A Wealth of Discovery Built on the Human Genome Project — by the Numbers

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Comment A wealth of discovery built on the Human Genome Project — by the numbers Alexander J. Gates, Deisy Morselli Gysi, Manolis Kellis & Albert-László Barabási A new analysis traces the story of the draft genome’s impact on genomics since 2001, linking its effects on publications, drug approvals and understanding of disease. he 20th anniversary of the publica- research has changed over time. The trends hunt1,2. Indeed, evidence for the first tion of the first draft of the human remain when we control for the growth in biol- protein-coding gene emerged in 1902, with genome1,2 offers an opportunity to ogy publications over the same period (see SI, the discovery of the hormone secretin4 (SCT track how the project has empowered Fig. S6). We did not control for time since the gene), 50 years before the structure of DNA research into the genetic roots of discovery of genes, but estimate that doing so was uncovered, and 75 years before genome Thuman disease, changed drug discovery and would not have altered our conclusions. sequencing became commonplace. Our helped to revise the idea of the gene itself. These connections offer a snapshot of the analysis shows that, between the start of the Here we distil these impacts and trends. We evolution of the research landscape before and HGP in 1990 and its completion in 2003 (after combined several data sets to quantify the dif- after the HGP. It shows an intense focus on a the draft was published in 2001), the number ferent types of genetic element that have been small number of ‘superstar’ protein-coding of discovered (or ‘annotated’) human genes discovered and that generated publications, genes, potentially to the detriment of interest- grew drastically. It levelled out suddenly in the and how the pattern of discovery and publish- ing work that could be done on others. There mid-2000s at about 20,000 protein-coding ing has changed over the years. Our analysis has been a pivot towards non-protein-coding genes (see ‘Twenty years of junk, stars and linked together data including 38,546 RNA sections of the genome, and to understand- drugs: Non-coding elements’), far short of the transcripts; around 1 million single nucleotide ing interactions between genetic material 100,000-strong estimate previously adopted polymorphisms (SNPs); 1,660 human diseases by many in the scientific community2. with documented genetic roots; 7,712 approved Although discoveries of protein-coding and experimental pharmaceuticals; and genes reached a plateau, interest in individual 704,515 scientific publications between 1900 By 2017, 22% of gene- genes grew rapidly following the HGP. Each and 2017 (see Supplementary information; SI ). year since 2001, between 10,000 and 20,000 The results highlight how the Human related publications papers mentioning protein-coding genes have Genome Project (HGP), with its comprehensive referenced just 1% been published (see SI; Fig. S3). list of protein-coding genes, spurred a new era However, that interest has focused largely of elucidating the function of the non-coding of genes.” on just a few genes. Before 1990, HBA1 was the portion of the genome and paved the way most studied because it encodes one of the for therapeutic developments. Crucially, the proteins in adult haemoglobin. From 1990, results track the emergence of a systems-level and proteins. And drug discovery has been attention then shifted to CD4 (based on the view of biology alongside the conventional sin- grounded in just a few protein targets. cumulative number of publications) given the gle-gene perspective, as researchers mapped Some of these trends are familiar to biolo- protein’s involvement in T-cell immunity and the interactions between cellular building gists, but to quantify and visualize them is to as the cell receptor for HIV. Yet the interest in blocks (see ‘No jump for big teams’). consider them anew. these two genes pales next to the explosion There are limitations to our analysis. For There is no world without an HGP for com- of attention on individual genes following the example, there is no consensus on where a parison. So it is impossible to say whether draft 2001 HGP sequence. Some superstar gene starts and ends or, surprisingly, even these trends would have arisen anyway. Other genes, including TP53, TNF and EGFR, became what sequence exactly encodes some genes3. factors, from increased computing power to the subject of hundreds of publications a year, Multiple naming conventions are in use for sophisticated sequencing methods, also had with most other genes receiving scant atten- some genomic elements, so sometimes our a role in many of these developments. It is tion (see ‘Deep impact’ and ‘Twenty years of methodology did not connect them. And other nonetheless clear that the HGP’s catalogue junk, stars and drugs: Star genes’). We find links between publications and elements might catalysed the continuing genetic revolution. that, by 2017, 22% of gene-related publications not have been added to databases by authors. referenced just 1% of genes. Finally, our graphs end in 