Role of ABCA5 in the Pathogenesis of Parkinson's Disease

Role of ABCA5 in the Pathogenesis of Parkinson’s disease

Lisa Mak

A thesis in total fulfilment of the requirements for the degree of

Masters by Research

School of Medical Science

Faculty of Medicine

August 2013

ORIGINALITY STATEMENT

„I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.‟

Signed ……………………………………………......

Date ……………………………………………......

TABLE OF CONTENT PAGE

Originality statement I Acknowledgement II Abbreviations III Abstract V

1. INTRODUCTION 1 1.1 Parkinson‟s disease 1 1.2 Brain Lipids 3 1.2.1 Importance of lipids in the brain 3 1.2.2 Lipids and Parkinson‟s disease 4 1.3 ATP-binding cassette (ABC) transporters 5 1.3.1 ABCA subfamily 6 1.3.2 ABCA transporter and neurodegeneration 12 1.4 ABCA5 12 1.4.1 ABCA5 expression 13 1.4.2 Function of ABCA5 13 1.4.3 Regulation of ABCA5 15 1.5 Hypothesis and aims of project 16

2. MATERIALS AND METHODS 17 2.1 Materials 18 2.2 Cell culture methods 20 2.2.1 Thawing cell lines from liquid nitrogen stock 20 2.2.2 Maintaining and culturing cells 20 2.2.3 Transfection 20 2.3 Genetic techniques 21 2.3.1 RNA extraction from cells and brain tissues 21 2.3.1.1 RNA extraction from cells 21 2.3.1.2 RNA extraction from brain tissues 22 2.3.2 Reverse transcription 22 2.3.3 Quantitative real-time polymerase chain reaction 23 2.4 Protein methods 25 2.4.1 Cell lysates (RIPA) 25 2.4.2 Western blotting 25 2.5 BODIPY-cholesterol efflux assay 26 2.6 Statistical analyses 28

3. RESULTS 29 3.1 Expression of ABCA5 in the human brain 30 3.2 Expression of α-synuclein in the human brain 33 3.2.1 Impact of ABCA5 expression on α-synuclein in SK-N-SH cells 34 3.3 Function and regulation of ABCA5 35 3.3.1 Development of protocol for measuring cholesterol efflux 35 3.3.2 ABCA5 as a cholesterol transporter 36 3.3.3 PPAR-activator induces ABCA5 expression in SK-N-SH cells 39

4. DISCUSSION 43

5. REFERENCES 48

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………......

ACKNOWLEDGEMENTS

Firstly, I would like to give thanks to my supervisor Dr. Scott Kim for his much appreciated support and his continuous advices throughout my candidature. I am also very grateful to my co-supervisor Prof. Glenda

Halliday for all her support and encouragement.

I would also like to extend my appreciation to the rest of my colleagues within the Halliday Group and within Neuroscience Research Australia for their support and assistance and friendship throughout the years.

I am also grateful to Mrs. Elizabeth Gilbert for her generous Gilbert scholarship during my candidature.

Special thanks to my close friend and sister in Christ Puika for sharing all the joy and tears and always being there for me.

I am deeply grateful to my family and my fiancé, Victor, for their tremendous amount of love, support and encouragement they have given to me throughout my candidature.

Last but not least, I would like to give all the glory to my lord Jesus and am extremely grateful for giving me such a valuable experience to learn and grow.

LIST OF ABBREVIATIONS

ABC transporter ATP-binding cassette transporter

ABCA1 ATP-binding cassette subfamily A1

ABCA2 ATP-binding cassette subfamily A2

ABCA3 ATP-binding cassette subfamily A3

ABCA4 ATP-binding cassette subfamily A4

ABCA5 ATP-binding cassette subfamily A5

ABCA7 ATP-binding cassette subfamily A7

ABCA8 ATP-binding cassette subfamily A8

AD Alzheimer‟s disease

ApoA-I Apolipoprotein A-I

ApoE Apolipoprotein E

APP Amyloid precursor protein

Aβ Amyloid-β

BODIPY Dipyrromethene boron difluoride

BSA Bovine serum albumin

CD Cyclodextrin cDNA Complementary deoxyribonucleic acid

CNS Central nervous system

Ct Comparative threshold cycle dNTP Deoxyribonucleotide triphosphate

EDTA Ethylenediaminetetraacetic acid

GWAS Genome-wide association study

HCl Hydrogen chloride

III

HDL High density lipoprotein

LB Lewy bodies

LDL Low-density lipoprotein

LXR Liver-X receptor

MES cells Mesencephalic neuronal cells

M-MLV Moloney Murine Leukemia Virus mRNA Messenger RNA

NaCl Sodium chloride

NBDs Nucleotide-binding domains

Opti-MEM Opti-minimal essential medium

PBS Phosphate buffered saline

PD Parkinson‟s disease

PMI Post-mortem interval

PPAR Peroxisome proliferator-activated receptor

PUFAs Poly-unsaturated fatty acids qRT-PCR Quantitative real-time polymerase chain reaction

