbZ tcfd [kkyh Hkwfe ds {ks=Qy esa deh vkbZ sown area and the land available for cultivation is almost gS [kjhQ dh ikjaifjd [ksrh tSls Tokj] eDdk dk LFkku lks;kchu us ys saturated. There was increase in grassland under forest fy;k gS ftldh otg ls fdlkuksa dks vkfFkZd ykHk feyk gSA o"kkZ vk/ but the area under barren land decreased. The study focused that the area which was under traditional kharif kkfjr [ksrh] flapkbZ dh Ik;kZIr miyC/krk u gksus ,oa o"kkZ dh vfuf'prrk crops viz. jowar, maize has been replaced by soybean ds dkj.k xsgw dh [ksrh dk {ks=Qy de gqvk gS tcfd pus dh Qly crop. It has become the most favored kharif crop of the dk {ks=Qy fLFkj gS xUuk vjgj vkfn yach vof/k dh Qly gksus ,oa farmers due to its comparatively more profitability. The vknku lkexzh ij vf/kd ykxr vkus ds dkj.k {ks=Qy esa deh vkbZ area under irrigated wheat declined due to non-availability of adequate irrigated water as the rainfall pattern was un- gSA uniform. However, the area under chickpea remained constant. Cultivation of sugarcane, pigeon pea crops References also declined due to long crop duration and input exhaustive crops. The number of ponds in the Tehsil remained constant, however, the number of well s was Barr SL (1992) Object-based Re-classification of High Resolution Digital Imagery for Urban Land-Use increased but more interestingly the area covered under Monitoring. International Archives of irrigation by wells reduced due to un-uniform pattern of Photogrammetry and Remote Sensing (ISPRS, rainfall. The tube wells proved to be of great significance Washington De 1992). Vol XXIX Part B7 Commission in bringing more area under irrigation and boosting up VII: 969-976 agricultural production. Barr (1992) studied on structural Chaurasia R, Closhali De, Dhaliwal SS, Minakshi Sharma PK, variation in communities modulates spectral signatures Kudrat M, Tiari AK (1996) Landuse change analysis of vegetation and form basis to describe community for agricultural management - a case study of Tehsil structure of any agricultural land subjectively and at Talwandi Sabo, Punjab. 1 Indian Soc of Remote spatial level. Turner et al. (1993) studied that most Sensing 24 (2): 115-123 important factor in the modification of the land cover Dutta S, Patel K, Moharana SC, Sarangi BK, Das A (2001) and its conversion is the human use component rather Analysis of temporal IRS -WiFS data for Rabi crop than the natural changes. classification of Orissa state using hierarchical decision tree based classification. In 'Symposium on Remote Sensing Application with special cSrwy ftys ds LFkkuh; fuokfl;ksa ds dFku ,oa foKku vk/kkfjr emphasison high-resolution data, Ahmadabad December 11-13, 2001 2000 2010 lwpukvksa ds vk/kkj ij o"kZ & ds nkSjku ,d= fd;s x;s Ehrlich D, Estes J, Scepan J, McGwire C (1994) Crop Area vkdM+ks ds }kjk cSrwy ftys ds losZ{k.k esa egRoiw.kZ rkfdZd fu"d"kZ Monitoring within an Advanced Agricultural feysA fofHkUu ljdkjh laLFkkuksa ls izkIr vkdM+ks }kjk ftys dh Hkwfe Information System. Geocarto International 4:31-42 Rossiter DG (1996) A theoretical framework for land mi;ksx] Hkwfe oxhZdj.k ,oa d`f"k Hkwfe mi;ksx vkfn esa O;kid ifjorZu evaluation. Discussion paper. Geodenna, 72: 165- ns[kus feykA cSrwy ftys esa o"kZ 2000&2001 esa d`f"k dk cqokbZ gsrq 190 {ks= 86128-0 gs- Fkk ftlesa o"kZ 2010&11 esa 9032-0 gsDVs;j Turner IT, BL Moran EF, Rindfuss RR (2004) Integrated Land- Change Science and its Relevance to the Human {ks=Qy vkSj tqM+ x;kA bl izdkj ftys esa dqy [ksrh ;ksX; Hkwfe esa 4- Sciences. In: Land Change Science: Observing 53 izfr'kr o`fn~/k gqbZA cSrwy ftys esa ikjaifjd [ksrh ls gVdj [kjhQ Monitoring, and Understanding Trajectories of Change on the Earth's Surface. Senes: Remote Qlyksa esa vkfFkZd :Ik ls Qk;nsean rFkk cktkj ekax ds vuq:Ik uxnh Sensing and Digital Image Processing E: 431-448 Qly lks;kchu dk jdck c

418 JNKVV Res J 46(3): 419-422 (2012)

Luteinising hormone receptor (LHr) transcripts in buffalo ovarian follicles

N. Lail, T. Nanda, R. Ranjan* and R. Prasad Department of Animal Biotechnology CCS HAU Hisar, Haryana *Animal Biotechnology Centre Nanaji Deshmukh Veterinary Science University Jabalpur 482004 (MP)

