DOCSLIB.ORG

Downloaded from Capacity for Human Malaria Among Anopheles Lines from Africa, Asia, Europe, and Latin Cluding Adapting to Humans As Primary Hosts

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downloaded from Capacity for Human Malaria Among Anopheles Lines from Africa, Asia, Europe, and Latin Cluding Adapting to Humans As Primary Hosts RESEARCH ◥ exist, Anopheles exhibits a dynamic genomic RESEARCH ARTICLE SUMMARY evolutionary profile. Comparative analyses show a fivefold faster rate of gene gain and loss, elevated gene shuffling on the X chromosome, MOSQUITO GENOMICS and more intron losses in Anopheles.Somede- terminants of vectorial capacity, such as chemo- ◥ sensory genes, do not show Highly evolvable malaria vectors: The ON OUR WEB SITE elevated turnover but in- stead diversify through Anopheles Read the full article genomes of 16 mosquitoes at http://dx.doi. protein-sequence changes. org/10.1126/ We also document evidence † et al. science.1258522 ofvariationinimportant Daniel E. Neafsey,* Robert M. Waterhouse,* .................................................. reproductive phenotypes, INTRODUCTION: Control of mosquito vectors comparisons to individual genes or sets of ge- genes controlling immunity to Plasmodium ma- has historically proven to be an effective means nomic markers with no genome-wide data to laria parasites and other microbes, genes en- of eliminating malaria. Human malaria is investigate attributes associated with vectorial coding cuticular and salivary proteins, and transmittedonlybymosquitoesinthegenus capacity across the genus. genes conferring metabolic insecticide resist- Anopheles, but not all species within the genus, ance. This dynamism of anopheline genes and or even all members of each vector species, are RESULTS: We sequenced and assembled the genomes may contribute to their flexible capacity efficient malaria vectors. Variation in vectorial genomes and transcriptomes of 16 anophe- to take advantage of new ecological niches, in- Downloaded from capacity for human malaria among Anopheles lines from Africa, Asia, Europe, and Latin cluding adapting to humans as primary hosts. mosquito species is determined by many factors, America, spanning ~100 million years of evo- including behavior, immunity, and life history. lution and chosen to represent a range of CONCLUSIONS: Anopheline mosquitoes ex- evolutionary distances from An. gambiae,a hibit a molecular evolutionary profile very dis- RATIONALE: Thisvariationinvectorialca- variety of geographic locations and ecological tinct from Drosophila, and their genomes harbor pacity suggests an underlying genetic/genomic conditions, and varying degrees of vectorial strong evidence of functional variation in traits http://science.sciencemag.org/ plasticity that results in variation of key traits capacity. Genome assembly quality reflected that determine vectorial capacity. These 16 new determining vectorial capacity within the DNA template quality and homozygosity. De- reference genome assemblies provide a founda- genus. Sequencing the genome of Anopheles spite variation in contiguity, the assemblies tion for hypothesis generation and testing to gambiae, the most important malaria vector were remarkably complete and searches for further our understanding of the diverse bio- in sub-Saharan Africa, has offered numerous arthropod-wide single-copy orthologs gener- logical traits that determine vectorial capacity.▪ insights into how that species became highly ally revealed few missing genes. Genome an- The complete list of authors and affiliations is available in specializedtoliveamongandfeeduponhu- notation supported with RNA sequencing the full article online. mans and how susceptibility to mosquito transcriptomes yielded between 10,738 and *These authors contributed equally to this work. control strategies is determined. Until very 16,149 protein-coding genes for each species. †Corresponding author. E-mail: [email protected] (D.E.N.); [email protected] (N.J.B.) recently, similar genomic resources have Relative to Drosophila, the closest dipteran Cite this article as D. E. Neafsey et al., Science 347, on September 21, 2019 not existed for other anophelines, limiting genus for which equivalent genomic resources 1258522 (2015). DOI: 10.1126/science.1258522 Geography, vector status, and molecular phylogeny of the 16 newly sequenced anopheline mosquitoes and selected other dipterans. The maximum likelihood molecular phylogeny of all sequenced anophelines and two mosquito outgroups was constructed from the aligned protein sequences of 1085 single-copy orthologs. Shapes between branch termini and species names indicate vector status and are colored according to geographic ranges depicted on the map. Ma, million years ago. SCIENCE sciencemag.org 2JANUARY2015• VOL 347 ISSUE 6217 43 RESEARCH ◥ the 450 known species of anopheline mosqui- RESEARCH ARTICLE toes (3). Sequencing the genome of Anopheles gambiae, the most important malaria vector in sub-Saharan Africa, has offered numerous in- MOSQUITO GENOMICS sights into how that species became highly spe- cialized to live among and feed upon humans and how susceptibility to mosquito control strat- Highly evolvable malaria vectors: The egies is determined (4). Until very recently (5–7), similar genomic resources have not existed for Anopheles other anophelines, limiting comparisons to in- genomes of 16 mosquitoes dividual genes or sets of genomic markers with no genome-wide data to investigate attributes as- 1 † 2,3,4,5 6 Daniel E. Neafsey, * Robert M. Waterhouse, * Mohammad R. Abai, sociated with vectorial capacity across the genus. 