RIPA Radioimmunoprecipitation

RXR Retinoid X receptor

SDS-PAGE SDS polyacrylamide gels

SE Standard error

SNPC Substantianigra pars compacta

SP cells Side population cells

TMDs Transmembrane domains

α-syn α-synuclein

ABSTRACT

Parkinson‟s disease (PD) is one of the most common neurological movement disorders in humans. Its pathological hallmark is the deposition of intracellular aggregates of the neuronal protein α-synuclein. Increasing evidence indicates that α-synuclein binds and interacts with lipids, which are transported in the central nervous system (CNS) by a group of proteins called ATP-Binding Cassette subfamily A (ABCA) transporters. A genome-wide association study reported that ABCA5 is associated with PD. However, very little is known about the function of ABCA5 in the brain or PD. The aim of this project is to investigate the potential function of ABCA5 in the brain and in the disease process of PD. This was achieved by analysing changes in ABCA5 expression in samples of human post-mortem PD brain compared with age- and gender- matched disease-free controls, andby assessing PD relevant molecular changes inin vitro models transiently expressing ABCA5. In the anterior cingulate cortex, ABCA5 gene expression, but not the expression of other ABCA transporters, was significantly reduced in PD compared to controls. The levels of α-synuclein expression were also significantly decreased in the same region as ABCA5. Moreover, SK-N-SH neuronal cells transiently transfected with ABCA5 demonstrated significantly up-regulated α- synuclein mRNA expression with no increase in α-synuclein protein levels. Transiently expressed ABCA5 was also shown to stimulate the efflux of cholesterol from neurons to discsmade from apolipoproteinE. Upregulation of ABCA5 gene expression could be stimulated by peroxisome proliferator-activated receptor (PPAR)in a time - and dose- dependent manner. These findings suggest that ABCA5 may be involved in regulation of lipid homeostasis in the pathological process of PD.

Chapter 1: Introduction

1.1.PARKINSON’S DISEASE

Parkinson‟s disease (PD) was first described in “An essay on the shaking palsy” by

James Parkinson in 1817 (Parkinson, 2002) where he detailed his observations of six individuals; one followed in detail over a long period of time, and the other five observed at a distance. Despite the small number of patients, Parkinson was able to provide a very accurate account of the symptoms of the disease as: “Involuntary tremulous motion, with lessened muscular power, in parts not in action and even when supported; with a propensity to bend the trunk forward, and to pass from a walking to a running pace”. Motor features remain the main criteria for the clinical diagnosis of PD, but it is now known that PD patients may also experience a number of non-motor features such as neuropsychiatric symptoms (hallucinations, depression and dementia)

(Sanchez-Ramos et al., 1996), sleep disturbances (Stacy, 2002), constipation

(Sadjadpour, 1983), hypotension (Goldstein, 2006), fatigue (van Hilten et al., 1993), olfactory deficits and autonomic dysfunctions.

PD is one of the most prevalent neurodegenerative diseases in humans. It affects approximately 1% of people over the age of 65, and the prevalence rises to 5% of people over the age of 85 (Van Den Eeden et al., 2003). It can be characterized as early onset or late onset. Early onset PD, which is estimated at 3% of PD cases, occurs before the age of 50 years and is usually due to genetic mutations. The majority of the PD cases are late onset and mostly sporadic.

Pathology of PD is characterised by the specific death of dopaminergic neurons in the substantianigra pars compacta (SN) and the abnormal formation of protein aggregates known as Lewy bodies (LB) (Byrne et al., 1987) with α-synuclein being the major component (Spillantini et al., 1997; Wakabayashi et al., 1997). α-Synuclein is a

2 presynaptic protein with a molecular weight of 14.6 kDa(Jakes et al., 1994). In 1997, a missense mutation in the SNCA gene (A53T) was identified to be the cause of early- onset familial PD (Polymeropoulos et al., 1997). Since then a number of other mutations and multiplications in the SNCA gene have been identified, all with the characteristic pathology of PD.

1.2. BRAIN LIPIDS

1.2.1. Importance of lipids in the brain

Lipids, commonly known as fats, are a broad group of naturally occurring molecules which are defined as hydrophobic, but are soluble in nonpolar organic solvents. They include fatty acids, cholesterol, phospholipids, sphingolipids and triglyceride. The main biological functions of lipids include energy storage, as structural components of cell membranes, and as important signalling molecules. The human brain is highly enriched in lipids. Lipids account for about 10% of the brain‟s fresh weight and half the dry matter of the brain. Moreover, gray matter contains 36-40% lipid and white matter 49-

66% (O'Brien & Sampson, 1965). They are actively synthesized and increase substantially in quantity during the early phases of development of the nervous system and they serve an important role in the brain.

The plasma membrane of neurons consists of a lipid bilayer composed primarily of phospholipids and cholesterol, and proteins with important cellular function such as receptors, transporters, and enzymes, are all embedded in this lipid bilayer (Spector &

Yorek, 1985).

Myelin is a specialized lipid membrane that encases neuronal axons in the brain. It is composed of 78% lipid and facilitates the conduction of electrical impulses along the myelinated nerve fibers. The lipid composition of brain myelin is highly unusual, and differs significantly from the plasma membrane. The predominant lipids in myelin are sphingolipids, cholesterol and glycerophospholipids. The importance of myelin is highlighted by a number of neurodegenerative autoimmune diseases such as multiple sclerosis, transverse myelitis and chronic inflammatory demyelinating polyneurophathy arising from myelin dysfunction.

Fatty acids, glycerolipids, sphingolipids and cholesterol are the major lipid classes and they are of particular significance in the central nervous system (CNS). The human brain is particularly enriched in two poly-unsaturated fatty acids (PUFAs): arachidonic acid and docosahexaenoic acid (also known as omega-6 and omega-3) (Chen et al.,

2008). PUFAs are essential for neuronal membranes because they provide membrane fluidity and permeability. They can also serve as an energy reservoir, and importantly, they take part in intra- and extracellular signalling as second messengers (Ruiperez et al., 2010). PUFAs have also been reported to take part in neuronal growth (Darios &

Davletov, 2006) as well as mediate other functions such as generation of apoptotic signals (Balsinde et al., 2006), cellular proliferation (Herbert & Walker, 2006) and translocation of lipid-modifying enzymes to cellular membranes (Wooten et al., 2008).