Abstract seven-membrane transmembrane/cytoplasmic module, which is the anchoring unit that transduces the signal The present study was carried out on buffalo ovarian follicles. initiated in extracellular domain and couples to G- Ovaries were obtained from slaughter house in summer and proteins. Lhr is expressed primarily in gonadal tissues winter. Follicles present on the ovarian surface were counted and has been studied extensively in testis and in theca and classified as small, medium and large follicles based on cells, granulosa cells and corpus luteum in ovaries their diameter size. The follicles with diameter less than 5 (Dufau 1998) mm were placed under the category of small follicles; those of diameter 5-9 mm were classified as medium follicles, Buffaloes are the backbone for rural economy in whereas follicles with diameter more than 9 mm were placed India, especially for landless farmers. There are 97.7 under the category of large follicles. These graded follicles million buffaloes in India which are around 56% of world were isolated mechanically and looked for the presence of population (FAO 2004). Lower conception rates and long LHr transcript in each season. Each class of follicles was calving interval are major constraints in enhancing investigated for the presence of Lhr gene transcript in the productivity of buffaloes. Better understanding of two seasons using RT-PCR analysis. Further the ovarian folliculogenesis could help in improving the concentration of LHr cDNa was checked in each category of follicles in the two different seasons using spectrophotometric reproductive potential of buffaloes (Bansal and Saigal estimation. Our study showed the presence of LHr gene 2006). transcripts in all the categories of follicles that is LHr transcript Buffalo is a monovular species with poorly expresses itself in all follicles irrespective of variation in their diameter size. LHr expression was also found to be continuous understood physiological mechanism. The recruitment irrespective of variation in season that is LHr expression in of dominant follicle during the estrous cycle remains ovarian follicles was found to be both in summer and winter unclear (Zelezink and Banyo 1994). In recent years season. It was observed that LHr transcript level increases follicular waves have been clearly defined in terms of with the increase in follicular size. There was also a notable number (Hamilton et al. 1995). Each wave begins with variation in the transcript level of LHr in summer and winter. It growth of a cohort of follicles. Healthy follicles are is found that LHr expression decreases in the summer season recruited as dominant follicles leading to ovulate while for the corresponding follicles. other follicles undergo atresia. (Hamilton et al. 1995). Follicles have got gonadotropin receptors on the Key word: Follicles, LHr, Transcript, RT-PCR granulosa cells which render them capable of responding to both follicular stimulating hormone (FSH) and leutinizing hormone (LH) stimulation (Ireland and Hormones are chemical messenger that coordinate the Roche 1982-1983). Heat stress inhibits expression of activity of different cells in a multicellular organism. The gonadotropin receptors in granulosa cells (Shimizu et size of mature LHr is 80-90Kda and it is member of al. 2005). For improving reproductive performance of subfamily of glycoprotein hormone receptor within the buffaloes, better understanding of female reproductive superfamily of G-protein coupled receptor (GPCR). It cycle is a prerequisite. Study of specific genes is composed of three functional units i.e. extracellular expression associated with follicular growth and hormone-binding domain (Tsai-Morris et al.1990) development will be an additional step in our intracellular or cytoplasmic or c-terminal domain and understanding of control of follicular growth and

419 development. Therefore, elucidation of molecular Total RNA isolation from different grade of follicle in two mechanism associated with follicular growth will provide months the basis for development of therapeutic regimens to induce ovulartory cycles and to improve the success Total RNA was isolated from each pool of different type rate of assisted reproductive technologies for improving of follicle (Table1.) by using Trizol (Life technologies) reproductive performance of buffaloes. Expression of reagent as per the manufacturer’s instruction with minor mRNAs for LHr may be involved in the process of modifications. recruitment and selection of dominant follicles (Bao et al. 1997).The present study was carried to find out the Reverse transcription (cDNA synthesis) presence of LHr transcripts in ovarian follicles of buffalo by PCR and also the effect of follicular size on LHr Poly(A) RNA isolated from each pool of follicles were transcripts in ovarian follicles of buffalo slaughtered in reverse transcribed into cDNA in a total volume of 15 different season. μl using 2.5 μM poly(T) primers, 50 μM of each dNTP and 10 units of AMV-RT in the presence of a Material and methods ribonuclease inhibitor. Reverse transcription reaction was performed at 37ºC for 45 min and stopped by heat- inactivating at 95ºC for 5 min. Isolation and grading of follicles Polymerase chain reaction (PCR) Ovaries of adult buffaloes were collected from the New Delhi slaughter house in the month of July and December. Collected ovaries was transported to the LHr and GAPDH genes were amplified from cDNA laboratory in sterile normal saline solution (NSS) samples by polymerase chain reaction. The primers supplemented with antibiotics (Penicillin 100 IU/ml, were used for amplification of LHr gene and GAPDH streptomycin 50µg/ml, Hi-Media, India) at 4º C. Prior to gene are given in table 2. The reaction was carried out isolation, all the visible ovarian follicles were classified in 25 µl separately for both the genes, consisted of 4ul as small, medium and large follicles based on their of cDNA, 10 Picomol of each primer, 2.5 µl of 10X buffer, diameter size as described by Lohan et al. (2003). After 0.50 µl of dNTPs, 1.5 µl of Mgcl2 (25mM),1.25 µl of grading follicles were isolated manually with forceps DMSO, 2.5U of Taq polymerase and volume of reaction and scissors.

Table 1. Numbers follicles used for RNA isolation from the ovaries collected in the month of July and December Exp. No.Ovaries collected in the month of July Ovaries collected in the month of December Small follicle Medium follicle Large follicle Small follicle Medium follicle Large follicle

110 10 10 10 10 10 210 10 10 10 10 10 310 10 10 10 10 10 410 10 10 10 10 10 510 10 10 10 10 10 Total 50 50 50 50 50 50

Table 2. Primer designed for LHr and GAPDH genes was adjusted with nuclease free water. The PCR Gene Primers Sequence Product size condition included an initial denaturation 94°C for 5 min (expected) followed by 30 cycles of denaturation at 94°C for 1min, annealing at 55°C for 45 sec for Lhr gene and 59°C for Lhr Forward TAATATCCTAGCCATCACGGGA 254 GAPDH gene and extension at 72°C for 1 min with a Reverse CAGAGAGTTCACTTGCAA ACAC final extension at 72°C for 10 min The PCR products GAPDH Forward GGCAAAGTGGACATCGTCGCCA 267 were run on 2% agarose gels and visualized under UV Reverse ACCCTTCAAGTGAGCCCCAGC light.

