Increased DNA Copy Number Variation Mosaicism in Elderly Human Brain
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
European Patent Office of Opposition to That Patent, in Accordance with the Implementing Regulations
(19) TZZ Z_T (11) EP 2 884 280 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/566 (2006.01) 09.05.2018 Bulletin 2018/19 (21) Application number: 13197310.9 (22) Date of filing: 15.12.2013 (54) Method for evaluating the scent performance of perfumes and perfume mixtures Verfahren zur Bewertung des Duftverhaltens von Duftstoffen und Duftstoffmischungen Procédé d’evaluation de senteur performance du parfums et mixtures de parfums (84) Designated Contracting States: (56) References cited: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB WO-A2-03/091388 GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR • BAGHAEI KAVEH A: "Deorphanization of human olfactory receptors by luciferase and Ca-imaging (43) Date of publication of application: methods.",METHODS IN MOLECULAR BIOLOGY 17.06.2015 Bulletin 2015/25 (CLIFTON, N.J.) 2013, vol. 1003, 19 June 2013 (2013-06-19), pages229-238, XP008168583, ISSN: (73) Proprietor: Symrise AG 1940-6029 37603 Holzminden (DE) • KAVEH BAGHAEI ET AL: "Olfactory receptors coded by segregating pseudo genes and (72) Inventors: odorants with known specific anosmia.", 33RD • Hatt, Hanns ANNUAL MEETING OF THE ASSOCIATION FOR 44789 Bochum (DE) CHEMORECEPTION, 1 April 2011 (2011-04-01), • Gisselmann, Günter XP055111507, 58456 Witten (DE) • TOUHARA ET AL: "Deorphanizing vertebrate • Ashtibaghaei, Kaveh olfactory receptors: Recent advances in 44801 Bochum (DE) odorant-response assays", NEUROCHEMISTRY • Panten, Johannes INTERNATIONAL, PERGAMON PRESS, 37671 Höxter (DE) OXFORD, GB, vol. -
Pathogenetic Subgroups of Multiple Myeloma Patients
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE High-resolution genomic profiles define distinct clinico- pathogenetic subgroups of multiple myeloma patients Daniel R. Carrasco,1,2,8 Giovanni Tonon,1,8 Yongsheng Huang,3,8 Yunyu Zhang,1 Raktim Sinha,1 Bin Feng,1 James P. Stewart,3 Fenghuang Zhan,3 Deepak Khatry,1 Marina Protopopova,5 Alexei Protopopov,5 Kumar Sukhdeo,1 Ichiro Hanamura,3 Owen Stephens,3 Bart Barlogie,3 Kenneth C. Anderson,1,4 Lynda Chin,1,7 John D. Shaughnessy, Jr.,3,9 Cameron Brennan,6,9 and Ronald A. DePinho1,5,9,* 1 Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115 2 Department of Pathology, Brigham and Women’s Hospital, Boston, Massachusetts 02115 3 The Donna and Donald Lambert Laboratory of Myeloma Genetics, Myeloma Institute for Research and Therapy, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205 4 The Jerome Lipper Multiple Myeloma Center, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115 5 Center for Applied Cancer Science, Belfer Institute for Innovative Cancer Science, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 6 Neurosurgery Service, Memorial Sloan-Kettering Cancer Center, Department of Neurosurgery, Weill Cornell Medical College, New York, New York 10021 7 Department of Dermatology, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, 02115 8 These authors contributed equally to this work. 9 Cocorresponding authors: [email protected] (C.B.); [email protected] (J.D.S.); [email protected] (R.A.D.) *Correspondence: [email protected] Summary To identify genetic events underlying the genesis and progression of multiple myeloma (MM), we conducted a high-resolu- tion analysis of recurrent copy number alterations (CNAs) and expression profiles in a collection of MM cell lines and out- come-annotated clinical specimens. -
WO 2019/068007 Al Figure 2
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD. -
The Effect of Compound L19 on Human Colorectal Cells (DLD-1)
