UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
RECENT ADVANCES in BIOLOGY, BIOPHYSICS, BIOENGINEERING and COMPUTATIONAL CHEMISTRY
RECENT ADVANCES in BIOLOGY, BIOPHYSICS, BIOENGINEERING and COMPUTATIONAL CHEMISTRY Proceedings of the 5th WSEAS International Conference on CELLULAR and MOLECULAR BIOLOGY, BIOPHYSICS and BIOENGINEERING (BIO '09) Proceedings of the 3rd WSEAS International Conference on COMPUTATIONAL CHEMISTRY (COMPUCHEM '09) Puerto De La Cruz, Tenerife, Canary Islands, Spain December 14-16, 2009 Recent Advances in Biology and Biomedicine A Series of Reference Books and Textbooks Published by WSEAS Press ISSN: 1790-5125 www.wseas.org ISBN: 978-960-474-141-0 RECENT ADVANCES in BIOLOGY, BIOPHYSICS, BIOENGINEERING and COMPUTATIONAL CHEMISTRY Proceedings of the 5th WSEAS International Conference on CELLULAR and MOLECULAR BIOLOGY, BIOPHYSICS and BIOENGINEERING (BIO '09) Proceedings of the 3rd WSEAS International Conference on COMPUTATIONAL CHEMISTRY (COMPUCHEM '09) Puerto De La Cruz, Tenerife, Canary Islands, Spain December 14-16, 2009 Recent Advances in Biology and Biomedicine A Series of Reference Books and Textbooks Published by WSEAS Press www.wseas.org Copyright © 2009, by WSEAS Press All the copyright of the present book belongs to the World Scientific and Engineering Academy and Society Press. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior written permission of the Editor of World Scientific and Engineering Academy and Society Press. All papers of the present volume were peer reviewed -
Computational Methods Addressing Genetic Variation In
COMPUTATIONAL METHODS ADDRESSING GENETIC VARIATION IN NEXT-GENERATION SEQUENCING DATA by Charlotte A. Darby A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland June 2020 © 2020 Charlotte A. Darby All rights reserved Abstract Computational genomics involves the development and application of computational meth- ods for whole-genome-scale datasets to gain biological insight into the composition and func- tion of genomes, including how genetic variation mediates molecular phenotypes and disease. New biotechnologies such as next-generation sequencing generate genomic data on a massive scale and have transformed the field thanks to simultaneous advances in the analysis toolkit. In this thesis, I present three computational methods that use next-generation sequencing data, each of which addresses the genetic variations within and between human individuals in a different way. First, Samovar is a software tool for performing single-sample mosaic single-nucleotide variant calling on whole genome sequencing linked read data. Using haplotype assembly of heterozygous germline variants, uniquely made possible by linked reads, Samovar identifies variations in different cells that make up a bulk sequencing sample. We apply it to 13cancer samples in collaboration with researchers at Nationwide Childrens Hospital. Second, scHLAcount is a software pipeline that computes allele-specific molecule counts for the HLA genes from single-cell gene expression data. We use a personalized reference genome based on the individual’s genotypes to reveal allele-specific and cell type-specific gene expression patterns. Even given technology-specific biases of single-cell gene expression data, we can resolve allele-specific expression for these genes since the alleles are often quite different between the two haplotypes of an individual. -
PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics. -
Program Book
