DOCSLIB.ORG

REGULATORY GENOMICS - REGULATORYSYSTEMS BIOLOGY GENOMICS - DREAM4 Wed Dec 2-Sun Dec 6, 2009

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
REGULATORY GENOMICS - REGULATORYSYSTEMS BIOLOGY GENOMICS - DREAM4 Wed Dec 2-Sun Dec 6, 2009 Abstracts of papers, posters and talks presented at the 2009 Joint RECOMB Satellite Conference on REGULATORY GENOMICS - REGULATORYSYSTEMS BIOLOGY GENOMICS - DREAM4 Wed Dec 2-Sun Dec 6, 2009 YDL051W YKR057W MIT / Broad Institute / CSAIL YNL232W YLR179C YER060WA YNL277W YPL206C YJR139C YJR010W YPR167C YNR051C YDR502C YFR030W YDR253C YOR038C YPL038W YIR017C YNL103W YER114C YOL064C YJR138W YER092W YOR344C YJR137C YGR204W YLR157C YAL012W YBR144C YER091C YLR158C YLR303W YJR060W Asparagine catabolism Cysteine biosynthetic process Methionine metabolism Sulfur acid metabolism YLR155C YBR145W Other or unknown function Conference Chairs: Manolis Kellis, MIT Ziv Bar-Joseph, CMU Andrea Califano, Columbia Gustavo Stolovitzky, IBM REGULATORY GENOMICS - SYSTEMS BIOLOGY - DREAM4 2009 Abstracts of papers, posters and talks presented at the 2009 Joint RECOMB Satellite Conference on REGULATORY GENOMICS - REGULATORYSYSTEMS BIOLOGY GENOMICS - DREAM4 Wed Dec 2-Sun Dec 6, 2009 MIT / Broad Institute / CSAIL Conference Chairs: Manolis Kellis, MIT Ziv Bar-Joseph, CMU Andrea Califano, Columbia Gustavo Stolovitzky, IBM Conference Chairs: Manolis Kellis ..................................................... Associate Professor, MIT Ziv Bar-Joseph ................................................ Associate Professor, CMU Andrea Califano ........................................ Professor, Columbia University Gustavo Stolovitzky.......................................Systems Biology Group, IBM In Partnership With: PLoS Computational Biology .........................editor: Catherine Nancarrow PLos ONE .................................................................. editor: Peter Binfield Associate Editor, PLoS Computational Biology Uwe Ohler Session Chairs: Regulatory Genomics: DREAM4: Systems Biology: Nitin Baliga Fritz Roth Diego di Bernardo Panayiotis (Takis) Benos Peter Sorger James Collins Michael Brent Yuval Kluger Christina Leslie Avi Ma'ayan Uwe Ohler Franziska Michor Ron Shamir Roded Sharan Pablo Tamayo Dennis Vitkup Program Committee: Regulatory Genomics: Hao Li Eleazar Eskin Manolis Kellis, chair Eran Segal Igor Jurisica Ziv Bar-Joseph, chair Ron Shamir Pascal Kahlem Orly Alter Saurabh Sinha Andre Levchenko Nitin S Baliga Mona Singh Avi Ma'ayan Panayiotis (Takis) Christopher Workman Adam Margolin Benos Satoru Miyano Mathieu Blanchette Systems Biology and Dana Pe'er Michael R. Brent DREAM: Theodore Perkins Albert Erives Andrea Califano, chair Timothy Ravasi Eleazar Eskin Gustavo Stolovitzky, Frederick Roth Ernest Fraenkel chair Michael Samoilov Nir Friedman M. Madan Babu Roded Sharan Mikhail Gelfand Gary Bader Mona Singh Sridhar Hannenhalli Joel Bader Pavel Sumazin Tim Hughes Diego di Bernardo Denis Thieffry Uri Keich Jim Collins Ioannis Xenarios Christina Leslie Joaquin Dopazo Local Organization and Student Volunteers: Local organization Matt Edwards CMU Monica Concepcion Chuck Epstein Anthony Gitter Sally Lee Sudeshna Fisch Peter Huggins Pia Handsom Taran Gujral Hai-Son Le Karen Shirer Christina Harview Henry Lin Eliana Hechter Shan Zhong Local Volunteers: Yan Meng Guy Zinman Loyal Goff Michal Rabani Charlie Frogner Erroll Rueckert Other Patrycja Missiuro Mark Sevecka Betty Chang Yang Ding Tal Shay Antonina Mitrofanova Mary Addonizio Eboney Smith Yeison Rodriguez Adam Callahan Li Wang Cover art credit: Yeast functional modules in amino-acid metabolism, Daniel Marbach Gene expression atlas for Drosophila Blastoderm. Fowlkes, DePace, Malik. Human membrane receptor interactions, Yanjun Qi, Judith Klein-Seetharaman. Special thanks for booklet assembly to: Michelle Martin Online material: All talks will be videotaped