1.2.2. Lipids and Parkinson’s disease

Recently, there has been increasing evidence indicating that lipids may play a role in

PD(Bras et al., 2008; Teismann et al., 2003). Experimental studies have shown that α- synuclein can bind to lipid membranes through its amino-terminal repeats, indicating that it might be a lipid-binding protein (Jo et al., 2000). Multiple studies have also

4 documented the interactions between α-synuclein and phospholipid membranes and free fatty acids. It has been reported that α-synuclein interacts with free PUFAs to form soluble oligomers which then aggregate into insoluble high-molecular weight complexes (Sharon, Bar-Joseph, Frosch, et al., 2003). Another study has also reported that an alpha-helical conformational change is observed when α-synuclein is in the presence of either arachidonic acid or docosahexaenoic acid (Broersen et al., 2006). The same study also showed that α-synuclein reduced the micellar size of PUFAs and when they are exposed to PUFAs for a long period of time, α-synuclein fibrils will be formed

(Broersen et al., 2006). Moreover, a recent study has demonstrated that recombinant α- synuclein is able to bind fatty acids in vitro through its N-terminal region (Karube et al.,

2008).

The effect of α-synuclein on the levels of free PUFAs has also been investigated and results show that in mice lacking α-synuclein, the levels of free PUFAs were lower than those in wild-type mice. Yet, increased levels of free PUFAs in mesencephalic neuronal cells (MES cells) were observed upon overexpression of α-synuclein(Sharon, Bar-

Joseph, Mirick, et al., 2003). However, the levels of saturated or monounsaturated fatty acids did not change in all cell types, indicating that α-synuclein is only influential on

PUFA levels.

Another study revealed the association of α-synuclein with negatively charged membranes has a profound effect upon the integrity of bilayers containing anionic phospholipids (Madine, 2006). α-Synuclein appeared to destabilize the lipid bilayer to form smaller vesicular or nonbilayer structures (Madine, 2006).

1.3. ATP-BINDING CASSETTE (ABC) TRANSPORTERS

Forty-eight members of the ABC transporter family in humans have been identified

(Dean et al., 2001; Takahashi et al., 2005) and based on sequence homology and functions, they have been classified into seven subfamilies by the Human Genome

Organization (Dean et al., 2001).

The structure of a typical “full-size” ABC transporter consists of two hydrophilic nucleotide-binding domains (NBDs) located in the cytoplasm and two hydrophobic transmembrane domains (TMDs) embedded in the lipid bilayer that determines the substrate-specificity of the particular transporter (Linton, 2007). Not all ABC transporters are “full-size” transporters, some are only “half-size” transporters, which contain only one NBD and one TMD. However, “half-size” transporters require dimerization with another “half-size” transporter in order to function properly.

Figure 1.Topological model of a full size ABC transporter.

They utilize the energy of ATP hydrolysis to transport a variety of physiologic substrates across membranes (Petry et al., 2006; Schmitz et al., 2007). The substrates being transported range from ions to macromolecules (Linton, 2007) such as peptides, lipids, sugars, as well as hydrophobic compounds (Klein et al., 1999). 6

1.3.1. ABCA subfamily

ABCA subfamily comprises 12 full-sized transporters and they transport lipids such as cholesterol and phospholipids across membranes (Takahashi et al., 2005). Mutations in this subfamily cause genetic diseases such as Tangier disease caused by mutations in

ABCA1, Stargardt macular dystrophy and Cone-Rod dystrophy by ABCA4 (Maeda et al., 2008) and harlequin type ichthyosis by ABCA12 (Kelsell et al., 2005).

The focus of this study is on the ABCA subfamily because they transport lipids in the brain. In recent years, there has been mounting evidence indicating that specific members of the ABCA subfamily control brain lipid homeostasis and regulate a number of neurodegenerative disease processes. The human ABCA subfamily is divided into two subgroups based on phylogenetic analysis and gene structure (Broccardo et al.,

1999) : One subgroup contains five members, ABCA5, A6, A8, A9 and A10 (Albrecht

& Viturro, 2007) as they form a compact cluster on chromosome 17q (Albrecht &

Viturro, 2007). They also share strikingly high overall amino acid sequence homology but differ significantly from other members in the subfamily (Kaminski et al., 2006).

The prototype ABCA1 was mapped to chromosome 9q31 (Luciani et al., 1994). It is expressed in a variety of human tissues with highest expression levels in placenta, liver, lung, adrenal glands and fetal organs (Langmann et al., 1999). Northern blot analysis has indicated that ABCA1 mRNA is also expressed in the human brain (Langmann et al., 1999). The expression studies of ABCA1 in isolated human brain cells revealed that it is expressed in fetal neurons, astrocytes, microglia and oligodendrocytes and ABCA1 expression has been detected in all of these cell types with the highest expression in neurons and microglia (Kim et al., 2006).

ABCA1 has been identified as the defective gene in Tangier disease patient. Tangier disease is characterized by low serum high density lipoproteins and a biochemical defect in the cellular efflux of lipids to high density lipoproteins (Remaley et al., 1999).

Since then, ABCA1 has been studied intensively for its role as a major determinant of plasma HDL concentrations, as well as a transporter of major importance in lipoprotein metabolism, macrophage cholesterol homeostasis, and atherosclerosis (Aiello et al.,

2002; Attie et al., 2001). Because of these combined findings, ABCA1 is now seen as an important therapeutic target for treatment of low high-density lipoprotein (HDL) syndromes and cardiovascular disease.