Pacific Symposium on Biocomputing 2016 January 4-8, 2016 Big Island of Hawaii Program Book PACIFIC SYMPOSIUM ON BIOCOMPUTING 2016 Big Island of Hawaii, January 4-8, 2016 Welcome to PSB 2016! We have prepared this program book to give you quick access to information you need for PSB 2016. Enclosed you will find • Logistics information • Menus for PSB hosted meals • Full conference schedule • Call for Session and Workshop Proposals for PSB 2017 • Poster/abstract titles and authors • Participant List Conference materials are also available online at http://psb.stanford.edu/conference-materials/. PSB 2016 gratefully acknowledges the support the Institute for Computational Biology, a collaborative effort of Case Western Reserve University, the Cleveland Clinic Foundation, and University Hospitals; the National Institutes of Health (NIH), the National Science Foundation (NSF); and the International Society for Computational Biology (ISCB). If you or your institution are interested in sponsoring, PSB, please contact Tiffany Murray at [email protected] If you have any questions, the PSB registration staff (Tiffany Murray, Georgia Hansen, Brant Hansen, Kasey Miller, and BJ Morrison-McKay) are happy to help you. Aloha! Russ Altman Keith Dunker Larry Hunter Teri Klein Maryln Ritchie The PSB 2016 Organizers PACIFIC SYMPOSIUM ON BIOCOMPUTING 2016 Big Island of Hawaii, January 4-8, 2016 SPEAKER INFORMATION Oral presentations of accepted proceedings papers will take place in Salon 2 & 3. Speakers are allotted 10 minutes for presentation and 5 minutes for questions for a total of 15 minutes. Instructions for uploading talks were sent to authors with oral presentations. If you need assistance with this, please see Tiffany Murray or another PSB staff member. -
Big Data, Moocs, and ... (PDF)
HHMI Constellation Studios for Science Education November 13-15, 2015 | HHMI Headquarters | Chevy Chase, MD Big Data, MOOCs, and Quantitative Education for Biologists Co-Chairs Pavel Pevzner, University of California- San Diego Sarah Elgin, Washington University Studio Objectives Discuss existing challenges in bioinformatics education with experts in computational biology and quantitative biology education, Evaluate best practices in teaching quantitative and computational biology, and Collaborate with scientist educators to develop instructional modules to support a biology curriculum that includes quantitative approaches. Friday | November 13 4:00 pm Arrival Registration Desk 5:30 – 6:00 pm Reception Great Hall 6:00 – 7:00 pm Dinner Dining Room 7:00 – 7:15 pm Welcome K202 David Asai, HHMI Cynthia Bauerle, HHMI Pavel Pevzner, University of California-San Diego Sarah Elgin, Washington University Alex Hartemink, Duke University 7:15 – 8:00 pm How to Maximize Interaction and Feedback During the Studio K202 Cynthia Bauerle and Sarah Simmons, HHMI 8:00 – 9:00 pm Keynote Presentation K202 "Computing + Biology = Discovery" Speakers: Ran Libeskind-Hadas, Harvey Mudd College Eliot Bush, Harvey Mudd College 9:00 – 11:00 pm Social The Pilot Saturday | November 14 7:30 – 8:15 am Breakfast Dining Room 8:30 – 10:00 am Lecture session 1 K202 Moderator: Pavel Pevzner 834a-854a “How is body fat regulated?” Laurie Heyer, Davidson College 856a-916a “How can we find mutations that cause cancer?” Ben Raphael, Brown University “How does a tumor evolve over time?” 918a-938a Russell Schwartz, Carnegie Mellon University “How fast do ribosomes move?” 940a-1000a Carl Kingsford, Carnegie Mellon University 10:05 – 10:55 am Breakout working groups Rooms: S221, (coffee available in each room) N238, N241, N140 1. -
Modeling and Analysis of RNA-Seq Data: a Review from a Statistical Perspective
Modeling and analysis of RNA-seq data: a review from a statistical perspective Wei Vivian Li 1 and Jingyi Jessica Li 1;2;∗ Abstract Background: Since the invention of next-generation RNA sequencing (RNA-seq) technolo- gies, they have become a powerful tool to study the presence and quantity of RNA molecules in biological samples and have revolutionized transcriptomic studies. The analysis of RNA-seq data at four different levels (samples, genes, transcripts, and exons) involve multiple statistical and computational questions, some of which remain challenging up to date. Results: We review RNA-seq analysis tools at the sample, gene, transcript, and exon levels from a statistical perspective. We also highlight the biological and statistical questions of most practical considerations. Conclusion: The development of statistical and computational methods for analyzing RNA- seq data has made significant advances in the past decade. However, methods developed to answer the same biological question often rely on diverse statical models and exhibit dif- ferent performance under different scenarios. This review discusses and compares multiple commonly used statistical models regarding their assumptions, in the hope of helping users select appropriate methods as needed, as well as assisting developers for future method development. 