bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 2 3 4 5 6 7 8 9 Bud13 Promotes a Type I Interferon Response by 10 Countering Intron Retention in Irf7 11 12 13 Luke S. Frankiw1,2, Devdoot Majumdar1,2, Christian Burns1, Logan Vlach1, Annie Moradian1, 14 Michael J. Sweredoski1, David Baltimore1,3* 15 16 1Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125, 17 USA 18 2These authors contributed equally 19 3Lead Contact 20 *Correspondence: [email protected] 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

53 SUMMARY 54 55 Intron retention (IR) has emerged as an important mechanism of gene expression control. Despite

56 this, the factors that control IR events remain poorly understood. We observed consistent IR in one

57 intron of the Irf7 gene and identified Bud13 as an RNA-binding protein that acts at this intron to

58 increase the amount of successful splicing. Deficiency in Bud13 led to increased IR, decreased

59 mature Irf7 transcript and protein levels, and consequently to a dampened type I interferon

60 response. This impairment of Irf7 production in Bud13-deficient cells compromised their ability to

61 withstand VSV infection. Global analysis of Bud13 knockdown and BUD13 cross-linking to RNA

62 revealed a subset of introns that share many characteristics with the one found in Irf7 and are

63 spliced in a Bud13-dependent manner. Deficiency of Bud13 led to decreased mature transcript from

64 genes containing such introns. Thus, by acting as an antagonist to IR, Bud13 facilitates the

65 expression of genes at which IR occurs.

66

67

68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93

2 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

94 INTRODUCTION 95 110 Three forms of alternative processing of a pre-mRNA have been described: differential

111 inclusion of an exon, alternative splice site selection, and intron retention (IR). The latter, IR, has

112 emerged as a previously underappreciated mechanism of post-transcriptional gene regulation.

113 Unlike the two alternative splicing events, IR rarely contributes to proteomic diversity.1 However, IR

114 events have the ability to act as negative regulators of gene expression by: (1) delaying onset of

115 gene expression by slowing down splicing kinetics, (2) increasing potential nuclear degradation by

116 nuclear exosomes, (3) increasing potential cytoplasmic degradation by nonsense mediated decay.2

117 Recent genomic studies suggest IR plays an important role in the regulation of gene

118 expression in a wide range of processes including cellular differentiation3,4 and tumorigenesis.5

119 Further, widespread IR throughout mouse and human cell and tissue types has led to the idea that

120 IR events act to functionally “tune” the transcriptome of a cell.6 However, with few exceptions, the

121 factors that control IR events and thus potentially shape gene expression programs of cells, remain

122 poorly understood.

123 Irf7 is an interferon-inducible master regulator of the type-I interferon-dependent immune

124 response and is crucial to the production of interferon- and .7 Aberrant Irf7 production is linked to

125 a wide range of pathologies, from life-threatening influenza8 to autoimmunity9, because precise

126 regulation of Irf7 ensures a proper immune response. Notably, intron 4 of Irf7 is short, GC-rich, and

127 has a poor splice donor sequence, characteristics shared by many poorly spliced introns. We and

128 others have previously shown that intron 4 of Irf7 splices inefficiently10, affecting gene expression

129 and opening a new line of inquiry as to the mechanism of IR regulation in Irf7.

130 Using RNA antisense purification-mass spectrometry (RAP-MS)11, we identified the protein

131 Bud13 as one that regulates IR in Irf7. Bud13 was found to aid splicing efficiency and expression of

132 the Irf7 mature transcript and protein, thus promoting the downstream type-I interferon-dependent

133 immune response. We show that Irf7 is able to trigger a robust interferon response in the presence

134 but not in the absence of Bud13. Further, Bud13 was found to increase the splicing efficiency of a

135 multitude of other junctions with similar characteristics to the one found in Irf7. By aiding in splicing

3 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

136 efficiency, Bud13 limits intron retention and increases gene expression levels of transcripts

137 containing Bud13 dependent junctions.

138

139 RESULTS 140 141 Irf7 contains an intron that splices poorly following stimulation. 142 143 To study the role of mRNA splicing during an innate immune response, we sequenced the

144 RNA from mouse bone marrow-derived macrophages (BMDMs) stimulated with either TNFα, IFNα,

145 or Poly(I:C). From this sequencing, we identified an increased number of intronic reads in the fourth

146 intron of the most abundant transcript of Irf7 (Fig. 1A). A variety of features of this intron make it a

147 likely candidate for retention.6 It is extremely small at 69 nucleotides and has a high G/C content in

148 both the flanking exons and within the intron itself (Fig. 1B-E). Furthermore, the intron contains a

149 ‘weak’ 5’ splice site, one that deviates significantly from a consensus splice site sequence. This is

150 quantified using a maximum entropy model to calculate the splice site quality score (Fig. 1F).12 This

151 retention is independent of time or stimulant (Fig. 1G, H).

152 To quantify the extent of retention across RNA-seq data-sets, we use a metric we designate

153 the “splicing ratio” (SR) (Fig. 1I; see methods), which is a length normalized ratio of intronic reads to

154 total reads at each junction. Low SR values indicate a junction is primarily spliced whereas high SR

155 values indicate a junction is primarily unspliced. Using this metric, we quantified the extent of

156 retention for all junctions in the most abundant Irf7 transcript. We observed that for all types of

157 stimulation, the retention of the fourth intron of the transcript is much greater than that seen for any

158 of the other introns (Fig. 1J and S1A, B). This intron remains poorly spliced despite the fact that

159 there is clear excision of neighboring introns. It is worth noting that quantitation of the IFNα

160 stimulation shows increased intronic signal throughout the Irf7 transcript. This increased intronic

161 signal is due to faster and stronger induction of Irf7 via stimulation with IFNα and as such, an

162 increase in the amount of pre-mRNA at a given stimulation time-point. Despite this increase in

163 intronic signal throughout the transcript, we observed a corresponding increase in the level of

4 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

164 retention for the poorly spliced fourth intron (Fig. 1J, S1B). Thus, we conclude this intron of Irf7

165 splices poorly following many forms of stimulation.

166

167 RAP-MS identifies Bud13 as an RNA binding protein that interacts with IRF7 mRNA. 168 169 To understand how cells handle a retained intron, we sought to identify trans-acting proteins

170 that might affect the process using RNA Antisense Purification followed by Mass Spectrometry (RAP-

171 MS) (Fig. 2A)11. RAP-MS employs antisense biotin-containing ssDNAs complementary to Irf7 exons

172 to purify the proteins associated with the total pool of Irf7 transcripts, containing both nascent pre-

173 mRNAs and mature mRNA. Using this proteomic approach, we identified the RNA-binding protein

174 Bud13 to be highly enriched (~6-fold) on Irf7 transcripts as compared to β-actin transcripts, which were

175 used as a control (Fig. 2B). Bud13 has been characterized in yeast as a member of the Retention

176 and Splicing complex (RES),13 forming a trimeric complex with Pml1p and Snu17p, and aids in the

177 splicing and nuclear retention of a subset of transcripts. It is not well characterized in mammalian

178 systems. We captured a variety of other known RNA-binding proteins (Pum2, Prpf40a, Son); however,

179 no other protein was enriched greater than two fold on Irf7 transcripts. We observed specificity in the

180 RNA antisense purification for the intended transcripts (Fig. 2C).

181 Following RAP-MS, we confirmed Bud13 enrichment on Irf7 transcripts by performing RNA

182 Immunoprecipitation (RIP) followed by qPCR. Using formaldehyde cross-linked, BMDMs stimulated

183 with TNFα for 30 minutes or Poly(I:C) for 12 hours, we observed >7-fold enrichment of Irf7 transcripts

184 associated with Bud13 immunoprecipitates as compared to Rabbit IgG control immunoprecipitates

185 (Fig. 2D, E). Of note, despite using two different stimuli, we find similar levels of enrichment. In

186 contrast, no differential enrichment of Rpl32 was observed. Thus, isolating the proteins associated

187 with Irf7 mRNA transcripts led to the identification of Bud13, and immunoprecipitation of Bud13 protein

188 confirmed enrichment of Irf7 mRNA.

189

190

191

5 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

192 Bud13 knockdown leads to increased retention in the weak Irf7 intron. 193 194 To determine whether the enrichment of Bud13 had an effect on Irf7 mRNA processing, we

195 used an shRNA approach to knockdown Bud13 protein levels in BMDMs (Fig. S2A, B). To quantify

196 differences in splicing between the shBud13 sample and the scrambled control sample, we calculated

197 the difference in the previously mentioned splicing ratio (SR) metric between shBud13 and control for

198 each junction at each time point. This resulting value was designated the ΔSR. A positive ΔSR

199 indicates a junction is more unspliced in the shBud13 sample while a negative ΔSR indicates a junction

200 is more unspliced in the control sample.

201 RNA-seq was performed on RNA from unstimulated BMDMs, as well as macrophages

202 stimulated with TNFα for 0, 30, 60, and 120 minutes. Bud13 knockdown led to a further increased

203 retention of the fourth intron in Irf7 (Fig. 3A – highlighted intron, S2C). Further, the sequencing

204 coverage plots showed little variation in splicing for the other seven introns in the transcript. This was

205 confirmed when splicing was quantified using the ΔSR metric (Fig. 3B). This splicing difference was

206 confirmed via RT-PCR (Fig. 3C). At all stimulation time-points, the ΔSR value for the fourth intron was

207 significantly greater than 0, indicating an increase in retention when Bud13 levels were reduced. There

208 is a significant difference in the ΔSR of intron 4 as compared to every other junction in the Irf7 transcript

209 (p<0.001, Student’s t-test). All other pairwise comparisons are insignificant. It appears that Bud13

210 plays a specific role of aiding in the excision of the poorly spliced junction but is not required for total

211 splicing of other introns in the transcript, at least as indicated by the partial knockdown with an shRNA.

212 We next looked at how this retention affected the induction kinetics of Irf7. We observed decreased

213 induction of Irf7 mRNA in response to TNFα stimulation in shBud13 BMDMs as compared to control

214 BMDMs (Fig. 3D), consistent with the idea that intron retention leads to transcript degradation.14 Other

215 TNFα induced transcripts that lacked a Bud13 dependent splicing defect showed similar induction

216 between the time-courses (Fig. S2 D-F).

217

218

219

6 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

220 Bud13 knockdown alters the type I interferon response. 221 222 Because Irf7 is known as a ‘master regulator’ for robust type I interferon production7, we next

223 investigated the effect of Bud13 knockdown on a type I interferon response. To do so, we stimulated

224 BMDMs with the TLR3 agonist Poly(I:C) for up to 24 hours. Activation of TLR3 leads to the production

225 of type I interferons followed by the downstream induction and activation of Irf7, which serves to

226 amplify the type I interferon response via positive feedback8. We again observed differential splicing

227 between the shBud13 samples and the control samples in intron 4 of Irf7 (Fig. 4A, S3A). As before,

228 there is a significant difference in the ΔSR of intron 4 as compared to every other junction in the Irf7

229 transcript (Fig. 4B. p<0.001, Student’s t-test), whereas all other pairwise comparisons are insignificant.

230 As is the case with TNFα, knocking down Bud13 altered Irf7 induction kinetics. Less Irf7 mRNA is

231 induced at 240, 720, and 1440mins of poly(I:C) stimulation (Fig. 4C). This reduction in Irf7 mRNA

232 leads to a decrease in the amount of Irf7 protein produced (Fig. 4D).

