Educational Workshop EW04: Practical approach to diagnose mixed anaerobic infections in "real time“ Arranged with the ESCMID Study Group for Anaerobic Infections (ESGAI)
Convenor: Elisabeth Nagy (Szeged, HU)
Faculty: Diane .M. Citron (Culver City, US) Ulrik Stenz Justesen (Odense, DK) Georg Conrads (Aachen, DE) Elisabeth Nagy (Szeged, HU)
Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Classical methods for identification of anaerobes from mixed infections: do we still need them?
Diane M. Citron R.M. Alden Research Lab Culver City, California
Survey of USA Hospital Labs (2006-2007)
150 hospital laboratories (200-1000 beds); 85% responded to questionnaire 85% processed anaerobic cultures 15% sent to reference lab 100% used selective and differential media for isolation (in addition to blood agar) 30% use identification disks 66% use preformed enzyme kits 30% use other biochemical tests 4% GLC 0% used molecular methods Goldstein EJ et al, 2008, Anaerobe 14:68-72
Practical considerations
Few commercial molecular kits available for routine anaerobic specimens except in specialized areas (C. difficile toxin) Molecular methods mostly limited to in-house preparations in large labs or research institutions
1 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Incidence of anaerobes in clinical specimens
B. fragilis group 35% B. fragilis (40-50%) B. thetaiotaomicron (20%) Other Bf group (20-40%) Prevotella-Porphyromonas etc. 15-20% Fusobacterium 5-10% Anaerobic cocci 25-30% Clostridium 8-15% Non-sporeforming GPR 5-10%
What classical methods are being used?
Selective and differential agar media to culture anaerobes Rapid tests such as catalase, spot indole, urease, nitrate Identification kits – RapID ANA II, Rapid ID 32a and others Tube biochemicals GLC for short and long chain fatty acids
Selective and differential media
Bacteroides bile-esculin- gentamicin agar (BBE) Rapid presumptive ID of B. fragilis group, Alistipes, and Bilophila. Some strains of Fusobacterium mortiferum and F. varium may grow. (bile resistant) Enterococci highly resistant to gentamicin will grow
2 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Selective and differential media
Laked blood with kanamycin and vancomycin brucella agar (LKV) Inhibits gram-positives and enterics Grows Bacteroides, Prevotella, Alistipes some fusobacteria(and Van-R Clost. innocuum!) Enhances pigmentation of Prev. melaninogenica group
Growth on Selective and differential media
EYA-Fusobacterium necrophorum (FEA) PEA Porphyromonas LKV-BBE B. fragilis
Prevotella BBE-Bilophila species CCFA- Clostridium difficile
F. nucleatum Identification disks: kanamycin 1000 ug vancomycin 5 ug colistin 10 ug
P. intermedia
B. fragilis
3 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Spot indole test p-DMACA reagent
Colonies can also be rubbed onto filter paper moistened with reagent. Blue color is +
Rapid urease test (disks, tablets)
preformed enzyme; incubate aerobically, read 1-2h
neg pos
Grouping of gram-negative rods
Bile Kana Van Col Cat Nit B.fragilis grp R R R R + - Prevotella S R R V - - Porphyromonas S R S R - - Fusobacteria V S R S - - Bilophila R S R S + + Desulfovibrio VSRR-+ + C. ureolyticus grp. V S R S -+ +
4 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Bacteroides fragilis group
bile resistant (BBE plate) resistant to kana, vanco, colistin disks most clinical isolates are catalase pos comprise 1/3 of clinical isolates most virulent (capsule) most antibiotic resistant Parabacteroides distasonis, merdae, goldsteinii, johnsonii, gordonii
Prevotella species
Isolated from oral and pelvic infections, abdominal and soft tissue Growth inhibited on BBE (but may turn agar black from hydrolysis of esculin if colonies plated directly) Resistant to kana, vanco, variable colistin Catalase and indole usually negative
Fusobacterium spp
species bile NO3 ind lipase esc cells
nucleatum S - + - - r,pt necrophorum SR -++-r,pleo naviforme S - + - - boat gonidiaform. S - + - - gonidia mortiferum R - - - v pleo varium R - +- -+ -pleo
5 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Fusobacterium nucleatum
S to kana, colistin disks; R to vanco indole positive; lipase negative slender rods with pointed ends several different colony types; subspecies Isolated from all types of infections and all areas of the body polymicrobial infections or single isolate
Fusobacterium necrophorum
S to kana and colistin disks ; R to vanco indole and lipase positive; beta- hemolytic cells have rounded ends or may be very pleomorphic important pathogen in Lemmiere’s disease and postanginal sepsis in young people (deep vein thrombosis, metastatic thrombi) Throat cultures?
