DOCSLIB.ORG

927-930 Feature Modencode NR.Indd

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
927-930 Feature Modencode NR.Indd Vol 459|18 June 2009 FEATURE Unlocking the secrets of the genome Despite the successes of genomics, little is known about how genetic information produces complex organisms. A look at the crucial functional elements of fly and worm genomes could change that. DNA and expressed sequence tags, have been These two model organisms, with their ease of Susan E. Celniker, Laura A. L. Dillon, invaluable, but unfortunately these data sets husbandry and genetic manipulation, are pillars Mark B. Gerstein, Kristin C. Gunsalus, remain incomplete7. Non-coding RNA genes of modern biological research, and a systematic Steven Henikoff, Gary H. Karpen, present an even greater challenge8–10, and many catalogue of their functional genomic elements Manolis Kellis, Eric C. Lai, Jason D. Lieb, remain to be discovered, particularly those promises to pave the way to a more complete David M. MacAlpine, Gos Micklem, that have not been strongly conserved during understanding of the human genome. Studies Fabio Piano, Michael Snyder, Lincoln Stein, evolution. Flies and worms have roughly the of these animals have provided key insights Kevin P. Whiteand Robert H. Waterston, for same number of known transcription factors as into many basic metazoan processes, including the modENCODE Consortium humans11, but comprehensive molecular stud- developmental patterning, cellular signalling, ies of gene regulatory networks have yet to be DNA replication and inheritance, programmed he primary objective of the Human tackled in any of these species. cell death and RNA interference (RNAi). The Genome Project was to produce high- In an attempt to remedy this situation, the genomes are small enough to be investigated Tquality sequences not just for the human National Human Genome Research Institute comprehensively with current technologies and genome but also for those of the chief model (NHGRI) launched the ENCODE (Encyclope- findings can be validated in vivo. The research organisms: Escherichia coli, yeast (Saccharomy- dia of DNA Elements) project in 2003, with the communities that study these two organisms will ces cerevisiae), worm (Caenorhabditis elegans), goal of defining the functional elements in the rapidly make use of the modENCODE results, fly (Drosophila melanogaster) and mouse (Mus human genome. The pilot phase of the project deploying powerful experimental approaches musculus). Free access to the resultant data has focused on 1% of the human genome and a that are often not possible or practical in mam- prompted much biological research, includ- parallel effort to foster technology develop- mals, including genetic, genomic, transgenic, ing development of a map of common human ment12. The initial ENCODE analysis revealed biochemical and RNAi assays. modENCODE, genetic variants (the International HapMap new findings but also made clear just how com- with its potential for biological validation, will Project)1, expression profiling of healthy and plex the biology is and how our grasp of it is far add value to the human ENCODE effort by illu- diseased cells2 and in-depth studies of many from complete13. On the basis of this experi- minating the relationship between molecular individual genes. These genome sequences ence, the NHGRI launched two complemen- and biological events. have enabled researchers to carry out genetic tary programmes in 2007: an expansion of the The modENCODE project (Table 1) com- and functional genomic studies not previously human ENCODE project to the whole genome plements other systematic investigations possible, revealing new biological insights with (www.genome.gov/ENCODE) and the model into these highly studied organisms. In both broad relevance across the animal kingdom3,4. organism ENCODE (modENCODE) project organisms, RNAi collections have been devel- Nevertheless, our understanding of how the to generate a comprehensive annotation of oped and used to uncover novel gene func- information encoded in a genome can produce the functional elements in the C. elegans and tions14–18. Mutants are being recovered through a complex multicellular organism remains far D. melanogaster genomes (www.modencode. insertional mutagenesis19 and targeted dele- from complete. To interpret the genome accu- org; www.genome.gov/modENCODE). tions (http://celeganskoconsortium.omrf.org; rately requires a complete list of functionally important elements and a description of their TABLE 1 modENCODE CONSORTIUM dynamic activities over time and across dif- Elements Worm Fly Primary experimental data ferent cell types. As well as genes for proteins Transcripts Robert Waterston Susan Celniker Tiling arrays, RNASeq, RT-PCR/RACE, and non-coding RNAs, functionally impor- (mRNAs, non- (University of (LBNL), Eric Lai mass spectrometry, 3’ untranslated tant elements include regulatory sequences coding RNAs, Washington), (Sloan-Kettering region clone library, UAS-miRNA flies, that direct essential functions such as gene transcription start Fabio Piano (New Institute) knockdowns of RNA-binding proteins expression, DNA replication and chromosome sites, untranslated York University) regions, miRNAs) inheritance. Although geneticists have been quick to