In the brain, early examination of the physiological role of ABCA1 revealed that the protein acts as a translocator of phospholipids and cholesterol between the inner and outer plasma membrane (Lawn et al., 1999), but the detailed mechanisms of this translocation of phospholipids and cholesterol at the plasma membrane are still poorly understood. ABCA1 is proposed to act as the gate-keeper for modulating flux of tissue cholesterol into the reverse cholesterol transport pathway (Lawn et al., 1999; Oram &

Vaughan, 2000). Further experiments also suggest that the ABCA1 protein may actively mediate cholesterol transport (Vaughan & Oram, 2003). This study proposed that the extracellular lipid acceptor apolipoprotein A-I (ApoA-I) binds to ABCA1 and phospholipids and the resulting phospholipid-ApoA-I complex induces passive cholesterol efflux from the cell as a consequence of conformational changes in ABCA1.

A study by Kim et al. (2007) supports this view by demonstrating that in the presence of apolipoprotein E (ApoE) discs, ABCA1 can stimulate the removal of cholesterol from neurons.

Lipid-poor apolipoprotein Lipoprotein

Figure 2.Model for ABCA1 lipid-removal pathway. Excess cholesterol is incorporated into phospholipid domains of the intracellular plasma membrane. ABCA1 then transports cholesterol into its transmembrane chamber, where cholesterol is “flipped” to the extracellular plasma membrane. Lipid-poor apolipoprotein then picks up cholesterol from the cell-surface and carries it away from the cell.

While membrane cholesterol distribution is thought to modulate amyloid precursor protein (APP) processing, which may induce neurodegenerative diseases such as

Alzheimer‟s disease (AD) (Simons et al., 1998; Sparks et al., 1994), several studies have been performed to investigate the potential regulation of APP proteolysis and brain amyloid deposition by ABCA1. These will be explained in detail below in the section on the influences of ABC transporters on neurodegenerative diseases.

ABCA2 is expressed predominantly in the brain with particularly high expression in brain white matter regions and is localized mainly to late endosome/lysosomes in oligodendrocytes(Zhao et al., 2000). It is also found to colocalize in time and space with myelination markers (i.e. O4 and myelin basic protein) and the appearance of thick

9 myelin segments (Tanaka et al., 2003). Deficiency in ABCA2 results in abnormal sphingolipid metabolism in mouse brain suggesting that ABCA2 is involved in the intracellular metabolism of sphingolipids in the brain, particularly sphingomyelin and gangliosides in oligodendrocytes(Sakai et al., 2007). Davis (2011) then demonstrated that ABCA2 regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in neuronal cells.

ABCA3 is a 1704 amino acid glycoprotein of 190 kDa and it was found to have the highest expression in alveolar type II cells in the lung, followed by the brain, thyroid and testis (Langmann et al., 2003). Immunnohistochemistry has revealed ring-like structures in the cytosol of the cells, suggesting that ABCA3 protein is specifically concentrated in the membrane of lamellar bodies (Yamano et al., 2001). As alveolar type II cells are known to regulate the surfactant concentration in the alveolar space by secretion, reabsorption, and storage in lamellar bodies, ABCA3 is hypothesized to play an active role in the excretion of the lipid fraction of the pulmonary surfactant (Nagata et al., 2004).

ABCA4 is a retinal-specific member of the ABCA subfamily. It is localized in the retina along the rims and incisures of both rod and cone photoreceptor outer segment disk membranes (Illing et al., 1997). It mediates the transport of retinyldiene phospholipid complexes within the rod outer segment of the retina (Allikmets et al., 1997) and mutations in this gene can cause Stargardt disease (Maeda et al., 2008) and other eye- related disorders.

ABCA7 was characterized as a 2,146 amino acid protein expressed in human brain

(Ikeda et al., 2003). Its expression levels were shown to increase during induced sterol uptake conditions and decrease in cholesterol-depleting conditions (Brunham et al.,

2006). These studies suggest that ABCA7 plays an important role in lipid trafficking. It has also been reported to exhibit similar protein sequence homology with ABCA1

(54%) and co-regulate with ABCA1 in response to cholesterol uptake and efflux in macrophages (Kaminski et al., 2000). Kim et al. (2006) has demonstrated that ABCA7 has the highest expression in human microglia and Jehle et al. (2006) has also shown that macrophage ABCA7 plays a role in phagocytosis of apoptotic debris. These studies propose that microglial ABCA7 may play a role in phagocytosis of apoptotic debris in the brain.

The ABCA8 protein is a classical full-size transporter which has been demonstrated to exert an ATPase-dependent drug transport function (Graff & Pollack, 2004). Expression of ABCA8 mRNA was detected in human brain by northern blot and qRT-PCR analysis and in fetal brain neurons and astrocytes by qRT-PCR (Langmann et al., 2003;

Tsuruoka et al., 2002). The function of this protein is still unknown, with further studies needed.

1.3.2. ABCA transporter and neurodegeneration

Alzheimer’s disease

The development and accumulation of senile plaques consisting of abnormal aggregations of the amyloid-β (Aβ) peptide in the extracellular compartment of the brain parenchyma is one of the diagnostic hallmarks of Alzheimer‟s disease (AD)

(Lambert et al., 2009). An imbalance between the production of Aβ peptides and their clearance from the brain is one of the main hypotheses to explain the accumulation of

Aβ in AD patients (Shibata et al., 2000).