233 Next we looked at how this reduction in Irf7 would alter the production of RNA from interferon

234 signature genes (ISGs). Expression of 119 ISGs (selected based on upregulation in response to IFNα

15 235 ; see methods) was examined. In unstimulated BMDMs, used as a baseline, the median log2

236 expression fold change (FPKM shBud13/ FPKM control) is 0.1655 (Fig. 4D). In contrast, at 720 mins

237 of stimulation, the median log2 expression fold change shifts to -0.1007 (Fig. 4E), indicating a

238 significant decrease in ISG expression in the shBud13 sample compared to the control sample at this

239 time-point compared to the baseline (Wilcoxon rank-sum, P< .001). This significant decrease in ISG

240 expression remained true when comparing any of the ‘early’ time points (0, 15, 60 mins) to any of the

241 ‘late’ timepoints (240, 720, 1440 mins) (Fig. 4G, Wilcoxon rank-sum, P<0.001). qPCR was used to

242 monitor expression of both IFNα and IFN following 720 and 1440 mins of Poly(I:C) stimulation. We

243 observed significant reduction in both when comparing the shBud13 samples as to the control samples

244 (Fig. 4H, I). To ensure differential expression of ISGs was not due to splicing defects from Bud13

245 knockdown, we quantified the ΔSR for every ISG junction at 720 mins. The fourth intron of Irf7 has

246 the greatest ΔSR at 0.227. Only four other junctions of the 375 that were examined have ΔSRs greater

7 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

247 than 0.1, and the majority of junctions have ΔSRs close to 0 (Fig. S3C; mean = 0.002, median = 0).

248 Similar results were obtained when BMDMs were stimulated with the TLR9 agonist CpG (Figure S4).

249 Taken together, we conclude that Bud13 deficiency results in a highly compromised type I interferon

250 response.

251 We next examined whether Irf7 pre-mRNA with a retained fourth intron was able to exit the

252 nucleus and enter the cytoplasm. BMDMs were stimulated with poly(I:C) and fractionated into a

253 nuclear fraction (containing the nucleoplasm and chromatin) and a cytoplasmic fraction. RNA-seq

254 was performed on both fractions. In the cytoplasm, we found Irf7 mRNA to be completely spliced (Fig.

255 4J, K). Thus, unspliced Irf7 is either being degraded in the nucleus, or it makes it to the cytoplasm

256 and is degraded extremely quickly, such that virtually no signal can be detected via RNA-seq.

257 Furthermore, in support of our whole cell sequencing data and Irf7 immunoblots, we observed less

258 Irf7 mRNA in the cytoplasm in shBud13 samples as compared to control samples (Fig. 4L). In the

259 nucleus, although we notice a large number of unspliced reads at all junctions in both samples, the

260 fourth intron of Irf7 again showed a specific dependency on Bud13 (Fig. 4K, S5B). Finally, the fourth

261 intron had a greater RPKM in the nucleus in shBud13 compared to control BMDMs across the

262 stimulation time-course (Fig. 4K) and had a significantly greater nuclear ΔSR than any other junctions

263 in the transcript (Fig S5B).

264 Global analysis of the role of Bud13 in BMDMs.

265 We next investigated global splicing differences caused by Bud13 knockdown. Using the

266 TNFα stimulated data-set, ΔSR was calculated for every junction in every expressed gene. We

267 found that a number of other transcripts had a Bud13 dependent junction (Fig. 5A). Of note, the

268 fourth intron of Irf7 is among the most Bud13 dependent junctions in both the TNFα and Poly(I:C)

269 data-sets (Fig. 5A., Fig. S6H, see methods for analysis details). Similar to the case with Irf7, almost

270 all transcripts contain only a single Bud13 dependent junction, even when low thresholds are used to

271 quantify dependency (Fig. 5B). To determine whether splicing differences caused by Bud13

272 knockdown led to altered gene expression, we compared the effect of the Bud13 knockdown on

8 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

273 genes that contained a Bud13 dependent junction to those that did not. (see methods). The median

274 log2 expression fold change (FPKM shBud13/ FPKM control) for genes containing a Bud13

275 dependent junction was -0.5084. In contrast, the median log2 expression fold change (FPKM

276 shBud13/ FPKM control) for genes without any junctions affected by Bud13 knockdown was -0.2170.

277 Thus, we conclude there is an inverse relationship between IR due to Bud13 knockdown and gene

278 expression (Wilcoxon rank-sum, P< .01) (Fig. 5C).

279 Next, it was of interest to us to identify sequence elements that led Bud13 to have its specific

280 splicing effect. The most evident element to explore was the effect of splice site strength on Bud13-

281 dependent splicing. Previous work has shown that the yeast orthologue of Bud13 plays a role in

282 efficient splicing for a junction with a weak 5’ splice site13. Further, the junction affected in Irf7 has a

283 non-consensus 5’ splice site. To investigate this issue, we first quantified every 5’ and 3’ splice site

284 using a maximum entropy model.12 Then, we took progressively weaker splice site thresholds, and

285 compared the mean ΔSR for every junction below that threshold to the mean ΔSR of every junction in

286 the data-set (Fig. 5D). We saw that as the splice site threshold for the 5’ splice site became

287 progressively weaker, the mean ΔSR for junctions weaker than that threshold increased and thus

288 there was a greater Bud13 splicing effect. This result was not seen when the same analysis was

289 applied to the 3’ splice site. In support of a 5’ splice site dependency for a Bud13 effect, we noticed

290 differences in the 5’ splice site motif of Bud13 dependent junctions as compared to to all expressed

291 junctions (Fig. 5E).

292 We then analyzed the Bud13 splicing effect with respect to other features known to correlate

293 with IR.6 Across all time-points for both TNFα (Fig. 5F-H) and Poly(I:C) (Fig. S7 A-C), Bud13

294 dependent introns were dramatically smaller and had increased G/C content in both the intron and in

295 the flanking exons. We also noticed that the distance from the branch point to the 3’ splice site was

296 smaller in the Bud13 dependent introns than in the total data-set (Fig. 5I, Fig. S7D). This could be a

297 byproduct of the smaller intron length; however, it is of interest because Bud13 has been shown in

298 yeast to bind just downstream of the branch point.16 A significant difference was not seen in branch

299 point strength and Bud13 splicing effect (Fig. S7 E, F). As IR is only one form of alternative splicing,

9 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

300 we also looked at whether other forms of alternative splicing were affected by Bud13 knockdown. We

301 found that the most statistically significant number of alternative splicing events were IR events (Fig.

302 S7G, see methods). There were three-times as many IR events as the next most alternative splicing

303 event. IR at intron 4 in Irf7 was the only alternative splicing event that occurred in transcripts related

304 to the type I interferon response.

305 eCLIP shows enrichment on Bud13 dependent junctions near the 3’ splice site.

306 Next we used enhanced crosslinking and immunopreciptation (eCLIP)-seq data from the

307 ENCODE Project Consortium17 to investigate Bud13 binding specificity across the genome. We

308 found that in K562 and Hep G2 cells, the majority of Bud13 eCLIP-sequencing reads were located

309 downstream of the branchpoint near the 3’ splice site (Fig. 6A, B), consistent with what is seen in

310 yeast.16 Plots are shown as a measure of binding over input. There is some read density near the

311 5’ splice site, which we hypothesize is due to Bud13’s association with the spliceosome. Although it

312 may not bind near the 5’ splice site, factors in the spliceosome that interact with Bud13 may

313 immunoprecipitate with Bud13, leading to 5’ signal. Data for Sf3b4 and Prpf8, known RBPs that

314 interact with the 3’ and 5’ splice site respectively, is also shown for comparison (Fig. 6A, B). We

315 hypothesized that Bud13 binding would correlate with Bud13 activity. To test this hypothesis, we

316 used knockdown data from the ENCODE Project Consortium to determine Bud13 dependent

317 junctions in K562 and Hep G2 cells. In K562 cells, we noticed that there was a significant increase

318 in Bud13 binding over input at Bud13 dependent junctions (Fig. 6A). In Hep G2 cells, this increase

319 was less pronounced (Fig. 6B), however, we note that we found Bud13 knockdown had a much

320 greater impact in K562 cells as compared to Hep G2 cells (Fig. S8A). In order to survey a large

321 enough selection of junctions in Hep G2’s, we had to significantly lower our threshold for what was

322 deemed a Bud13 dependent junction (see methods), which in turn might explain the dampened

323 Bud13 binding/activity relationship in Hep G2. We conclude that Bud13 either preferentially

324 associates with these Bud13 dependent junctions or associates with them for a longer period of

325 time,.

10 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

326 We next performed peak calling to determine the location of significant peaks. We find the

327 majority of peaks are in intronic regions or intron-exon junctions and that most of the peaks that lie in

328 intron-exon junction are located at the 3’ junction (Fig. 6C, D). As might be expected from

329 knockdown data, when comparing introns that have an overlapping eCLIP peak to all introns from

330 expressed transcripts, we see both a length and G/C% bias (Fig. 6E, F). Bud13 peaks tend to fall in

331 smaller introns that are GC rich, a finding consistent with the ΔSR data. Lastly, a list of the GO

332 biological processes most enriched from the list of peaks in K562 and Hep G2 cells is shown (Fig.

333 6G).

334

335 Bud13 knockdown alters the BMDM response to VSV.

336 Vesicular stomatitis virus (VSV) is a (-)ssRNA virus known to induce type I IFN through

337 TLR718. To test whether impairment of Irf7 due to Bud13 knockdown was present in VSV stimulated

338 BMDMs, we infected both shBud13 and control BMDMs at an MOI of 5 and 10. At all time-points

339 throughout infection in both MOIs, there was dampened Irf7 induction (Fig. 7A, B) as quantified by

340 Taqman qPCR. Next, in order to determine the consequences of impaired Irf7 induction, we

341 determined the yield of virus from BMDMs following a period of infection with a given input MOI.

342 shBud13 BMDMs produce significantly more VSV as compared to control BMDMs (Fig. 7C). This

343 difference in viral production is presumably due to decreased production of Irf7 and the

344 corresponding dampened type I interferon response. To test if a mechanism other than Irf7 intron

345 retention may contribute to the impaired response to viral infection, we rescued Irf7 levels by

346 expressing Irf7 cDNA either in the context of the Bud13 knockdown or the control. We found

347 overexpression of Irf7 cDNA effectively rescues the ability for a cell to clear virus (Fig. 7C). As such,

348 we conclude that the viral susceptibility associated with Bud13 knockdown is due to the increased

349 intron retention in the fourth intron of Irf7 and the corresponding dampened type I interferon

350 response.

351 352 353

11 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

354 DISCUSSION 355 356 In this study, we sought proteins that might relate to the poor splicing of an intron in Irf7

357 transcripts. Using RAP-MS, we identified Bud13 as a protein that has the ability to increase splicing

358 of the Irf7 intron. In the absence of Bud13, in response to inflammatory stimulus, macrophages

359 produced Irf7 with increased intron retention (IR) and notably less mature Irf7 transcript and protein

360 (Fig. 3C, 4C, 4D, S4C). Irf7 is the interferon-inducible master regulator of the type-I interferon-

361 dependent immune response.7 Correspondingly, depletion of Bud13 led to a general reduction in

362 ISG and cytokine production, implying a compromised type I interferon response (Fig. 4E-J, S4D-G).

363 This splicing and corresponding expression defect upon Bud13 depletion was observed under

364 various stimulation regimens and times. We found that macrophages deficient for Bud13 were

365 strikingly more susceptible to infection by VSV, presumably owing to the reduction in Irf7 transcript

366 levels (Fig. 7).

367 We observed the Bud13 splicing dependence in other introns of other genes. A number of

368 short, GC-rich introns with non-consensus splice donor sites were excised inefficiently when Bud13

369 levels were depleted (Fig. 5). As was the case with Irf7, this increased IR reduced mature transcript

370 levels (Fig. 5A). Transcripts containing retained introns have been shown in the literature to be

371 degraded by two mechanisms: (1) nuclear degradation via the RNA exosome, (2) cytoplasmic

372 degradation upon detection of a pre-termination codon (PTC) via the NMD decay machinery.

