DOCSLIB.ORG

A CRISPR Screen to Identify Combination Therapies of Cytotoxic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A CRISPR Screen to Identify Combination Therapies of Cytotoxic CRISPRi Screens to Identify Combination Therapies for the Improved Treatment of Ovarian Cancer By Erika Daphne Handly B.S. Chemical Engineering Brigham Young University, 2014 Submitted to the Department of Biological Engineering in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Engineering at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY February 2021 © 2020 Massachusetts Institute of Technology. All rights reserved. Signature of author………………………………………………………………………………… Erika Handly Department of Biological Engineering February 2021 Certified by………………………………………………………………………………………… Michael Yaffe Director MIT Center for Precision Cancer Medicine Department of Biological Engineering and Biology Thesis Supervisor Accepted by………………………………………………………………………………………... Katharina Ribbeck Professor of Biological Engineering Chair of Graduate Program, Department of Biological Engineering Thesis Committee members Michael T. Hemann, Ph.D. Associate Professor of Biology Massachusetts Institute of Technology Douglas A. Lauffenburger, Ph.D. (Chair) Ford Professor of Biological Engineering, Chemical Engineering, and Biology Massachusetts Institute of Technology Michael B. Yaffe, M.D., Ph.D. (Thesis Supervisor) David H. Koch Professor of Science Prof. of Biology and Biological Engineering Massachusetts Institute of Technology 2 CRISPRi Screens to Identify Combination Therapies for the Improved Treatment of Ovarian Cancer By Erika Daphne Handly B.S. Chemical Engineering Brigham Young University, 2014 Submitted to the Department of Biological Engineering in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Engineering ABSTRACT Ovarian cancer is the fifth leading cause of cancer death for women in the United States, with only modest improvements in patient survival in the past few decades. Standard-of-care consists of surgical debulking followed by a combination of platinum and taxane agents, but relapse and resistance frequently occur. To identify genes that confer sensitivity or resistance in tumor cells treated with platinum chemotherapeutics, I performed genome-wide screens combining cisplatin or oxaliplatin with CRISPRi pooled gene knockdowns. Screens were analyzed at 9-days to mimic patient care, and at 48-hours to isolate the short-term DNA damage response. Genes whose knockdown caused sensitivity to the platinum chemotherapeutics were identified through a multi-objective optimization approach to account for knockdown efficiencies and variances in sequencing depth. To filter the noise in the genome-wide screen and more confidently identify ‘hits,’ a smaller pooled CRISPRi screen of four hundred targets was designed, and a few ‘hits’ were validated. Interestingly, knockdown of FAAP24, a component of the FA core complex, was found to sensitize multiple ovarian cancer cells to platinum compounds, and thus may be a promising candidate for a combination treatment with oxaliplatin and cisplatin. Chapter 5 details an implementation of a combination therapy with cisplatin using peptide nanoparticles. Peptide nanoparticles are a promising therapeutic for the delivery of siRNA and allow for targeting of specific proteins that are difficult to inhibit with small molecular inhibitors; specifically, nanoplexes allowed for the targeting of the REV3 protein, the catalytic component of the translesion synthesis polymerase. Interfering with REV3 expression through siRNA has a synergistic effect with cisplatin treatment in both human and mouse models of lung cancer, indicating that REV3 is an excellent target to combine with cisplatin therapies. This REV3 knock- down sensitivity was also extended to human ovarian cancer cell lines, indicating the potential of the combination treatment for both lung and ovarian cancers. Thesis Supervisor: Michael B. Yaffe Title: David H. Koch Professor of Science; Prof. of Biology and Biological Engineering 3 Acknowledgments I would like to thank everyone who made the work for my thesis possible, specifically the Ovarian Cancer Research Foundation (OCRF), the Koch Institute of Integrative Cancer Research, the Biological Engineering