420 Spectrophotometric reading (2003). They found that LHr transcript expression did not change with follicle diameter in sheep or cattle. To determine the quantity of cDNA in different follilces, During present study upon quantification by cDNA samples from each type of follicles obtained after spectrophotometer we find that LHr expression gene specific reverse transcription (as mentioned increases with the increase in follicle size. Our results above) was used. 2 μl of cDNA sample was mixed with are consistent with the semiquantitive RT-PCR study 98 μl of nuclaese free water and the spectrophotometric of Nogueira et al. (2007). Where there was a clear reading at optical density (OD) values 260 and 280nm increase in LHr expression with follicle diameter in bovines. Our results are also similar with the results of were taken against nuclease free water (98 μl) as a Beg et al. 2001. They also reported an increase in LHr blank. The concencentration of cDNA was calculated expression with follicle size. This increase in as follows: physiologically relevant as increase in gonadotropin binding during follicle growth occurs in cattle and sheep Amount of DNA (mg/ml) = OD260 x dilution factor x 50 (Ireland and Roche 1983). Though the above findings support our results, Results and Discussion but with the help of spectrophotometer readings we are not able to draw any firm conclusion. Because in our In this study expression of mRNA for LH receptors during study initial concentration of RNA in different categories follicular development was studied. Previous studies of follicles, and formation of primer dimers may affect demonstrated that LH receptor or its mRNA was the result. Our quantification study did not allow a expressed only in granulosa cells of large artral follicles relationship to be established between follicular size (Ireland and Roche 1982). Currently there is a and LH receptor mRNA. The reason for this is the controversy in the literature regarding the expression sensitivity and/or specificity of the techniques used in of LHr in granulosa cells from small follicles (Nogueira the present study and previous studies. However et al. 2007). In situ hybridization studies suggest that several other Researchers like Spicer et al. (1986) also non dominant follicles (less than 9 mm diameter) do reported an increase in LH receptor concentrations not express LHr mRNA (Garverick et al. 2002). However increases with follicle size. studies using RT-PCR have indicated the presence of During present study we also noticed a marked LHr mRNA in granulosa cells of small follicles less than increased in the LHr expression in the all categories of 4mm diameter (Robert et al. 2003). During our study follicles in winter than that of summer. This result is RT-PCR analysis of LHr transcripts showed the consistent with the report of Shimizu et al. (2005), who expression of LHr in small follicles (less than 5mm). reported that gonadotropin receptor expression is (Nogueira et al. 2007) studied the semiquantitative RT- inhibited by the heat stress. PCR and find that granulosa cells from small follicles in bovine contain little or no LHr mRNA and do not express Based on our study we can conclude that functional LHr on the cell surface. But during our study developments of follicles are continous and independent we were able to find LHr expression in small follicles. It of reproductive phase. We can also conclude that LHr may be attributed to the species differences in the two transcript expresses itself in ovarian follicles irrespective studies. While the small follicles expressing LH receptor of their size and breeding season. Our result also mRNA in the present study shows the discrepancy with suggests that LHr expression increases with the the previous studies but Jolley et al. (1994) reported increase in follicular size. We can also conclude that follicles as small as 4.5mm in diameter could produce LHr expression is inhibited by heat stress.or in other a cAMP response following LH stimulation. This result way we can say that its expression increases during supports our finding of the presence of LHr transcripts breeding season. in small follicles. In support of our present study Jolly et al. (1994) concluded that cAMP response to LH increase linearly with increasing follicles diameter. orZeku v/;;u HkSal ds fMEcxzafFk ds jkse ij fd;k x;k gSA vaMk’k; During our study we also checked the presence of LHr xehZ ,oa lfnZ;ks esa o/k ?kj ls izkIr fd;kA jkse tks fMEcxzafFk lrg ij transcripts in the medium and large size follicles. We ekStwn Fks mls fxuk x;k rFkk oxhZdj.k NksVs] e/;e vkSj cMs O;kl ds were able to detect LHr expression in both medium and vk/kkj Ikj fd;k x;kA jkse ftudh O;kl 5 ,e-,e- gS mUgs NksVs jkse large sized follicles irrespective of the season. This finding is consistent with the findings of Robert et al. ds Js.kh esa] 5&9 O;kl okys dks e/;e rFkk 9 ,e-,e- vkSj mlls

421 vf/kd okys dks cMs jkse dh Js.kh esa j[kk x;kA bl oxhZd`r jkse dks Ireland JJ, Roche JF (1983) Control of follicular growth and development. J Reprod Fertil Suppl 34: 39-54 LHr ;a=or vyx fd;k x;k vkSj izfrfyfi dh mifLFkfr nks ekSleks Jolley PD, Tisdall DJ, Heath, DA, Lun S, McNatty, KP (1994) es RT- PCR ds }kjk fd;k x;kA fofHkUu izdkj ds jkse tks nks ekSle Apoptosis in bovine granulosa cells in relation to esa izkIr gq;s Fks] muds LHr cDNA dk ,dkxzrk Spectrophometric steroid synthesis, cyclic adenosine 3’, 5’- monophosphate response to follicle stimulating ls vkdyu fd;k x;kA gekjs v/;;u ls ;s irk pyrk gS fd LHr hormone and luteinizing hormone, and follicular thu izfrfyfi gjsd Js.kh ds jkse esa mifLFkr gSA Bhd blh rjg ekSle atresia. Biol Reprod 51: 934-944 Lohan IS, Kaker ML, Malik RK, Arora, KL (2003) Ovarian LHr dk Hkh thu izfrfyfi ds vfHkO;fDr ij dksbZ izHkko ugh gSA ;g follicular dynamics in Murrah buffalo (Bubalus ns[kk x;k fd LHr izfrfyfi dk Lrj cMs jkse esa c< tkrk gS vkSj bubalis) heifers during puberty and sexual maturity. bldk Lrj xehZ;ks esa ?kV tkrs gSA Indian J Anim Sci 73: 517-518 Nogueira MFG, Buratini J, Price CA, Casthilo ACS (2007) Expression of LH receptor splice variants in bovine References granulosa cells: Changes with follicle size and regulation by FSH in vitro. Mol Reprod Develop 74: 680-686 Bansal N, Saigal RP (2006) Surface count of follicles during different phases of reproductive cycles in the ovaries Robert C, Gagne D, Lussier JG, Bousquet D, Bsrnes FL, Sirad of Indian buffaloes. Indian Anim Sci 76: 995-997 MA (2003) Presence of LH receptor mRNA in granulosa cells as a potential marker of oocyte Bao B, Garverick HA, Smith GW, Smith MF, Salfen ME, development competence and characterization of the Youngquist RS (1997) Changes in messenger RNA bovine spicing isoforms. Reproduction 223: 43-54 encoding LH receptor, cytochrome P450 side chain cleavage and aromatase are associated with Shimizu T, Ohshima I, Ozawa M, Takahashi S, Tajima A, Shiota recruitment and selection of bovine follicles. Biol M, Miyazaki H, Kanai Y (2005) Heat stress diminishes Reprod 56: 1158-1168 gonadotropin receptor expression and enhances susceptibility to apoptosis of rat granulosa cells. Beg MA, Bergfelt DR, Kot K, Wiltbank MC, Ginther OJ (2001) Reproduction 129: 463-472 Follicular fluid factors and granulosa cell gene expression associated with follicle deviation in cattle. Spicer LJ, Echterncamp SE (1986) Ovarian follicular growth, Biol Reprod 64: 432-441 function and turnover in cattle: A review. J Amin Sci 62: 428-451 Dufau ML (1998) The luteinising hormone receptor. Annu Rev Physiol 461-496 Tsai-Morris CH, Buzcko E, Wang W, Dufau, ML (1990) Intronic nature of the rat luteinizing hormone receptor gene Garverick HA, Baxter G, Gong JG, Armstrong DG, Campbell defines a soluble receptor subspecies with hormone BK, Gutierrez CG, Webb R (2002) Regulation of binding activity. J Biol Chem 265: 19385-88 expression of ovarian mRNA encoding steroidogenic enzymes and gonadotropin receptors by FSH and Zelezink AJ, Banyo DF (1994) Control of follicular GH in hypogonadotropic cattle. Reproduction 123: development, corpus luteum function and the 651-661 recognition of pregnancy in higher primates. In: Knobel E Neil J (eds.). The Physiology of Hamilton SH, Garverick HA, Keisler DH, Xu ZZ, Loos K, Ireland Reproduction. New York: Raven Press Ltd 75 JJ, Roche JF (1982) Development of antral follicles in cattle after prostaglandin-induced luteolysis: changes in serum hormones, steroids in follicular (Manuscript Receivd : 30.06.2010; Accepted 30.20.2010) fluid and gonadotropin receptor. Endocrinology 111: 2077-2086