Transcription-factor- Michael Snyder Kevin White ChIP-chip, ChIP-seq, transcription- decode the functional elements in the yeast binding sites (Yale University) (University of factor-tagged strains, anti- Chicago) transcription factor antibodies S. cerevisiae, with its small compact genome and powerful experimental tools5–6, our under- Chromatin marks Jason Lieb Gary Karpen (LBNL), ChIP-chip and ChIP-seq of (University of Steven Henikoff chromosome-associated proteins and standing of the more complex genomes of North Carolina), nucleosomes human, mouse, fly and worm is still rudimen- Steven Henikoff tary. Intrinsic signals that define the bounda- (University of ries of protein-coding genes can only be partly Washington) recognized by current algorithms, and signals DNA replication David MacAlpine ChIP-chip and ChIP-seq of essential for other functional elements are even harder to (Duke University initiator proteins, origin mapping and find and interpret. Experimental approaches, Medical Center) DNA copy number in differentiated notably the sequencing of complementary tissues 927 © 2009 Macmillan Publishers Limited. All rights reserved 9927-93027-930 FeatureFeature mmodENCODEodENCODE NR.inddNR.indd 927927 112/6/092/6/09 113:50:243:50:24 OPINION NATURE|Vol 459|18 June 2009 RNA Centromere polymerase specification Condensation Histone Replication origins and and cohesion modifications, pre-replicative complex variants, and Spliceosome binding proteins Transcription Pre-RC DNA Nuclear pore and factors polymerase nuclear lamin interactions Isolate Domain-level chromatin regulation and Extract dosage compensation RNA Origin mapping, Short RNA Long RNA timing, miRNA mRNA differential piRNA hnRNA replication siRNA ncRNA Generate antibodies Microarray or sequence Epigenetics and transcription regulation Replication Transcription and splicing Figure 1 | DNA element functions and identification process. www.shigen.nig.ac.jp/c.elegans), with the other issues as the opportunities arise. the different types of functional element eventual goal of one for every known gene. The core of the modENCODE project consists will be used to reveal fundamental princi- Genome sequences of related species are now of ten groups who use high-throughput ples of fly and worm genome biology and to also available for both fly20,21 and worm22, methods to identify functional elements begin to uncover the emergent properties and multiple independent wild isolates are (see Table 1). A Data Coordinating Center of these complex genomes. Some topics the being characterized (T. MacKay, personal (DCC) will collect, integrate and display the modENCODE groups, along with interested communication, www.dpgp.org23; R.H.W.). data. Together, the groups expect to identify members of the wider community, intend to First-generation catalogues have been assem- the principal classes of functional element explore are outlined below, but these are only a bled of gene expression patterns during for D. melanogaster and C. elegans. They will beginning. Our intention is to create a resource development and in different tissues24–34. work closely together to complete the precise that will provide the foundation for ongoing annotation of protein-coding genes, identify analysis by scientists for years to come. Research and analysis small RNAs and non-coding RNA transcripts, Our two model organisms share many The modENCODE project will operate as an map transcription start sites, identify promoter similarities with other metazoans, including open consortium and participants can join motif elements, elucidate functional elements humans. They also differ from other organ- on the understanding that they will abide by within 3ʹ untranslated regions, and identify isms in some striking ways, particularly in the set criteria (www.genome.gov/26524644). alternatively spliced transcripts as well as the details of the establishment and maintenance An important aim of the project is to respond signals required for splicing. Genomic sites of cellular identity, centromere biology and to the needs of the broader Drosophila and bound by sequence-specific transcription heterochromatin function. To help under- C. elegans scientific communities, and several factors will also be comprehensively identi- stand how the similarities and differences in avenues will be open for suggestions on fied. Charting the chromatin
Load more

Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
    [Show full text]
  • Manolis Kellis Piotr Indyk
    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
    [Show full text]
  • Prof. Manolis Kellis April 15, 2008
    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
    [Show full text]
  • ENCODE Consortium Meeting
    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
    [Show full text]
  • Unweaving)The)Circuitry)) Of)Complex)Disease!
    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
    [Show full text]
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]
  • ENCODE: Understanding the Genome
    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
    [Show full text]
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
    [Show full text]
  • An Integrated Encyclopedia of DNA Elements in the Human Genome
    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]