It has been established that ABCA1 plays an important role in influencing the development of AD. Increased ABCA1 mRNA and protein expression was identified in

AD hippocampal neurons (Kim et al., 2010). There is an increased risk of AD in people carrying certain ABCA1 genetic polymorphisms, where the 219K/883I/1587R haplotype is significantly associated with AD (Rodriguez-Rodriguez et al., 2007). It is known that excess cholesterol promotes amyloid precursor protein (APP) cleavage generating toxic Aβ peptides. Kim et al. (2007) demonstrated that ABCA1 promotes cholesterol efflux to apolipoprotein E (ApoE) discs, which may provide insight into the role ABCA1 plays in regulating neuronal cholesterol efflux and the generation of Aβ peptides. In agreement with this, Wahrle et al. (2005) reported an increase in the levels of Aβ peptides in Abca1 depleted mice. Another study of Wahrle et al. (2008) has also confirmed such influence of ABCA1 on Aβ peptides in AD by showing reduced amyloid deposition in overexpressed Abca1 AD mouse models.

1.4. ABCA5

Despite the importance of lipids in the pathological processes of PD, the role of ABCA transporters in the pathological processes of PD is fundamentally unknown. A genome- wide association study (GWAS)published in Nature Genetics (Simon-Sanchez et al.,

2009) reported that a member of ABCA subfamily, ABCA5, is associated with a reduced risk for PD. Although there is virtually nothing known about the role of

ABCA5 in the pathogenesis of PD, a number of studies have been done to investigate the role of ABCA5 in peripheral tissues.

1.4.1. ABCA5 expression

The ABCA5 gene is located on human chromosome 17q23.4 (Kubo et al., 2005) and codes a 1,642 amino acid protein (Petry et al., 2003) with a predicted molecular weight

12 of approximately 183 kDa (Petry et al., 2003). Northern blot analysis has revealed

ABCA5 mRNA expression in a number of human tissues including brain, liver, pancreas (Ohtsuki et al., 2007) and to a lesser extent skeletal muscle, kidney and placenta (Petry et al., 2003). Human ABCA5 mRNA expression has also been detected in colon carcinoma, neuroblastoma and leukemia cell lines (Petry et al., 2003), monocytes and macrophages (Langmann et al., 2006) with high expression in cells of melanocytic origin (Heimerl et al., 2007).

Expression of mouse Abca5 and rat Abca5 are quite similar to that of human, with transcripts of mouse Abca5 being strongly observed in brain, testis, lung and Kupffer cells of the livers, and weakly observed in heart, kidney, skeletal muscle and placenta samples (Kubo et al., 2005). Mouse Abca5 was also detected in the mouse brain, in oligodendrocytes and astrocytes in particular (Kubo et al., 2005). Northern-blot analyses has also revealed prominent detection of rat Abca5 mRNA in testis, lung and brain

(Petry et al., 2003), but most abundantly in testis, in basal cells of testicular seminiferous tubules and in interstitial cell clusters that consist mainly of Leydig cells

(Petry et al., 2006).

1.4.2. Function of ABCA5

Function of the ABCA5 transporter is still an unknown, but a number of possible roles have been suggested. It has been shown that pronounced expression of rat Abca5 were detected in Leydig cells, which are known to process cholesterol in the synthesis of testosterone. Since the initial steps of cholesterol dependent steroid hormone synthesis take place in the mitochondria and the final conversion into testosterone occurs at theendoplasmic reticulum, the intracellular localization of rat Abca5, presumably at the

Golgi apparatus, and its expression in Leydig cells, indicate that this transporter may play a role in intracellular sterol/steroid trafficking (Petry et al., 2006).

Ye et al. (2008) has also proposed that mouse Abca5 may have a role in macrophage cholesterol homeostasis due to its expression in Kupffer cells. Another study supported this concept reported that Abca5 deficient mice have significantly suppressed macrophage cholesterol efflux to high-density lipoprotein (Ye et al., 2010).

A study on Abca5 knockout mice revealed that after 10 weeks of age they exhibit abnormalities including subcutaneous edema, exophthalmos, and trembling leading to death (Kubo et al., 2005). Anatomical examination of these knockout mice revealed enlarged hearts due to failure of heart function, injured liver and visceral congestion, but no prominent abnormalities in brain and lungs (Kubo et al., 2005). Analyses showed that cardiomyocytes degenerated through vacuolation due to abnormalities in the processing of autolysosomes (Kubo et al., 2005). Interestingly, in the brain and lung of the Abca5 knockout mice, Abca2 and Abca3 proteins were highly expressed respectively (Kubo et al., 2005) suggesting a possible compensatory role preventing failure of functions in these organs.

In human, studies have been focused on cancer because human ABCA5 proteins are highly expressed in “Tip”-SP cells which are cells that are resistant to chemotherapy drug (Huang et al., 2009). It is possible that ABCA5 may contribute to the drug resistant activity in these cells (Huang et al., 2009). Moreover, although the mechanism which leads to the induction of ABCA5 in human colon carcinoma is unknown, it has been found that in GI-112 cells both ABCA5 and ABCB1 mRNAs are predominantly expressed (Ohtsuki et al., 2007). This suggests that the induction of ABCA5 in colon carcinoma may be linked to that of ABCB1 and ABCA5 may be acting as a drug efflux transporter in association with ABCB1.

1.4.3. Regulation of ABCA5

A clear regulation of the ABCA5 gene is still to be investigated but there are a number of recent studies showing regulation or induction of the gene. It is reported that ABCA5 mRNA can be up-regulated in vitro studies by incubation of human monocyte-derived macrophages with acetylated low-density lipoprotein and down-regulated by induction of high-density lipoprotein-mediated cholesterol efflux (Klucken et al., 2000). This regulation was independent of liver-X receptor/ retinoid X receptor (LXR/RXR) stimulation (Langmann et al., 2006). It is known that cholesterol and oxysterols are inducers for ABCA1 and ABCG1upregulation (Langmann et al., 2006). Since ABCA5 appear to share many similar properties with ABCA1 and ABCG1, it may come under similar control. Consistent with this suggestion, mouse Abca5 expression in Kupffer cells was reported to be upregulated by a western-type diet which includes increased cholesterol and fat (Ye et al., 2008). Moreover, quantitative RT-PCR analysis revealed that mouse Abca5 expression was up-regulated following oxidized low-density lipoprotein stimulation (Ye et al., 2010).