and shared freely online with presenter’s permission. All papers accepted and published will be available freely online from PLoS. All videos of accepted papers will be linked to the papers through the PLoS site. Photos from the meeting will be made available through the conference website. All invited talks will be sync’ed with slides in an interactive site by the New York Academy of Sciences. All these materials can be accessed at any time from: http://compbio.mit.edu/recombsat/ For any inquiries, please contact the conference chairs at: [email protected] Industry and Government Sponsors: The organizers wish to thank the following industrial and government sponsors for their generous support of this conference. The NIH National Centers for Biomedical Computing and the MAGNet Center at Columbia University The New York Academy of Sciences IBM Research Scientific Partners The organizers also wish to thank the following journals for their invaluable support in publishing conference manuscripts. PLoS Computational Biology PLoS ONE Local Hosts and Organization Many thanks also go to our local hosts for making this meeting possible. Massachusetts Broad Institute of Computer Science Institute of MIT and Harvard and Artificial Technology Intelligence Lab Wednesday December 2nd, 2009 Dear attendees, Welcome to the 6th Annual RECOMB Satellite on Regulatory Genomics, the 5th Annual RECOMB Satellite on Systems Biology, and the 4th Annual DREAM reverse engineering challenges. The goal of this meeting is to bring together computational and experimental scientists in the area of regulatory genomics and systems biology, to discuss current research directions, latest findings, and establish new collaborations towards a systems-level understanding of activities in the cell. The next 5 days will consist of keynote presentations, oral presentations selected from submitted full length papers and 1-page abstracts, and posters presentations also selected from submitted abstracts. But most importantly, it’s an opportunity to connect, discuss, exchange ideas, think together, and plan ahead. For the second year in a row this meeting has been sold out, this year more than a month in advance. We have also received a record number of more than 50 full length papers and more than 250 abstracts, resulting in a scientific program of outmost quality. All submitted full length papers were fully reviewed by the program committee and 17 were accepted to the conference and by our partner journals, with 8 papers going to PLoS Computational Biology and 9 papers to PLoS ONE. These papers should appear online by the time the meeting starts, and will be ultimately linked together with the corresponding talks on the PLoS website, providing a new means for science dissemination. All abstracts were reviewed by the conference chairs and 16 additional session chairs, resulting in 50 abstracts selected for oral presentation, and most remaining abstracts for poster presentation. Welcome to Boston, for what promises to be a very exciting meeting! The conference chairs: Regulatory Genomics: Manolis Kellis (MIT), Ziv Bar-Joseph (CMU). Systems/DREAM: Andrea Califano (Columbia), Gustavo Stolovitzky (IBM). RECOMB Regulatory Genomics 2009 ( Full length manuscript; ► Invited talk; Accepted abstract) Wednesday, Dec. 2, 2009 3pm Conference check-in open, Poster session I set-up 5pm Welcome Remarks 5:15► Mark Biggin: Evidence for Quantitative Transcription Networks ...1 5:45 Sarah E. Calvo: Widespread translational repression...................2 6pm Hilal Kazan: Learning binding preferences....................................3 6:15 Igor Ulitsky: Towards prediction of MicroRNA function..