Bacteroides ureolyticus-like grp Kana-S, Vanco-R, Col~S
URE MOT CAT BILE CO2 NO2 B. ureolyticus +--+ --+ Camp. gracilis -----+ Camp. rectus -+---+ Bilo. wadsworthia +-+R -+ Sut. wadsworthen. ---R-+ Dial. pneumo. Col-R ------Desulfovibrio Col-R -+ +/- -+ -R -+ Eiken. corrod. - - --++
( Use disk test for bile resistance)
6 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Clostridium perfringens
Box car shaped GPB Double zone of beta-hemolysis on BA Lecithinase positive Produces abundant gas in liquid media (blood culture bottles?)
Clostridium innocuum
Resistant to cefoxitin, other cephs, vancomycin (MIC= 8-16), some strains R to clindamycin, quinolones Grows on CCFA medium – resembles C. difficile but (PRO-neg) Disks- resistant to Ka, Va, Cl Misidentified in preformed enzyme kits ( often as C. subterminale) Gram variable rod, occ large terminal spores Isolated from IA infections, blood
Clostridium ramosum
Gram-variable long slender rod Chains in broth media Spores are rarely visible – terminal May be resistant to antimicrobials Identify using enzyme kits, biochemicals
7 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Clostridium clostridioforme group
Typically stains Gram-negative Spores are rarely seen Sensitive to vanco and kana disks One of most frequently encountered clostridia ~10-30% produce beta-lactamase; generally more resistant to antimicrobials (clinda, moxifloxacin) Identify with enzyme kits or biochems New species: boltae, hathewayii, citroniae, aldenense
Clostridium septicum
Swarmer; subterminal spores; indole-neg Bacteremia associated with cancer of large bowel Portal of entry – ileocecum Myonecrosis, gas gangrene) Underlying conditions- (leukemia, lymphoma, diabetes Susceptible to usual antimicrobials Toxins not eliminated with abx treatment High mortality
Gram-positive rods– non-sporeforming catalase nitrate indole Propionibacteria + +- +- Actinomyces -+ +- Eggerthella lenta + + - “Eubact. grp.” - -+ - Lactobacilli - - - Bifidobacteria - - -
8 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Propionibacterium acnes
Frequent skin contaminant in blood, csf cultures Occasionally pathogenic (shunts, implants, post- op cultures from eye) Relatively slow-growing ID based on pos rxns for catalase, indole, nitrate Acne strains may be R to tetra and macrolides All strains R metronidazole
Importance of basic tests – ID to group >75% of clinical isolates
Gram stain – cell morph Growth in 20% bile Susceptibility to 1mg kana Susceptibility to 5 ug vanco Catalase Spot indole Nitrate Fluorescence
Limitations of phenotypic identification tests
Current and newer taxonomy is based on 16S rRNA and other gene sequences Identification kits have limited databases resulting in misidentifications of some organisms Expensive and time-consuming for the results obtained
9 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
What can classical methods still do?
Provide a basic level of identification based on phenotypic appearance Provide isolates for further study Susceptibility to antimicrobials and to detect novel resistance mechanisms Sequencing to identify new species
Molecular characterization of resistance mechanisms – limitations
The cfiA gene is present in 3-5% of bacteroides fragilis, yet resistance is not expressed unless insertion sequences are present NimB genes may be present if Finegoldia magna, yet the strains remain susceptible to metronidazole Multiple mechanisms may be present in one strain – eg beta-lactamase + efflux pumps Emergence of novel mechanisms
Diversity of Anaerobic Bacteremia: Gram-negative isolates
Group, Genus 16S rRNA vs Conventional Genus Species Genus Species None Bacteroides (129) 129 124 127 102 26 Fusobacterium (15) 15 15 15 14 0 Parabacteroides (7) 7 7 7 5 2 Porphyromonas (1) 1 1 1 0 0 Prevotella (11) 11 11 10 8 4 Veillonella (4) 4 3 0 0 4 Other (4)* 4 3 0 0 4 *Alistipes, Bilophila, Campylobacter Simmon KE el al, J Clin Microbiol 2008,46:1596