373 Although the majority of these introns contain a PTC, it remains to be determined whether

374 degradation is occurring in the nucleus or cytoplasm.14,19

375 Bud13 was originally identified as a part of a “Retention and Splicing” (RES) complex13 in

376 yeast. However, yeast Bud13 (ScBud13) and mammalian Bud13 are significantly different lengths

377 (266 vs. 637 amino acids) 20, with only the mammalian protein containing a large, disordered

378 arginine-rich N-terminal domain. ScBud13 counteracts IR in introns within the mediator complex,

379 mating genes, and tRNA modifying genes21–23, which in turn impair yeast budding. In connection

380 with the RES complex, ScBud13 is thought to safeguard formation of the ‘Bact complex’ of the

24 act 381 spliceosome. In the B stage, the 5’ splice donor and branch point are recognized by the

12 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

382 spliceosome. However, progression to catalysis of the first step of the splicing reaction requires

383 remodeling of several spliceosome components.25 Lack of the RES complex has been shown to lead

384 to premature binding of Prp2, a quality control factor that is responsible for spliceosome remodeling

385 as well as the disassembly of suboptimal substrates. It has been hypothesized that ScBud13 and

386 the RES complex temporally regulate Prp2 binding.24 In the mammalian context, short, GC-rich

387 introns with weak donor sites may be particularly susceptible to Prp2-mediated disassembly, which

388 may explain the specificity of IR events upon Bud13 depletion.

389 In yeast, differential studies using mass spectrometry26 and cross-linking have established

390 that some ScBud13 is detectable in preparations of stalled B, Bact, and B* complexes. One cryo-EM

391 structure of the yeast spliceosome found density corresponding to ScBud13 in a stalled Bact pre-

392 catalytic complex, although a structure of the stalled B complex found only weak density for

393 ScBud13.21,27 In mammals, structural evidence of Bud13 is limited. Given the partial sequence

394 homology between all members of the yeast RES complex and their mammalian counterparts, it is

395 not surprising that Bud13 (and other RES complex members) are often undetectable in preparations

396 of stalled spliceosomes using cross-linking and mass-spectrometry. Furthermore, Bud13 was not

397 detected in a recent human cryo-EM structure of a stalled B complex.28 Taken together, it is not yet

398 possible to determine if the sub-stoichiometric nature of Bud13 in mammalian spliceosome

399 complexes is because it is constitutively associated but highly transient or because it serves as a

400 non-essential accessory to spliceosome function. Cryo-EM studies, as well as single molecule

401 studies, would seem to suggest compositional heterogeneity of the spliceosome, and that the

402 Bud13-endowed spliceosome may catalyze the splicing reaction in a fundamentally different way

403 than is used in its absence.24,29,30

404 Recently, the RES complex in zebrafish was shown to regulate levels of IR in short, GC-rich

405 introns in knockout studies.31 Indeed, both in Zebrafish31 and C. Elegans,32 deficiency of RES

406 components has been reported to lead to embryonic lethality. Our results show that mammalian

407 Bud13 shares this splicing fidelity function, and deficiency may prevent proper development. Despite

408 this, knockdown and knock-out cell lines have displayed no overt growth defects, suggesting a

13 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

409 developmental but not immune-cell intrinsic dependence on Bud13 for survival. Of note, we did

410 sequence knockdowns of the other RES components, Rbmx2 and Snip1 (Fig. S11). We see a very

411 mild effect on the fourth intron of Irf7, and although the fourth intron is the most affected in both

412 cases as measured by ΔSR, it lacks statistical significance when compared to other introns in the

413 transcript. Further, we find very mild global IR when compared to the IR induced by Bud13

414 knockdown. We do not believe our data disputes what is shown in other organisms, but instead feel

415 that either more efficient knockdowns or a total knockout would be needed to replicate the strong

416 effect seen with Bud13 depletion.

417 With respect to Irf7, the fact that a crucial immunological gene has such an intron, with its

418 variety of seemingly negative characteristics that make it difficult for the spliceosome to excise, begs

419 the question as to why it exists. At the heart of an inflammatory response is a tightly regulated gene

420 expression program. Regulation of this gene expression program is crucial as small changes can

421 shift the balance away from protective immunity towards either nonexistent or destructive

422 immunity.33 Here we’ve shown that alterations to the splicing efficiency of the fourth intron have the

423 ability to significantly alter the functional output of Irf7. Thus, by existing in the Irf7 transcript and

424 commonly being retained, it stands to reason the weak fourth intron acts to dampen Irf7 output,

425 perhaps as a means to mitigate what otherwise would be an unchecked or inappropriately scaled

426 response. Whether a cell actively controls this splicing event and thus, the intron serves as a

427 regulatory control point, remains unknown. Further, it remains unknown whether Bud13 plays a role

428 in this regulation or whether it simply represents a mechanism that evolved to counter intron

429 retention in a subset of introns that require splicing but happen to be inherently weak.

430 In summary, we found that Bud13 modulates gene expression through its ability to alter IR,

431 often in notably small, GC-rich introns with weak splice sites. Deficiency of Bud13 results in IR and

432 concomitant decreased gene expression in transcripts such as Irf7, dampening the type I interferon

433 response and increasing viral susceptibility. Therefore Bud13, in mediating Irf7 gene expression,

434 presents a potential therapeutic target for the treatment of infections or autoimmune conditions.

435 Future studies should seek to understand why Bud13 is vital for the efficient splicing of only a subset

14 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

436 of junctions and whether or not this junction specificity plays an active role in regulating gene

437 expression. If modulated, this strategy by which components associated with the spliceosome

438 rescue transcripts from intron retention and degradation may represent a previously

439 underappreciated layer of regulation in many gene expression programs.

440

441 ACKNOWLEDGEMENTS 442 443 The authors would like to thank Mario Blanco and Mitchell Guttman (Dept. of Biology, Caltech) for 444 assistance with eCLIP analysis; Patricia Turpin, Mati Mann, Guideng Li, and Alok Joglekar (Dept. of 445 Biology, California Institute of Technology) for experimental and computational assistance. 446 Additionally, the authors would like to thank Genhong Cheng (Department of Microbiology, 447 Immunology & Molecular Genetics, UCLA) for VSV and Jae Jung (Department of Molecular 448 Microbiology & Immunology, USC) for VSV-GFP. This work was funded from a grant from NIH 449 (5R21AI126344) and from an endowment provided by the Raymond and Beverly Sackler 450 Foundation. 451 452 AUTHOR CONTRIBUTIONS 453 454 L.S.F, D.M., and D.B., conceived and designed experiments. L.S.F. conducted experiments. C.B. 455 helped develop RAP-MS and knockdown experiments. L.S.F. and D.M. analyzed sequencing data. 456 A.M. oversaw mass spectrometry and M.J.S. performed mass spectrometry analysis. L.S.F, D.M., 457 and D.B wrote the manuscript with input from all authors. 458

459

460

461

462

463

464

465

466

467

468

469

470

471

15 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

472 References: 473 474 1. Schmitz, U. et al. Intron retention enhances gene regulatory complexity in vertebrates.

475 Genome Biol. 18, 216 (2017).

476 2. Wong, J. J.-L., Au, A. Y., Ritchie, W. & Rasko, J. E. Intron retention in mRNA: No longer

477 nonsense. Bioessays 38, 41–49 (2016).

478 3. Wong, J. J.-L. et al. Orchestrated intron retention regulates normal granulocyte

479 differentiation. Cell 154, 583–595 (2013).

480 4. Yap, K., Lim, Z. Q., Khandelia, P., Friedman, B. & Makeyev, E. V. Coordinated regulation

481 of neuronal mRNA steady-state levels through developmentally controlled intron retention.

482 Genes Dev. 26, 1209–1223 (2012).

483 5. Dvinge, H. & Bradley, R. K. Widespread intron retention diversifies most cancer

484 transcriptomes. Genome Med. 7, 45 (2015).

485 6. Braunschweig, U. et al. Widespread intron retention in mammals functionally tunes

486 transcriptomes. Genome Res. 24, 1774–1786 (2014).

487 7. Honda, K. et al. IRF-7 is the master regulator of type-I interferon-dependent immune

488 responses. Nature 434, 772–777 (2005).

489 8. Ciancanelli, M. J. et al. Life-threatening influenza and impaired interferon amplification in

490 human IRF7 deficiency. Science 348, 448–453 (2015).

491 9. Harley, J. B. et al. Genome-wide association scan in women with systemic lupus

492 erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci.

493 Nat. Genet. 40, 204 (2008).

494 10. Shalek, A. K. et al. Single-cell transcriptomics reveals bimodality in expression and splicing

495 in immune cells. Nature 498, 236 (2013).

16 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

496 11. McHugh, C. A. et al. The Xist lncRNA interacts directly with SHARP to silence

497 transcription through HDAC3. Nature 521, 232–236 (2015).

498 12. Yeo, G. & Burge, C. B. Maximum entropy modeling of short sequence motifs with

499 applications to RNA splicing signals. J. Comput. Biol. 11, 377–394 (2004).

500 13. Dziembowski, A. et al. Proteomic analysis identifies a new complex required for nuclear

501 pre-mRNA retention and splicing. EMBO J. 23, 4847–4856 (2004).

502 14. Jacob, A. G. & Smith, C. W. Intron retention as a component of regulated gene expression

503 programs. Hum. Genet. 1–15 (2017).

504 15. Mostafavi, S. et al. Parsing the interferon transcriptional network and its disease

505 associations. Cell 164, 564–578 (2016).

506 16. Schneider, C. et al. Dynamic Contacts of U2, RES, Cwc25, Prp8 and Prp45 Proteins with the

507 Pre-mRNA Branch-Site and 3’ Splice Site during Catalytic Activation and Step 1 Catalysis

508 in Yeast Spliceosomes. PLOS Genet. 11, e1005539 (2015).

509 17. Consortium, E. P. An integrated encyclopedia of DNA elements in the human genome.

510 Nature 489, 57–74 (2012).

511 18. Lund, J. M. et al. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc.

512 Natl. Acad. Sci. U. S. A. 101, 5598–5603 (2004).

513 19. Sayani, S. & Chanfreau, G. F. Sequential RNA degradation pathways provide a fail-safe

514 mechanism to limit the accumulation of unspliced transcripts in Saccharomyces cerevisiae.

515 Rna 18, 1563–1572 (2012).

516 20. Na, I., Meng, F., Kurgan, L. & Uversky, V. N. Autophagy-related intrinsically disordered

517 proteins in intra-nuclear compartments. Mol. Biosyst. 12, 2798–2817 (2016).

17 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

518 21. Zhou, Y. & Johansson, M. J. The pre-mRNA retention and splicing complex controls

519 expression of the Mediator subunit Med20. RNA Biol. 1–7 (2017).

520 22. Zhou, Y., Chen, C. & Johansson, M. J. The pre-mRNA retention and splicing complex

521 controls tRNA maturation by promoting TAN1 expression. Nucleic Acids Res. 41, 5669–

522 5678 (2013).

523 23. Ni, L. & Snyder, M. A Genomic Study of the Bipolar Bud Site Selection Pattern

524 inSaccharomyces cerevisiae. Mol. Biol. Cell 12, 2147–2170 (2001).

525 24. Bao, P., Will, C. L., Urlaub, H., Boon, K.-L. & Lührmann, R. The RES complex is required

526 for efficient transformation of the precatalytic B spliceosome into an activated Bact complex.

527 Genes Dev. (2018).

528 25. Ohrt, T. et al. Prp2-mediated protein rearrangements at the catalytic core of the spliceosome

529 as revealed by dcFCCS. RNA 18, 1244–1256 (2012).

530 26. Fabrizio, P. et al. The evolutionarily conserved core design of the catalytic activation step of

531 the yeast spliceosome. Mol. Cell 36, 593–608 (2009).

532 27. Plaschka, C., Lin, P.-C. & Nagai, K. Structure of a pre-catalytic spliceosome. Nature 546,

533 617 (2017).

534 28. Bertram, K. et al. Cryo-EM structure of a pre-catalytic human spliceosome primed for

535 activation. Cell 170, 701–713 (2017).