422 JNKVV Res J 46(3): 423-424 (2012)

Tuberculosis in monkeys and its impact on wildlife health

Nidhi Rajput and A.B. Shrivastav Centre for Wildlife Forensic & Health Nanaji Deshmukh Veterinary Science University Jabalpur 482 001 (MP)

Abstract of the body. It is a zoonotic disease and can spread from animals to man and vice versa. In India, almost all the people carry the TB organisms in their respiratory Diagnosis of tuberculosis in the monkeys during necropsies has revealed a threat to the health of wild animals. Monkeys tract, which flare up in the case of poor immunity and live near or in the human residential areas, where from they malnutrition. About 90% of those infected get the infection. Sometimes, the monkeys, being problematic with Mycobacterium tuberculosis have asymptomatic TB to human population, are released in the forest area without infection with only a 10% lifetime chance that a latent testing for tuberculosis. The practice may negatively affect the wildlife conservation strategies by spreading the tuberculosis in the wild animals. Treatment of tuberculosis in the wild animals is a difficult task. Hence, pre-release testing of the problematic monkeys in the forest area is the best way to control tuberculosis in the wild animals.

Keywords : Tuberclosis, monkey, mycobacterium

Common langurs and rhesus macaques are monkeys commonly observed in the vicinity of towns and villages, however, in the jungle, they are usually found to the Fig. 2 Presence of tubercles over the lungs, liver and outskirts, rarely penetrating into the depths (Prater mesentary 2005). In recent years, necropsies conducted at Centre for Wildlife Forensic & Health, M.P.P.C.V.V., Jabalpur infection will progress to TB disease (Kumar et al. 2007). have revealed the presence of tuberculosis in most of That’s why it is also designated as the disease of poor the cases. Present article reports the incidences of people. Being a contagious disease, it rapidly spreads tuberculosis in monkeys and possible threat to the from one person to another by means of cough and wildlife health. From 2009 to 2010, seven carcasses of sneezing. monkeys have been subjected to necropsy. All the carcasses were emaciated with rough body coat (Fig. 1). Detailed examination revealed nodular lesions over the organs in three cases (Fig. 2). Impression smears made from the lesions and stained with Ziehl-Neelsen revealed acid fast organisms indicative of tuberculosis (Fig. 3). Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium. Mycobacteria are curved or rod-shaped, sometimes filamentous, acid fast bacteria (Vegad and Katiyar 2001). Tuberculosis is a disease of humans and animals that is characterized by whooping cough, emaciation and during necropsy by examining Fig. 3. Acid-fast bacilli in the impression smear the presence of tubercles on the lungs and other tissues prepared from the tubercles (Ziehl-Neelsen, 1000X) 423 TB is not a host specific and same organisms collection and subsequent drug administration. Studies can cause the disease both in man and animals. have shown that major cause of tuberculosis in monkeys Carcasses of monkeys received by the Centre were is due to its close vicinity to human beings. One out of recovered from the residential areas because rhesus ten north- Indian monkeys captured from big cities in macaques and common langurs usually live in the areas. north India have been reported to suffer from active They share the food and similar water sources with tubercular lesion (Nair and Ray 1954). Bazaz-Malik human population. It is possible that these monkeys (1967) has already studied the susceptibility of the might get TB infection from the infected human healthy tuberculin negative monkeys to Human type of population, but it becomes more dangerous, when they mycobacterium tuberculosis. It indicates that control can start spreading the infection to their companions. Steele be achieved by eradicating the tuberculosis in the (1966) has mentioned that monkeys and other primates human population. Although, the source of tuberculosis are susceptible to human type (Mycobacterium in human population is debatable being originated from tuberculosis) of disease. Animals frequently develop human strain or bovine strain (Grange et al. 1996). Still, generalised disease and succumb. During illness, they its treatment is universal and possible. On the other are active spreaders and may infect an entire troop in a hand, due to increased industrialization, the practice of short time. releasing the monkeys has been increased in recent years. This is negatively affecting the wildlife The relationship between the human population and conservation strategies as wild animals are said to be monkeys is not always symbiotic. Many times, disease-free and it is obvious for them to easily get the macaques and langurs create nuisance and become infection from the released monkeys suffering from TB. destructive to human holdings. In the case, they are Keeping in view the limitations to control the TB in wild captured and released into the forest area, mostly population, scientific release of problematic monkeys without testing for tuberculosis or any other disorders. is found to be one of the important steps to maintain The practice leads to spread of tuberculosis to other the healthy wild population and consequently for its co-existing animals. The tuberculosis in the wild animals proper conservation. is more challenging as TB organism is sturdy and treatment requires around 6 months time for complete satisfactory recovery. This kind of treatment is practically References impossible in free-range wild animals and also its management seems to be the difficult task. Hence, Bazaz-Malik Gauri (1967) Tubeculosis in monkeys: can it be scientific release of the problematic monkeys should a source of infection to man?: part II. Ind J Tuber consider the following to restrict secondary infection 15 (1): 12-16 among population: Grange JM, Yates MD, DeKantor IN (1996) Guidelines for speciation within the Mycobacterium tuberculosis complex. 2nd edn. World Health Organization 1. Adoption of Quarantine procedure is advocated. Observation for the abnormal signs, like, Kumar V, Abbas AK, Fausto N, Mitchell RN (2007) Robbins basic pathology. 8th edn. Saunders Elsevier p 516 emaciation, lethargy, persistent cough, exertional dyspnoea can be made prior to release. Nair CP, Ray AP (1954) Tuberculin test in diagnosis of tuberculosis in rhesus monkeys. Ind J Tuber 1: 85 2. Essentially examination for the presence of tuberculosis bacterium using Acid-fast staining and/ Prater SH (2005) The book of Indian Animals. 3rd edn. Oxford University Press p 29 or rapid TB diagnostic kit by collecting the nasal Steele JH (1966) Working paper No. 17 IVth FAO Far East and oral swabs as samples. PCR test can be Regional Conference on Animal Production and performed for the detection of Mycobacteria, if the Health Ceylon October 1966 facilities are available. Vegad JL, Katiyar AK (2001) A textbook of veterinary special 3. Monkeys found positive for tuberculosis should be pathology. 1st edn. International Book Distributing maintained and treated in isolation/rescue centre Co. p 355 until complete recovery.