2017, because there Superstar genes Intense study is, of course, justified for can be a time lag between an article’s publica- The popular perception is that the HGP genes that have profound biological impor- tion and entry into the databases we used. marked the start of the intensive search for tance. A good example is TP53 — it is crucial However, we do not expect these issues protein-coding genes. In fact, the 2001 draft to cell growth and death, and leads to cancer to affect the trends we note in how genome HGP paper signalled the end of a decades-long when inactivated or altered. Variations in this 212 | Nature | Vol 590 | 11 February 2021 ©2021 Spri nger Nature Li mited. All ri ghts reserved. ©2021 Spri nger Nature Li mited. All ri ghts reserved. Tiny dots The gene ADRA1A is 3% of genes were targeted by 99 dierent not discussed by drugs, 5% of all those any publications. approved. It is the subject of just 130 publications. TNF is associated with 160 known diseases, the most of any gene. Top 8 genes 7 1. TP53 6 2. TNF 3. EGFR 4. IL6 5. VEGFA 6. APOE 8 7. TGFB1 8. MTHFR DEEP 5 4 IMPACT 3 The 19,757 genes that encode proteins are arranged according to their relative position along each of the chromosomes, shown as rings. The Number of diseases 10 50 150 plane marks the publication of the draft Human Genome Project in 2001. 2 Number of Length beneath the plane scales to the publications number of publications on a gene since 50 100 200 before 2001 then; height above it denotes 100 500 1,000 publications beforehand. The breadth of the base of each peak reflects the number of diseases associated with Number of each gene. A few genes, distributed publications across the genome and chromosomes, after 2001 have been studied intensely, as have non-coding elements in between (not shown). In the past two decades, Chromosomes ordered researchers have learnt that these by number of genes latter regions help to regulate the 1 dynamic code of life. 19 11 2 17 3 6 12 7 5 X 16 Long story 9 4 The gene TP53 on 10 8 chromosome 17 was 14 discovered in 1979. 15 20 Associated with most 22 13 cancers, it has since 18 accumulated 9,232 21 1 publications. Y M chromosome (mitochondrial DNA) SOURCE: BARABASI LAB BARABASI SOURCE: Nature | Vol 590 | 11 February 2021 | 213 ©2021 Spri nger Nature Li mited. All ri ghts reserved. ©2021 Spri nger Nature Li mited. All ri ghts reserved. Comment gene are found in more than 50% of tumour regions of genome that were called junk DNA, thousands of individuals; these included the sequences. It is mentioned in 9,232 publica- or the dark matter of the genome? Thanks in International HapMap Project8 (the third and tions between 1976 and 2017 (see SI, Fig. S4). large part to the HGP, it is now appreciated final phase of which was completed in 2010) One might assume that the more that is that the majority of functional sequences in and the 1000 Genomes Project9 (completed known about the same genes, the greater the human genome do not encode proteins. in 2015). These data sets, combined with the incentive would be to explore the rest of Rather, elements such as long non-coding advances in statistical analysis, ushered in the genome. Instead, the opposite happened RNAs, promoters, enhancers and countless genome-wide association studies (GWAS) of during the past two decades: more attention gene-regulatory motifs work together to countless traits, including height10, obesity11 was lavished on a select few. Despite this being bring the genome to life. Variation in these and susceptibility to complex diseases such flagged as a potential problem on the tenth regions does not alter proteins, but it can as schizophrenia12. anniversary5 of the draft genome’s publica- perturb the networks governing protein There are now more than 30,000 papers tion, there has been no course correction. expression. per year linking SNPs and traits. A large frac- Our previous work on other, very different tion of these associations are in the once-dis- systems from human social networks to the missed non-coding regions (see SI, Table S3). World Wide Web indicates that this vast imbal- Cellular function relies on weak and strong ance can be explained by a ‘rich-gets-richer’ The discovery of links between genetic material and proteins. dynamic6,7 rooted in social factors. It is likely Mapping out this network now complements that as the number of papers focusing on TP53 non-protein-coding the Mendelian perspective (see page 218).
Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
  • Manolis Kellis Piotr Indyk

    Manolis Kellis Piotr Indyk

    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
  • Prof. Manolis Kellis April 15, 2008

    Prof. Manolis Kellis April 15, 2008

    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
  • ENCODE Consortium Meeting

    ENCODE Consortium Meeting

    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
  • Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
  • ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
  • An Integrated Encyclopedia of DNA Elements in the Human Genome

    An Integrated Encyclopedia of DNA Elements in the Human Genome

    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.