Stephen F. Austin State University SFA ScholarWorks Electronic Theses and Dissertations Spring 5-16-2018 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) Sepideh Mohammadhosseinpour [email protected] Follow this and additional works at: https://scholarworks.sfasu.edu/etds Part of the Biotechnology Commons Tell us how this article helped you. Repository Citation Mohammadhosseinpour, Sepideh, "The Effect of Compound L19 on Human Colorectal Cells (DLD-1)" (2018). Electronic Theses and Dissertations. 188. https://scholarworks.sfasu.edu/etds/188 This Thesis is brought to you for free and open access by SFA ScholarWorks. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of SFA ScholarWorks. For more information, please contact [email protected]. The Effect of Compound L19 on Human Colorectal Cells (DLD-1) Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 4.0 License. This thesis is available at SFA ScholarWorks: https://scholarworks.sfasu.edu/etds/188 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) By Sepideh Mohammadhosseinpour, Master of Science Presented to the Faculty of the Graduate School of Stephen F. Austin State University In Partial Fulfillment Of the Requirements For the Degree of Master of Science in Biotechnology STEPHEN F. AUSTIN STATE UNIVERSITY May, 2018 The Effect of Compound L19 on Human Colorectal Cells (DLD-1) By Sepideh Mohammadhosseinpour, Master of Science APPROVED: Dr. Beatrice A. Clack, Thesis Director Dr. Josephine Taylor, Committee Member Dr. Rebecca Parr, Committee Member Dr. Stephen Mullin, Committee Member Pauline Sampson, Ph.D. -
Clinical, Molecular, and Immune Analysis of Dabrafenib-Trametinib
Supplementary Online Content Chen G, McQuade JL, Panka DJ, et al. Clinical, molecular and immune analysis of dabrafenib-trametinib combination treatment for metastatic melanoma that progressed during BRAF inhibitor monotherapy: a phase 2 clinical trial. JAMA Oncology. Published online April 28, 2016. doi:10.1001/jamaoncol.2016.0509. eMethods. eReferences. eTable 1. Clinical efficacy eTable 2. Adverse events eTable 3. Correlation of baseline patient characteristics with treatment outcomes eTable 4. Patient responses and baseline IHC results eFigure 1. Kaplan-Meier analysis of overall survival eFigure 2. Correlation between IHC and RNAseq results eFigure 3. pPRAS40 expression and PFS eFigure 4. Baseline and treatment-induced changes in immune infiltrates eFigure 5. PD-L1 expression eTable 5. Nonsynonymous mutations detected by WES in baseline tumors This supplementary material has been provided by the authors to give readers additional information about their work. © 2016 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 eMethods Whole exome sequencing Whole exome capture libraries for both tumor and normal samples were constructed using 100ng genomic DNA input and following the protocol as described by Fisher et al.,3 with the following adapter modification: Illumina paired end adapters were replaced with palindromic forked adapters with unique 8 base index sequences embedded within the adapter. In-solution hybrid selection was performed using the Illumina Rapid Capture Exome enrichment kit with 38Mb target territory (29Mb baited). The targeted region includes 98.3% of the intervals in the Refseq exome database. Dual-indexed libraries were pooled into groups of up to 96 samples prior to hybridization. -
Analysis of Tissue-Specific & Allele- Specific DNA Methylation
