Accurate Promoter and Enhancer Identification in 127 ENCODE and Roadmap Epigenomics Cell Types and Tissues by Genostan
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Bivalent Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells
A Bivalent Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells Bradley E. Bernstein,1,2,3,* Tarjei S. Mikkelsen,3,4 Xiaohui Xie,3 Michael Kamal,3 Dana J. Huebert,1 James Cuff,3 Ben Fry,3 Alex Meissner,5 Marius Wernig,5 Kathrin Plath,5 Rudolf Jaenisch,5 Alexandre Wagschal,6 Robert Feil,6 Stuart L. Schreiber,3,7 and Eric S. Lander3,5 1 Molecular Pathology Unit and Center for Cancer Research, Massachusetts General Hospital, Charlestown, MA 02129, USA 2 Department of Pathology, Harvard Medical School, Boston, MA 02115, USA 3 Broad Institute of Harvard and MIT, Cambridge, MA 02139, USA 4 Division of Health Sciences and Technology, MIT, Cambridge, MA 02139, USA 5 Whitehead Institute for Biomedical Research, MIT, Cambridge, MA 02139, USA 6 Institute of Molecular Genetics, CNRS UMR-5535 and University of Montpellier-II, Montpellier, France 7 Howard Hughes Medical Institute at the Department of Chemistry and Chemical Biology, Harvard University, Cambridge, MA 02138, USA *Contact: [email protected] DOI 10.1016/j.cell.2006.02.041 SUMMARY which in turn modulate chromatin structure (Jenuwein and Allis, 2001; Margueron et al., 2005). The core histones The most highly conserved noncoding ele- H2A, H2B, H3, and H4 are subject to dozens of different ments (HCNEs) in mammalian genomes cluster modifications, including acetylation, methylation, and within regions enriched for genes encoding de- phosphorylation. Histone H3 lysine 4 (Lys4) and lysine velopmentally important transcription factors 27 (Lys27) methylation are of particular interest as these (TFs). This suggests that HCNE-rich regions modifications are catalyzed, respectively, by trithorax- may contain key regulatory controls involved and Polycomb-group proteins, which mediate mitotic in- heritance of lineage-specific gene expression programs in development. -
PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics. -
The Bioperl Toolkit: Perl Modules for the Life Sciences
Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich, David Block, Kris Boulez, et al. Genome Res. 2002 12: 1611-1618 Access the most recent version at doi:10.1101/gr.361602 Supplemental http://genome.cshlp.org/content/suppl/2002/10/20/12.10.1611.DC1.html Material References This article cites 14 articles, 9 of which can be accessed free at: http://genome.cshlp.org/content/12/10/1611.full.html#ref-list-1 Article cited in: http://genome.cshlp.org/content/12/10/1611.full.html#related-urls Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on January 25, 2012 - Published by Cold Spring Harbor Laboratory Press Resource The Bioperl Toolkit: Perl Modules for the Life Sciences Jason E. Stajich,1,18,19 David Block,2,18 Kris Boulez,3 Steven E. Brenner,4 Stephen A. Chervitz,5 Chris Dagdigian,6 Georg Fuellen,7 James G.R. Gilbert,8 Ian Korf,9 Hilmar Lapp,10 Heikki Lehva¨slaiho,11 Chad Matsalla,12 Chris J. Mungall,13 Brian I. Osborne,14 Matthew R. Pocock,8 Peter Schattner,15 Martin Senger,11 Lincoln D. Stein,16 Elia Stupka,17 Mark D. Wilkinson,2 and Ewan Birney11 1University Program in Genetics, Duke University, Durham, North Carolina 27710, USA; 2National Research Council of -
Manolis Kellis Piotr Indyk
6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality: -
Research Computing Facility an Update from Dr
Research Computing Facility An Update from Dr. Francesca Dominici June 20, 2013 Dear all, We are very excited to provide you some important updates regarding the research computing facility at the Faculty of Arts and Science (FASRC) http://rc.fas.harvard.edu. Please note that we are phasing out the HSPH cluster, and if you are currently leasing nodes on the HSPH cluster we will be working with you to migrate to FASRC. We have developed a FAQ document, which is available at the web link https://rc.fas.harvard.edu/hsph-at-fas-rc-frequently- asked-questions/ and also included in this message. Updates: 1. 158 HSPH accounts have been opened on FASRC, enabling users to run computing jobs on the FAS High Performance Computing Cluster (HPCC), also known as Odyssey 2. Several HSPH faculty have worked with the FASRC team to purchase data storage equipment and hardware that have been deployed at FASRC in Cambridge and linked to Odyssey via a secured network 3. FASRC has developed personalized solutions for our faculty to transfer secure data from HSPH to FAS in accordance with data user agreements. 4. FASRC has been mentioned as a key strength in training and research grant applications from HSPH, and high impact papers have been published that previously were delayed for lack of computing power 5. Please bookmark the web site http://rc.fas.harvard.edu/hsph- overview/ for additional and up to date information To access FASRC you will be charged approximately $3000 per year per account. Access for PhD and ScD students is free. -
Prof. Manolis Kellis April 15, 2008
Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA -
ENCODE Consortium Meeting
ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S. -
Unweaving)The)Circuitry)) Of)Complex)Disease!
Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics! -
Convergent Regulatory Evolution and Loss of Flight in Paleognathous Birds
Convergent regulatory evolution and loss of flight in paleognathous birds The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Sackton, Timothy B., Phil Grayson, Alison Cloutier, Zhirui Hu, Jun S. Liu, Nicole E. Wheeler, Paul P. Gardner, et al. 2019. Convergent Regulatory Evolution and Loss of Flight in Paleognathous Birds. Science 364 (6435): 74–78. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:39865637 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Open Access Policy Articles, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#OAP Convergent regulatory evolution and loss of flight in palaeognathous birds Timothy B. Sackton* (1,2), Phil Grayson (2,3), Alison Cloutier (2,3), Zhirui Hu (4), Jun S. Liu (4), Nicole E. Wheeler (5,6), Paul P. Gardner (5,7), Julia A. Clarke (8), Allan J. Baker (9,10), Michele Clamp (1), Scott V. Edwards* (2,3) Affiliations: 1) Informatics Group, Harvard University, Cambridge, USA 2) Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, USA 3) Museum of Comparative Zoology, Harvard University, Cambridge, USA 4) Department of Statistics, Harvard University, Cambridge, USA 5) School of Biological Sciences, University of Canterbury, New Zealand 6) Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK 7) Department of Biochemistry, University of Otago, New Zealand 8) Jackson School of Geosciences, The University of Texas at Austin, Austin, USA 9) Department of Natural History, Royal Ontario Museum, Toronto, Canada 10) Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, Canada *correspondence to: TBS ([email protected]) or SVE ([email protected]) 1 Whether convergent phenotypic evolution is driven by convergent molecular changes, in proteins or regulatory regions, are core questions in evolutionary biology. -
Motif Selection Using Simulated Annealing Algorithm with Application to Identify Regulatory Elements
Motif Selection Using Simulated Annealing Algorithm with Application to Identify Regulatory Elements A thesis presented to the faculty of the Russ College of Engineering and Technology of Ohio University In partial fulfillment of the requirements for the degree Master of Science Liang Chen August 2018 © 2018 Liang Chen. All Rights Reserved. 2 This thesis titled Motif Selection Using Simulated Annealing Algorithm with Application to Identify Regulatory Elements by LIANG CHEN has been approved for the Department of Electrical Engineering and Computer Science and the Russ College of Engineering and Technology by Lonnie Welch Professor of Electrical Engineering and Computer Science Dennis Irwin Dean, Russ College of Engineering and Technology 3 Abstract CHEN, LIANG, M.S., August 2018, Computer Science Master Program Motif Selection Using Simulated Annealing Algorithm with Application to Identify Regulatory Elements (106 pp.) Director of Thesis: Lonnie Welch Modern research on gene regulation and disorder-related pathways utilize the tools such as microarray and RNA-Seq to analyze the changes in the expression levels of large sets of genes. In silico motif discovery was performed based on the gene expression profile data, which generated a large set of candidate motifs (usually hundreds or thousands of motifs). How to pick a set of biologically meaningful motifs from the candidate motif set is a challenging biological and computational problem. As a computational problem it can be modeled as motif selection problem (MSP). Building solutions for motif selection problem will give biologists direct help in finding transcription factors (TF) that are strongly related to specific pathways and gaining insights of the relationships between genes. -
Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology. -
UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.