536 29. Blanco, M. R. et al. Single Molecule Cluster Analysis dissects splicing pathway

537 conformational dynamics. Nat. Methods 12, 1077 (2015).

538 30. Hoskins, A. A. & Moore, M. J. The spliceosome: a flexible, reversible macromolecular

539 machine. Trends Biochem. Sci. 37, 179–188 (2012).

18 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

540 31. Fernandez, J. P. et al. RES complex is associated with intron definition and required for

541 zebrafish early embryogenesis. PLoS Genet. 14, e1007473 (2018).

542 32. Jiang, M. et al. Genome-wide analysis of developmental and sex-regulated gene expression

543 profiles in Caenorhabditis elegans. Proc. Natl. Acad. Sci. 98, 218–223 (2001).

544 33. Kontoyiannis, D., Pasparakis, M., Pizarro, T. T., Cominelli, F. & Kollias, G. Impaired on/off

545 regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint

546 and gut-associated immunopathologies. Immunity 10, 387–398 (1999).

547 34. Liu, J. M., Sweredoski, M. J. & Hess, S. Improved 6-Plex Tandem Mass Tags Quantification

548 Throughput Using a Linear Ion Trap–High-Energy Collision Induced Dissociation MS3

549 Scan. Anal. Chem. 88, 7471–7475 (2016).

550 35. Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions,

551 deletions and gene fusions. Genome Biol. 14, R36 (2013).

552 36. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated

553 transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515

554 (2010).

555 37. Anders, S., Pyl, P. T. & Huber, W. HTSeq—a Python framework to work with high-

556 throughput sequencing data. Bioinformatics 31, 166–169 (2015).

557 38. Shen, S. et al. rMATS: robust and flexible detection of differential alternative splicing from

558 replicate RNA-Seq data. Proc. Natl. Acad. Sci. 111, E5593–E5601 (2014).

559 39. Corvelo, A., Hallegger, M., Smith, C. W. & Eyras, E. Genome-wide association between

560 branch point properties and alternative splicing. PLoS Comput. Biol. 6, e1001016 (2010).

561 40. Van Nostrand, E. L. et al. Robust transcriptome-wide discovery of RNA-binding protein

562 binding sites with enhanced CLIP (eCLIP). Nat. Methods 13, 508–514 (2016).

19 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

563 41. Shen, L., Shao, N., Liu, X. & Nestler, E. ngs. plot: Quick mining and visualization of next-

564 generation sequencing data by integrating genomic databases. BMC Genomics 15, 284

565 (2014).

566 42. Lovci, M. T. et al. Rbfox proteins regulate alternative mRNA splicing through evolutionarily

567 conserved RNA bridges. Nat. Struct. Mol. Biol. 20, 1434–1442 (2013).

568 43. Budak, G., Srivastava, R. & Janga, S. C. Seten: a tool for systematic identification and

569 comparison of processes, phenotypes, and diseases associated with RNA-binding proteins

570 from condition-specific CLIP-seq profiles. RNA 23, 836–846 (2017).

571

572

573

574

575

576

577

578

579

580

581

582

583

584

585

586

587

588

20 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

589 FIGURE LEGENDS

590 Figure 1: Irf7 contains a weak intron that is following many forms of stimulation. (A) Histogram of 591 mapped reads corresponding to the TNFα-induced expression of Irf7. The poorly spliced fourth intron is 592 highlighted. For all read density plots, reads are histogrammed in log10 scale and normalized to the 593 maximum value across the stimulation. (B) Comparison of Irf7 splice donor and acceptor sites in mice, 594 rats, and humans. (C-F) Histogram representing the intron length (C), intron GC content (D), flanking 595 exon GC content (E), or 5’ splice site strength of introns of expressed in BMDMs. Red represents 596 location of Irf7 intron 4 (C, D, F) or upstream exon (E). Black line represents downstream exon (E). (G, H) 597 Histogram of mapped reads corresponding to the IFNα (G) and poly(I:C) (H) induced expression of Irf7 598 focused on the slow splicing fourth intron. (I) Outline of Splicing Ratio (SR) metric. (J) Splicing ratio for all 599 introns in Irf7 plotted against time stimulated with TNFα. 600 601 Figure 2: RAP-MS and RIP identifies Bud13 as an RNA binding protein that interacts with IRF7 602 mRNA. (A) Outline of the RAP-MS procedure used to identify RNA-binding proteins on transcritps of 603 interest. (B) TMT ratio (Irf7/Actb) for proteins identified as enriched on either Irf7 (TMT ratio >1) or Actb 604 (TMT ratio <1) transcripts. (C) RT-qPCR analysis of transcripts captured via RAP for Irf7 (blue) and Actb 605 (gold) probes. (D) RIP followed by RT-qPCR for Irf7 and Rpl32 in TNFα stimulated BMDMs. Shown is 606 the relative enrichment of transcripts captured in Bud13 RIP as compared to Rabbit IgG RIP. (E) Same as 607 (d) except stimulation with poly(I:C). Data are representative of two independent experiments ((C-E), 608 mean + SEM). *P < 0.05, **P < 0.01 and ***P < 0.001 (t-test). 609 610 Figure 3: Bud13 knockdown leads to increased retention in the poorly splicing intron of Irf7. (A) 611 Histogram of mapped reads corresponding to the TNFα-induced expression of Irf7. The poorly spliced 612 fourth intron is highlighted. shBud13 samples are shown in green. Control samples are shown in grey. 613 (B) ΔSRs calculated for each junction in the Irf7 transcript. The ΔSR of intron 4 as compared to all other 614 junctions is significant (Student’s t-test, p<0.001). No other pairwise comparison is significant. (C) 615 Splicing gel from RNA extracted from BMDMS stimulated for 30 mins. TNFα (top). Quantification of 616 splicing gel (bottom). (D) Irf7 FPKM fold change with respect to time stimulated. shBud13 is shown in 617 green, control is shown in grey. Data is representative of two independent experiments (C) and is 618 represented as mean + SEM. * denotes p < 0.05, ** denotes p < 0.01, and *** denotes p < 0.001 using a 619 Student’s t test.

620 Figure 4: Bud13 knockdown alters the type I interferon response. (A) Histogram of mapped reads 621 corresponding to the TNFα-induced expression of Irf7. The poorly spliced fourth intron is highlighted. 622 shBud13 samples are shown in blue. Control samples are shown in grey. (B) ΔSRs calculated for each 623 junction in the Irf7 transcript. The ΔSR of intron 4 as compared to all other junctions is significant 624 (Student’s t-test, p<0.001). No other pairwise comparison is significant. (C) Irf7 FPKM fold change with 625 respect to time stimulated. shBud13 is shown in blue, control is shown in grey. (D) Immunoblot analysis 626 of Irf7 protein following 720 mins. poly(I:C) stimulation (left). Quantification relative to ActB (right). (E) 627 Log2 expression fold change (shBud13/control) for 119 ISGs in unstimulated BMDMs (median = 0.1655). 628 (F) As in (E) for stimulated BMDMs (720 mins poly(I:C) (median = -0.1007). Wilcoxon rank-sum between 629 (E) and (F), P< .001. (G) Median log2 expression fold change (shBud13/control) for ISGs in unstimulated 630 BMDMs, and BMDMs stimulated with Poly(I:C) 15, 60, 240, 720, and 1440 mins. Bars represent 95% CI. 631 (Wilcoxon rank-sum, P< .001, for any of the ‘early’ time-points (0, 15, 60 mins) compared to any of the 632 ‘late’ time-points (240, 720, 1440 mins). (H) RT-qPCR analysis of IFNα mRNA levels in unstimulated 633 BMDMs and BMDMs stimulated with poly(I:C) for 720 mins and 1440 mins. (I) Same as (H) for IFNβ. (J) 634 Nuclear fraction (top) and cytoplasmic fraction (bottom) histograms of mapped reads corresponding to the 635 poly(I:C)-induced expression of Irf7 (720 mins). The poorly spliced fourth intron is highlighted. shBud13 636 samples are shown in blue. Control samples are shown in grey. Nuclear ΔSR = 0.35. (K) Nuclear and 637 cytoplasmic RPKM for Irf7 intron 4 from fractionated BMDMs stimulated with poly(I:C). (L) Cytoplasmic 638 Irf7 FPKM for control (grey) and shBud13 BMDMs stimulated with poly(I:C). Data is representative of four 639 independent experiments (H, I) and is represented as mean + SEM. * denotes p < 0.05, ** denotes p < 640 0.01, and *** denotes p < 0.001 using a Student’s t test. Results are presented relative to those of Rpl32 641 (H,I).

21 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

642 Figure 5: Global analysis of the role of Bud13. (A) Ranked bar chart showing genes with a junction most 643 affected by Bud13 knock-down in all samples during TNFα stimulation. See S7 for histograms relating to 644 most affected junctions. (B) Grouped bar chart depicting the number of genes that have a single Bud13 645 affected junction vs. multiple Bud13 affected junctions using three different ΔSR thresholds. (C) 646 Transcripts were classified as ‘Bud13 dependent’ if they had a junction with a ΔSR. >0.15. The log2 647 expression fold change (FPKM shBud13/ FPKM control) for each gene represented by the transcripts in 648 the ‘Bud13 dependent’ category as well as all other genes is shown. Median ‘increased IR’ = -0.5084. 649 Median ‘decreased IR’ = -0.2170. (Wilcoxon rank-sum, P< .01). (D) Mean ΔSR. for junctions below the 650 indicated threshold (x-axis) vs. mean ΔSR. for all junctions. Threshold applied for the 5’ splice site (blue) 651 and the 3’ splice site (green). (E) 5’SS motif for all expressed junctions as compared to junctions that show 652 retention upon Bud13 knockdown (ΔSR. > 0.15). (F) Size of intron for introns retained upon Bud13 653 knockdown (ΔSR. > 0.15) (blue), in introns located in the same transcript as those affected by Bud13 654 (green), and in introns from all expressed transcripts (orange). (G) Same as (F) for GC content. (H) 655 Flanking exon GC content for exons that flank introns retained upon Bud13 knockdown (ΔSR. > 0.15) 656 (dark green) as compared to exons that flank introns from all expressed transcripts (light green). (I) 657 Distance from the branch point to the 3’ splice site for introns retained upon Bud13 knockdown (ΔSR. > 658 0.15) (dark blue) as compared to introns from all expressed transcripts (light blue). (F-I) data from BMDM 659 TNFα stimulation. Box plots show median (center line), interquartile range (box) and tenth and ninetieth 660 percentiles. *P < 0.05, **P < 0.01 and ***P < 0.001 (Mann-Whitney U-test). 661 Figure 6: Bud13 interacts primarily near the 3’ splice site of small, GC rich introns. (A) eCLIP-seq 662 read density plots in K562 cells. Bud13 density plot over all expressed junctions shown in blue (top), 663 Bud13 density plot over Bud13 dependent junctions shown in red (top). Sf3b4 density plot over all 664 expressed junctions shown in maroon (middle), and Prpf8 density plot over all expressed junctions is 665 shown in green (bottom). (B) Same as in (A) but for Hep G2 cells. (C) Bud13 eCLIP-seq peak 666 distribution. Peaks fell within either intronic regions, intron-exon junctions, or exonic regions. Peaks that 667 fell within intron-exon junction were further classified as 5’ junction peaks or 3’ junction peaks (bottom). 668 (D) Same as (C) but for Hep G2. (E) Size of all introns in expressed transcripts for the given cell line 669 (dark blue) vs size of introns with overlapping eCLIP peak (maroon). Shown in K562 (left) and Hep G2 670 (right) cells. Box plots show median (center line), interquartile range (box) and tenth and ninetieth 671 percentiles (whiskers). *P < 0.05, **P < 0.01 and ***P < 0.001 (Mann-Whitney U-test). (F) Same as (E) 672 for GC content. (G) GO terms (biological process) enriched among Bud13 eCLIP peaks in K562(dark 673 blue) and Hep G2 (maroon) cells.