Program at MIT, and the Center for Precision Cancer Medicine (CPCM) for providing the funding for this work. I would thank my advisor, Michael Yaffe, for his scientific insights, support both in science and in life, and dedication to the proper training of young scientists. He is an excellent hypothesis generator and has an ability to connect topic that most people would think are disparate fields due to his eclectic interests. My thesis committee, Douglas Lauffenburger and Michael Hemann, gave fantastic ideas and progressed the work on the project greatly. My lab-mates were instrumental for teaching me lab techniques, engaging in scientific discussion, and keeping me sane. Special acknowledgements for Yi Wen Kong, Christian Braun, Tatiana Netterfield and Jesse Patterson for directly helping me on my work. Thank you for also being kind and fun to work with. Also, special thanks to my bay mates Tatiana Netterfield and Sriram Ganapathy for talking about life and science, and making coming into work fun and positive. Brian Joughin and Pau Creixell were very patient helping me with any and all computation questions. Additionally, thank you to all the people who entertained me in tissue culture and kept me entertained during long tissue culture sessions; notable good talkers include Ian Cannell, Bert van de Kooij, Karl Merrick and Sanjeev Dhara. Leny Gocheva, the director of research at the Koch Institute, has always taken time to be supportive of me, provide words of encouragement, and is amazing at editing (with quick turnarounds!). Thank you to our lab support team – Susanne Swartwout, for keeping the lab functional and working with a chaotic group of scientists, and Tom Dietzel, for keeping Mike on track and being master of the schedule. I had some great mentors through undergraduate work as well that should be mentioned. William Pitt let me research in his lab as a freshman in undergraduate, and gave me one of my first experiences with biomedical research. Brian Woodfield also mentored me as an early researcher and was very fun, intelligent, and inspirational. Christian Metallo let me study under him for a summer internship with the Amgen program, and the skills I learned in that lab were the most relevant to my research today. I would not have been prepared for MIT without that internship and his guidance. Finally, I would like to thank Dr. Todo, Dr. Hiroshi, and Dr. Asahi, who let me study with them at Hokkaido University and who worked extremely hard to teach me in English when it was not their primary language (I speak Japanese, but my science Japanese vocabulary is limited). I was very lucky to have the opportunity to study with them. I come from a wonderful family who has been supportive of every venture I have chosen to pursue. My parents, Paul and Kyoko Handly, are a constant source of support and encouragement, and obviously played a crucial role in who I am today. I am very grateful for everything they have done, and continue to do. My siblings, Naomi and Jonah, are a source of inspiration and fun, and my older sister Naomi has been leading the way in academic studies since I was born. I have a great role model in her. My husband, Seth Vogel, has done a great job encouraging me to work hard and has been a source of comfort and commiseration when science does not work. With Seth, 4 I gained a whole other family as well, who have been supportive and encouraging to me as well. My grandpa, Tatsuo Izumi, believed in my scientific abilities very early on, and invested time in learning about the biomedical sciences and set me up with my first internship studying diabetes. He emphasized hard work and I miss his random phone calls in my life. My thanks extend to a whole community of friends, roommates, and classmates (not necessary in distinct categories) who have been inspirational and supportive of me. The Biological Engineering program has been a great community of classmates to study and grow with. Specific thanks to Ally Huang – for being a great roommate and friend, George Sun – for supporting me through my first few times trying to do computational work and being a hilarious friend, and Malvika Verma – for being my running buddy and keeping me physically and mentally healthy through graduate school. Corinne Saltzman was a