1.5.HYPOTHESIS AND AIMS OF PROJECT

HYPOTHESIS

ABCA5 functions as a lipid transporter in neurons that participates in the pathological process of PD.

AIMS

1. To determine the expression of ABCA5 in the human brain and any changes

in its expression associated with PD

2. To investigate the impact of ABCA5 on α-synuclein production in neurons

3. To determine the function of ABCA5 as a lipid transporter in neurons andits

potential regulation

Chapter 2: Materials and Methods

2.1. MATERIALS

Human brain tissues were obtained following approval (PID0189) from the Sydney

Brain Bank. Ethics for the project was approved by the University of New South Wales

Human Research Ethics Committee (HREC 11221). Frozen grey matter brain tissues from 10 sporadic PD cases and 10 controls were used in this study. Standardized clinicopathological criteria were used for diagnosis (Halliday et al., 2002). The mean age of PD cases and controls was 79±9 y and 88±6 y respectively. The mean post- mortem interval was 8.5±8 h and 10.5±5 h respectively. There was no difference in the sex distribution between groups and both groups had similar causes of death. PD affected regions (mid-posterior putamen, anterior cingulate cortex), and non-affected region (visual cortex) were chosen for this study. Approximately 50 mg of brain tissue from anatomically specified regions were collected using a 3-mm stainless steel biopsy needle from frozen brain slices (dissected on a bed of dry-ice) and were isolated for

RNA as described below.

Case ID Gender Age PMI (h) PD 1 M 75 9 PD 2 M 69 5 PD 3 F 85 26 PD 4 F 78 22 PD 5 M 72 29 PD 6 M 80 17 PD 7 M 84 7 PD 8 F 83 32 PD 9 M 90 5 PD 10 M 79 42 Control 1 F 78 37 Control 2 F 82 7.5 Control 3 M 69 13.5 Control 4 M 85 9 Control 5 M 65 14.5 Control 6 M 68 45.5 Control 7 M 73 38.5 Control 8 M 88 9 Control 9 F 85 10 Control 10 M 81 29 Table 1.Frozen post-mortem brain tissues from 10 sporadic PD and 10 control cases.M, male; F, female; PD, Parkinson‟s disease; PMI, post-mortem interval.

2.2.CELL CULTURE METHODS 2.2.1. Thawing cell lines from liquid nitrogen stock

After cells were taken out from liquid nitrogen, the base of the cryogenic tube was thawed in a 37°C water bath immediately. Cells were then transferred to an Eppendorf tube and spun down at 1,000 g for 5 min. Supernatant was removed and the cell pellet resuspended in appropriate culture media. The resultant suspension was added to 25mL

3 of media in a medium flask (75 cm ) and incubated at 37°C in a CO2 incubator.

2.2.2. Maintaining and culturing cells

All cell culture media and additives were obtained from Invitrogen (Melbourne,

Australia) unless stated otherwise. Cell cultures were checked every day to ensure that cells were healthy and were not over-confluent. Cell culture media (Dulbecco's

Modified Eagle Medium with high glucose, GlutaMAX, Invitrogen Melbourne,

Australia) was refreshed at least every 3 days. When cells were confluent, 0.05% trypsin was added to the media in order to remove the cells from the surface of the cell culture flask and incubated at 37°C in a CO2 incubator for 5 min. An equal volume of Fetal bovine serum media was then added to inactive the trypsin. Cell suspension was then transferred to a falcon tube and spun at 1,000 g for 5 min. The supernatant was discarded and the resultant pellet was resuspended in 10 mL cell culture media, of which only 1 mL was added to a medium flask containing 25 mL media for ongoing cell culture.

2.2.3. Transfection

Transient transfection was performed using Lipofectamine 2000 or Lipofectamine LTX and Opti-MEM I (Invitrogen) following the manufacturer‟s protocol.

24 h before transfection, cells were seeded at 100,000 cells per well in culture 12-well plates with antibiotic-free cell culture media. When cells are ready for transfection, two reaction Eppendorf tubes were set up: one containing 100 µL of Opti-MEM and 3 µL of lipofectamine (Lipofectamine 2000 or Lipofectamine LTX; Invitrogen, Melbourne,

Australia) per well and the other containing 100 µL of Opti-MEM and 1.6 µg of plasmid per well. Once lipofectamine and cDNA were added to their respective tubes, the mixture was then incubated at room temperature for 5 min. Next, the two tubes would combine together and the final solution was mixed gently and incubated at room temperature for 20 min. Cell culture media was then renewed with antibiotic-free media.

At the end of the 20 min, 200 µL of the final solution was carefully and gently added to each well and cells were incubated overnight at 37°C in a CO2 incubator.

2.3.GENETIC TECHNIQUES 2.3.1. RNA extraction from cells and brain tissues

2.3.1.1. RNA extraction from cells

RNA from cells seeded in culture multi-well plates were extracted with trizol reagent

(Invitrogen, Melbourne, Australia) and transferred to labelled Eppendorf tubes. 100µL of chloroform was added to each tube for cleaning and mixed vigorously before incubating at room temperature for 3 min. Samples were then centrifuged at 12,000 g for 15 min at 4°C. Next, the top aqueous phase was transferred to new labelled

Eppendorf tubes, where 250 µL of isopropanol was added to each sample for RNA precipitation and incubated at -20°C for 1 hr. Samples were then centrifuged at 12,000 g for 10 min at 4°C. The supernatant was discarded before the pellets were washed with

500 µL of 75% ethanol. Samples were then centrifuged at 7,500 g for 5 min at 4°C.