674 Figure 7: Bud13 knockdown alters the BMDM response to VSV. (A) RT-qPCR analysis of Irf7 mRNA 675 levels in infected control or shBud13 BMDMs stimulated with VSV (MOI 5) across 24 hours. (B) Same as 676 in (A) except stimulated at an MOI of 10. Results are presented relative to those of Rpl32. (C) PFU/mL for 677 viral supernatant from infected shBud13 (blue), control (red), shBud13 with Irf7 overexpression (yellow), or 678 control with Irf7 overexpression (maroon) BMDMs. Data is representative of two (A, B) or three 679 independent experiments (C) and is shown as mean + SEM. * denotes p < 0.05, ** denotes p < 0.01, and 680 *** denotes p < 0.001 using a Student’s t test 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 STAR METHODS

22 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

696 697 Contact for Reagent and Resource Sharing 698 699 Further information and requests for resources and reagents should be directed to and will be 700 fulfilled by the Lead Contact, David Baltimore ([email protected]). 701 702 Experimental Model and Subject Detail 703 704 Animals 705 The California Institute of Technology Institutional Animal Care and Use Committee approved all 706 experiments. C57BL/6 WT mice were bred and housed in the Caltech Office of Laboratory Animal 707 Resources (OLAR) facility. C56BL6/J mice were sacrificed via CO2 euthanasia and sterilized with 708 70% ethanol. Femur and tibia bones harvested and stripped of muscle tissue. Bone marrow cells 709 were resuspended in 20mL of fresh DMEM. 2.5 *106 bone-marrow cells plated in a 150mm dish in 710 20mL of BMDM Media (DMEM, 20% FBS, 30% L929 condition media, and 1% Pen/Strep) and 711 grown at 5% CO2 and 37°C. BMDM media was completely replaced on day 3 as well as a 712 supplemental addition of 5mL L929 condition media on day 5. 713 714 Cell Culture 723 724 Human embryonic kindey cells (HEK293T) from ATCC were cultured in DMEM supplemented with 725 10% FBS and 1% Pen/Strep. Cell line was maintened at 37°C in 5% CO2. 726 727 Method Detail 728 729 Knockdown Experiments 730 BMDMs for knockdown experiments were grown as described above with a few additions. On days 3 731 and 4, retrovirus encoding shRNAs were added to cells. On day 5, cells were selected with 732 puromycin (5ug/mL). On day 8, following ~72 hours of puromycin treatment, media was removed 733 and 10mL of PBS w/ 2mM EDTA was added. Cells were lightly scraped and replated in either 6 well 734 plates or 10-cm dishes depending on the experiment. Cells were left in BMDM media overnight. 735 The following day, cells were stimulated with either 20ng/mL of TNFα, 5ug/mL Poly(I:C) (Sigma), or 736 ODN 1585 (1-5 µM) (InvivoGen). 737 738 RNA Isolation: 739 Total RNA was purified from BMDMs using TRIzol reagent (Ambion) as per the manufacturer’s 740 instructions. Genomic DNA in RNA purifications was eliminated through treatment with Turbo 741 DNase (Thermo Fisher Scientific) for 30 min at 37°C. 0.1-1µg RNA and 1µM dT(30) oligo (d14-954: 742 5’-AAGCAGTGGTATCAACGCAGAGTACT(30)) was heated at 80°C for 2.5min followed by snap 743 cooling on ice. 10µL template-switch RT mix added (10µM template-switch oligo (TSO: 5’- 744 AAGCAGTGGTATCAACGCAGAGTACACArGrGrG), 20mM DTT, 2X ProtoScriipt II Reverse 745 Transcriptase Reaction Buffer (NEB), 1mM dNTPs, 40U Murine RNAse Inhibitor (NEB), and 200U 746 ProtoScript II (NEB) Reverse Transcriptase. Reaction incubated in thermocycler with the following 747 program: 1. 42°C for 30min, 2. 45°C for 30min, 3. 50°C for 10min, followed by deactivation of RT for 748 10min at 80°C. 749 750 RNA Fractionation: 751 Confluent 10-cm dish of mature BMDMs were scraped into 400µL cold NP-40 lysis buffer, APJ1 752 (10mM Tris-HCl (pH 7.5), 0.08% NP-40, 150mM NaCl). Lysed cells layered onto 1mL cold sucrose 753 322 cushion, APJ2 (10mM Tris-HCl (pH 7.5), 150mM NaCl, 24% w/v sucrose) and centrifuged for 754 10min at 4°C and 13000 rpm. The supernatant from this spin represents the cytoplasmic RNA 755 fraction, which is immediately added to 3 volumes of 100% ethanol and 2 volumes of buffer RLT (4M 756 GuSCN, 325 0.1M β-mercaptoethanol, 0.5% N-lauroyl sarcosine, 25mM Na-citrate, pH7.2) and

23 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

757 stored at -80°C until ready to purify RNA. Pellet, containing intact nuclei, is resuspended in 500µL 758 TRIzol reagent. If the pellet was difficult to dissolve, it was heated at 50°C with occasional vortexing. 759 100µL chloroform added and shaken vigorously for 15-20s; allowed to phase separate at room 760 temperature for 5min. Tube centrifuged at 4°C and 12000 x g for 15min. Clear upper aqueous phase 761 removed to a new tube, ensuring white DNA mid-phase is not removed, and is immediately added to 762 3 volumes of 100% ethanol and 2 volumes of buffer RLT and stored at -80°C until ready to purify 763 RNA. RNA is purified according to Qiagen RNeasy column protocol and eluted in 30µL nuclease- 764 free H2O. RNA samples are DNAse treated with Turbo-DNAse and stored at -80°C. 765 766 Library preparation and RNA-Seq Analysis 767 Limited PCR amplifications was performed prior to library preparation. PCR reaction done with 768 KAPA HiFi HotStart 2x ReadyMix, 5% cDNA, and 1µM primer (d14-955: 5’- 769 AAGCAGTGGTATCAACGCAGAGTACT). Thermal cycler programmed for 120 seconds at 95°C as 770 initial denaturation, followed by 14 cycles of 30sec at 95°C for denaturation, 30sec at 62.5°C as 771 annealing, 150sec at 72°C for extension, and final extension at 72°C for 5 min. PCR reactions 0.9X 772 SeraMag and eluted in 25µL. Concentrations of purified library determined using Qubit High 773 Sensitivity dsDNA kit (Invitrogen) as described. Full length cDNA libraries were barcoded using the 774 Nextera XT Tagmentation protocol (Illumina). 775 776 RNA-Antisense Purification 777 RNA antisense purification-mass spectrometry (RAP-MS) was performed as described in McHugh et 778 al. with a few alterations. Briefly, we designed three 90-mer DNA oligonucleotide probes that were 779 antisense to the complementary target RNA sequence in both Irf7 and Actb transcripts. Each probe 780 was targeted to a different location on the transcript and modified with a biotin in order to enable 781 capture of DNA:RNA hybrids on streptavidin coated magnetic beads. 782 RNA Prep and Lysis: ~250million cells, or 25 150mm plates of BMDMs were used for each capture. 783 Following stimulation with TNFα (20ng/ml) for 30 minutes, ~5-10 mL of PBS w/ 2mM EDTA was 784 added to each plate and cells were removed by lightly scraping. Cells were pelleted, resuspended in 785 PBS, and poured into a new 150mm plate. The cells were then crosslinked in Spectrolinker at 254 786 nm wavelength with 0.8 J/cm2 (instrument setting: 8000 x 100 uJ/cm2). Following crosslinking, cells 787 were again pelleted, at which point the pellet could be frozen and stored at -80°C. Cells were lysed 788 in 2mL of lysis buffer per capture (10 mM Tris pH 7.5, 500 mM LiCl, 0.5% Triton X-100, 0.2% sodium 789 dodecyl sulphate, 0.1% sodium deoxycholate) supplemented with Protease Inhibitor Cocktail (EMD 790 Millipore) and 1000 U of Murine RNase Inhibitor (New England Biolabs). We found the smaller the 791 volume used per sample, the more efficient the capture was downstream and thus the minimum 792 volume needed to lyse cells should be optimized. Samples were incubated for 10 min on ice to 793 allow lysis. Following lysis, sample was passed through 20-gauge needle once and then 26-gauge 794 needle 3-5 times to disrupt the pellet and shear genomic DNA. In between passing the sample 795 through the 26-gauge needle, the sample was sonicated on ice with a microtip set at 5W power for a 796 total of 30 s in intermittent pulses (0.7 s on, 1.3 s off). Samples were then mixed with twice the 797 lysate volume of 1.5x LiCl/Urea Buffer (the final buffer contains 10 mM Tris pH 7.5, 500 mM LiCl, 798 0.5% Triton X-100, 0.2% SDS, 0.1% deoxycholate, 4 M urea). Lysates were incubated on ice for 10 799 min then cleared by centrifugation for 10 min at 4,000g. 800 Pre-clearing lysate: BioMag streptavidin beads (Bang Laboratories Inc.) were first washed 3x in 801 0.25-0.5ml of 500mM LiCl/4M Urea buffer (10 mM Tris pH 7.5, 500 mM LiCl, 0.5% Triton X-100, 802 0.2% SDS, 0.1% deoxycholate, 4 M urea). 50ul of beads were added to each sample and the 803 samples were incubated at 37°C for 30 min with shaking. Streptavidin beads were then magnetically 804 separated from lysate samples using a magnet. The beads used for preclearing lysate were 805 discarded and the lysate sample was transferred to fresh tubes twice to remove all traces of 806 magnetic beads. Input for quality control experiments can be removed at this point. 807 Hybridization, Capture of Probes and Elution of Associated Protein: Following pre-clearing, the 808 biotinylated 90-mer DNA oligonucleotide probes specific for the RNA target of interest (vary per 809 sample but ~5ul of 25uM per probe) were heat-denatured at 85°C for 3 min and then snap-cooled on