10 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Diversity of Anaerobic Bacteremia: Gram-positive isolates Group, Genus 16S rRNA Conventional Genus Species Genus Species None Anaerococcus (7) 7 1 7 0 0 Clostridium (97) 97 93 93 71 13 Eggerthella (14) 14 14 9 7 5 Eubacterium (1) 1 1 0 0 1 Finegoldia (3) 3 2 2 0 1 Parvimonas (3) 3 3 3 0 0 Peptoniphilus (8) 8 1 0 0 8 Other (12)* 12 10 5 1 7 *Actinobaculum, Catabacter, Propionibacterium, Ruminococcus, Solobacterium, Tissierella Simmon KE el al, J Clin Microbiol,2008,46:1596
Identification of anaerobic GPR from blood cultures
20 isolates – compare 16S RNA gene sequencing to conventional methods 11 clostridia – barati, difficile, indolis, innocuum, paraputrificum, ramosum, septicum 9 NSF –Eubacterium, lactobacilli, P. acnes Correct identifications: Vitek ANI – 2/20; RapID ANA II – 7/20; API 20A – 6/20; MicroSeq 13/20
Lau SKP et al, J Clin Path 2006:59;219-222
16S rRNA sequencing vs conventional for 127 blood culture anaerobes (%)
Genus and Genus only No ID Mis ID species 16S MicroSeq 94 94 5 0
16S GeneBank 98 98 2 (new 0 species) Conventional 52 79 9 9
Some of the unusual isolates: Actinomyces europaeus, A. funkeii, Clostridium hathewayi ,C. scindens, Lactobacillus sakei, Robinsoniella sp, Solobacterium moorei, Turicibacter sanguinis, Bacteroides dorei, B. nordii, B. xylanisolvens, Sneathia sanguinegens, Veillonella dispar, Veillonella rodentium
Justesen, 2010, JCM
11 Citron - Classical methods for identification of anaerobes from mixed infections: do we still need them?
Bacteroides and Parabacteroides recovered from clinical specimens at St. John’s Med Ctr Santa Monica, CA 2006-11
Species (N=559) no. % total
B. caccae 28 5.0 B. cellulosilyticus 30.5 P. distasonis 23 4.1 B. dorei 10.2 B. eggerthii 10.2 B. fragilis 211 37.7 P. goldsteinii 10 1.8 P. gordonii 20.4 B. intestinalis 20.4 P. johnsonii 50.9 B. massiliensis 20.4 P. merdae 71.3 B. nordii 30.5 B. ovatus 69 12.3 B. salyersiae 40.7 B. stercoris 30.5 B. thetaiotaomicron 100 17.9 B. uniformis 35 6.3 B. vulgatus 49 8.8 B. xylanisolvens 10.2
Anaerobic Gram-positive recovered from clinical specimens cocci 2006-2011
Species (N=240) No. % Finegoldia magna 96 40 Parvimonas micra 67 27.9 Pe. asaccharolyticus * 23 9.6 Pe. gorbachii 4 1.7 Pe. harei 31.3 Pe. harei-like 9 3.8 Ps. anaerobius 12 5.0 A. prevotii 41.7 No GenBank match 6 2.5
One each: Anaerococcus hydrogenalis, A. lactolyticus, A. murdochii, A. tetradius, A. vaginalis; Peptococcus niger; Peptoniphilus coxii, P. tyrelliae ; Murdochiella assacharolytica; (0.4%)
Prevotella species recovered from clinical specimens from 2006 - 2011
Species (n=143) No. % of total P. bivia 46 32.2 P. buccae 21 14.7 P. buccalis 32.1 P. denticola 53.5 P. disiens 21.4 P. intermedia 85.6 P. loescheii 53.5 P. melaninogenica 18 12.6 P. nanceiensis 10 7 P. oralis 53.5 P. oris 32.1 P. salivae 21.4 P. timonensis 53.5 P. baroniae, P. bergensis, P. heparinolytica, P. tannearae 1 ea 0.7 P. species, no GenBank match 7 4.9
12 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Antibiotic resistance determination: dilution methods versus disc diffusion ‐ the old story comes back
Ulrik Stenz Justesen, MD, DMSc
Department of Clinical Microbiology Odense University Hospital
ECCMID, London, 2012
Antimicrobial susceptibility testing (AST)
Antibiotic resistance determination
or
Antimicrobial susceptibility testing (AST)
Why do we do AST?
“Antibiotic resistance among anaerobic organisms has increased significantly in recent years.” (2007)
“High levels of antimicrobial agent resistance among anaerobic organisms are continually reported.” (2012)
Foreword: CLSI Standard: Methods for antimicrobial susceptibility testing of anaerobic bacteria. Approved standard. M11‐A7 and A8.