(Manuscript Receivd : 19.09.2011; Accepted 30.01.2012) Occurrence of tuberculosis in human, monkeys and other wild animals is co-related. Diagnosis/ treatment of TB in free-range monkeys is a complex process due to the constraints involved in the sample

424 JNKVV Res J 46(3): 425-428 (2012)

Effect of Asparagus racemosus supplementation on qualitative and quantitative parameters of hypogalactic buffalo milk

A.K. Soni, P.C. Shukla and R.P.S. Baghel College of Veterinary Science and Animal Husbandry Nanaji Deshmukh Veterinary Science University Jabalpur 482 001 (MP)

Abstract major cause (Radostits et al. 2010). The high yielders are reported to be more susceptible to nutritional During the study a total of 30 apparently healthy hypogalactic imbalance than the low yielders (Hart et al. 1979). buffaloes were selected and divided in 3 equal groups. The Shatavari (Asparagus racemosus) is an excellent animals of all groups received basal ration. Besides this T 1 galactogogue. It enhances the lobeo- alveolar growth and T groups received 25 g and 50 g Asparagus racemosus 2 in mammary gland and stimulates the release of daily continuously for 60 days respectively. The average milk corticosteroids and prolactin (Sharma et al. 1996). production was increased by 7.59% and 13.07% in T1 and T2 group respectively. While, in control group the average milk Further the effect of postpartum shatavari production was decreased by 7.41%. The average milk Fat supplementation on milk production and composition in lactating crossbred cows and buffaloes were well % in T1 & T2 group was increased by 4.28% and 1.19% respectively at 60th day of experiment. The average milk SNF documented by Berhane and Singh (2002), Somkuwar in T1 & T2 group was increased by 7.16% and 9.62% et al. (2005), Mishra et al. (2008) and Tanwar et al. respectively at 60th day of experiment. The economics of milk (2008). production was also calculated in terms of average increase in the milk production as compared to control group during 60 Hence, looking to the role of Shatavari as days of treatment.The overall net profit of Rs 1569.60/- in 60 galactogogue the present study was aimed to correct days was obtained in the group T2. While, net profit of Rs the hypogalactia in buffaloes.

2208.40/- in 60 days was obtained in group T1. Material and methods Keyword: Hypogalactia, Asparagus racemosus, basal ration For the present study 30 apparently healthy hypogalactic lactating buffaloes having approximate six India has 105.34 million buffaloes that ranked first in years of age were selected from the villages the world. In Madhya Pradesh, buffalo population is 9.13 (unorganized sector) in and around Jabalpur region for millions ranking 4th in India. From which around 1, therapeutic studies. These hypogalactic buffaloes were 12,635 (Censes 2007) are in Jabalpur. Today in the field divided in two groups (T1 and T2) each consisting of 10 of livestock industry and villages the buffaloes are the animals. In addition to these, a group of 10 buffaloes main milk producing animal. The milk production and was kept as control. The animals of all groups were fed its sell in the market is the primary basis of the income the basal ration consisting of mineral mixture, of the farmers or dairy owners. concentrate, green fodder and wheat straw etc). In addition to this the animals of T and T groups had Hypogalactia, is a syndrome in which the lactating 1 2 received 25 g and 50 g Asparagus racemosus daily for a animal gives less than the expected milk because of period of 60 days. The milk production of buffaloes were persistent hypocalcaemia (Antarkar 1980). recorded at 15 days pre-treatment and then for 60 days Hypocalcaemia is the primary factor that induces post-treatment. The milk samples were analyzed at 0th, hypogalactia in dairy animals. However the fodders 30th and 60th day of investigation. grown on mineral deficient soil also reported to be the

425 Statistical Analysis 50 g of Asparagus racemosus for 60 days. However, with equal supplementation Tanwar et al. (2008) found 12.72% increase in the average milk production in 60 days so, Statistical analysis was done as per Snedecor and these observations are in conformity with the findings of Cochran (1994) using Duncan's Multiple Range Method. the present study (Table 1 and Figure 1).

Results and Discussion Percentage of fat

Milk Production In control group, the mean fat percentage at 0th, 30th and 60th was 8.19 ± 0.239, 8.16 ± 0.238 and 8.12 ± 0.235 As regards the overall milk production decreased trend respectively. In T1 group, it was 8.31± 0.163, 8.36 ± 0.162 was observed in control group. However, drastic and 8.41 ± 0.162 respectively. In T2 group, it was 8.78 ± increase in the milk production of T1 and T2 group was 0.185ab, 8.96 ± 0.187a and 9.16 ± 0.186a respectively. recorded as 7.59% and 13.07% respectively. During In control group, non significant (p< 0.05) decrease was the study period all animals were in mid lactation. In th th observed at 30 and 60 day interval was observed. In T1 control group the production was decreased because group, non significant (p< 0.05) increased was observed no any additional supplementation was given to the th th at 30 and 60 day interval. On the other hand in T2 group, th animals of control group. While, T1 and T2 group had significant (p< 0.05) increase was observed at 30 and received an additional supplementation of Asparagus 60th day interval. This increase in fat % is because of the racemosus. These findings are similar with the findings enhancement of the amount of Asparagus racemosus. of Anjaria and Gupta (1967); Chouhan et al. (1971); At 0th day the average fat % in all groups were slightly Arora et al. (1982); Singal, (1995) and Ramesh et al. higher as compared to findings of Prasad (2009). In control (2000). In the present finding 13.07% increase in the group, the fat % was decreased due to no average milk production was found in animals receiving supplementation other than the basal ration. However, in

Table 1. Effect of Asparagus racemosus supplementation on milk yield (Litres /Buffalo/Day) Group 0th day 15th Day 30th Day 45th Day 60th Day Total (Liters/Buffalo/15Day) % Change in Milk Yield C 658.10 0.69↑ 1.05↓ 2.99↓ 2.68↓ 7.41↓ ↑ ↑ ↑ ↑ ↑ T1 725.25 3.17 2.68 0.85 0.89 7.59 ↑ ↑ ↑ ↑ ↑ T2 666.75 5.42 2.73 2.38 2.54 13.07

T1 group the increase was non significant (p< 0.05) In T2 group, significant (p< 0.05) increase at 30th and 60th day interval was found. Similar findings were reported by Berhane and Singh (2002); Somkuwar et al. (2005); Mishra et al. (2008) and Tanwar et al. (2008). (Table 2 & Figure 2).