great roommate through graduate school, and still motivates me to work hard and have fun. My undergraduate roommate, Heidi Carlston, is still one of my best friends and person I go to for random fun ideas and just generally life advice. My church community in general has always provided support and reassurance, and helped keep my faith strong through graduate school. Finally, I would like to acknowledge some key inspirations for going into cancer research. I have multiple family members who has have died of cancer, which has shaped my career trajectory and has motivated me to join the "fight" against cancer. My grandmother, Setsuko Izumi, died while I was young of pancreatic cancer and my aunt, Oko Izumi, died of breast cancer while I was in High School. Both cases were jarring and demonstrated the devastating effects that cancer can have on a family. While I was in college, my grandmother, Cristel Handly, died of high grade serous ovarian cancer, which is the same type of cancer I have the opportunity to study today. I am grateful I have had so many good people in my life who still continue
Load more

Recommended publications
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point
    [Show full text]
  • Datasheet: VMA00937 Product Details
    Datasheet: VMA00937 Description: MOUSE ANTI CIAPIN1 Specificity: CIAPIN1 Format: Purified Product Type: PrecisionAb Monoclonal Clone: AB04/1G9 Isotype: IgG1 Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio- rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 The PrecisionAb label is reserved for antibodies that meet the defined performance criteria within Bio-Rad's ongoing antibody validation programme. Click here to learn how we validate our PrecisionAb range. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependent on sample type. Target Species Human Product Form Purified IgG - Liquid Preparation Mouse monoclonal antibody affinity purified on Protein G from tissue culture supernatant Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide Stabilisers Approx. Protein IgG concentration 1.0 mg/ml Concentrations Immunogen E. coli-derived recombinant protein of amino acids 1-312 of human CIAPIN1 Page 1 of 3 External Database Links UniProt: Q6FI81 Related reagents Entrez Gene: 57019 CIAPIN1 Related reagents Fusion Partners Spleen cells from immunised BALB/c mice were fused with cells of the mouse SP2/0 myeloma cell line Specificity Mouse anti CIAPIN1 antibody recognizes anamorsin, also known as cytokine-induced apoptosis inhibitor 1. CIAPIN1 is an electron transfer protein required for assembly of cytosolic iron-sulfur clusters, a family of cofactors critical for many cellular functions (Lipper et al.
    [Show full text]
  • ACE2 Interaction Networks in COVID-19: a Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors
    Journal of Clinical Medicine Article ACE2 Interaction Networks in COVID-19: A Physiological Framework for Prediction of Outcome in Patients with Cardiovascular Risk Factors Zofia Wicik 1,2 , Ceren Eyileten 2, Daniel Jakubik 2,Sérgio N. Simões 3, David C. Martins Jr. 1, Rodrigo Pavão 1, Jolanta M. Siller-Matula 2,4,* and Marek Postula 2 1 Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, Santo Andre 09606-045, Brazil; zofi[email protected] (Z.W.); [email protected] (D.C.M.J.); [email protected] (R.P.) 2 Department of Experimental and Clinical Pharmacology, Medical University of Warsaw, Center for Preclinical Research and Technology CEPT, 02-091 Warsaw, Poland; [email protected] (C.E.); [email protected] (D.J.); [email protected] (M.P.) 3 Federal Institute of Education, Science and Technology of Espírito Santo, Serra, Espírito Santo 29056-264, Brazil; [email protected] 4 Department of Internal Medicine II, Division of Cardiology, Medical University of Vienna, 1090 Vienna, Austria * Correspondence: [email protected]; Tel.: +43-1-40400-46140; Fax: +43-1-40400-42160 Received: 9 October 2020; Accepted: 17 November 2020; Published: 21 November 2020 Abstract: Background: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (coronavirus disease 2019; COVID-19) is associated with adverse outcomes in patients with cardiovascular disease (CVD). The aim of the study was to characterize the interaction between SARS-CoV-2 and Angiotensin-Converting Enzyme 2 (ACE2) functional networks with a focus on CVD. Methods: Using the network medicine approach and publicly available datasets, we investigated ACE2 tissue expression and described ACE2 interaction networks that could be affected by SARS-CoV-2 infection in the heart, lungs and nervous system.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Location Analysis of Estrogen Receptor Target Promoters Reveals That