Nguyen MH et al. Antimicrobial resistance and clinical outcome of Bacteroides bacteremia: findings of a multicenter prospective observational trial. Clin Infect Dis. 2000.
13 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Why we do AST?
Snydman et al. Clin Infect Dis. 2010.
Why do we do AST?
Why do we do AST?
14 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Why do we do AST?
How do we do AST?
What methods are available?
• Agar dilution or broth dilution (CLSI reference method)
• Gradient strip (Etest , MICE and others ...)
• Disk diffusion???
Agar or broth dilution
Brucella Blood Agar or broth
Clinical and Laboratory Standards Institute (CLSI)
• Methods for antimicrobial susceptibility testing of anaerobic bacteria. Approved standard. M11‐A8. 2012.
Pros and cons • Excellent reproducibility •Laborious
15 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Agar dilution
Amyes S. OIDL Antibacterial Chemotherapy. 2011.
Broth dilution – commercial assays
Breakpoint testing ‐ not suitable for monitoring purposes
Gradient strip
Etest, MICE and others ...
The Etest is FDA approved but not addressed by the CLSI
McFarland 1.0 on supplemented (hemin and vitamin K) Brucella Blood Agar – BBA
Pros and cons •Very easy •Very expensive
Bacteroides fragilis ATCC 25285
16 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
When should we do AST?
“To assist in the management of infection in individual patients with serious or life‐threatening infections”
Relying on surveillance testing?
Snydman et al. Clin Infect Dis. 2010.
The old story comes back?
• Disk diffusion is coming back?
• High levels of antimicrobial agent resistance among anaerobic organisms are continually reported
• Clinical microbiology laboratories are asking for simple and inexpensive methods
• We have clinical EUCAST MIC breakpoints
EUCAST MIC breakpoints (anaerobes)
17 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Is there a EUCAST disk diffusion method?
No!
Is there a EUCAST disk diffusion method?
Does anaerobes grow on the MH‐F (Mueller‐Hinton Fastidious)?
No!
Justesen et al. ECCMID. 2011.
Disk diffusion and anaerobic bacteria?
•Not a lot of data so far
• Sometimes used for screening, e.g. moxifloxacin and C. difficile
•Might work with some of the 24‐hour anaerobes, e.g. Bacteroides spp. and Clostridium spp.
•Someyears ago it seemed to work for Bacteroides (Johnson et al. Clin Infect Dis. 1995) ‐ ”but it did not make it over the top”
Why? No resistance? Disagreement on conditions ‐ Wilkins‐Chalgren/BBA? Mix of slow and fast growing anaerobic bacteria?
Bacteroides fragilis ATCC 25285
18 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Brucella Blood Agar for disk diffusion AST?
##
Highest mean difference 2.7 mm Highest range 5.5 mm Justesen et al. ECCMID. 2011.
Further studies are needed with clinical isolates
##
Justesen et al. ECCMID. 2011.
Disk diffusion AST for the B. fragilis group?
This slide is intentionally left blank
19 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Brucella Blood Agar for disk diffusion AST?
The Brucella blood agar for disk diffusion antimicrobial susceptibility testing – reproducibility results for Clostridium difficile ATCC 700057
Abstract and poster P680
Justesen et al. ECCMID. 2012.
Results
Disk diffusion AST for Clostridium difficile
Disk diffusion antimicrobial susceptibility testing of Clostridium difficile
Abstract and poster P681
Erikstrup et al. ECCMID. 2012.
20 Justesen - Antibiotic resistance determination: dilution methods versus disc diffusion - the old story comes back
Disk diffusion AST standardisation so far
Conditions
•Plates have been reduced 18‐24 hours before use (or not?)
•Inoculum preparation: 1 McFarland in thioglycolate bouillon (saline 0.85%?)
•Inoculation and incubation: complying with the EUCAST 15‐15‐15 rule
•Anaerobic atmosphere (10 % H2, 10 % CO2, 80 % N2)
•Temperature and time: 37 °C for 24 hours
• Brucella Blood Agar‐plates with hemin, vitamin K1 and laked sheep blood
Summary, conclusions and perspectives
Preliminary disk diffusion studies with Bacteroides fragilis group reference strains and clinical isolates have been promising. Furthermore, studies with clinical isolates of Clostridium difficile shows that isolates with reduced susceptibility to metronidazole and vancomycin can be separated from wild‐ type isolates with disk diffusion.
Although the reference methods are still the AST methods of choice for a large number of slow growing anaerobic species, disk diffusion seems to be a potential alternative for certain rapidly growing anaerobic bacteria.