Analysis of tissue-specific & allele- specific DNA methylation Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät IV – Chemie und Pharmazie der Universität Regensburg vorgelegt von Elmar Schilling aus Schwenningen 2009 The present work was carried out in the Department of Hematology and Oncology at the University Hospital Regensburg from June 2005 to June 2009 and was supervised by PD. Dr. Michael Rehli. Die vorliegende Arbeit entstand in der Zeit von Juni 2005 bis Juni 2009 in der Abteilung für Hämatologie und internistische Onkologie des Klinikums der Universität Regensburg unter der Anleitung von PD. Dr. Michael Rehli. Promotionsgesuch eingereicht am: 30. Juli 2009 Die Arbeit wurde angeleitet von PD. Dr. Michael Rehli. Prüfungsausschuss: Vorsitzender: Prof. Dr. Sigurd Elz 1. Gutachter: Prof. Dr. Roland Seifert 2. Gutachter: PD. Dr. Michael Rehli 3. Prüfer: Prof. Dr. Gernot Längst Lob und Tadel bringen den Weisen nicht aus dem Gleichgewicht. (Budha) TABLE OF CONTENTS 1 INTRODUCTION .............................................................................................. 1 1.1 THE CONCEPT OF EPIGENETICS ............................................................................................. 1 1.2 DNA METHYLATION .............................................................................................................. 2 1.2.1 DNA methyltransferases ................................................................................................ 3 1.2.2 -
AKT-Mtor Signaling in Human Acute Myeloid Leukemia Cells and Its Association with Adverse Prognosis
Cancers 2018, 10, 332 S1 of S35 Supplementary Materials: Clonal Heterogeneity Reflected by PI3K- AKT-mTOR Signaling in Human Acute Myeloid Leukemia Cells and its Association with Adverse Prognosis Ina Nepstad, Kimberley Joanne Hatfield, Tor Henrik Anderson Tvedt, Håkon Reikvam and Øystein Bruserud Figure S1. Detection of clonal heterogeneity for 49 acute myeloid leukemia (AML) patients; the results from representative flow cytometric analyses of phosphatidylinositol-3-kinase-Akt-mechanistic target of rapamycin (PI3K-Akt-mTOR) activation. For each patient clonal heterogeneity was detected by analysis Cancers 2018, 10, 332 S2 of S35 of at least one mediator in the PI3K-Akt-mTOR pathway. Patient ID is shown in the upper right corner of each histogram. The figure documents the detection of dual populations for all patients, showing the results from one representative flow cytometric analysis for each of these 49 patients. The Y-axis represents the amount of cells, and the X-axis represents the fluorescence intensity. The stippled line shows the negative/unstained controls. Figure S2. Cell preparation and gating strategy. Flow cytometry was used for examination of the constitutive expression of the mediators in the PI3K-Akt-mTOR pathway/network in primary AML cells. Cryopreserved cells were thawed and washed before suspension cultures were prepared as described in Materials and methods. Briefly, cryopreserved and thawed primary leukemic cells were incubated for 20 minutes in RPMI-1640 (Sigma-Aldrich) before being directly fixed in 1.5% paraformaldehyde (PFA) and permeabilized with 100% ice-cold methanol. The cells were thereafter rehydrated by adding 2 mL phosphate buffered saline (PBS), gently re-suspended and then centrifuged. -
Variable Selection Via Penalized Regression and the Genetic Algorithm Using Information Complexity, with Applications for High-Dimensional -Omics Data
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2016 Variable selection via penalized regression and the genetic algorithm using information complexity, with applications for high-dimensional -omics data Tyler J. Massaro University of Tennessee, Knoxville, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Applied Statistics Commons, Biostatistics Commons, and the Multivariate Analysis Commons Recommended Citation Massaro, Tyler J., "Variable selection via penalized regression and the genetic algorithm using information complexity, with applications for high-dimensional -omics data. " PhD diss., University of Tennessee, 2016. https://trace.tennessee.edu/utk_graddiss/3944 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Tyler J. Massaro entitled "Variable selection via penalized regression and the genetic algorithm using information complexity, with applications for high-dimensional -omics data." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements -
Supplementary Data
SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name olfactory receptor, family 4, subfamily C, member 16 Gene Symbol OR4C16 Organism Human Gene Summary Olfactory receptors interact with odorant molecules in the nose to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. Gene Aliases OR11-135 RefSeq Accession No. NC_000011.9, NT_167190.1 UniGene ID Hs.553619 Ensembl Gene ID ENSG00000181935 Entrez Gene ID 219428 Assay Information Unique Assay ID qHsaCED0047495 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000314634 Amplicon Context Sequence TTCCTTTTCTACTTATCCTTATCTGATACTTGCCTCTCTACTTCCATAACCCCTAGA ATGATTGTGGATGCCCTTTTGAAGAAGACAACTATCTCCTTCAGCGAGTGCATGA TC Amplicon Length (bp) 84 Chromosome Location 11:55339781-55339894 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9998 cDNA Cq Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) Target not expressed in universal RNA gDNA Cq Target not expressed -
Us 2018 / 0305689 A1
US 20180305689A1 ( 19 ) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 /0305689 A1 Sætrom et al. ( 43 ) Pub . Date: Oct. 25 , 2018 ( 54 ) SARNA COMPOSITIONS AND METHODS OF plication No . 62 /150 , 895 , filed on Apr. 22 , 2015 , USE provisional application No . 62/ 150 ,904 , filed on Apr. 22 , 2015 , provisional application No. 62 / 150 , 908 , (71 ) Applicant: MINA THERAPEUTICS LIMITED , filed on Apr. 22 , 2015 , provisional application No. LONDON (GB ) 62 / 150 , 900 , filed on Apr. 22 , 2015 . (72 ) Inventors : Pål Sætrom , Trondheim (NO ) ; Endre Publication Classification Bakken Stovner , Trondheim (NO ) (51 ) Int . CI. C12N 15 / 113 (2006 .01 ) (21 ) Appl. No. : 15 /568 , 046 (52 ) U . S . CI. (22 ) PCT Filed : Apr. 21 , 2016 CPC .. .. .. C12N 15 / 113 ( 2013 .01 ) ; C12N 2310 / 34 ( 2013. 01 ) ; C12N 2310 /14 (2013 . 01 ) ; C12N ( 86 ) PCT No .: PCT/ GB2016 /051116 2310 / 11 (2013 .01 ) $ 371 ( c ) ( 1 ) , ( 2 ) Date : Oct . 20 , 2017 (57 ) ABSTRACT The invention relates to oligonucleotides , e . g . , saRNAS Related U . S . Application Data useful in upregulating the expression of a target gene and (60 ) Provisional application No . 62 / 150 ,892 , filed on Apr. therapeutic compositions comprising such oligonucleotides . 22 , 2015 , provisional application No . 62 / 150 ,893 , Methods of using the oligonucleotides and the therapeutic filed on Apr. 22 , 2015 , provisional application No . compositions are also provided . 62 / 150 ,897 , filed on Apr. 22 , 2015 , provisional ap Specification includes a Sequence Listing . SARNA sense strand (Fessenger 3 ' SARNA antisense strand (Guide ) Mathew, Si Target antisense RNA transcript, e . g . NAT Target Coding strand Gene Transcription start site ( T55 ) TY{ { ? ? Targeted Target transcript , e . -
Explorations in Olfactory Receptor Structure and Function by Jianghai
Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 ABSTRACT Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 Copyright by Jianghai Ho 2014 Abstract Olfaction is one of the most primitive of our senses, and the olfactory receptors that mediate this very important chemical sense comprise the largest family of genes in the mammalian genome. It is therefore surprising that we understand so little of how olfactory receptors work. In particular we have a poor idea of what chemicals are detected by most of the olfactory receptors in the genome, and for those receptors which we have paired with ligands, we know relatively little about how the structure of these ligands can either activate or inhibit the activation of these receptors. Furthermore the large repertoire of olfactory receptors, which belong to the G protein coupled receptor (GPCR) superfamily, can serve as a model to contribute to our broader understanding of GPCR-ligand binding, especially since GPCRs are important pharmaceutical targets.