Drug Development in Dengue Virus and Molecular Epidemiology of Malaria in Western
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Virus Research Frameshifting RNA Pseudoknots
Virus Research 139 (2009) 193–208 Contents lists available at ScienceDirect Virus Research journal homepage: www.elsevier.com/locate/virusres Frameshifting RNA pseudoknots: Structure and mechanism David P. Giedroc a,∗, Peter V. Cornish b,∗∗ a Department of Chemistry, Indiana University, 212 S. Hawthorne Drive, Bloomington, IN 47405-7102, USA b Department of Physics, University of Illinois at Urbana-Champaign, 1110 W. Green Street, Urbana, IL 61801-3080, USA article info abstract Article history: Programmed ribosomal frameshifting (PRF) is one of the multiple translational recoding processes that Available online 25 July 2008 fundamentally alters triplet decoding of the messenger RNA by the elongating ribosome. The ability of the ribosome to change translational reading frames in the −1 direction (−1 PRF) is employed by many Keywords: positive strand RNA viruses, including economically important plant viruses and many human pathogens, Pseudoknot such as retroviruses, e.g., HIV-1, and coronaviruses, e.g., the causative agent of severe acute respiratory Ribosomal recoding syndrome (SARS), in order to properly express their genomes. −1 PRF is programmed by a bipartite signal Frameshifting embedded in the mRNA and includes a heptanucleotide “slip site” over which the paused ribosome “backs Translational regulation HIV-1 up” by one nucleotide, and a downstream stimulatory element, either an RNA pseudoknot or a very stable Luteovirus RNA stem–loop. These two elements are separated by six to eight nucleotides, a distance that places the NMR solution structure 5 edge of the downstream stimulatory element in direct contact with the mRNA entry channel of the Cryo-electron microscopy 30S ribosomal subunit. The precise mechanism by which the downstream RNA stimulates −1 PRF by the translocating ribosome remains unclear. -
Transmissible Familial Creutzfeldt-Jakob Disease
Proc. Natl. Acad. Sci. USA Vol. 88, pp. 10926-10930, December 1991 Medical Sciences Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene (amyloid precursor protein/prion protein) LEV G. GOLDFARB*, PAUL BROWN*, W. RICHARD MCCOMBIEt, DMITRY GOLDGABERt, GARY D. SWERGOLD§, PETER R. WILLS¶, LARISA CERVENAKOVAII, HENRY BARON**, C. J. GIBBS, JR.*, AND D. CARLETON GAIDUSEK* *Laboratory of Central Nervous System Studies, and tSection of Receptor Biochemistry and Molecular Biology, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892; 4Department of Psychiatry, State University of New York, Stony Brook, NY; §Laboratory of Biochemistry, Division of Cancer Biology and Diagnosis, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; IDepartment of Physics, University of Auckland, New Zealand; Institute of Preventive and Clinical Medicine, Bratislava, Czechoslovakia; and **Searle Pharmaceuticals, Paris, France Contributed by D. Carleton Gajdusek, September 6, 1991 ABSTRACT The PRNP gene, encoding the amyloid pre- MATERIALS AND METHODS cursor protein that is involved in centrally Creutzfeldt-Jakob The Tested Population. A total of 535 individuals were disease (CJD), has an unstable region of five variant tandem screened for extra repeats in the PRNP gene: 117 patients octapeptide coding repeats between codons 51 and 91. We with spongiform encephalopathies (including 60 familial cas- screened a total of 535 individuals for the presence of extra es); 159 first-degree relatives ofpatients with familial spongi- repeats in this region, including patients with sporadic and form encephalopathies; 39 patients with other neurological familial forms ofspongiform encephalopathy, members oftheir diseases; 16 patients with non-neurological diseases; and 204 families, other neurological and non-neurological patients, and normal controls. -
Identification of the Binding Partners for Hspb2 and Cryab Reveals
Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity. -
A Yeast Phenomic Model for the Gene Interaction Network Modulating
Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1. -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
Supplement 1 Microarray Studies