24 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

810 ice. Probes and pre-cleared lysate were mixed and incubated at 55°C with shaking for 2 h to 811 hybridize probes to the capture target RNA. 500mL of washed streptavidin beads (Bang 812 Laboratories Inc.) were then added to each sample at 55°C with shaking for 30 mins. Beads with 813 captured hybrids were washed 6 times with LiCl/Urea Hybridization Buffer. If needed, 1% of the 814 beads can be removed for qPCR quality control experiment. TRIzol reagent can be added directly to 815 beads to elute RNA. Beads were then resuspended in Benzonase Elution Buffer (20 mM Tris pH 816 8.0, 2 mM MgCl2, 0.05% NLS, 0.5 mM TCEP) and 125 U of Benzonase nonspecific RNA/DNA 817 nuclease was added. Incubation occurred for 1-2 h at 37°C. Beads were then separated from the 818 sample using a magnet. Supernatant was collected. Contaminant beads were removed by 5 rounds 819 of magnetic separation on supernatant. Protein was precipitated overnight at 4°C with 10% 820 trichloroacetic acid (TCA). TCA treated protein elution samples were pelleted by centrifugation for 30 821 min at 20,000g, then washed with 1 ml cold acetone and recentrifuged. Final protein elution pellets 822 were air dried to remove acetone, resuspended in fresh 8 M urea dissolved in 40 ml of 100 mM Tris- 823 HCl pH 8.5, and stored at -20°C. 824 Mass Spec Prep. and Analysis Performed as in McHugh et al. with few exceptions. Instead of 825 SILAC we label proteins at the mass spec prep step using TMT (Thermo). After desalting on a 826 Microm Bioresources C8 peptide MicroTrap column and lyophilization of peptide fraction, lyophilized 827 protein pellets were resuspended in 100mM TEAB at a concentration of 1ug/ul. We then added 828 1.64ul of TMT labelling reagent to each ug of sample. The reaction was incubated for one hour at 829 room temperature. The reaction was quenched with 0.32ul of 5% hydroxylamine per ug of protein 830 used and incubated for 15 mins at room temperature. Following quenching, the samples were 831 mixed, desalted as before, lyophilized, and mass spec was performed on Orbitrap Fusion mass 832 spectrometer using a TMT instrument method as described in Liu et al.34 833 Raw files were searched using MaxQuant (v. 1.5.3.30) against the UniProt mouse database (59550 834 sequences) and a contaminant database (248 sequences). TMT 6plex was selected as the 835 quantitation method with a reporter mass tolerance of 0.3. Oxidation of methionine and protein N- 836 terminal acetylation were variable modifications and carbamidomethylation of cysteine was fixed 837 modification. A 1% protein and peptide false discovery rate as estimated by the target-decoy 838 approach was used for identification. 839 840 RNA Immunoprecipitation 841 RNA immunoprecipitations were performed as previously described. Between 5-10 confluent 15 cm2 842 dishes of BMDMs per sample were stimulated with either 20ng/mL of TNFα for 30 minutes or 843 5ug/mL Poly(I:C) for 12 hours. Following stimulation, proteins were cross-linked to DNA by adding 844 formaldehyde directly to the media to a final concentration of 0.75%, with light shaking at room 845 temperature for 10 mins. To quench the crosslinking reaction, glycine to a final concentration of 125 846 mM was added to the media and incubated with shaking for 5 mins at room temp. Media was then 847 aspirated and cells were rinsed twice with 10 mL of cold PBS. Following the second wash, cells 848 were scraped into 10mL of PBS and spun down gently ( 5 min, 4°C, 1,000xg). Final cell pellet was 849 resuspended in 0.1-1mL of polysome lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES (pH 850 7.0), 0.5% NP40, 1 mM DTT, 100 U.ml RNase Inhibitor (NEB)) supplemented with Protease Inhibitor 851 Cocktail (EMD Millipore). At this point the mRNP lysate was frozen. If needed, passing the lysate 852 through a small gauge needle can help with lysate. Protein-G beads were pre-treated at 4°C with 853 NT2 (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM MgCl2, 0.05% NP40) supplemented with 5% 854 BSA to a final ratio of 1:5 for at least 1h before use. Appropriate amount of antibody per sample 855 (optimized based on antibodyused but typically ~1-10ug) was added ot 250-500ul of bead/BSA 856 slurry and incubated at 4°C. Following incubation, beads were spun down and washed with 1 ml of 857 ice-cold NT2 buffer 4–5 times. Following final wash, beads were resuspended in 850ul of NT2 and 858 supplemented with 200U of RNase inhibitor, 10 μl of 100 mM DTT and EDTA to 20 mM. Frozen 859 lysate was thawed and centrifuged at 15,000*g for 15 mins. The cleared supernatant was removed 860 and 100ul was added to the prepared beads. Input removed at this step. Beads and lysate were 861 incubated for 4h at 4°C with mixing. The beads were washed 4-5 times with ice-cold NT2 and then 862 resuspended in 100ul of NT2 buffer. 4ul of 5M NaCl was added incubated with shaking at 65°C for 2

25 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

863 hours. NT2 buffer can also be supplemented with 30 μg of proteinase K to release the RNP 864 component. RNA was isolated by adding TRIzol reagent (Ambion) as per the manufacturer’s 865 instructions. RNA was reverse transcribed and quantification was performed using TaqMan qPCR. 866 867 Immunoblot 868 BMDM samples were prepared as described previously. On day 8, they were plated at similar 869 density. Following adherence, BMDMs were stimulated with Poly(I:C) or CpG for the indicated time. 870 Cells were scraped into subcellular fractionation buffer (20mM HEPES (pH 7.4), 10 mM KCl, 2 mM 871 MgCl2, 1mM EDTA, 1 mM EGTA). The cells were then passed through a 27 gauge needle 10 times, 872 incubated on ice for 10 mins, and spun down at 720xg for 5 min. The pellet contained the nuclei, 873 which was washed with fractionation buffer, passed through a 25 gauge needle 10 times, and 874 centrifuged again at 720xg for 10 mins. The resulting pellet was resuspended in RIPA lysis buffer. 875 Queal amounts of proteins were analyzed by immunoblot using the following reagents: anti-IRF7 876 (Millipore, ABF130), anti-Lamin B1 HRP conjugate (Cell Signalling, D9V6H), and anti-rabbit IgG 877 HRP conjugate (Cell Signalling). 878 879 Viral Plaque Assays 880 Plaque assays were done one Vero cells. 2.5*105 vero cells were plated in a 12 well plate the night 881 before infection. Prior to infection, cells were checked to ensure confluence. VSV was serially 882 diluted and infected in 12 well plate for 1 h. VSV was then removed and cells were layered carefully 883 with DMEM supplemented with 2% FBS and 0.4% agarose. Plate was incubated for 2 days, and 884 then fixed with 10% formaldehyde, for 1 h to overnight. Finally, agarose plugs were removed 885 carefully and cells were stained with crystal violet. 886 887 VSV-GFP Infection Experiment 888 BMDMs were grown as described above in 150mm dishes. On day 8, following ~72 hours of 889 puromycin treatment, media was removed and 10mL of PBS w/ 2mM EDTA was added. Cells were 890 lightly scraped and 250,000 cells/well were replated in 12 well plates in BMDM media. Cells were 891 left for 12 hours to adhere. Following adherence, VSV-GFP was added at the specified MOI for the 892 specified amount of time. Following the time-course, cells were lightly scraped, washed and spun 893 down, and resuspended in PBS. Samples were analyzed on a MACSQuant10 Flow Cytometry 894 machine (Miltenyi). Gating strategy depicted in Fig. 7. 895 896 VSV-GFP Viral Supernatant Experiment 897 BMDMs were grown as described above in 150mm dishes. On day 8, following ~72 hours of 898 puromycin treatment, media was removed and 10mL of PBS w/ 2mM EDTA was added. Cells were 899 lightly scraped and 400,000 cells/well were replated in 12 well plates in BMDM media. Cells were 900 left to adhere for 12 hours, before being infected at an MOI of 25 for 8 hours. Following infection, 901 virus was removed and the cells were washed with PBS three times. Then, 500ul of BMDM media 902 (DMEM, 20% FBS, 30% L929 condition media, and 1% Pen/Strep) was added to each well. 18 903 hours later, media was collected and stored at -80°C. To titer viral supernatant, Vero cells were 904 plated in a 96-well plate at 30,000 cells per well in 90ul of D10 media. 12 hours after plating, 90ul 905 supernatant was added to the 90ul of D10 at different dilutions. PFU/mL was calculated from a 906 standard curve with a virus of known concentration. 907 908 Quantification and Statistical Analysis 909 All statistical analysis was performed in Python (version 2.7.9). Unless otherwise indicated in figure 910 legends, statistical significance measurements were marked as follows: * denotes p < 0.05, ** denotes 911 p < 0.01, *** denotes p < 0.001, and n.s. denotes not significant. RNA-Seq expression and splicing 912 analysis as well as eCLIP analysis is described in more detail below. 913 914 915 RNA-Sequencing Analysis

26 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

916 Sequencing was performed on a HiSeq 2500 High Throughput Sequencer (Illumina). Single-end 50- 917 mer reads were aligned using Tophat v2.1.1.35 Gene expression was determined using Cufflinks 918 v2.2.1 and the FPKM (Fragments Per Kilobase Million) metric.36 919 920 Splicing Ratio and ΔSR Calculation 921 A custom script was written in Python using the HTSeq37 library to calculate Splicing Ratio. First, 922 reads that map to an intron or exon feature are summed. To map to a feature, reads must have >1 923 bp overlap with the feature. If a read maps to more than one feature, such as in the case of a splice 924 junction read, the read is split between the features. SR is calculated by taking the length 925 normalized number of reads that map to each intron, divided by the average length normalized 926 number of exon reads plus the length normalized intron value. When SR is equal to 0, this indicates 927 a junction is completely spliced. In contrast, large SR values indicate intron retention. 928 We use the SR value to calculate ΔSR, which is equal to SR(shBud13) – SR(Ctl). Values greater 929 than 0 indicate the junction is more unspliced in the shBud13 sample, whereas values less than 0 930 indicate the junction is more unspliced in the Ctl sample. For the global analysis, in order for the 931 ΔSR of a junction to be considered, it must pass through a number of filters. To account for 932 transcripts that are annotated in Ensembl version 67, but not expressed, we set an FPKM threshold 933 of 15. Further, a local normalized read count threshold on the upstream/downstream exons was 934 implemented to ensure a level of sequencing depth needed to get accurate splicing values. To pass 935 this threshold, the sum of the reads that map to the the upstream/downstream exons divided by the 936 length of these exons must be  0.25. 937 938 ISG and Genome-Wide Analysis 939 ISGs used in Fig. 4 E-H were selected based on induction 2 hours after in vivo IFNa injection.15 We 940 classified ISGs to be any gene with a fold change  3.5 following 2 hours of induction. Intron RPKM 941 was calculated using a custom python script with the HTSeq library. In Fig. 5a, transcripts from the 942 30 min. TNFα data-set that had a junction with a ΔSR value above 0.15 were sorted into an 943 ‘increased IR’ category (ΔSR >0.15), whereas all other transcripts were sorted into an unaffected 944 category (ΔSR <-0.15). The selected data-set is representative of all time-points from the TNFα, 945 Poly(I:C) and CpG datasets. A maximum entropy model was used to calculate 3’ and 5’ splice site 946 strengths.12 To determine differences in 5’ splice site sequence for Bud13 dependent junctions, the 947 nine base pair sequence near the 5’ splice site junctions for junctions that had a ΔSR >0.15 was 948 compared to all expressed junctions (FPKM>1). The top Bud13 dependent junctions were plotted 949 based on the average ΔSR value across all time-points from the TNFα data-set (Fig. 5D) as well as 950 the Poly (I:C) data-set (Fig. SH). Junctions that had a ΔSR value <0.15 in a time-point were filtered 951 out in the TNFα data-set, while junctions that had a ΔSR value <0.15 in two time-points were filtered 952 out in the Poly (I:C) data-set. The zero time-point was removd for the transcripts induced by the 953 stimulant (Irf7 and Cd14). For the comparison of alternative splicing events, rMATs38 was used on 954 the TNFα data-set. Splicing events were deemed significant if p<0.05 and FDR<0.1 for all time- 955 points. SVMBPfinder was used to determine BP related features (BP strength and distance from BP 956 to 3' splice site).39 957 958 eCLIP 959 Data for eCLIP experiments were downloaded from ENCODE Project Consortium.18 Analysis of 960 eCLIP data is the same as has been described previously.40 Fold change of eCLIP read density 961 compared to input read density along a normalized intron was calculated using ngs.plot.41 Peaks 962 were called using CLIPper.42 Peaks were deemed significant if they were >3-fold enriched and had 963 p-value<10-5. Peak locations were determined using a custom python script with the HTSeq library. 964 Enriched GO terms were determined using Seten.43 965 966 967 968 Data and Software Availability

27 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

969 970 The next-generation sequencing data reported in this study will be deposited to the Gene Expression 971 Omnibus (GEO). Upon completion of deposit, the accession number for this data will be provided. 972

28 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

TNFα A. G. 129 0 mins. 0 129 30 mins. 0 129 60 mins. 0 129 120 mins. 0

H.

5’ SS

B. 5’ Exon CAG gtaagt Intron 3’ Exon Irf7 Retained Intron Mouse: CAG gtacat Rat: CAG gtacat Human: CAG gtaccc C. D. # of Introns # of Introns

I. J. 0.4 Intron 1 Size (Nucleotides) GC Content Intron 2 0.3 E. F. Intron 3 Intron 4 Intron 5 0.2 Intron 6 Intron 7 Splicing Ratio Intron 8 0.1

0.0 # of Exons # of Introns 0 50 100 Time (mins.)