………… 4 Light snacks – 6:30-6:45pm 6:45 Clifford A. Meyer: Inferring key transcriptional regulators .............5 7pm Jason Ernst: Genome-wide discovery of chromatin states……….6 7:15 Mattia Pelizzola: Human DNA methylomes at base resolution .....7 7:30 Leonid Mirny: Different strategies for gene regulation……………8 7:45► Bob Waterston: Deciphering C. Elegans embryonic network.......9 Regulatory Genomics Welcome Reception/Poster Session I 8:15pm-9:45pm Hors d’oeuvres, snacks, refreshments, cash bar Thursday, Dec. 3, 2009 Breakfast – 8am 9am► Rick Young: Programming cell state ...........................................10 9:30 Jesse M. Gray: Widespread RNA polymerase II recruitment......11 9:45 Yue Zhao: Inferring binding energies ..........................................12 10am Guillaume Bourque: Binding site turnover in stem cells ………..13 Coffee / Snacks / Fruit Break – 10:15-10:45am 10:45 Michael Brodsky: Identification and analysis of regulatory regions14 11am Yang Ding: Exact calculation of partition function ………………15 11:15 Sheng Zhong: A analysis of transcription factor interactions….16 11:30 Pouya Kheradpour: Regulatory motifs associated with TF........17 11:45 Quan Zhong: Edgetic perturbation models of human ................18 Lunch Break / Networking Opportunities – 12-1pm 1pm► Naama Barkai: Evolution of nucleosome positioning .................19 1:30 Pieter Meysman: Structural DNA for the prediction of binding....20 1:45 Claes Wadelius: Nucleosomes are positioned in exons..............21 2pm Eugene Bolotin: Identification of human HNF4 target genes….. 22 Coffee / Snacks / Fruit Break – 2:15-2:45pm Poster set-up for Session II 2:45 Damian Wójtowicz: Mapping of non-B DNA structures ...............23 3pm Elizabeth A. Rach: The landscape of transcription initiation .......24 3:15 Julia Lasserre: TSS detection......................................................25 3:30 Ron Shamir : Signaling pathways analysis tool...........................26 Regulatory Genomics Poster Session II – 3:45pm-5:15pm Hors d’oeuvres, snacks, refreshments 5:15► Nikolaus Rajewsky: Post-transcriptional gene regulation............27 5:45 Stein Aerts : Regulatory network for retinal differentiation ..........28 6pm Raja Jothi: A link
Load more

Recommended publications
  • Bonnie Berger Named ISCB 2019 ISCB Accomplishments by a Senior
    F1000Research 2019, 8(ISCB Comm J):721 Last updated: 09 APR 2020 EDITORIAL Bonnie Berger named ISCB 2019 ISCB Accomplishments by a Senior Scientist Award recipient [version 1; peer review: not peer reviewed] Diane Kovats 1, Ron Shamir1,2, Christiana Fogg3 1International Society for Computational Biology, Leesburg, VA, USA 2Blavatnik School of Computer Science, Tel Aviv University, Tel Aviv, Israel 3Freelance Writer, Kensington, USA First published: 23 May 2019, 8(ISCB Comm J):721 ( Not Peer Reviewed v1 https://doi.org/10.12688/f1000research.19219.1) Latest published: 23 May 2019, 8(ISCB Comm J):721 ( This article is an Editorial and has not been subject https://doi.org/10.12688/f1000research.19219.1) to external peer review. Abstract Any comments on the article can be found at the The International Society for Computational Biology (ISCB) honors a leader in the fields of computational biology and bioinformatics each year with the end of the article. Accomplishments by a Senior Scientist Award. This award is the highest honor conferred by ISCB to a scientist who is recognized for significant research, education, and service contributions. Bonnie Berger, Simons Professor of Mathematics and Professor of Electrical Engineering and Computer Science at the Massachusetts Institute of Technology (MIT) is the 2019 recipient of the Accomplishments by a Senior Scientist Award. She is receiving her award and presenting a keynote address at the 2019 Joint International Conference on Intelligent Systems for Molecular Biology/European Conference on Computational Biology in Basel, Switzerland on July 21-25, 2019. Keywords ISCB, Bonnie Berger, Award This article is included in the International Society for Computational Biology Community Journal gateway.
