DOCSLIB.ORG

Unweaving)The)Circuitry)) Of)Complex)Disease!

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Unweaving)The)Circuitry)) Of)Complex)Disease! Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics! 29!mammals! Feedback)from)environment)/)disease)state) Building systems-level views of genome regulation Goal: A systems-level understanding of genomes and gene regulation:! • The regulators: Transcription factors, microRNAs, sequence specificities" • The regions: enhancers, promoters, and their tissue-specificity" • The targets: TFs"targets, regulators"enhancers, enhancers"genes" • The grammars: Interplay of multiple TFs " prediction of gene expression" ! The parts list = Building blocks of gene regulatory networks" ! Our tools: Comparative genomics & large-scale experimental datasets. ! • Evolutionary signatures for coding/non-coding genes, microRNAs, motifs" • Chromatin signatures for regulatory regions and their tissue specificity" • Activity signatures for linking regulators " enhancers " target genes" • Predictive models for gene function, gene expression, chromatin state" ! Integrative models = Define roles in development, health, disease" Compara:ve)genomics)maps) Func:onal)Genomics)) • Measure)constraint)across)species) and)Epigenomics) ENCODE) and)iden:fy)conserved)regions) Roadmap)) • Define)evolu:onary)signatures)for) in)reference)cell)types) Epigenomics) genes,)ncRNAs,),)miRNAs,)mo:fs) • FineHmap)topHscoring)loci) • Measure)lineageHspecific)constraint) • Iden:fy)relevant)cell)types) within)the)human)popula:on) • Iden:fy)relevant)pathways) 29)mammals) • Detect)addi:onal)loci) 2! 1! REFERENCE)MAPS) CATGACTG! Gene:c) CATGCCTG! GWAS) Disease) Varia:on) • TopHscoring)loci) 3! • PHvalues,)effect)sizes) • Agnos:c)to)mechanism) Molecular)Varia:on)) Molecular)Varia:on)) in)reference)individuals) in)cases/controls)Disease)) ) Environment) epigenomics Covariates) • Variants)changing)gene)expression) • Intermediate)molecular)phenotypes) • TissueHspecific,)mul:H:ssue)eQTLs) • Measured)in)diseaseHrelevant):ssues) ) • Pinpoint)regulatory)regions) GTEx • Capture)environmental)effects)) • Link)SNPs)to)target)genes/regions) • Capture)downstream)disease)effects) 4! MAPS)THAT)VARY)ACROSS)INDIVIDUALS) 5! Genomic/Epigenomic tools for disease SNPs • Evolutionary signatures gene/genome annotation – High-resolution annotation: genes, RNAs, motif instances – Measuring selection within the human population • Chromatin states regulatory region annotation – Classes of promoter/enhancer/transcribed/repressed/etc – Prioritizing chromatin experiments, mark/state imputation • Activity signatures linking enhancer networks – Activity-based linking of TFs " enhancers " targets – Testing activators/repressors in 2000+ human enhancers • Interpreting disease-associated sequence variants – Mechanistic predictions for individual top-scoring SNPs – Functional roles of 1000s of disease-associated SNPs • Personal (epi)genomes: geno-/phenotype, cis/trans – Allele-specific activity. Alzheimer’s and brain methylation Evolutionary signatures reveal genes, RNAs, motifs Compare 29 mammals Increased conservation pinpoints functional regions! Distinct patterns of change distinguish diff. functions! Protein-coding genes! - Codon Substitution Frequencies" - Reading Frame Conservation" RNA structures! - Compensatory changes" - Silent G-U substitutions" microRNAs! - Shape of conservation profile" - Structural features: loops, pairs" - Relationship with 3’UTR motifs" Regulatory motifs! - Mutations preserve consensus" Lindblad-Toh Nature 2011! - Increased Branch Length Score" Stark Nature 2007! - Genome-wide conservation" Measuring constraint at individual nucleotides NRSF motif! • Reveal individual transcription factor binding sites • Within motif instances reveal position-specific bias • More species: motif consensus directly revealed Translational read-through in human & fly! Overlapping selection in human exons! Synonym. Substitut. Rate! Jungreis, Genome Research 2011! Lin, Genome Research 2011! Protein-coding Continued protein- No more Stop codon! 2nd stop! Reveal splicing signals, RNA structures, conservation coding conservation conserv read through! codon! enhancer motifs, dual-coding genes! RNA structure families: ortholog/paralog cons! Regions of codon-level positive selection! distributed" localized" Parker Gen. Res. 2011! Lindblad-Toh Nature 2011! Ex:MAT2A S-adeosyl-methionic level detection! Distributed vs. localized positive selection! Structure/loop sequence deep conservation! Immunity/taste vs. retinal/bone/secretion! Human constraint outside conserved regions Active regions Average diversity (heterozygosity) " Aggregate over the genome" • Non-conserved regions: • Conserved regions: – ENCODE-active regions – Non-ENCODE regions show reduced diversity show increased diversity ! Lineage-specific constraint in ! Loss of constraint in human biochemically-active regions when biochemically-inactive Detect!SNPs!that!disrupt!conserved!regulatory!mo7fs! • Func7onallyBassociated!SNPs!enriched!in!states,!constraint! • Priori7ze!candidates,!increase!resolu7on,!disrupted!mo7fs! What!frac7on!of!the!genome!maWers?! 1%!proteinBcoding! Ac7ve!in!Cell!Type!1! 40%B80%!ac7ve! 5%!mammalian! across!mul7ple! conserved! cell!types! +4B11%!human! constrained! Ac7ve!in!Cell!Type!2! …! 3,000,000,000)nucleo:des) • Evidence)of)lineageHspecific)constraint)in)human)for)nonHconserved)elements)) • Muta:ons)in)nonHconserved)regions)can)have)lateHonset)disease)phenotypes) • Gene:c)disease)requires)understanding)the)whole)human)genome) Functional genomics and GTEx for disease 1. Reference Epigenomes chromatin states, linking – Annotate dynamic regulatory elements in multiple cell types – Activity-based linking of regulators " enhancers " targets 2. Interpreting disease-associated sequence variants – Mechanistic predictions for individual top-scoring SNPs – Functional roles of 1000s of disease-associated SNPs 3. Multi-cell systems-level expression changes in GTEx – Learn expression programs in 40 tissues for each person – Genetic basis of gene module membership changes 4. Genetic / epigenomic variation in health and disease – Genetic variation#Brain methylation#Alzheimer’s disease – Global repression of distal enhancers. NRSF, ELK1, CTCF Compara:ve)genomics)maps) Func:onal)Genomics)) • Measure)constraint)across)species) and)Epigenomics) ENCODE) and)iden:fy)conserved)regions) Roadmap)) • Define)evolu:onary)signatures)for) in)reference)cell)types) Epigenomics) genes,)ncRNAs,),)miRNAs,)mo:fs) • FineHmap)topHscoring)loci) • Measure)lineageHspecific)constraint) • Iden:fy)relevant)cell)types) within)the)human)popula:on) • Iden:fy)relevant)pathways) 29)mammals) • Detect)addi:onal)loci) 2! 1! REFERENCE)MAPS) CATGACTG! Gene:c) CATGCCTG! GWAS) Disease) Varia:on) • TopHscoring)loci) • PHvalues,)effect)sizes) • Agnos:c)to)mechanism) Chromatin signatures for genome annotation Epigenomic maps 1. DNA methylation 2. Histone modifications Multi-variate HMM captures combinations 3. DNA accessibility Ernst & Kellis Nature Biotech 2010. Ernst & Kellis Nature Methods, 2012.ChromHMM Chroma:n)state)dynamics)reveal)linking/regulators) Predicted linking Correlated activity • Single annotation track for each cell type • Summarize cell-type activity at a glance • Study activity pattern across tissues Ernst , Kheradpour, et al, Nature 2011 Multi-cell activity profiles connect enhancers Gene Chromatin Active TF motif TF regulator Dip-aligned expression States enrichment expression motif biases HUVEC NHEK GM12878 K562 HepG2 NHLF HMEC HSMM H1 Link enhancers to target genes ON Active enhancer Motif enrichment TF On Motif aligned OFF Repressed Motif depletion TF Off Flat profile Multi-cell activity profiles connect enhancers Gene Chromatin Active TF motif TF regulator Dip-aligned expression States enrichment expression motif biases HUVEC NHEK GM12878 K562 HepG2 NHLF HMEC HSMM H1 Link TFs to target enhancers! Predict activators vs. repressors! ON Active enhancer Motif enrichment TF On Motif aligned OFF Repressed Motif depletion TF Off Flat profile Coordinated)ac:vity)reveals)ac:vators/repressors) Enhancer activity! Activity signatures for each TF! Ex1: Oct4 predicted activator Ex2: Gfi1 repressor
Load more

Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
    [Show full text]
  • Manolis Kellis Piotr Indyk
    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
    [Show full text]
  • Prof. Manolis Kellis April 15, 2008
    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
    [Show full text]
  • ENCODE Consortium Meeting
    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
    [Show full text]
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]
  • ENCODE: Understanding the Genome
    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
    [Show full text]
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
    [Show full text]
  • An Integrated Encyclopedia of DNA Elements in the Human Genome
    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]
  • Analysis, Visualization, and Machine Learning of Epigenomic Data
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2017-12-12 Analysis, Visualization, and Machine Learning of Epigenomic Data Michael J. Purcaro University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Computational Biology Commons, Genomics Commons, and the Integrative Biology Commons Repository Citation Purcaro MJ. (2017). Analysis, Visualization, and Machine Learning of Epigenomic Data. GSBS Dissertations and Theses. https://doi.org/10.13028/M23T1Q. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/938 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial 4.0 License This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. ANALYSIS, VISUALIZATION, AND MACHINE LEARNING OF EPIGENOMIC DATA A Dissertation Presented By MICHAEL JOSEPH PURCARO Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY DECEMBER 12, 2017 BIOINFORMATICS AND COMPUTATIONAL BIOLOGY M.D., PH.D. PROGRAM I-ii ANALYSIS, VISUALIZATION, AND MACHINE LEARNING OF EPIGENOMIC DATA A Dissertation Presented
    [Show full text]