Percentage of milk solid not fat

The milk samples of Control, T1 and T2 groups were analyzed at 0, 30 and 60 day of experiment. In control group, the mean concentration at 0th, 30th and 60th was 9.18 ± 0.077, 9.31 ± 0.073 and 9.49 ± 0.089 respectively. bc ab In T1 group, it was 9.33 ± 0.058 , 9.62 ± 0.151 and

426 a 10.01 ± 0.143 respectively. In T2 group, it was 9.07 ± in 60 days was earned in group T1, receiving 25 gm of c ab a 0.203 , 9.68 ± 0.208 and 9.96 ± 0.214 respectively. Asparagus racemosus. (The profit was more in T1 group In control group, there was non significant (p< 0.05) it is because of that the average milk production of th th increase in SNF% at 30 and 60 day interval. However, buffaloes of the group T1 was already higher than T2 as compared to 0th day significant (p< 0.05) increase group prior to start of study as compared to T2 group). th was observed at 60 day interval. In T1 group non However, contrary result was reported by Berhane significant (p< 0.05) increase was observed at 30th day (2000) who supplemented 100 g Asparagus racemosus and 60th day. However, as compared to 0th day the per animal (alternate day) and observed significantly increase was significant (p< 0.05) at 60th day interval. (p< 0.05) higher per liter cost of milk production in At 0th day the SNF% in all groups were above than the shatavari supplemented group (Rs 9.51) than the control average value as reported by Prasad (2009). In T1 and group (Rs 7.15).

T2 groups non significant (p< 0.05) increase in SNF% at 30th and 60th day was seen. These findings were 30 similar to the findings of Berhane and Singh, (2002); bl v/;;u gsrq LoLFk ijUrq nqX/k&mRiknu esa de vk¡dh xbZ dqy Somkuwar et al. (2005); Mishra et al. (2008) and Tanwar HkSalksa dks fy;k x;k RkFkk mUgsa rhu cjkcj lewgksa esa foHkDr fd;k x;kA et al. (2008) (Table 3 & Figure 3). iz;ksx esa iz;qDr HkSalksa esa ls nl HkSalksa dks dUVªksy&lewg ds varxZr j[kk x;k] ftUgsa flQZ ewy [kk|kUu ¼csfld&jk'ku½ gh fn;k x;kA vU; HkSalksa Economics of milk production dks mipkj ds vuqlkj Vh&1 ¼izFke½ ,oa Vh&2 ¼f}rh;½ lewg esa ewy [kk|kUu ds vykok Øe'k% 25 xzke ,oa 50 xzke lrkojh pw.kZ 60 In the present study overall net profit of 1569.60/- in 60 fnolksa rd fu;fer #Ik ls fn;k x;kA bl mipkj esa ;g fu"d"kZ vk;k days was earned in the group T receiving 50 gm 2 fd Vh&1 ,oa Vh&2 nksuksa lewgksa esa vkSlr nqX/k mRiknu Øe'k% 7- Asparagus racemosus. While, net profit of Rs 2208.40/-

Table 2. Effect of Asparagus racemosus supplementation on milk fat (%)

Interval Control %Change T1 %Change T2 %Change 0 8.19±0.239 8.31±0.163 8.78±0.185ab 30 8.16±0.238 0.85↓ 8.36±0.162 0.60↑ 8.96±0.187a 2.05↑ 60 8.12±0.235 0.49↓ 8.41±0.162 0.59↑ 9.16±0.186a 2.23↑ Overall % Change 1.34↓ 1.19↑ 4.28↑

Values in the table with different superscript differ significantly (p< 0.05) ↑ means increase ↓ means decrease

59% rFkk 13.07% rd c<+ x;kA blds vfrfjDr mipkfjr HkSalksa ds nqX/k esa olk dh ek=k rFkk olk jfgr va'k ¼,l-,u-,Q-½ dh ek=k dk Hkh vkadyu fd;k x;k] fu"d"kZ eas nksuksa lewgksa esa olk Øe'k% 4- 28% o 1-19% rFkk olk jfgr va'k ¼,l-,u-,Q-½ 7-16% ,oa 9-62% cM+k gqvk Ikk;k x;kA mijksDr iz;ksx ds Ik'pkr~ bykt ds QyLo#Ik vkfFkZd ewY;kadu Hkh ns[kk x;k] ftlesa 60 fnol Ik'pkr izFke lewg esa 1569-60 #Ik;s rFkk f}rh; lewg esa 2208-40 #Ik;s dk ykHkka'k izkIRk gqvkA

References

Antarkar RG (1980) Studies of blood calcium in post parturient

427 Table 3. Effect of Asparagus racemosus supplementation on milk solid not fat (%)

Interval Control %Change T1 %Change T2 %Change 0 9.18±0.077 9.33±0.058bc 9.07±0.203c 30 9.31±0.073 1.42↑ 9.62±0.151ab 3.11↑ 9.68±0.208ab 6.73↑ 60 9.49±0.089 1.93↑ 10.01±0.143a 4.05↑ 9.96±0.214a 2.89↑ Overall %Change 3.35↑ 7.16↑ 9.62↑ Values in the table with different superscript differ significantly (p< 0.05) ↑ means increase ↓ means decrease