    [Show full text]
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
    [Show full text]
  • DREAM: a Dialogue on Reverse Engineering Assessment And
    DREAM:DREAM: aa DialogueDialogue onon ReverseReverse EngineeringEngineering AssessmentAssessment andand MethodsMethods Andrea Califano: MAGNet: Center for the Multiscale Analysis of Genetic and Cellular Networks C2B2: Center for Computational Biology and Bioinformatics ICRC: Irving Cancer RResearchesearch Center Columbia University 1 ReverseReverse EngineeringEngineering • Inference of a predictive (generative) model from data. E.g. argmax[P(Data|Model)] • Assumptions: – Model variables (E.g., DNA, mRNA, Proteins, cellular sub- structures) – Model variable space: At equilibrium, temporal dynamics, spatio- temporal dynamics, etc. – Model variable interactions: probabilistics (linear, non-linear), explicit kinetics, etc. – Model topology: known a-priori, inferred. • Question: – Model ~= Reality? ReverseReverse EngineeringEngineering Data Biological System Expression Proteomics > NFAT ATGATGGATG CTCGCATGAT CGACGATCAG GTGTAGCCTG High-throughput GGCTGGA Structure Sequence Biology … Biochemical Model Validation Control X-Y- Control X+Y+ Y X Z X+Y- X-Y+ Control Control Specific Prediction SomeSome ReverseReverse EngineeringEngineering MethodsMethods • Optimization: High-Dimensional objective function max corresponds to best topology – Liang S, Fuhrman S, Somogyi (REVEAL) – Gat-Viks and R. Shamir (Chain Functions) – Segal E, Shapira M, Regev A, Pe’er D, Botstein D, KolKollerler D, and Friedman N (Prob. Graphical Models) – Jing Yu, V. Anne Smith, Paul P. Wang, Alexander J. Hartemink, Erich D. Jarvis (Dynamic Bayesian Networks) – … • Regression: Create a general model of biochemical interactions and fit the parameters – Gardner TS, di Bernardo D, Lorentz D, and Collins JJ (NIR) – Alberto de la Fuente, Paul Brazhnik, Pedro Mendes – Roven C and Bussemaker H (REDUCE) – … • Probabilistic and Information Theoretic: Compute probability of interaction and filter with statistical criteria – Atul Butte et al. (Relevance Networks) – Gustavo Stolovitzky et al. (Co-Expression Networks) – Andrea CaCalifanolifano et al.
    [Show full text]
  • Research Report 2006 Max Planck Institute for Molecular Genetics, Berlin Imprint | Research Report 2006
    MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS Research Report 2006 Max Planck Institute for Molecular Genetics, Berlin Imprint | Research Report 2006 Published by the Max Planck Institute for Molecular Genetics (MPIMG), Berlin, Germany, August 2006 Editorial Board Bernhard Herrmann, Hans Lehrach, H.-Hilger Ropers, Martin Vingron Coordination Claudia Falter, Ingrid Stark Design & Production UNICOM Werbeagentur GmbH, Berlin Number of copies: 1,500 Photos Katrin Ullrich, MPIMG; David Ausserhofer Contact Max Planck Institute for Molecular Genetics Ihnestr. 63–73 14195 Berlin, Germany Phone: +49 (0)30-8413 - 0 Fax: +49 (0)30-8413 - 1207 Email: [email protected] For further information about the MPIMG please see our website: www.molgen.mpg.de MPI for Molecular Genetics Research Report 2006 Table of Contents The Max Planck Institute for Molecular Genetics . 4 • Organisational Structure. 4 • MPIMG – Mission, Development of the Institute, Research Concept. .5 Department of Developmental Genetics (Bernhard Herrmann) . 7 • Transmission ratio distortion (Hermann Bauer) . .11 • Signal Transduction in Embryogenesis and Tumor Progression (Markus Morkel). 14 • Development of Endodermal Organs (Heiner Schrewe) . 16 • Gene Expression and 3D-Reconstruction (Ralf Spörle). 18 • Somitogenesis (Lars Wittler). 21 Department of Vertebrate Genomics (Hans Lehrach) . 25 • Molecular Embryology and Aging (James Adjaye). .31 • Protein Expression and Protein Structure (Konrad Büssow). .34 • Mass Spectrometry (Johan Gobom). 37 • Bioinformatics (Ralf Herwig). .40 • Comparative and Functional Genomics (Heinz Himmelbauer). 44 • Genetic Variation (Margret Hoehe). 48 • Cell Arrays/Oligofingerprinting (Michal Janitz). .52 • Kinetic Modeling (Edda Klipp) . .56 • In Vitro Ligand Screening (Zoltán Konthur). .60 • Neurodegenerative Disorders (Sylvia Krobitsch). .64 • Protein Complexes & Cell Organelle Assembly/ USN (Bodo Lange/Thorsten Mielke). .67 • Automation & Technology Development (Hans Lehrach).