7 7 8 9 10 Sergey S. Aganezov, Max A. Alekseyev, James E. Allen, James Amon, Bruno Arcà, Thus, we sequenced and assembled the ge- 11 12 13 6 Peter Arensburger, Gleb Artemov, Lauren A. Assour, Hamidreza Basseri, nomes and transcriptomes of 16 anophelines 1 1 14,15 16 Aaron Berlin, Bruce W. Birren, Stephanie A. Blandin, Andrew I. Brockman, from Africa, Asia, Europe, and Latin America. 17 18 2,3 19 20 Thomas R. Burkot, Austin Burt, Clara S. Chan, Cedric Chauve, Joanna C. Chiu, We chose these 16 species to represent a range Mikkel Christensen,8 Carlo Costantini,21 Victoria L. M. Davidson,22 Elena Deligianni,23 of evolutionary distances from An. gambiae,a Tania Dottorini,16 Vicky Dritsou,24 Stacey B. Gabriel,25 Wamdaogo M. Guelbeogo,26 variety of geographic locations and ecological Andrew B. Hall,27 Mira V. Han,28 Thaung Hlaing,29 Daniel S. T. Hughes,8,30 conditions, and varying degrees of vectorial Downloaded from Adam M. Jenkins,31 Xiaofang Jiang,32,27 Irwin Jungreis,2,3 Evdoxia G. Kakani,33,34 capacity (8) (Fig. 1, A and B). For example, An. Maryam Kamali,35 Petri Kemppainen,36 Ryan C. Kennedy,37 Ioannis K. Kirmitzoglou,16,38 quadriannulatus, although extremely closely Lizette L. Koekemoer,39 Njoroge Laban,40 Nicholas Langridge,8 Mara K. N. Lawniczak,16 related to An. gambiae, feeds preferentially on Manolis Lirakis,41 Neil F. Lobo,42 Ernesto Lowy,8 Robert M. MacCallum,16 bovines rather than humans, limiting its poten- Chunhong Mao,43 Gareth Maslen,8 Charles Mbogo,44 Jenny McCarthy,11 Kristin Michel,22 tial to transmit human malaria. An. merus, An. Sara N. Mitchell,33 Wendy Moore,45 Katherine A. Murphy,20 Anastasia N. Naumenko,35 melas, An. farauti, and An. albimanus females Tony Nolan,16 Eva M. Novoa,2,3 Samantha O’Loughlin,18 Chioma Oringanje,45 can lay eggs in salty or brackish water, instead http://science.sciencemag.org/ Mohammad A. Oshaghi,6 Nazzy Pakpour,46 Philippos A. Papathanos,16,24 of the freshwater sites required by other species. With a focus on species most closely related to Ashley N. Peery,35 Michael Povelones,47 Anil Prakash,48 David P. Price,49,50 An. gambiae (9), the sampled anophelines span Ashok Rajaraman,19 Lisa J. Reimer,51 David C. Rinker,52 Antonis Rokas,52,53 the three main subgenera that shared a common Tanya L. Russell,17 N’Fale Sagnon,26 Maria V. Sharakhova,35 Terrance Shea,1 ancestor ~100 million years ago (Ma) (10). Felipe A. Simão,4,5 Frederic Simard,21 Michel A. Slotman,54 Pradya Somboon,55 Vladimir Stegniy,12 Claudio J. Struchiner,56,57 Gregg W. C. Thomas,58 Marta Tojo,59 Materials and methods summary 23 60 42 41 Pantelis Topalis, José M. C. Tubio, Maria F. Unger, John Vontas, Genomic DNA and whole-body RNA were ob- 36 61 62 2,3,63 Catherine Walton, Craig S. Wilding, Judith H. Willis, Yi-Chieh Wu, tained from laboratory colonies and wild-caught 64 4,5 53 33,34 Guiyun Yan, Evgeny M. Zdobnov, Xiaofan Zhou, Flaminia Catteruccia, specimens (tables S1 and S2), with samples for 16 42 62 16,24 George K. Christophides, Frank H. Collins, Robert S. Cornman, Andrea Crisanti, nine species procured from newly established on September 21, 2019 Martin J. Donnelly,51,65 Scott J. Emrich,13 Michael C. Fontaine,42,66 William Gelbart,67 isofemale colonies to reduce heterozygosity. Matthew W. Hahn,68,58 Immo A. Hansen,49,50 Paul I. Howell,69 Fotis C. Kafatos,16 Illumina sequencing libraries spanning a range Manolis Kellis,2,3 Daniel Lawson,8 Christos Louis,41,23,24 Shirley Luckhart,46 of insert sizes were constructed, with ~100-fold Marc A. T. Muskavitch,31,70 José M. Ribeiro,71 Michael A. Riehle,45 Igor V. Sharakhov,35,27 paired-end 101–base pair (bp) coverage gener- Zhijian Tu,27,32 Laurence J. Zwiebel,72 Nora J. Besansky42† ated for small (180 bp) and medium (1.5 kb) in- sert libraries and lower coverage for large (38 kb) Variation in vectorial capacity for human malaria among Anopheles mosquito species is insert libraries (table S3). DNA template for the determined by many factors, including behavior, immunity, and life history. To investigate small and medium input libraries was sourced the genomic basis of vectorial capacity and explore new avenues for vector control, we from single female mosquitoes from each species sequenced the genomes of 16 anopheline mosquito species from diverse locations
Load more

Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
    [Show full text]
  • Manolis Kellis Piotr Indyk
    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
    [Show full text]
  • Prof. Manolis Kellis April 15, 2008
    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
    [Show full text]
  • ENCODE Consortium Meeting
    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
    [Show full text]
  • Unweaving)The)Circuitry)) Of)Complex)Disease!