Finally, the ethanol wash was discarded and the pellet was briefly air-dried before re- suspension in 20 µL of RNA-free water.

The concentrations of extracted RNA samples were determined by using the ND-100

Nanodrop Spectrophotometer. Samples were then stored at -80°C.

2.3.1.2.RNA extraction from brain tissues

Trizol reagent (Invitrogen, Melbourne, Australia) was used to extract RNA from post- mortem brain tissues. 700 µL of trizol was added to 30-50 mg of brain tissue in labelled

Eppendorf tubes. Pestles, which were sterilized with 70% ethanol, were used to homogenize the brain tissues. Subsequently, 300 µL of RNase-free water and 200µL of chloroform were added to each tube and samples mixed vigorously. Samples were then centrifuged at 12,000 g for 15 min at 4°C before the top aqueous phase was transferred to new Eppendorf tubes. An equal amount of isopropanol was added to the aqueous phase and incubated at -20°C for 1 hr. Afterwards, samples were again centrifuged at

12,000 g for 10 min at 4°C. The supernatant was discarded and the resultant pellet washed in 1 mL of 75% ethanol. Samples were centrifuged at 7,500 g for 5 min at 4°C.

The ethanol wash was then discarded and the pellet briefly air-dried before re- suspension in 20 µL of RNase-free water. The concentration of extracted RNA samples was measured using the ND-1000 Nanodrop Spectrophotometer and samples stored at -

80°C.

2.3.2. Reverse Transcription

Extracted RNA from either cells or brain tissues was reverse transcribed to generate cDNA. Firstly, a mastermix 1 was prepared with 4 µg of RNA, 20 units of RNasin, 1

µL of 0.1 M DTT, 50 ng/µL of random primers and the remaining volume was made up

22 of 14 µL of RNase-free water. The mixture was incubated at 65°C for 10 min and then immediately cooled on ice for 5 min. A mastermix 2 was prepared with 5 µL of

Moloney Murine Leukemia Virus (M-MLV) in 5X buffer, 1.25 µL of 10 mMdNTPs,

0.5 µL of reverse transcriptase and 0.5 µL of RNase-free water. Mastermix 2 was then added to mastermix 1, and the final mixture incubated at 37°C for 2 hrs before the enzymes were inactivated at 95°C for 10 min. The generated cDNA was stored at -

20°C.

2.3.3. Quantitative Real-time Polymerase Chain Reaction (qPCR) cDNA generated from the reverse transcription was used as a template in the quantitative real-time (QRT) PCR assay. QRT-PCR amplification was carried out using a Mastercyclereprealplex S (Eppendorf, North Ryde, NSW, Australia) and the fluorescent dye iQ SYBR green supermix (Biorad, Australia). Each reaction mix consisted of 5µl of SYBR green supermix, 1µl each of forward and reverse primer, 1µl of cDNA template and the reaction mix was made up to 20 µl with RNase-free water.

Amplification was carried out with 40 cycles of denaturation (95°C, 15s) and annealing and extension (60°C, 1min). All gene expression was normalized to β-actin, which served as an internal control for the quality of RNA isolated from each tissue sample.

The primers used are listed below in table 2. The relative expression of each gene was calculated using the comparative threshold cycle (Ct) value method with the formula

2-∆∆Ct (where ∆∆Ct = ∆Ct sample - ∆Ct reference) .

Primer Primer Sequence (5'→ 3') ABCA5 Forward AGCCAAACAGCACATGTGGCGA Reverse AGACAGCCTCTGCCTCCTCCA

ABCA1 Forward GCTCTGGGAGAGGATGCTGA Reverse CGTTTCCGGGAAGTGTCCTA

α-synuclein Forward TAGGCTCCAAAACCAAGGAGG Reverse CCTTCTTCATTCTTGCCCAACT

β-actin Forward TCATGAAGTGTGACGTGGACATCCGT Reverse CCTAGAAGCATTTGCGGTGCACGATG

Table 2.qPCR primer sequences.

2.4.PROTEIN METHODS

2.4.1. Cell lysates (RIPA)

Radioimmunoprecipitation (RIPA) buffer (20 mM Tris-HC1 pH 7.5, 150 mMNaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 0.1 mg/mL phenylmethylsulfonyl fluoride; stocks were frozen at -20°C) was thawed on ice and 150

µL per well aliquoted out and 1/3rd of protease inhibitor cocktail tablet (complete Mini protease inhibitor cocktail tablet; Roche Diagnostics, Mannheim, Germany) added just before use. The protease inhibitor cocktail tablet was solubilized in 4 mL RIPA buffer by vortex mixing.

Cell culture media was removed and cells were rinsed with cold 1X phosphate buffered saline (PBS). The PBS wash was removed, RIPA buffer added to each well, and the cell suspensions transferred to labelled Eppendorf tubes. Cell suspensions were spun at

12,000 g for 2 min to pellet cellular debris. The supernatant was transferred to a new

Eppendorf tube and the RIPA lysates stored at -20°C.