Clostridium perfringens or other Clostridium spp. may well be the next candidates to be evaluated for AST with disk diffusion (penicillin, clindamycin and metronidazole susceptibility).
21 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections Georg Conrads & Hans-Peter Horz
Division of Oral Microbiology & Immunology, University Hospital (RWTH), Aachen, Germany
ESCMID Educational Workshop, London, March 2012
The Dawning of Molecular Identification in Microbiology
16S rRNA
In 1977 Carl Woese did the first microbial phylogenetic tree based on 16S rRNA sequences, a „molecular clock“ of bacterial evolution
C o n t e n t s Molecular Methods discussed…. 1) DNA probes & primers a) genomic: design, examples, problems b) oligonucleotides: design, examples, problems 2) (RTQ-) Polymerase Chain Reaction a) universal b) specific c) Fingerprinting 3) Microarrays, Chips & Surface Plasmon Resonance 4) Sequencing: pyro-, nano-, mixed ..with special attention applications & challenges
22 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
1) DNA probes & primers
Genomic probes:
• Genome fragments
• Long PCR products or even the whole genome
• (complete) sequence unkown
• But empirically specific for species
Oligonucleotide probes (& primers):18-35 mer
• in-silico designed & tested
Probes
AATUGCTATCGCAATAGGCTAGCGGTACCGGATTACGG ATACCAGTTATCGGGACCATTTATAGGACCATTTTAGGG CAAAACTTTTTCGGGATTTCTCAAAGGGAGATTAGGAC ACCACCATTATATTATTAGGGCCCATTTATTAGGAGGGG GCTCCTTAAAAGGGGAAGGGGGAAATTTCTTTGGGATT Genomic TCTTCTTCTCTTCTTUCTCTTCTGGAGAGGAGAGTTCGG AGATTTAGGATTAGGCTTTAGGGGGACCCCCAAAAATT CGGTATACATAGGACATTAGACCCAGTACCAAATTGCT ATCGCAATAGGCTAGCGGTACCGGATTACGGATACCAG TTATCGGGACCATTTATAGGACCATTTTAGGGCAAAAC UTTTTCGGGATTTCTCAAAGGGAGATTAGGACACCACC ATTATATTATTAGGGCCCATTTATTAGGAGGGGGCTCCT TAAAAGGGGAAGGGGGAAATTTCTTTGGGATTTCTTCTT CTCTTCTTTCTCTTCUGGAGAGGAGAGTTCGGAGATTTA GGATTAGGCTTTAGGGGGACCCCCAAAAATTCGGTATA CATAGGACATTAGACCCAGTACCA
oligo AAGTTGACGTGGACTGGGATUUUUU
Genomic DNA probes
Selective strategy: Restriction fragments of the test-strain hybridized to biotinylated DNA of the closest related species and hybrids eliminated by avidin-agarose gel: remaining DNA fragments labelled and used as probes (Schmidhuber 1988) Random Prime Labelling: Gene Images RPL Module (GE), Dig-High Prime (Roche) Random Nick Labelling: Dig-Nick (Roche)
23 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Genomic DNA probes: Examples
Mainly for Oral pathogens in checkerboard format Food-borne (2011) Vaginal flora (2008) Mycoplasma, viruses
Limits will be discussed
Nascimento et al. 2006, dental implant flora
Checkerboard DNA-DNA hybridization membrane showing the hybridization of 40 of the 77 DNA probes to endodontic samples.
Brito L C N et al. J. Clin. Microbiol. 2007;45:3039-3049
Oligonucleotide probes and primers
Probe hybridisation – Probe: oligonucleotide of 18-32 b length – Target: rRNA/DNA signature, resistance gene, toxin-or other virulence gene – Assay: Dot-/Slot-/cell-/ in situ-/ colony-/ELOSA-hybrid. Polymerase chain reaction – Primer: oligonucleotide combination – Target: see above – Assay: Broad to „universal“ range PCR, Specific-PCR, PCR- derived fingerprinting, microarrays
24 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
C o m p u t e r d e s i g n In-silico design of ideal oligonucleotide: – Automated comparison of e.g. 16S rRNA sequences (BLAST, ARB etc.) – Choice of region with 2-3 central mismatches; in the case of primers additional mismatch at 3’ end – avoid GC-stretches – avoid hairpin or duplex formation – Melting temperature at least 60°C, as high as 72°C (primers) – Amplicon length: between 100-200 bp (50-60% GC content)
Databases & Web Tools Databases: – Ribosomal Database Project: http://rdp.cme.msu.edu – ARB, Munich, Germany: www.arb-home.de – NCBI (Genbank): www.ncbi.nlm.nih.gov – RIDOM: www.ridom-rdna.de (sorry most anaerobes still ignored!) – ISENTIO Ripseq www.ripseq.com
Web Tools: – Check probe (RDP), Check chimera (RDP), secondary structure, Design probe (ARB), 16S chromatograms (single, multi).