    Location analysis of estrogen receptor ␣ target promoters reveals that FOXA1 defines a domain of the estrogen response Jose´ e Laganie` re*†, Genevie` ve Deblois*, Ce´ line Lefebvre*, Alain R. Bataille‡, Franc¸ois Robert‡, and Vincent Gigue` re*†§ *Molecular Oncology Group, Departments of Medicine and Oncology, McGill University Health Centre, Montreal, QC, Canada H3A 1A1; †Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6; and ‡Laboratory of Chromatin and Genomic Expression, Institut de Recherches Cliniques de Montre´al, Montreal, QC, Canada H2W 1R7 Communicated by Ronald M. Evans, The Salk Institute for Biological Studies, La Jolla, CA, July 1, 2005 (received for review June 3, 2005) Nuclear receptors can activate diverse biological pathways within general absence of large scale functional data linking these putative a target cell in response to their cognate ligands, but how this binding sites with gene expression in specific cell types. compartmentalization is achieved at the level of gene regulation is Recently, chromatin immunoprecipitation (ChIP) has been used poorly understood. We used a genome-wide analysis of promoter in combination with promoter or genomic DNA microarrays to occupancy by the estrogen receptor ␣ (ER␣) in MCF-7 cells to identify loci recognized by transcription factors in a genome-wide investigate the molecular mechanisms underlying the action of manner in mammalian cells (20–24). This technology, termed 17␤-estradiol (E2) in controlling the growth of breast cancer cells. ChIP-on-chip or location analysis, can therefore be used to deter- We identified 153 promoters bound by ER␣ in the presence of E2. mine the global gene expression program that characterize the Motif-finding algorithms demonstrated that the estrogen re- action of a nuclear receptor in response to its natural ligand.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]
  • Macropinocytosis Requires Gal-3 in a Subset of Patient-Derived Glioblastoma Stem Cells
    ARTICLE https://doi.org/10.1038/s42003-021-02258-z OPEN Macropinocytosis requires Gal-3 in a subset of patient-derived glioblastoma stem cells Laetitia Seguin1,8, Soline Odouard2,8, Francesca Corlazzoli 2,8, Sarah Al Haddad2, Laurine Moindrot2, Marta Calvo Tardón3, Mayra Yebra4, Alexey Koval5, Eliana Marinari2, Viviane Bes3, Alexandre Guérin 6, Mathilde Allard2, Sten Ilmjärv6, Vladimir L. Katanaev 5, Paul R. Walker3, Karl-Heinz Krause6, Valérie Dutoit2, ✉ Jann N. Sarkaria 7, Pierre-Yves Dietrich2 & Érika Cosset 2 Recently, we involved the carbohydrate-binding protein Galectin-3 (Gal-3) as a druggable target for KRAS-mutant-addicted lung and pancreatic cancers. Here, using glioblastoma patient-derived stem cells (GSCs), we identify and characterize a subset of Gal-3high glio- 1234567890():,; blastoma (GBM) tumors mainly within the mesenchymal subtype that are addicted to Gal-3- mediated macropinocytosis. Using both genetic and pharmacologic inhibition of Gal-3, we showed a significant decrease of GSC macropinocytosis activity, cell survival and invasion, in vitro and in vivo. Mechanistically, we demonstrate that Gal-3 binds to RAB10, a member of the RAS superfamily of small GTPases, and β1 integrin, which are both required for macro- pinocytosis activity and cell survival. Finally, by defining a Gal-3/macropinocytosis molecular signature, we could predict sensitivity to this dependency pathway and provide proof-of- principle for innovative therapeutic strategies to exploit this Achilles’ heel for a significant and unique subset of GBM patients. 1 University Côte d’Azur, CNRS UMR7284, INSERM U1081, Institute for Research on Cancer and Aging (IRCAN), Nice, France. 2 Laboratory of Tumor Immunology, Department of Oncology, Center for Translational Research in Onco-Hematology, Swiss Cancer Center Léman (SCCL), Geneva University Hospitals, University of Geneva, Geneva, Switzerland.