    [Show full text]
  • Manolis Kellis Piotr Indyk
    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
    [Show full text]
  • Prof. Manolis Kellis April 15, 2008
    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
    [Show full text]
  • ENCODE Consortium Meeting
    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
    [Show full text]
  • Machine Learning and Statistical Methods for Clustering Single-Cell RNA-Sequencing Data Raphael Petegrosso 1, Zhuliu Li 1 and Rui Kuang 1,∗
    i i “main” — 2019/5/3 — 12:56 — page 1 — #1 i i Briefings in Bioinformatics doi.10.1093/bioinformatics/xxxxxx Advance Access Publication Date: Day Month Year Manuscript Category Subject Section Machine Learning and Statistical Methods for Clustering Single-cell RNA-sequencing Data Raphael Petegrosso 1, Zhuliu Li 1 and Rui Kuang 1,∗ 1Department of Computer Science and Engineering, University of Minnesota Twin Cities, Minneapolis, MN, USA ∗To whom correspondence should be addressed. Associate Editor: XXXXXXX Received on XXXXX; revised on XXXXX; accepted on XXXXX Abstract Single-cell RNA-sequencing (scRNA-seq) technologies have enabled the large-scale whole-transcriptome profiling of each individual single cell in a cell population. A core analysis of the scRNA-seq transcriptome profiles is to cluster the single cells to reveal cell subtypes and infer cell lineages based on the relations among the cells. This article reviews the machine learning and statistical methods for clustering scRNA- seq transcriptomes developed in the past few years. The review focuses on how conventional clustering techniques such as hierarchical clustering, graph-based clustering, mixture models, k-means, ensemble learning, neural networks and density-based clustering are modified or customized to tackle the unique challenges in scRNA-seq data analysis, such as the dropout of low-expression genes, low and uneven read coverage of transcripts, highly variable total mRNAs from single cells, and ambiguous cell markers in the presence of technical biases and irrelevant confounding biological variations. We review how cell-specific normalization, the imputation of dropouts and dimension reduction methods can be applied with new statistical or optimization strategies to improve the clustering of single cells.
    [Show full text]
  • Unweaving)The)Circuitry)) Of)Complex)Disease!
    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
    [Show full text]
  • Lecture 10: Phylogeny 25,27/12/12 Phylogeny
    גנומיקה חישובית Computational Genomics פרופ' רון שמיר ופרופ' רודד שרן Prof. Ron Shamir & Prof. Roded Sharan ביה"ס למדעי המחשב אוניברסיטת תל אביב School of Computer Science, Tel Aviv University , Lecture 10: Phylogeny 25,27/12/12 Phylogeny Slides: • Adi Akavia • Nir Friedman’s slides at HUJI (based on ALGMB 98) •Anders Gorm Pedersen,Technical University of Denmark Sources: Joe Felsenstein “Inferring Phylogenies” (2004) 1 CG © Ron Shamir Phylogeny • Phylogeny: the ancestral relationship of a set of species. • Represented by a phylogenetic tree branch ? leaf ? Internal node ? ? ? Leaves - contemporary Internal nodes - ancestral 2 CG Branch© Ron Shamir length - distance between sequences 3 CG © Ron Shamir 4 CG © Ron Shamir 5 CG © Ron Shamir 6 CG © Ron Shamir “classical” Phylogeny schools Classical vs. Modern: • Classical - morphological characters • Modern - molecular sequences. 7 CG © Ron Shamir Trees and Models • rooted / unrooted “molecular • topology / distance clock” • binary / general 8 CG © Ron Shamir To root or not to root? • Unrooted tree: phylogeny without direction. 9 CG © Ron Shamir Rooting an Unrooted Tree • We can estimate the position of the root by introducing an outgroup: – a species that is definitely most distant from all the species of interest Proposed root Falcon Aardvark Bison Chimp Dog Elephant 10 CG © Ron Shamir A Scally et al. Nature 483, 169-175 (2012) doi:10.1038/nature10842 HOW DO WE FIGURE OUT THESE TREES? TIMES? 12 CG © Ron Shamir Dangers of Paralogs • Right species distance: (1,(2,3)) Sequence Homology Caused
    [Show full text]
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
    [Show full text]