Ribosomal V6 tags pyrosequencing of coral reef microbes, Galdos et al. 2011(Environm.Microbiology)
25 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Empirical Testing Positive control: Reference strains including ATCC – plus: 10-20 uncorrelated strains of test species of different origin Negative control: Reference strains including ATCC of the nearest neighbor – plus: 10-20 uncorrelated strains of the nearest neighbor of different origin Additional control: 20 representatives of closely or more distantly related species sharing the same habitat.
Oligonucleotide probes & Blot-hybridisation Isolation of nucleic acids from reference strains and clinical material
Immobilisation
Hybridisation
Detection (chemiluminescence, fluorescence) Pros: cost-efficient & multiplex, ratio of cell counts conserved
26 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Oligonucleotide probes: Challenges
Each oligo needs individual hybridization temperature to avoid cross-reactivity
Under stringent conditions: NO cross- reactivity with other bacterial DNA - but likely with HUMAN DNA
2) P C R - based diagnostic
Classic and quantitative (qPCR, RTQ-PCR)
ESCMID Educational Workshop, London, March 2012
The „universal“ PCR
16S rDNA Conserved primer annealing site
Variable „informative“ core
27 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Broad-range („universal“) PCR…
…has a broad-range of applications
total cell-count determination detecting new species in clinical samples (review by Y. Song 2005) & restriction fingerprinting of ecosystems higher sensitivity than culture accuracy of 84% (complete sequencing = 100%, phenotypic= 56%)
Real time quantitative PCR
pre-and post 6 4 therapy 10 3x10
SybrGreen TaqMan
28 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Principles, when using PCR for routine
three (to five) separted rooms: sample preparation, adding of positive control, amplification floor with sticky mats to avoid cross contaminations closed systems (LightCycler, TaqMan) NA-decontamination of surfaces (e.g. DNA Exitus) amplicon-decontamination of sample by uracil-N- glykosylase (UNG) (plus using dUTP instead of dTTP in PCR reaction) negative control for PCR and nucleic acid preparation inhibition control
Cell % count RTQ-PCR Aggregatibacter 3x105 3.33 actinomycetemcomitans Tannerella forsythia 5x104 0.56 periodontitis Porphyromonas gingivalis 2x103 0.02 typical result (commercial product) Treponema denticola 6x105 6.66 Fusobacterium nucleatum 3x102 <0.01 Parvimonas micros 4x104 0.44 Total 9x106 100
7,24% 0,45% Unimportant rest 3,33% A.actino ? Red complex
88,98% Orange complex
PCR based Fingerprinting
Method Pub-Med History
T-RFLP 646 1997-2012
rDNA based: ARDRA, ARDRA 364 1992-2012
T-RFLP, DGGE, ITS- DGGE 2,148 1988-2012
PCR, rMLST (domain to strain) ITS-PCR 1,300 1991-2012
(r)MLST 229 2001-2012 genomic DNA based: Rep-PCR (also ERIC, BOX) 696 1991-2012
Rep-, Box-, ERIC-PCR; AP-PCR (misleading RAPD) 442 1990-2012 AP-PCR, MLST RTQ-PCR, qPCR 4,983 1990-2012
Nested PCR 5,525 1990-2012
PCR 380,000 1986-2012
For contrast: PFGE 9,217 Before 1986 - 2012
29 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
T-RFLP = terminal restriction fragment length polymorphism Universal PCR 16S rDNA 4 T-RFLP profiles
T-RFs
Virtual Digest Culman et al., 2009 BMC Bioinformatics http://trex.biohpc.org/ Shyu et al., 2007; Microb. Ecol. HOMD http://mica.ibest.uidaho.edu/trflp.php
Example: oral microbial changes during a challenging trecking tour
Group I Group II Sampling at end of trek
n = 28 n = 30
Manang
No symptoms Symptoms
Sampling at start
n = 58 Bhulebhule
58 healthy volunteers were included in the study
Comparison of T-RFLP profiles using PCA
Start of trip Group I Group II
n = 28 n = 30 PCA 2 (31%) 2 PCA PCA 2 (21%) 2 PCA
No symptoms No symptoms
PCA 1 (43%) PCA 1 (37%)
End of trip
n = 28 n = 30 PCA 2 (29%) 2 PCA
No symptoms (18%) 2 PCA Symptoms
PCA 1 (42%) PCA 1 (43%)
30 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Microbial diversity significantly elevated in Group II
Group I Group II
Shannon-Weaver Index calculated as follows:
-∑ pi * (ln pi)
pi = proportion of individual T-RFs
Start End Start End
ResponsePrevotellaT-RF 84 bpsp. ofEubacterium individualT-RF 277 nodatum bp sp. T-RFsT-RFBacteroidetes 462 bp
Group I
Group I
No Symptoms Group II Symptoms Group II
50 bp Terminal Restriction Fragments (T-RF) in bp 500 bp
Red signals: relative increase Green signals: relative decrease
3) Microarrays (Gene chips)
All in one go!!