EASE Categories Significantly Enriched in vs MG vs vs MGC4-2 Pt1-C vs C4-2 Pt1-C UP-Regulated Genes MG System Gene Category EASE Global MGRWV Pt1-N RWV Pt1-N Score FDR GO Molecular Extracellular matrix cellular construction 0.0008 0 110 genes up- Function Interpro EGF-like domain 0.0009 0 regulated GO Molecular Oxidoreductase activity\ acting on single dono 0.0015 0 Function GO Molecular Calcium ion binding 0.0018 0 Function Interpro Laminin-G domain 0.0025 0 GO Biological Process Cell Adhesion 0.0045 0 Interpro Collagen Triple helix repeat 0.0047 0 KEGG pathway Complement and coagulation cascades 0.0053 0 KEGG pathway Immune System – Homo sapiens 0.0053 0 Interpro Fibrillar collagen C-terminal domain 0.0062 0 Interpro Calcium-binding EGF-like domain 0.0077 0 GO Molecular Cell adhesion molecule activity 0.0105 0 Function EASE Categories Significantly Enriched in Down-Regulated Genes System Gene Category EASE Global Score FDR GO Biological Process Copper ion homeostasis 2.5E-09 0 Interpro Metallothionein 6.1E-08 0 Interpro Vertebrate metallothionein, Family 1 6.1E-08 0 GO Biological Process Transition metal ion homeostasis 8.5E-08 0 GO Biological Process Heavy metal sensitivity/resistance 1.9E-07 0 GO Biological Process Di-, tri-valent inorganic cation homeostasis 6.3E-07 0 GO Biological Process Metal ion homeostasis 6.3E-07 0 GO Biological Process Cation homeostasis 2.1E-06 0 GO Biological Process Cell ion homeostasis 2.1E-06 0 GO Biological Process Ion homeostasis 2.1E-06 0 GO Molecular Helicase activity 2.3E-06 0 Function GO Biological -
Co-Expression Module Analysis Reveals Biological Processes
Shi et al. BMC Systems Biology 2010, 4:74 http://www.biomedcentral.com/1752-0509/4/74 RESEARCH ARTICLE Open Access Co-expressionResearch article module analysis reveals biological processes, genomic gain, and regulatory mechanisms associated with breast cancer progression Zhiao Shi1,2, Catherine K Derow3 and Bing Zhang*3 Abstract Background: Gene expression signatures are typically identified by correlating gene expression patterns to a disease phenotype of interest. However, individual gene-based signatures usually suffer from low reproducibility and interpretability. Results: We have developed a novel algorithm Iterative Clique Enumeration (ICE) for identifying relatively independent maximal cliques as co-expression modules and a module-based approach to the analysis of gene expression data. Applying this approach on a public breast cancer dataset identified 19 modules whose expression levels were significantly correlated with tumor grade. The correlations were reproducible for 17 modules in an independent breast cancer dataset, and the reproducibility was considerably higher than that based on individual genes or modules identified by other algorithms. Sixteen out of the 17 modules showed significant enrichment in certain Gene Ontology (GO) categories. Specifically, modules related to cell proliferation and immune response were up-regulated in high- grade tumors while those related to cell adhesion was down-regulated. Further analyses showed that transcription factors NYFB, E2F1/E2F3, NRF1, and ELK1 were responsible for the up-regulation of the cell proliferation modules. IRF family and ETS family proteins were responsible for the up-regulation of the immune response modules. Moreover, inhibition of the PPARA signaling pathway may also play an important role in tumor progression. -
The Role of Cyclin B3 in Mammalian Meiosis
THE ROLE OF CYCLIN B3 IN MAMMALIAN MEIOSIS by Mehmet Erman Karasu A Dissertation Presented to the Faculty of the Louis V. Gerstner Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy New York, NY November, 2018 Scott Keeney, PhD Date Dissertation Mentor Copyright © Mehmet Erman Karasu 2018 DEDICATION I would like to dedicate this thesis to my parents, Mukaddes and Mustafa Karasu. I have been so lucky to have their support and unconditional love in this life. ii ABSTRACT Cyclins and cyclin dependent kinases (CDKs) lie at the center of the regulation of the cell cycle. Cyclins as regulatory partners of CDKs control the switch-like cell cycle transitions that orchestrate orderly duplication and segregation of genomes. Similar to somatic cell division, temporal regulation of cyclin-CDK activity is also important in meiosis, which is the specialized cell division that generates gametes for sexual production by halving the genome. Meiosis does so by carrying out one round of DNA replication followed by two successive divisions without another intervening phase of DNA replication. In budding yeast, cyclin-CDK activity has been shown to have a crucial role in meiotic events such as formation of meiotic double-strand breaks that initiate homologous recombination. Mammalian cells express numerous cyclins and CDKs, but how these proteins control meiosis remains poorly understood. Cyclin B3 was previously identified as germ cell specific, and its restricted expression pattern at the beginning of meiosis made it an interesting candidate to regulate meiotic events. -
Essential Genes and Their Role in Autism Spectrum Disorder
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality. -
S41467-020-18249-3.Pdf
ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible. -
Gene Section Review
Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1. -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.