    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
    [Show full text]
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]
  • ENCODE: Understanding the Genome
    ENCODE: Understanding the Genome Michael Snyder November 6, 2012 Conflicts: Personalis, Genapsys, Illumina Slides From Ewan Birney, Marc Schaub, Alan Boyle Encyclopedia of DNA Elements (ENCODE) • NHGRI-funded consortium • Goal: delineate all functional elements in the human genome • Wide array of experimental assays • Three Phases: 1) Pilot 2) Scale Up 1.0 3) Scale up 2.0 The ENCODE Project Consortium. An Integrated Encyclopedia of DNA Elements in the Human Genome. Nature 2012 Project website: http://encodeproject.org The ENCODE Consortium Brad Bernstein (Eric Lander, Manolis Kellis, Tony Kouzarides) Ewan Birney (Jim Kent, Mark Gerstein, Bill Noble, Peter Bickel, Ross Hardison, Zhiping Weng) Greg Crawford (Ewan Birney, Jason Lieb, Terry Furey, Vishy Iyer) Jim Kent (David Haussler, Kate Rosenbloom) John Stamatoyannopoulos (Evan Eichler, George Stamatoyannopoulos, Job Dekker, Maynard Olson, Michael Dorschner, Patrick Navas, Phil Green) Mike Snyder (Kevin Struhl, Mark Gerstein, Peggy Farnham, Sherman Weissman) Rick Myers (Barbara Wold) Scott Tenenbaum (Luiz Penalva) Tim Hubbard (Alexandre Reymond, Alfonso Valencia, David Haussler, Ewan Birney, Jim Kent, Manolis Kellis, Mark Gerstein, Michael Brent, Roderic Guigo) Tom Gingeras (Alexandre Reymond, David Spector, Greg Hannon, Michael Brent, Roderic Guigo, Stylianos Antonarakis, Yijun Ruan, Yoshihide Hayashizaki) Zhiping Weng (Nathan Trinklein, Rick Myers) Additional ENCODE Participants: Elliott Marguiles, Eric Green, Job Dekker, Laura Elnitski, Len Pennachio, Jochen Wittbrodt .. and many senior
    [Show full text]
  • Co-Expression Networks Reveal the Tissue-Specific Regulation of Transcription and Splicing
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Co-expression networks reveal the tissue-specific regulation of transcription and splicing Ashis Saha,1 Yungil Kim,1,6 Ariel D.H. Gewirtz,2,6 Brian Jo,2 Chuan Gao,3 Ian C. McDowell,4 The GTEx Consortium,7 Barbara E. Engelhardt,5 and Alexis Battle1 1Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA; 2Program in Quantitative and Computational Biology, Princeton University, Princeton, New Jersey 08540, USA; 3Department of Statistical Science, Duke University, Durham, North Carolina 27708, USA; 4Program in Computational Biology and Bioinformatics, Duke University, Durham, North Carolina 27708, USA; 5Department of Computer Science and Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the reg- ulation of splicing and transcription.
    [Show full text]
  • An Integrated Encyclopedia of DNA Elements in the Human Genome
    An integrated encyclopedia of DNA elements in the human genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dunham, Ian, Anshul Kundaje, Shelley F. Aldred, Patrick J. Collins, Carrie A. Davis, Francis Doyle, Charles B. Epstein, et al. “An Integrated Encyclopedia of DNA Elements in the Human Genome.” Nature 489, no. 7414 (September 5, 2012): 57–74. As Published http://dx.doi.org/10.1038/nature11247 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/87013 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2013 March 06. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Nature. 2012 September 6; 489(7414): 57–74. doi:10.1038/nature11247. An Integrated Encyclopedia of DNA Elements in the Human Genome The ENCODE Project Consortium Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]