ESCMID Educational Workshop, London, March 2012
31 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Electrically addressable array
a) b)
a) Nanoprobes, E-news 02-2006; b) Liu-Y et al. Analytical Chemistry 2008
Bead microarray (Illumina, iScan)
3 µm silica beads (50,000 per array) with 1 Mio probes each, in wells linked by optical fibres to detection unit - man, mouse, rat arrays, no prokaryotes
Photolithographic high-density array (Affymetrix)
Many eukarya: human, mouse, zebrafish, yeast, rice, Drosophila, C. elegans, Aradiposis, barley, chicken, canine…..still only three prokaryotes (not cost-efficient), Custom Array Service MyGeneChip
32 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Spotted or printed microarrays (NimbleGen-Roche, Agilent & IMGM)
very flexible; custom-made for 500 € (244 k) – 105 € (15 k) + costs for bioinformatics
….order by catalog (200 species) or custom design (100-500 €/chip)
Surface Plasmon Resonance (SPR)
Mixed infection
33 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Gene chips in clinical microbiology and infectious diseases
Comparative genomics Strain typing and characterization Host-pathogen interactions Transcriptional regulation Vaccine development Pathogen detection and identification
Pathogen detection and identification
Dols et al. 2011: 14 Bacterial Vaginosis associated species Harrington et al. 2008: 17 fecal flora analysis Davignon et al. 2005: 20 respiratory tract pathogens microarray incl. flu-like bioterrorism pathogens Xing et al. & Institut Pasteur, 2006: 50 bacterial and viral species plus antibiotic resistance and toxin genes. Couzinet et al. 2005: 201 Staph. strains from 33 species and different origin (human, vet., food, environment), 92% concordance with 16S sequencing DeSantis et al. 2005: simultaneous detection of 8,900 taxa for microbial diversity (SSU1409-1491 directed, PM/MM).
Palka-Santini et al. BMC Microbiology 2009:
• 20 most prominent sepsis agents • 930 gene segments including virulence & resistance genes •detection limit: 104 genomes by LSpex pre-amplification with 800 primers in one reaction! • 0.02 µM each primer •Vent exo- DNA poly. (N.E. biolabs) •annealing: 55°C 45s •few genes not amplificated (increase primer conc selectively) •few cross-reactions
34 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Major Challenges & Solutions
specimen collection instruction & information of personnel low pathogen number filtration, concentration, amplification (on-chip, whole genome, LSplex) human competitor DNA selective isolation (Loxter, Molzym) of bacterial DNA only living cells RNA-dependent amplification, blocking of dead cell PCR by ethidium or propidium monoazide intercalation & crosslinking so many species… hierarchical sequences
Bacteroides melaninogenicus 1970 subspecies subspecies intermedius subspecies asaccharolyticus melaninogenicus B. asaccharolyticus B. melaninogenicus B. endodontalis 1977 B. denticola B. gingivalis B. intermedius B. loescheii B. corporis Prevotella P. disiens P. enoeca P. intermedia P. heparinolytica P. albensis P. marshii P. baroniae P. multiformis 2009 P. bivia P. multisaccachrivorax Porphyromonas P. buccae P. salivae P. buccalis P. shahii P. asaccharolytica P. cangingivalis P. brevis P. loescheii P. endodontalis P. cansulci P. bryantii P. tannerae P. oralis P. gingivalis P. catoniae P. corporis P. o r i s P. gulae P. crevioricanis P. nigrescens P. oulorum P. circumdentaria P. gingivicanis P. melaninigenica P. r u m i n i c o l a (P. salivosa) P. macacae P. denticola P. pallens P. canoris P. levii P. dentalis P. amnii P. somerae P. uenonis P. histicola P. bergensis P. nanceiensis P. copri P. paludivivens P. falsenii 40 years of research: make 55 out of 1! P. stercorea P. m a c u l o s a P. timonensis P. zoogleoformans P. veroralis
Lessons from Oral Microbiology: Periodontitis as an „Ecological disaster“ in Sulcus gingivae Healthy
Actinomyces odontolyticus Veillonella parvula Campylobacter concisius Streptococcus Capnocytophaga gingivalis gordonii Actinomyces viscosus Eikenella corrodens S. mitis
Fusobacterium nucleatum, ParvimonasGCF & micra, pH up Socransky, 1998 Prevotella intermedia, P. nigrescens,Eh downStreptococcus constellatus, Campylobacter gracilis, C. rectus, Eubacterium Marsh, 2003 nodatum,
Aggregatibacter Tannerella forsythensis actinomycetemcomitans Porphyromonas gingivalis Treponema denticola Aggressive Periodontitis
35 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
How can we monitor mixed anaerobic bacterial ecosystems by microarrays?