1 Introduction RNA sequencing (RNA-seq) uses the next generation sequencing (NGS) technologies to reveal arXiv:1804.06050v3 [q-bio.GN] 1 May 2018 the presence and quantity of RNA molecules in biological samples. Since its invention, RNA- seq has revolutionized transcriptome analysis in biological research. RNA-seq does not require any prior knowledge on RNA sequences, and its high-throughput manner allows for genome-wide profiling of transcriptome landscapes [1,2]. -
Cloud Computing and the DNA Data Race Michael Schatz
Cloud Computing and the DNA Data Race Michael Schatz April 14, 2011 Data-Intensive Analysis, Analytics, and Informatics Outline 1. Genome Assembly by Analogy 2. DNA Sequencing and Genomics 3. Large Scale Sequence Analysis 1. Mapping & Genotyping 2. Genome Assembly Shredded Book Reconstruction • Dickens accidentally shreds the first printing of A Tale of Two Cities – Text printed on 5 long spools It was theIt was best the of besttimes, of times, it was it wasthe worstthe worst of of times, times, it it was was the the ageage of of wisdom, wisdom, it itwas was the agethe ofage foolishness, of foolishness, … … It was theIt was best the bestof times, of times, it was it was the the worst of times, it was the theage ageof wisdom, of wisdom, it was it thewas age the of foolishness,age of foolishness, … It was theIt was best the bestof times, of times, it was it wasthe the worst worst of times,of times, it it was the age of wisdom, it wasit was the the age age of offoolishness, foolishness, … … It was It thewas best the ofbest times, of times, it wasit was the the worst worst of times,of times, itit waswas thethe ageage ofof wisdom,wisdom, it wasit was the the age age of foolishness,of foolishness, … … It wasIt thewas best the bestof times, of times, it wasit was the the worst worst of of times, it was the age of ofwisdom, wisdom, it wasit was the the age ofage foolishness, of foolishness, … … • How can he reconstruct the text? – 5 copies x 138, 656 words / 5 words per fragment = 138k fragments – The short fragments from every copy are mixed -
Manolis Kellis Piotr Indyk
6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality: -
BENG181/CSE 181/BIMM 181 Molecular Sequence Analysis Instructor: Pavel Pevzner
COURSE ANNOUNCEMENT FOR WINTER 2021 BENG181/CSE 181/BIMM 181 Molecular Sequence Analysis https://sites.google.com/site/ucsdcse181 Instructor: Pavel Pevzner ● phone: (858) 822-4365 ● e.mail: [email protected] ● web site: bioalgorithms.ucsd.edu Teaching Assistants: ● Andrey Bzikadze ([email protected]) ● Hsuan-lin (Charlene) Her ([email protected]) Time: 6:30-7:50 Mon/Wed, Place: online (seminar Friday 4:00-4:50 online) Zoom link for the class: https://ucsd.zoom.us/j/99782745100 Zoom link for the seminar: https://ucsd.zoom.us/j/96805484881 Office hours: PP: (Th 3-5 online), TAs (online Tue 1-2 PM and 4-5 PM or by appointment online) PP zoom link: https://ucsd.zoom.us/j/96986851791 Andrey Bzikadze zoom link: https://ucsd.zoom.us/j/94881347266 Hsuan-lin (Charlene) Her zoom link: https://ucsd.zoom.us/j/95134947264 Prerequisites: The course assumes some prior background in biology, some algorithmic culture (CSE 101 course on algorithms as a prerequisite), and some programming skills. Flipped online class. Starting in 2014, the Innovative Learning Technology Initiative (ILTI) at University of California encourages professors to transform their classes into online offerings available across various UC campuses. Dr. Pevzner is funded by the ILTI and NIH to develop new online approaches to bioinformatics education at UCSD. Since 2014, well before the COVID-19 pandemic, all lectures in this class are available online rather than presented in the classroom. Multi-university class. This class closely follows the textbook Bioinformatics Algorithms: an Active Learning Approach that has now been adopted by 140+ instructors from 40+ countries. -