Livestock Census (2007) Prasasnik Prativedan 2009-2010. Department of Animal Husbandry Government of Madhya Pradesh pp 46-47 Mishra IS, Jaiswal RS, Bhardwas RK, Sharma RJ, Joshi, YP, Mandal BC, Rahal A (2008) Effect of feeding shatavari on nutrient intake, digestibility and milk production in crossbred lactating cows. National Seminar on emerging Opportunities for Commercialization in dairy (6-7 Nov) NDRI Karnal Haryana 132001 India Patel A, Kanitkar U (1969) Asparagus racemosus wild form bordi as a galactogogue in buffaloes. Indian Vet J 46:718-21 Prasad Jagdish (2009) Animal Husbandry and Dairy Science 4th revised Edn Publ Kalyani Publishers Ludhiana p 282 Radostits OM, Blood DC, Gay CC (2010) In: Text book of cows and buffaloes and evaluation of oral and Veterinary Medicine. 10th Edn Publ Bailliere Tindall parenteral calcium therapy. (As cited by Rode A.M. London p 1310-1367 MVSc thesis MAVFSU Nagpur 1982) Ramesh PT, Mitra SK, Suryanarayana T, Sachan A (2000) Arora SP, Aston K, Drane HM, Saba N (1982) The fertility of Evaluations of 'Galactin' a herbal preparation in dairy heifers consuming red clover silage. Grass for Sci cows. The Veterinarian 24 (Feb): 15-17 37: 101-106 Sharma S, Ramji S, Kumari S, Bapna JS (1996) Randomized Berhane M, Singh VP (2002) Effect of feeding indigenous controlled trial of Asparagus racemosus (Shatavari) galactopoietics feed supplements on milk production as a lactogogue in lactational inadequacy. Indian in crossbred cows. Indian J Anim Sc 72(7): 609-611 Pediatr 33:675-677 Berhane M (2000) Studies on feeding some indigenous Singal SP (1995) Study on the effect of "Payapro" on milk galactopoietics feed supplement on performance of yield in lactating cows. Dairy guide Jan-March: 45- crossbred cows. MSc thesis submitted to JNKVV 47 Jabalpur (MP) Snedecor WG, Cochran WG (1994) In: Statistical method. Hart LC, Bines JA, Morant SV (1979) Endocrines control of 8th Edn The Iowa State College Press Inc Amer Iowa energy metabolism in cows: Correlation of hormones USA and metabolites in high and low yielding cows for Somkuwar AP, Khadtare CM, Pawar SD, Gatne MM (2005) lactation. J Dairy Sci 62: 270-277 Influence of shatavari feeding on milk production in Livestock Census (2007) Department of Animal Husbandry buffaloes. Pashudhan 31(2):3 Dairying and Fisheries Ministry of Agriculture Tanwar PS, Rathore SS, Kumar Yogendra (2008) Effect of Government of India http://www.dahd.nic.in/ Shatavari (Asparagus recemosus) on milk production relcensus.htm in dairy animals. Indian J of Ani Res 42:602-606

(Manuscript Receivd : 13.11.2011; Accepted 01.02.2012)

428 JNKVV Res J 46(3): 429-433 (2012)

Effect of educational background of girl students on extent of participation in sports and games at different educational level in Rewa Division of Madhya Pradesh

Rachna Mishra and J.K. Sharma Awadhesh Pratap Singh University Rewa 486001 MP

Abstract with the development of society. Especially, girls or women must be educated, as they play vital role in the family The effect of educational background of girl students on and society. When a girl is educated she attains extent of participation in sports and games at different knowledge and gains power, which helps in her self educational level (middle, high and higher secondary) were development. When she has family it gives a positive assessed through survey of 520 girls students (from rural thinking and influences that family in various ways. As and urban area) from Rewa Division of Madhya Pradesh her children grow, she educate them, which helps the State. The statistical analysis conformed the significant society to progress in all aspects. It is a fact that every relationship between the educational level of girls students body must get education but when girl get educated it and rate of participation on all the factors of educational benefit future generations of our country. Sports and back ground. The extent of participation of girl students games are integral component of education and it brings in sports and games was increased with the increase in recognition in the society. A healthy person is always an their level of education. The girl students having different asset to the society due to his ability to contribute towards educational backgrounds have interest and eager to development. Sports and games activity for girls is one of participate in the sports and games. Thus there is a need the important process through which the healthy pillars to provide the congenial atmosphere for sports and games of the nation can be built-up in future. The present trends and increase their level of education, which help for towards more or less unlimited participation for women in increasing the participation of girl students in sports and wholesome (Gendel 1960) competitive activities is games. gainining momentum. As society become even more aware of the fact that such activity is well within the capabilities of the female, there will be complete Keywords: Educational level, Sports and Games, Female acceptance of woman in sports activities (Synder and students, educational background and rate of participate. Elmer 1973). Over the years efforts have been made to introduce sports and games as an integral part of the Education is the process of instruction aimed at the all school education, thus, level of education may effect the round development of boys and girls. It is the only wealth extent of participation of girl students in sports and games. that can not be robbed. Nelson Mandela once said Thus, the present study on factors affecting participation "Education is the most powerful weaper which you can as different school level for rural and urban girl students use to change the world". It is a powerful instrument for in sports and games was undertaken. reducing inequity and poverty and for laying a foundation of sustained economic growth for individuals and their Material and methods communities learning includes the moral values, physical status, improvement of character and the methods to increase the strength of mind. Education is very important The Rewa division comprises of three district (Rewa, Sidhi in the present day life and only a literate person can adjust and Satna) were selected for study. From each district

429 three rural and three urban schools were selected to provide the congenial environment which help for randomly. In all 18 school were selected for drawing increasing the participation of girl students in sports and samples. From each selected schools 10 girls from each games. strata (middle, high and higher secondary schools) were Different factors of educational level (middle, high selected. Thus in all, the sample frame will be comprises and higher secondary) were also assumed to influence of 540 girls students were interviewed for collecting of the participation of girl students in sports and games. primary data through pre-tested interview schedule and The relationship of these factors was examined by survey method. statistical test (Chi-square test) and results obtained are The collected data were tabulated, classified and presented in Table 2 . statistically analysed using frequency distribution, It is observed from the result that there is significant arithmetical mean and chi-square test to evaluate the relationship between the educational level of girl students effect of educational back ground of girl students on extent and rate of participation on all the factors of educational of participation in sports and games at different background. These results lead to conclude that the educational level. extent of participation of girl students in sports and games was increased with the increase in their level of education. Results and Discussion This might be due to increased interest and under standing of girl students towards sports and games by the increase Different factors of educational background at various level in their level of education. This is also evident from the were assumed to influence the participation of girl students study by Eitle (2002) Stevenson (2003) , Halawal (2006,) in sports and games. The relationship of these factors Blackwell and MC laughlin (2009), Lutz etal. (2009) and was examined by statistical test (Chi-Square test) and Nandekar etal. (2010). results obtained are presented in Table 1. Thus it is concluded from the present finding that The results of statistical analysis clearly indicate the girl students having different educational backgrounds that in rural areas of Rewa division only public school are have interest and eager to participate in the sports and existing where the medium of instruction is Hindi, School games. Although the extent of participation in sports and timing is in morning, mid-day meal is not available, lady games was increased with the increase in their level of sports teacher is not available. However, the other factors education. Thus, there is a need to provide the congenial like availability of sports facilities, attendance in school atmosphere for sports and games and increase their level and performance in the last examination have mixed of educational which help for increasing the participation response. In the Urban areas of Rewa Division accross of girl students in sports and games. the three districts all the factors gained mix response. After perusal of results it is found that factors like f'k{kk ds fofHkUu Lrjksa ij 'kS{kf.kd okrkoj.k dk Nk=kvksa type of school, medium of instruction, school timing, dh [ksydwn esa Hkkxhnkjh ds izHkko dk v/;;u e0iz0 ds availability of mid day meal, availability of lady sport jhok laHkkx dh 520 ¼xzkeh.k ,oa 'kgjh½ Nk=kvksa ls izR;{k teacher, availability of sports facilities, regular attendance lk{kkRdkj dj fd;k x;k A v/;;u ds lka[;dh; fo'ys"k.k in the school and performance in the last examination ds vkadM+s ;g n'kkZrs gSa fd Nk=k, fdlh Hkh 'kS{kf.kd did not have any effect on the extent of participation of okrkoj.k dh gksa muds [ksydwn esa Hkkxhnkjh ij f'k{kk ds girl students in sports and games. fofHkUu Lrj dk izHkko ik;k x;k gSa A ;g 'kk;n blfy;s These results leads to conclude that whether the ik;k x;k fd izR;sd Nk=k ds eu esa pkgs mldk 'kS{kf.kd girl students studying in public or private schools, their okrkoj.k dksbZ Hkh gks [ksydwn esa Hkkxhnkjh dh yyd medium of instruction may be Hindi or English, their vfHkyf{kr gqbZA vr% Nk=kvksa dh [ksydwn esa fgLlsnkjh school timing may be morning or mid-day, they all have interest in sports and games. Beside this, even the girl c<+kus ds fy;s vuqdwy okrkoj.k cukus] [ksydwn dh students not get mid-day meal and lady sport teacher is vko';d vk/kkjHkwr lqfo/kk, c<+kus ,oa Nk=kvksa ds f'k{kk not available, in these conditions they have eager to ds Lrj dks c<+kus ij fo'ks"k cy nsus dh vko';drk participate in the sports and games. Thus there is a need gSa A