1. Sampling
Female, 36 y, loss of bone horizon. + vertical., BOP, inflammation
2. Transport to the laboratory
3. Isolation of DNA
4. PCR of 16S rDNA P.gingivalis P.gingivalis Cy5 Species II Species II
Species III Species III
Species IV Species IV Sample of e.g. subgingival 5. Hybridization
plaque Porphyromonas gingivalis catcher probe, position E8
6. Scan/Report
Heading with data of patient, site, Report clinical situation, laboratory
36 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Obstacles for accurate quantification
different lysis efficiency of gram-negative vers. gram-positive and aggregated vers. single cells. DeSantis: „Reproducible differences in microbial community composition were observed by altering the genomic DNA extraction method“ preferential amplification of different templates (non-)proportional diagnostic probe hybridization
Conclusion: accurate quantification seems to be still a “mission impossible” in chip formats
Polymicrobial infections: challenging
16S rDNA Conserved primer site
information
Getting „automated“
MicroSeq 500 (ABI): first sequencing kit for 527 bp of 16S rDNA Affirm™ VPIII (BD): the first direct specimen RNA probe-based diagnostic test for the differential detection and identification of the causative agents for vaginitis: Candida species, Gardnerella vaginalis and Trichomonas vaginalis BD ProbeTec (BD, e.g. MAX): RTQ-PCR for Chlamydia trachomatis (CT) and Neisseria gonorrhoeae SexTD-PCR-Kit (e.g. Bioneer): Detection of the most common causes of genital infections: HPV , Herpes simplex Virus Type 1 and 2 , Chlamydia trachomatis , Neisseria gonorrhoea and Treponema pallidum, Ureaplasma, Trichomonas etc. PLEX-ID (Abbott Molecular): DNA mass spectrometry
37 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
DNA analysis by Mass Spectronomy (Plex-Id, Abbott)
universal PCR for bacteria, viruses, protozoa, fungi
PCR products are analysed by mass spectronomy, amplicon mass profiles are checked with Ibis -Bioscience- database Strang 1b
Strang 1a
Ecker et al. 2008, Nature
4) Next-Generation Sequencing
New alternatives for Sanger method: pyro-, RDT, SBL
Voelkerdinger et al., 2009, Clinical Chemistry
454 FLX by Roche: Principles
DNA extraction Adaptors for beads and primer
One product per Pyro-Sequencing nano well
38 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
Ribosomal V6 tags pyrosequencing of coral reef microbes, Galdos et al. 2011 (Environm.Microbiology)
Direct amplification & sequencing in mixed Infections homepage: http://www.isentio.com/contentpages/Home.aspx
Two examples of mixed chromatograms, without (A) and with (B) displacement: these can be solved by uploading to INSENTIO: 20- 40 €/job, up to mix of three very reliable, 16S only.
Kommedal et al. JCM, 46, 2008
39 Conrads - Culture-independent Molecular Methods to investigate Flora Changes leading to mixed Anaerobic Infections
More Future: „Nanopore“-Sequencing
Fast & cost-efficient! One genome per night?
DNA
Branton et al. 2008, Nature
Acknowledgements
Hans-Peter Horz, PD, Dr. rer.nat.
Ilse Seyfarth: technical support
ESCMID Educational Workshop, London, March 2012
40 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
41 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
42 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
43 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
44 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
45 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
46 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
47 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
48 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
49 Nagy - Why to use MALDI-TOF for the identification of anaerobes?
50