GC Content MaxEnt Score (5’ss)

Figure 1: Irf7 contains a weak intron that is retained following many forms of stimulation. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. B. 6

5

4

3

2

MS Intensity Ratio (Irf7/ActB) 1

0

Mt1 Txn Tpi1SonBrd2 Srrm1 Eno1 Galk2 Actg1Speg Pum2Tcof1 Sod1 Sub1 Vash1 Ttc36 Cotl1 Mmrn1 Uba52 Olfr704 YwhaeOtud6a Bud13 Ubxn4Gpnmb Gpatch8Prpf40a Pla2g16 Olfr1415 Olfr1457 Ccdc109b Hsp90ab1 Tmprss11f

2.5 Irf7 Probe C. *** D. TNFα E. Poly(I:C) Actb Probe 15 15 2.0 *

1.5 10 10

*** 1.0 5 5 % Pulled Down 0.5 (Bud13 / Rabbit IgG) Relative Enrichment Bud13AB/Rabbit IgG Ab Bud13AB/Rabbit IgG 0.0 0 0

Irf7 Irf7 Actb Irf7 Rpl32 Rpl32 Rpl32

Figure 2: RAP-MS and RIP identify Bud13 as an RNA binding protein that interacts with IRF7 mRNA bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A.

B. C. D. 6 0.6 Control shBud13 0.4 4 0.6 *

ΔSR 0.2 FPKM 0.4 2 Fold Change 0.0 (Bud13KD - Control) 0.2

Quantified 0 -0.2 0 50 100

Unspliced:Spliced 0.0 Time (mins.)

Intron 1Intron 2Intron 3Intron 4Intron 5Intron 6Intron 7Intron 8 Control shBud13

Figure 3: Bud13 knockdown leads to increased retention in the poorly splicing intron of Irf7 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

0.3 A. B. E. 0 mins. Poly(I:C) Stimulation 0.2 3

Control 0.1 2

Median = 0.1655 ΔSR 0.0 1

-0.1

(Bud13KD - Control) 0

-0.2 (shBud13/Scr) -1 Expression Fold Change 2 Intron 1Intron 2Intron 3Intron 4Intron 5Intron 6Intron 7Intron 8 Log -2 C. 20 Control shBud13 15 -3

10 720 mins. Poly(I:C) Stimulation 3 shBud13 FPKM F. Fold Change 5 2

0 Median = -0.1007 0 500 1000 1500 1 D. Time (mins.)

0 * I. 1.00 (shBud13/Scr) -1 Expression Fold Change

0.75 2 Log 0.50 -2 Irf7 Expression ActB Normalized 0.25

-3 0.00

Control shBud13 G. 0.4 H. I. 0.04 0.025 *** *** Control Control shBud13 0.020 shBud13 0.2 0.03

0.015

0.02 mRNA mRNA mRNA mRNA β α Median (Fold) (Fold) * *** 0.0 0.010 IFN IFN

0.01 ** 0.005 ** Expression Fold Change 2 -0.2

Log 0.00 0.000 0 15 60 0 0 240 720 720 720 1440 1440 1440 Time (mins.) J. K. 1500 L. Control shBud13 Nuc 1000 720 min. Ctl Nuc Control Nuclear shBud13 Cyto 800 Ctl Cyto shBud13 shBud13 1000 720 min. 600 Nuclear

Control RPKM 400 (FPKM) Irf7 Intron 4 720 min. 500 Cytoplasmic

Cytoplasmic Irf7 200 shBud13 720 min. Cytoplasmic 0 0 0 200 400 600 0 60 240 480 720 Time (mins.) Time (mins.)

Figure 4: Bud13 knockdown alters the type I interferon response bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. 1.0 B. 200 C. Multiple Bud13 dependent junctions 0.8 Single Bud13 150 dependent junction

0.6

Control) SR 100 / Δ 0.4 # of Genes (shBud13 - Ctl) FPKM 50 0.2 (shBud13 2

0.0 0 Log ΔSR >1 0.05 ΔSR >2 0.10 ΔSR >3 0.15 Flii Irf7 Imp4 Nxf1 Maf1 Dpp7 Emg1 Kif5b Creb3Cd14Rpl10Eef1d Psme1Psma3 Hnrnpc Hmox2 Threshold

2.5 D. 3' Splice Site F. H. 2.0 5' Splice Site

1.5 Mean SR Diff. < Threshold Mean SR Diff. Total 1.0

0.5

0.0 3 4 5 6 7 8 9 10 Weak Junction Threshold (MaxEnt Score) E. G. I.

5’SS (Expressed Junctions)

5’SS (Bud13 Affected Junctions)

Downstream Intron Exon

Figure 5: Global analysis of the role of Bud13. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

K562 Peaks HepG2 Peaks A. B. C. D. Intron Intron Bud13 - Bud13 Dependent. Bud13 - Bud13 Dependent. Intron-Exon Jct. Intron-Exon Jct. Bud13 - All Expressed Bud13 - All Expressed Exon Exon 37.1% 35.3% 26.2% 27.4%

27.6% 46.4%

3' Junction 3' Junction 20.1% 5' Junction 5' Junction 29.5%

Sf 3 b4 Sf 3 b4 70.5% 79.1%

G. viral process Prpf8 Prpf8 K562 viral transcription RNA processing Hep G2 RNA splicing nonsense-mediated decay mRNA export from nucleus mRNA processing mRNA splicing via spliceosome SRP-dependent protein targeting rRNA processing translation translational initiation E. F. RNA export from nucleus mRNA 3'-end processing regulation of mRNA stability

GO: Biological Process GO: Biological Process termination of pol II transcription DNA duplex unwinding gene expression negative regulation of mRNA splicing protein folding DNA repair DNA replication proteasome catabolic process

0 1 2 3 -Log10(G. set p-value)

Figure 6: Bud13 interacts with Bud13 dependent junctions near the 3’ splice site. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

VSV Infection: D. A. MOI 5 ** 50 Control *

40 shBud13 *

30 **

20 Fold Change 10

0 0 200 400 600 800 Time (mins.)

VSV Infection: MOI 10 B. 40 Control 30 shBud13 * 20 * *

Fold Change 10

0 0 200 400 600 800 Time (mins)

20000 C. *** *** *** 15000

10000

PFU/mL ** ** 5000

0

Ctl

shBud13 Ctl + Irf7 OE

shBud13 + Irf7 OE

Figure 7: Bud13 knockdown alters the BMDM response to VSV. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

FIGURE LEGENDS

Figure 1: Irf7 contains a weak intron that is following many forms of stimulation. (A) Histogram of mapped reads corresponding to the TNFα-induced expression of Irf7. The poorly spliced fourth intron is highlighted. For all read density plots, reads are histogrammed in log10 scale and normalized to the maximum value across the stimulation. (B) Comparison of Irf7 splice donor and acceptor sites in mice, rats, and humans. (C-F) Histogram representing the intron length (C), intron GC content (D), flanking exon GC content (E), or 5’ splice site strength of introns of expressed in BMDMs. Red represents location of Irf7 intron 4 (C, D, F) or upstream exon (E). Black line represents downstream exon (E). (G, H) Histogram of mapped reads corresponding to the IFNα (G) and poly(I:C) (H) induced expression of Irf7 focused on the slow splicing fourth intron. (I) Outline of Splicing Ratio (SR) metric. (J) Splicing ratio for all introns in Irf7 plotted against time stimulated with TNFα.

Figure 2: RAP-MS and RIP identifies Bud13 as an RNA binding protein that interacts with IRF7 mRNA. (A) Outline of the RAP-MS procedure used to identify RNA-binding proteins on transcritps of interest. (B) TMT ratio (Irf7/Actb) for proteins identified as enriched on either Irf7 (TMT ratio >1) or Actb (TMT ratio <1) transcripts. (C) RT-qPCR analysis of transcripts captured via RAP for Irf7 (blue) and Actb (gold) probes. (D) RIP followed by RT-qPCR for Irf7 and Rpl32 in TNFα stimulated BMDMs. Shown is the relative enrichment of transcripts captured in Bud13 RIP as compared to Rabbit IgG RIP. (E) Same as (d) except stimulation with poly(I:C). Data are representative of two independent experiments ((C-E), mean + SEM). *P < 0.05, **P < 0.01 and ***P < 0.001 (t-test).

Figure 3: Bud13 knockdown leads to increased retention in the poorly splicing intron of Irf7. (A) Histogram of mapped reads corresponding to the TNFα-induced expression of Irf7. The poorly spliced fourth intron is highlighted. shBud13 samples are shown in green. Control samples are shown in grey. (B) ΔSRs calculated for each junction in the Irf7 transcript. The ΔSR of intron 4 as compared to all other junctions is significant (Student’s t-test, p<0.001). No other pairwise comparison is significant. (C) Splicing gel from RNA extracted from BMDMS stimulated for 30 mins. TNFα (top). Quantification of splicing gel (bottom). (D) Irf7 FPKM fold change with respect to time stimulated. shBud13 is shown in green, control is shown in grey. Data is representative of two independent experiments (C) and is represented as mean + SEM. * denotes p < 0.05, ** denotes p < 0.01, and *** denotes p < 0.001 using a Student’s t test.

