ENCODE Consortium Meeting

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S. Collins, M.D., Ph.D. Laura Dillon, M.S. Director Program Analyst National Human Genome Research Institute Division of Extramural Research National Institutes of Health National Human Genome Research Institute Room 4B09 National Institutes of Health MSC 2152 Suite 4076 31 Center Drive MSC 9305 Bethesda, MD 20892-2152 5635 Fishers Lane (301) 594-7185 Bethesda, MD 20892-9305 (301) 402-0837 Fax (301) 435-2027 [email protected] (301) 480-2770 Fax [email protected] Christine Colvis, Ph.D. Program Director Sarah Quelen Djebali, Ph.D. National Institute on Drug Abuse Bioinformatics and Genomics Program National Institutes of Health Center for Genomic Regulation Neuroscience Center, Room 4282 Doctor Aiguader 88 MSC 9555 Barcelona 8003 6001 Executive Boulevard Spain Bethesda, MD 20892-9555 +34 933160110 (301) 435-1323 [email protected] [email protected] Michael O. Dorschner, Ph.D. Greg Crawford, Ph.D. Instructor Assistant Professor Division of Oncology Duke Institute for Genome Sciences & Policy Department of Medicine Duke University University of Washington Center for Interdusciplinary Engineering, WTC East, Suite 600 Medicine and Applied Sciences, Room 2353B 2211 Elliott Avenue 101 Science Drive Seattle, WA 98121 Durham, NC 27708 (206) 267-1091, ext. 211 (919) 684-8196 [email protected] [email protected] Tim Dreszer, M.S. Job Dekker, Ph.D., M.S. Genome Browser Software Developer Assistant Professor Center for Biomolecular Science and Program in Gene Function and Expression Engineering University of Massachusetts Medical School University of California, Santa Cruz Lazare Research Building, Room 519 Engineering II Building, Suite 501 364 Plantation Street Mail Stop CBSE/ITI Worcester, MA 01541 1156 High Street (508) 856-4371 Santa Cruz, CA 95064 [email protected] (831) 459-4937 [email protected] Mark Diekhans Research Staff Member Ian Dunham Center for Biomolecular Science and Ensembl Developer Engineering European Molecular Biology Laboratory University of California, Santa Cruz European Bioinformatics Institute Engineering II Building, Suite 501 Welcome Trust Genome Campus Mail Stop CBSE/ITI Hinxton, Cambridge CB10 1SD 1156 High Street United Kingdom Santa Cruz, CA 95064 +44-(0)1223-494 444 (831) 459-1418 +44-(0)1223-494 468 Fax [email protected] [email protected] - 2 - Laura Elnitski, Ph.D. Paul Flicek, D.Sc. Investigator and Head Team Leader Genomic Functional Analysis Section Vertebrate Genomics Genome Technology Branch European Molecular Biology Laboratory National Human Genome Research Institute European Bioinformatics Institute National Institutes of Health Hinxton Outstation Room 5N-01R Wellcome Trust Genome Campus MSC 9400 Hinxton, Cambridge CB10 1SD 5625 Fishers Lane United Kingdom Bethesda, MD 20892-9400 +44-(0)1223-494 444 (301) 451-0265 +44-(0)1223-494 468 Fax [email protected] [email protected] Ghia Marie Euskirchen, Ph.D. Seth Eric Frietze, Ph.D. Associate Research Scientist University of California, Davis Department of Molecular, Cellular and 1509 Oak Avenue Developmental Biology Davis, CA 95616 Yale University (617) 331-7324 Kline Biology Tower, Room 918 [email protected] 266 Whitney Avenue New Haven, CT 06511 Melissa Jane Fullwood (203) 432-3510 Genome Institute of Singapore (203) 432-6161 Fax Agency for Science Technology and Research [email protected] Room 02-01 60 Biopolis Street Peggy Farnham, Ph.D. Singapore 138672 Associate Director of Genomics Singapore Genome Center and Department of (65) 64788097 Pharmacology (65) 64789059 Fax University of California, Davis [email protected] Room 4512 1 Shields Avenue Terry Furey, Ph.D. Davis, CA 95616 Duke Institute for Genome Sciences & Policy (530) 754-4988 Duke University [email protected] 101 Science Drive P.O. Box 3382 Elise Feingold, Ph.D. Durham, NC 27708 Program Director, Genome Analysis (919) 668-4728 National Human Genome Research Institute [email protected] National Institutes of Health Suite 4076 Mark Gerstein, Ph.D. MSC 9305 Professor of Computational Biology and 5635 Fishers Lane Bioinformatics Bethesda, MD 20892-9305 Department of Molecular Biophysics and (301) 496-7531 Biochemistry (301) 480-2770 Fax Department of Computer Science [email protected] Yale University Bass Building, Room 432A Katalin Fejes-Toth, Ph.D. 266 Whitney Avenue Postdoctoral Fellow New Haven, CT 06511 Cold Spring Harbor Laboratory (203) 432-6105 1 Bungtown Road [email protected] Cold Spring Harbor, NY 11756 (516) 367-5042 (516) 367-8874 Fax [email protected] - 3 - Thomas Raymond Gingeras, Ph.D. Eric Green, M.D., Ph.D. Principal Investigator Scientific Director Encode Grant U54 Division of Intramural Research Affymetrix, Inc. Chief 3380 Central Expressway Genome Technology Branch Santa Clara, CA 95051 Director (408) 731-5175 NIH Intramural Sequencing Center (408) 732-7025 Fax National Human Genome Research Institute [email protected] National Institutes of Health Room 5222 Paul Giresi MSC 8002 Graduate Student 50 South Drive Department of Biology Bethesda, MD 20892-8002 The University of North Carolina at Chapel Hill (301) 402-2023 Fordham Hall, Room 407 (301) 480-2634 Fax Campus Box 3280 [email protected] Chapel Hill, NC 27599-3280 (919) 843-3229 Roderic Guigo, Ph.D. [email protected] Coordinator Bioinformatics and Genomics Programme Peter Good, Ph.D. Center for Genomic Regulation Program Director Professor Division of Extramural Research University Pompeu Fabra National Human Genome Research Institute Doctor Aiguader 88 National Institutes of Health Barcelona 8003 MSC 9305 Spain 5635 Fishers Lane +34 933160110 Bethesda, MD 20892-9305 [email protected] (301) 496-7531 [email protected] Mark S. Guyer, Ph.D. Director John M. Greally, M.D., Ph.D. Division of Extramural Research Director National Human Genome Research Institute Einstein Center for Epigenomics National Institutes of Health Albert Einstein College of Medicine Suite 4076 Ullmann Building, Room 911 MSC 9305 1300 Morris Park Avenue 5635 Fishers Lane Bronx, NY 10461 Bethesda, MD 20892-9305 (718) 430-2875 (301) 496-7531 (718) 430-8855 Fax (301) 480-2770 Fax [email protected] [email protected] Gregory Hannon, Ph.D. Professor Watson School of Biological Sciences Investigator Howard Hughes Medical Institute Cold Spring Harbor Laboratory 1 Bungtown Road Cold Spring Harbor, NY 11724 (516) 367-8889 (516) 367-8874 Fax [email protected] - 4 - Ross C. Hardison, Ph.D. Vishy Iyer, Ph.D. T. Ming Chu Professor of Biochemistry Associate Professor Department of Biochemistry and Molecular Center for Systems and Synthetic Biology Biology The University of Texas at Austin Center for Comparative Genomics and Molecular Biology Building, Room 3.212AA Bioinformatics 1 University Station A4800 Pennsylvania State University Austin, TX 78712 Wartik Laboratory, Room 304 (512) 232-7833 University Park, PA 16802 [email protected] (814) 863-0113 (814) 863-7024 Fax Edwin Jacox, Ph.D. [email protected] Genomic Functional Analysis Section Genome Technology Branch Jennifer Harrow National Human Genome Research Institute HAVANA Group Leader National Institutes of Health Informatics Department Room 5N-01 Wellcome Trust Sanger Institute 5625 Fishers Lane Genome Campus Bethesda, MD 20892 Hinxton, Cambridge CB10 1SA (301) 451-0268 United Kingdom [email protected] +44-(0)1223-496 830 +44-(0)1223-496 802 Fax Manolis Kellis, Ph.D. [email protected] Associate Professor of Computer Science Broad Institute of MIT and Harvard Rachel Harte, Ph.D., M.S. Room 32G-826 Bioinformatics Engineer 32 Vassar Street Center for Biomolecular Science and Cambridge, MA 02139 Engineering (617) 253-2419 University of California, Santa Cruz (617)
Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition

    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
  • Manolis Kellis Piotr Indyk

    Manolis Kellis Piotr Indyk

    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
  • Prof. Manolis Kellis April 15, 2008

    Prof. Manolis Kellis April 15, 2008

    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
  • Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)The)Circuitry)) Of)Complex)Disease!

    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden

    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq

    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
  • ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome

    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing

    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
  • An Integrated Encyclopedia of DNA Elements in the Human Genome

    An Integrated Encyclopedia of DNA Elements in the Human Genome

    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St

    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
  • Analysis, Visualization, and Machine Learning of Epigenomic Data

    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2017-12-12 Analysis, Visualization, and Machine Learning of Epigenomic Data Michael J. Purcaro University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Computational Biology Commons, Genomics Commons, and the Integrative Biology Commons Repository Citation Purcaro MJ. (2017). Analysis, Visualization, and Machine Learning of Epigenomic Data. GSBS Dissertations and Theses. https://doi.org/10.13028/M23T1Q. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/938 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial 4.0 License This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. ANALYSIS, VISUALIZATION, AND MACHINE LEARNING OF EPIGENOMIC DATA A Dissertation Presented By MICHAEL JOSEPH PURCARO Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY DECEMBER 12, 2017 BIOINFORMATICS AND COMPUTATIONAL BIOLOGY M.D., PH.D. PROGRAM I-ii ANALYSIS, VISUALIZATION, AND MACHINE LEARNING OF EPIGENOMIC DATA A Dissertation Presented