Prof. Manolis Kellis April 15, 2008
Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA -
24019 - Probabilistic Graphical Models
Year : 2019/20 24019 - Probabilistic Graphical Models Syllabus Information Academic Course: 2019/20 Academic Center: 337 - Polytechnic School Study: 3379 - Bachelor's (degree) programme in Telecommunications Network Engineering Subject: 24019 - Probabilistic Graphical Models Credits: 5.0 Course: 3 Teaching languages: Theory: Grup 1: English Practice: Grup 101: English Grup 102: English Seminar: Grup 101: English Grup 102: English Teachers: Vicente Gomez Cerda Teaching Period: Second Quarter Schedule: --- Presentation Probabilistic graphical models (PGMs) are powerful modeling tools for reasoning and decision making under uncertainty. PGMs have many application domains, including computer vision, natural language processing, efficient coding, and computational biology. PGMs connects graph theory and probability theory, and provide a flexible framework for modeling large collections of random variables with complex interactions. This is an introductory course which focuses on two main principles: (1) emphasizing the role of PGMs as a unifying language in machine learning that allows a natural specification of many problem domains with inherent uncertainty, and (2) providing a set of computational tools for probabilistic inference (making predictions that can be used to aid decision making), and learning (estimating the graph structure and their parameters from data). Associated skills Basic Competences That the students can apply their knowledge to their work or vocation of a professional form in a professional way and possess the competences which are usually proved by means of the elaboration and defense of arguments and solving the solution of problems within their study area. That the students have the ability of collecting and interpreting relevant data (normally within their study area) to issue judgements which include a reflection about relevant topics of social, scientific or ethical nature. -
Curriculum Vitae—Nir Friedman
Nir Friedman Last update: February 14, 2019 Curriculum Vitae|Nir Friedman School of Computer Science and Engineering email: [email protected] Alexander Silberman Institute of Life Sciences Office: +972-73-388-4720 Hebrew University of Jerusalem Cellular: +972-54-882-0432 Jerusalem 91904, ISRAEL Professional History Professor 2009{present Alexander Silberman Institute of Life Sciences The Hebrew University of Jerusalem Professor 2007{present School of Computer Science & Engineering The Hebrew University of Jerusalem Associate Professor 2002{2007 School of Computer Science & Engineering The Hebrew University of Jerusalem Senior Lecturer 1998{2002 School of Computer Science & Engineering The Hebrew University of Jerusalem Postdoctoral Scholar 1996{1998 Division of Computer Science University of California, Berkeley Education Ph.D. Computer Science, Stanford University 1992{1997 M.Sc. Math. & Computer Science, Weizmann Institute of Science 1990{1992 B.Sc. Math. & Computer Science, Tel-Aviv University 1983{1987 Awards Alexander von Humboldt Foundation Research Award 2015 Fellow of the International Society of Computational Biology 2014 European Research Council \Advanced Grant" research award 2014-2018 \Test of Time" Award Research in Computational Molecular Biology (RECOMB) 2012 Most cited paper in 12-year window in RECOMB Michael Bruno Memorial Award 2010 \Israeli scholars and scientists of truly exceptional promise, whose achievements to date sug- gest future breakthroughs in their respective fields” [age < 50] European Research Council \Advanced