    [Show full text]
  • Down Regulation of CIAPIN1 Reverses Multidrug Resistance in Human Breast Cancer Cells by Inhibiting MDR1
    Molecules 2012, 17, 7595-7611; doi:10.3390/molecules17067595 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Down Regulation of CIAPIN1 Reverses Multidrug Resistance in Human Breast Cancer Cells by Inhibiting MDR1 Dan Lu 1,†,*, Zhibo Xiao 2,†, Wenxiu Wang 1, Yuqing Xu 1, Shujian Gao 1, Lili Deng 1, Wen He 1, Yu Yang 1, Xiaofei Guo 1 and Xuemei Wang 1 1 Department of Oncology, the Second Affiliated Hospital of Harbin Medical University, Harbin 150086, China 2 Department of Plastic Surgery, the Second Affiliated Hospital of Harbin Medical University, Harbin 150086, China † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]. Received: 13 March 2012; in revised form: 11 June 2012 / Accepted: 11 June 2012 / Published: 20 June 2012 Abstract: Cytokine-induced apoptosis inhibitor 1 (CIAPIN1), initially named anamorsin, a newly indentified antiapoptotic molecule is a downstream effector of the receptor tyrosine kinase-Ras signaling pathway. Current study has revealed that CIAPIN1 may have wide and important functions, especially due to its close correlations with malignant tumors. However whether or not it is involved in the multi-drug resistance (MDR) process of breast cancer has not been elucidated. To explore the effect of CIAPIN1 on MDR, we examined the expression of P-gp and CIAPIN1 by immunohistochemistry and found there was positive correlation between them. Then we successfully interfered with RNA translation by the infection of siRNA of CIAPIN1 into MCF7/ADM breast cancer cell lines through a lentivirus, and the expression of the target gene was significantly inhibited.
    [Show full text]
  • Genetic, Cytogenetic and Physical Refinement of the Autosomal Recessive CMT Linked to 5Q31ð Q33: Exclusion of Candidate Genes I
    European Journal of Human Genetics (1999) 7, 849–859 © 1999 Stockton Press All rights reserved 1018–4813/99 $15.00 t http://www.stockton-press.co.uk/ejhg ARTICLE Genetic, cytogenetic and physical refinement of the autosomal recessive CMT linked to 5q31–q33: exclusion of candidate genes including EGR1 Ang`ele Guilbot1, Nicole Ravis´e1, Ahmed Bouhouche6, Philippe Coullin4, Nazha Birouk6, Thierry Maisonobe3, Thierry Kuntzer7, Christophe Vial8, Djamel Grid5, Alexis Brice1,2 and Eric LeGuern1,2 1INSERM U289, 2F´ed´eration de Neurologie and 3Laboratoire de Neuropathologie R Escourolle, Hˆopital de la Salpˆetri`ere, Paris 4Laboratoire de cytog´en´etique, Villejuif 5G´en´ethon, Evry, France 6Service de Neurologie, Hˆopital des Sp´ecialit´es, Rabat, Morocco 7Service de Neurologie, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland 8Service D’EMG et de pathologie neuromusculaire, Hˆopital neurologique Pierre Wertheimer, Lyon, France Charcot-Marie-Tooth disease is an heterogeneous group of inherited peripheral motor and sensory neuropathies with several modes of inheritance: autosomal dominant, X-linked and autosomal recessive. By homozygosity mapping, we have identified, in the 5q23–q33 region, a third locus responsible for an autosomal recessive form of demyelinating CMT. Haplotype reconstruction and determination of the minimal region of homozygosity restricted the candidate region to a 4 cM interval. A physical map of the candidate region was established by screening YACs for microsatellites used for genetic analysis. Combined genetic, cytogenetic and physical mapping restricted the locus to a less than 2 Mb interval on chromosome 5q32. Seventeen consanguineous families with demyelinating ARCMT of various origins were screened for linkage to 5q31–q33.
    [Show full text]