430 el Satna District Rural Urban Rural Urban Urban Rural Urban Rural

0 0 20 10 28 2 0 28 02 0 1 9 28 29 21 0 20 10 9 28 0 0 20 21 10 0 20 21 9 1229 28 119 12 8 164 15 3 202 18 2 16 14 10 20 15 2 5 5 16 12 5 5 10 9 10 1 3 11 24 4 18 9 12 4 5 9 1 1 4 4 5 1 9 1 2 2 2 1 1 4 5 0 4 6 4 3 2 5 15 2 11 1 5 5 5 7 3 9 1 4 2 3 10 1 3 6 2 05 1 114 4 10 Middle High HS Middle High HS Middle High HS Middle High HS HS High HS High High HS HS High Middle Middle Middle Middle 155 12 4 162 16 2 12 1 615 7 16 2226 22 1110 11 12 10

Yes No Yes No Yes No Yes No Yes No Yes No Yes No Yes No Yes No Yes No Yes No Yes No No Yes No Yes No Yes No Yes No Yes No 4 26 Yes 11 9 Public7 No 10 20 Yes No 3 8 Yes 15 22 8 No 2 28 5 Yes 2 No 16 14 Yes 5 No 7 Yes No 3 8 Yes 2 0 0 0 0 Hindi 4 26 5 10 20 14 5 7 16 14 31627 5 3 9 0 20 10 5 7 0 1 0 15 3 9 2 5 15 28 1 7 5 16 15 10 8 29 20 22 3 9 40 8 0 15 14 15 016 1 0 9 2 Morning 1 14 16 0 0 15 15 Available available 0 0 Available 0 0 0 6 7 4 3 9 0 1 0 0 0 05 5 9 7 3 1 available 61 1 6 19 17 6 16 18 4 9 6 10 5 1110 2 111 10 3 10 5 10 Available available 18 6 191 20 5 216 10 216 28 1 11 10 4 20 218 13 Regular11 regular Out standing Others Factor Rewa District Effect of educational back ground girl students on extent participation in sports and games at different lev Factor Level Type of School Medium of Instruction Private 0 0 0 0 0 6 School 0 1 4 19 16 4 0 0 Timing 0 2 18 4 9 16 011 English 0 0 0 0 02 5 18 15 9 0 11 0Availability 0 0 2 18 4 9 16 011 day Mid of meal 0 Mid-day 0 0 0 Not 0 2 5 18 159 0 11 0 0 0 2 184 9 16 011 Availability sport lady of Teacher Not Availability of sports facilities Not Attendance school in Not Performance last the in examination Table 1: Table All the X2 values are non significant, therefore it is not mentioned in table

431 Sidhi District

Factor Level Rural Factor Middle High Yes No Yes No Yes Type of School Public 16 14 20 10 25 Private 0 0 0 0 0

Medium of Hindi 16 14 20 10 28 Instruction English 0 0 0 0 0

All the X2 values are non significant, therefore it is not mentionedSchool Timing in the table Morning 16 14 20 10 28 Mid-day 0 0 0 0 0 Availability of Mid Available 16 14 0 0 0 day meal Not 0 0 20 10 29 available Availability of lady Available 0 0 0 0 0 sport Teacher Not 15 15 20 10 28 available Availability of sports Available 3 2 5 3 5 facilities Not 13 12 18 4 22 available Attendance in Regular 10 10 17 5 16 school 432 Not 5 5 6 2 11 regular Performance in the Out 5 5 5 3 3 last examination standing Others 10 10 15 7 25 Table 2: Effect of educational level of girl students on participation in sports and games

** Significant at 1% level

References Lutz GM, Cornish DL, Gonnerman ME Jr. and Ralston M (2009) Impact of participation in high school extra curricular activities on early adult life experience : A Blackwell DL and McLaughlin DK (2009) Do rural youth attain study of Iowa Graduates. Jl of Instructional Psycho their educational goals. Rural Deve Pros 13(3) : 37- 6 : 15-20 40 Nandurkar PB, Nandarkar PP and Petkar HJ (2010) Role of Eitle J David (2002) Race, cultural capital and the educational incentive marks in women's sports participation. effects of participation in sports. Socio of educat 75 Brjsports Med 44 : 163 : 123-146 Stevenson Betsey (2003) Evidence on the effects of sports Gendel E (1960) Women and the Medical Aspects of Sports, participation examining the impact of title IX. http:// Hopper and Row Publishers New York bppk:-wharton,upenn.edu/betsegs/ oldsite/title Halawah Ibtesam (2006) The effect of motivation, family ix(2).pdf. environment and student characteristics on Synder, Eldon and Sprtzer, Elmer (1973). Family influence academic achievement. J of Instructional Psycho 3 and involvement in sports, Research Quarterly : 91-97 44:249 Klint A and Maureens (1998) Received competence and motives for participating in youth sports. A tests of harteri competence motivation theory. J of Sports (Manuscript Received: 10.08.2012 ; Accepted: 28.12.2012) Psycho 9 : 55-65

433