Figure 4: Bud13 knockdown alters the type I interferon response. (A) Histogram of mapped reads corresponding to the TNFα-induced expression of Irf7. The poorly spliced fourth intron is highlighted. shBud13 samples are shown in blue. Control samples are shown in grey. (B) ΔSRs calculated for each junction in the Irf7 transcript. The ΔSR of intron 4 as compared to all other junctions is significant (Student’s t-test, p<0.001). No other pairwise comparison is significant. (C) Irf7 FPKM fold change with respect to time stimulated. shBud13 is shown in blue, control is shown in grey. (D) Immunoblot analysis of Irf7 protein following 720 mins. poly(I:C) stimulation (left). Quantification relative to ActB (right). (E) Log2 expression fold change (shBud13/control) for 119 ISGs in unstimulated BMDMs (median = 0.1655). (F) As in (E) for stimulated BMDMs (720 mins poly(I:C) (median = -0.1007). Wilcoxon rank-sum between (E) and (F), P< .001. (G) Median log2 expression fold change (shBud13/control) for ISGs in unstimulated BMDMs, and BMDMs stimulated with Poly(I:C) 15, 60, 240, 720, and 1440 mins. Bars represent 95% CI. (Wilcoxon rank-sum, P< .001, for any of the ‘early’ time-points (0, 15, 60 mins) compared to any of the ‘late’ time-points (240, 720, 1440 mins). (H) RT-qPCR analysis of IFNα mRNA levels in unstimulated BMDMs and BMDMs stimulated with poly(I:C) for 720 mins and 1440 mins. (I) Same as (H) for IFNβ. (J) Nuclear fraction (top) and cytoplasmic fraction (bottom) histograms of mapped reads corresponding to the poly(I:C)-induced expression of Irf7 (720 mins). The poorly spliced fourth intron is highlighted. shBud13 samples are shown in blue. Control samples are shown in grey. Nuclear ΔSR = 0.35. (K) Nuclear and cytoplasmic RPKM for Irf7 intron 4 from fractionated BMDMs stimulated with poly(I:C). (L) Cytoplasmic Irf7 FPKM for control (grey) and shBud13 BMDMs stimulated with poly(I:C). Data is representative of four independent experiments (H, I) and is represented as mean + SEM. * denotes p < 0.05, ** denotes p < 0.01, and *** denotes p < 0.001 using a Student’s t test. Results are presented relative to those of Rpl32 (H,I). bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 5: Global analysis of the role of Bud13. (A) Ranked bar chart showing genes with a junction most affected by Bud13 knock-down in all samples during TNFα stimulation. See S7 for histograms relating to most affected junctions. (B) Grouped bar chart depicting the number of genes that have a single Bud13 affected junction vs. multiple Bud13 affected junctions using three different ΔSR thresholds. (C) Transcripts were classified as ‘Bud13 dependent’ if they had a junction with a ΔSR. >0.15. The log2 expression fold change (FPKM shBud13/ FPKM control) for each gene represented by the transcripts in the ‘Bud13 dependent’ category as well as all other genes is shown. Median ‘increased IR’ = -0.5084. Median ‘decreased IR’ = -0.2170. (Wilcoxon rank-sum, P< .01). (D) Mean ΔSR. for junctions below the indicated threshold (x-axis) vs. mean ΔSR. for all junctions. Threshold applied for the 5’ splice site (blue) and the 3’ splice site (green). (E) 5’SS motif for all expressed junctions as compared to junctions that show retention upon Bud13 knockdown (ΔSR. > 0.15). (F) Size of intron for introns retained upon Bud13 knockdown (ΔSR. > 0.15) (blue), in introns located in the same transcript as those affected by Bud13 (green), and in introns from all expressed transcripts (orange). (G) Same as (F) for GC content. (H) Flanking exon GC content for exons that flank introns retained upon Bud13 knockdown (ΔSR. > 0.15) (dark green) as compared to exons that flank introns from all expressed transcripts (light green). (I) Distance from the branch point to the 3’ splice site for introns retained upon Bud13 knockdown (ΔSR. > 0.15) (dark blue) as compared to introns from all expressed transcripts (light blue). (F-I) data from BMDM TNFα stimulation. Box plots show median (center line), interquartile range (box) and tenth and ninetieth percentiles. *P < 0.05, **P < 0.01 and ***P < 0.001 (Mann-Whitney U-test). Figure 6: Bud13 interacts primarily near the 3’ splice site of small, GC rich introns. (A) eCLIP-seq read density plots in K562 cells. Bud13 density plot over all expressed junctions shown in blue (top), Bud13 density plot over Bud13 dependent junctions shown in red (top). Sf3b4 density plot over all expressed junctions shown in maroon (middle), and Prpf8 density plot over all expressed junctions is shown in green (bottom). (B) Same as in (A) but for Hep G2 cells. (C) Bud13 eCLIP-seq peak distribution. Peaks fell within either intronic regions, intron-exon junctions, or exonic regions. Peaks that fell within intron-exon junction were further classified as 5’ junction peaks or 3’ junction peaks (bottom). (D) Same as (C) but for Hep G2. (E) Size of all introns in expressed transcripts for the given cell line (dark blue) vs size of introns with overlapping eCLIP peak (maroon). Shown in K562 (left) and Hep G2 (right) cells. Box plots show median (center line), interquartile range (box) and tenth and ninetieth percentiles (whiskers). *P < 0.05, **P < 0.01 and ***P < 0.001 (Mann-Whitney U-test). (F) Same as (E) for GC content. (G) GO terms (biological process) enriched among Bud13 eCLIP peaks in K562(dark blue) and Hep G2 (maroon) cells.

Figure 7: Bud13 knockdown alters the BMDM response to VSV. (A) RT-qPCR analysis of Irf7 mRNA levels in infected control or shBud13 BMDMs stimulated with VSV (MOI 5) across 24 hours. (B) Same as in (A) except stimulated at an MOI of 10. Results are presented relative to those of Rpl32. (C) PFU/mL for viral supernatant from infected shBud13 (blue), control (red), shBud13 with Irf7 overexpression (yellow), or control with Irf7 overexpression (maroon) BMDMs. Data is representative of two (A, B) or three independent experiments (C) and is shown as mean + SEM. * denotes p < 0.05, ** denotes p < 0.01, and *** denotes p < 0.001 using a Student’s t test

bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTAL FIGURES

A. B. Poly(I:C) IFNα 0 mins. 0.4 1.5 0 mins. 720 mins. 60 mins. 1440 mins. 120 mins. 0.3 1.0

0.2

0.5 Splicing Ratio Splicing Ratio 0.1

0.0 0.0

Intron 1 Intron 2 Intron 3 Intron 4 Intron 5 Intron 6 Intron 7 Intron 8 Intron 1 Intron 2 Intron 3 Intron 4 Intron 5 Intron 6 Intron 7 Intron 8

Figure S1: Splicing Ratios across all junctions in Irf7 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. B. ** C. 1.5

Ctl shBud13SC shBud13 1.0 Bud13 0.5 ActB Relative mRNA Expression Relative mRNA 0.0

Control shBud13

E. F. G. Zfp36 Nfkbie Cd83 15 15 15 Control Control Control shBud13 shBud13 shBud13 10 10 10 FPKM FPKM FPKM 5 5 5 Fold Change Fold Change Fold Change

0 0 0 0 50 100 0 50 100 0 50 100 Time (mins.) Time (mins.) Time (mins.)

Figure S2: shBud13 knocks down Bud13 protein and mRNA. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

** 1.4 1.25 720 mins. Poly(I:C) Control A. B. shBud13 1.2 1.00 1.0 0.75 0.8

0.6 0.50 Normalized FPKM

0.4 0.25 0.2

Normalized Unspliced vs. Spliced 0.00

0.0 Irf7 Irf1 Mx2 Stat2 Oas3 Stat1 Ifih1 Daxx Dhx58 Nlrc5 Isg20 Trim21Eif2ak2 Clec2d Oas1b

Control shBud13 C. D.

Figure S3: Irf7 Intron 4 is the most Bud13 knockdown affected junction of all ISGs. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. CpG ScrambleControl 206

0 mins. 0 206

720 mins.

0 206

1440 mins.

0 shBud13shBud13 206

0 mins. 0 206

720 mins. 0 206

1440 mins.

0

0 mins. CpG Stimulation B. 0.5 D 3 F.

0.4 2

Median = -0.2442 1 0.3

0 ΔSR 0.2

-1

0.1 (shBud13/Scr) (Bud13KD - Control) Expression Fold Change

2 -2 0.0 Log -3 720 1440

Time (mins.) -4 C. E. 720 mins. CpG Stimulation G. shBud13 3 20 0.015 Control Scramble *** 2 shBud13 15 Median = -0.4776 1 0.010

0 mRNA mRNA

10 α (Fold) *** -1

IFN 0.005 Fold Change

5 (shBud13/Scr) Expression Fold Change

2 -2

0 Log 0.000 -3 0 500 1000 1500 0 720 1440 Time (hours) -4

Figure S4: Bud13 knockdown alters the type I interferon response in response to CpG bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. Control B. 0.4 shBud13 720 mins. Poly(I:C) * p = 0.0526 1.0 0.3

0.8 0.2 FPKM 0.6

(Cyto/Total) ΔSR 0.1 0.4

0.2 0.0 (Bud13KD - Control) 0.0 -0.1 U2 Xist Rps5 Actb Rpl5 Malat1 Neat1 Rpl32 Gene Intron 1Intron 2Intron 3Intron 4Intron 5Intron 6Intron 7Intron 8

Figure S5: BMDM fractionation and effect of Bud13 on nuclear Irf7 splicing bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. Imp4 B. Psme1 C. Psma3 D. Dpp7 Scramble Scramble Scramble Scramble 325 1538 215 0 mins. 544 0 mins. 0 mins. 0 mins. 0 0 0 0 326 1538 215 30 mins. 544 30 mins. 30 mins. 30 mins. 0 0 0 326 0 1538 215 60 mins. 544 60 mins. 60 mins. 60 mins. 0 0 0 0 326 1538 215 120 mins. 544 120 mins. 120 mins. 120 mins. 0 0 0 shBud13 0 shBud13 shBud13 326 shBud13 1538 215 544 0 mins. 0 mins. 0 mins. 0 0 mins. 0 0 326 0 1538 215 544 30 mins. 30 mins. 30 mins. 0 30 mins. 0 0 0 326 1538 215 544 60 mins. 60 mins. 60 mins. 0 60 mins. 0 0 0 326 1538 215 544 120 mins. 120 mins. 120 mins. 0 120 mins. 0 0 0

E. Flii F. Emg1 G. Hnrnpc Scramble Scramble Scramble H. 132 501 215 0 mins. 0.6 0 0 mins. 0 mins. 132 0 0 30 mins. 501 215 30 mins. 30 mins. 0 132 0 0 60 mins. 501 215 0.4 0 60 mins. 60 mins. 132 0 0 120 mins. 501 215 SR

120 mins. 120 mins. Δ 0 0 0 shBud13 shBud13 shBud13 132 501 215 0.2 (shBud13 - Ctl) 0 mins. 0 mins. 0 mins. 0 0 0 132 501 215 30 mins. 30 mins. 30 mins. 0 0 0 132 501 215 0.0

60 mins. 60 mins. 60 mins. Irf7 0 Cul1 Sfr1 0 0 Imp4 Dpp7 Emg1 Lair1 Psma3 Fkbp1a Psmc6 Psme1 132 501 215 120 mins. 120 mins. 120 mins. 0 0 0

I. Imp4 J. Psma3 K. Emg1 L. Psme1 Scramble Scramble Scramble Scramble 74 284 84 229 0 mins. 0 mins. 0 mins. 0 mins. 0 0 0 0 74 284 84 15 mins. 15 mins. 15 mins. 15 mins. 229 0 0 0 0 74 284 84 229 60 mins. 60 mins. 60 mins. 60 mins. 0 0 0 0 284 84 240 mins. 74 240 mins. 240 mins. 240 mins.229 0 0 0 0 720 mins. 74 720 mins.284 720 mins. 84 720 mins.229 0 0 0 0 1440 mins.74 1440 mins.284 1440 mins.84 1440 mins.229 shBud13 0 shBud13 0 shBud13 0 shBud130 74 284 84 229 0 mins. 0 mins. 0 mins. 0 0 0 0 mins. 0 74 284 84 229 15 mins. 15 mins. 15 mins. 15 mins. 0 0 0 0 74 284 84 229 60 mins. 60 mins. 60 mins. 60 mins. 0 0 0 0 74 284 84 229 240 mins. 240 mins. 240 mins. 240 mins. 0 0 0 0 74 284 84 229 720 mins. 720 mins. 720 mins. 720 mins. 0 0 0 0 74 284 84 1440 mins. 1440 mins. 1440 mins. 1440 mins.229 0 0 0 0

Figure S6: Histograms of mapped reads corresponding to hits identified in TNFα and PIC data-sets. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. B.

200 C. D. G. Multiple Bud13 dependent junctions Single Bud13 150 dependent junction

100 # of Genes

50

0 E. F. ΔSR >1 0.05 ΔSR >2 0.10 ΔSR >3 0.15 Threshold

Figure S7: Supplemental global analysis of shBud13 bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A.

2000 Hep G2 K562 1500

1000

500 # of Reten)on Events

0 ΔSR > 0.15 ΔSR > 0.1 ΔSR > 0.05 ΔSR > 0.03

Figure S8: Bud13 dependent IR events in Hep G2 and K562 cells. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. B.

C. D. E. Control Control 0.8 50 * 50 shBud13 ** shBud13 * ** ** 40 *** 0.6 40 * * 30 30 0.4 ** (Fold) n.s Irf7 mRNA 20 20 0.2 % Infected % Infected 10 10 0.0 0 0 0 6 8 0 1 5 Control 10 12 24 0.1 10 25 50 shBud13 Time (hours) MOI Control + Irf7 shBud13 + Irf7 OE Figure S9: Bud13 knockdown alters the BMDM infection via VSV. bioRxiv preprint doi: https://doi.org/10.1101/443820; this version posted October 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A. B.

0.3

shBUD13 shRBMX2-1 0.2 shRBMX2-2 shSNIP1

0.1 Delta SR C. 60 shBUD13 0.0 shRBMX2-1 shRBMX2-2 40 shSNIP1

-0.1 20 # of Reten)on Events

Intron 1 Intron 2 Intron 3 Intron 4 Intron 5 Intron 6 Intron 7 Intron 8 0 ΔSR > 0.15 ΔSR > 0.1 ΔSR > 0.05

Figure S10: Knockdown of other RES complex proteins.