2.4.2. Western blotting

Protein concentrations were determined using BCA protein assays. Protein samples were then diluted in 5X sample loading dye (100 mM Tris pH 6.8, 32% glycerol, 3.2%

SDS, 0.16% bromophenol blue (w/v), 8% β-mercapthoethanol) and boiled at 95°C for 5 min. Samples were then spun down before loading onto SDS polyacrylamide gels

(SDS-PAGE). An SDS-PAGE gel consists of a 4% stacking gel (30% acrylamide, 0.5M

Tris pH 6.8, Distilled H2O, 10% SDS, 5% TEMED, 10% APS) and a 12% separating gel (30% acrylamide, 1.5M Tris pH 8.8 with 0.4% SDS, Distilled H2O, 5% TEMED,

10% APS). Gels were electrophoresed at 120 volts for 55 to 90 min (depending on the size of the target protein) in SDS running buffer (pH 8.9; 0.124 M Tris base, 0.5% SDS, 25

0.96 M Glycine). Afterwards, gels were transferred onto 0.45µm nitrocellulose membrane (Biorad, Hercules, CA) at 100 volts for 30 min in transfer buffer (1.4 M

Glycine, 0.18 M Trizma base). Membranes were then blocked for 2 h at room temperature in PBS containing 5% non-fat dry milk and probed with relevant primary antibodies: α-synuclein antibody 1:1000 (mouse monoclonal, BD biosciences, North

Ryde, Australia) and β-actin (rabbit polyclonal 1/2000; Sigma, Cat No. A5060 Sigma) that were diluted in 5% non-fat dry milk overnight at 4°C on an orbital shaker. The membranes were then washed three times in PBS containing 0.1% Tween-20 and then incubated with horseradish peroxidase-conjugated secondary antibody (Dako,

Carpinteria, CA, USA, 1/2000 dilution) for 2 h. Signals were detected using enhanced chemiluminescence (ECL, GE Healthcare, Buckinghamshire, UK) and X-ray films. The signal intensity was quantified using NIH ImageJ software. Membranes were routinely stripped and re-probed with β-actin to ensure equal loading among samples.

2.5.BODIPY-CHOLESTEROL EFFLUX ASSAY

The standard protocol for quantifying cell cholesterol efflux employs cells labelled with radioactive cholesterol (Rothblat et al., 2002). Although this approach to measuring cholesterol efflux has provided large amounts of data on both the efficiency of various extracellular acceptors and on different efflux pathways (Sankaranarayanan et al.,

2011), an attractive non-radioactive method has been recently developed. In this new method, a fluorescent sterol, BODIPY-cholesterol, is used as a substitute for the generally used radioactive cholesterol (Sankaranarayanan et al., 2011). BODIPY- cholesterol is a fluorescent analog of free cholesterol in which carbon-24 of the sterol side chain is linked directly to the dipyrromethene boron difluoride (“BODIPY”) moiety

(Li et al., 2006). In a series of experiments using J774 macrophages together with a

26 variety of cholesterol acceptors, they compared efflux of BODIPY-cholesterol and

[3H]cholesterol. Their studies demonstrated that BODIPY-cholesterol provides an efficient measurement of efflux compared with [3H]cholesterol and results in sensitive and high-throughput assays. Therefore, this new non-radioactive method was used to study ABCA5 effects on cholesterol efflux.

SK-N-SH cells were plated in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS in 48-well plates for 24 h. Cells were transiently transfected (as described above) with ABCA5 cDNA (Origene, Rockville, MD, USA) for 48 h. BODIPY labelling medium was prepared with 1.75mM methyl-β cyclodextrin

(CD) and 16% BODIPY-cholesterol (Avanti Polar Lipids, Alabaster) in DMEM buffer.

BODIPY-cholesterol was first added into an Eppendorf tube and dried under nitrogen gas in the dark to form a thin film in the bottom of the tube. The dried cholesterol was solubilized by adding CD in DMEM buffer in half the needed volume (10ml). The suspension was then sonicated in a water bath at 37°C for 30 min and placed in a shaking water bath at 37°C overnight. The cholesterol mixture was sonicated for 30 min and diluted to needed volume (up to 20ml) before use. Cells were labelled with

BODIPY-cholesterol by incubating the monolayers with 0.25 ml of labelling medium containing CD/BODIPY-cholesterol per well for 1 h, followed by washing with warm

PBS buffer. Cells were then equilibrated with DMEM containing 0.2% BSA only for 2 h at 37°C. After this equilibration period, the cells were washed with warm PBS buffer again. Cells were then incubated in DMEM containing 0.2% BSA with or without ApoE lipid acceptors and incubated at 37°C for 4 h. 50% of media was pipetted for measurement, and the remaining media was incubated until 24 h. ApoE disc containing recombinant apoE, 1-palmitoyl-2-oleylphosphatidyl choline (POPC), and cholesterol were prepared using the cholate dialysis method and characterized as described 27 previously(Rye et al., 2006). The POPC/cholesterol/apolipoprotein molar ratios of the apoE discs ranged from 114.7:12.8:1.0 to 94.4:8.4:1.0. This stoichiometry indicates that our reconstituted apoE discs were phospholipid-enriched as compared with astrocyte secreted apoE discs that have been reported to contain phospholipid/cholesterol ratios in the order of 2:1 to 1:2(LaDu et al., 1998). At the end of the incubation, efflux media was pipette recovered and its fluorescence intensity recorded using a Molecular Device

M2 plate reader (excitation 482nm, emission 515nm). Cell lysate was extracted and solubilized with 1% cholic acid shaking on a plate shaker for 4 h at room temperature before its fluorescence intensity was measured.

Calculation of % cholesterol efflux:

% efflux following 6 hr incubation= 6 hrfluorescence/(6 hr fluorescence+24 hrfluorescence+cell lysatefluorescence)

% efflux following 24 hr incubation=(6 hr fluorescence+24 hrfluorescence)/(6 hr fluroescence+24 hrfluorescence+cell lysatefluorescence)

2.6.STATISTICAL ANALYSES

Experiments were routinely performed in triplicate and repeated at least twice. Data are presented as means with standard errors. Differences were considered significant where

P ≤ 0.05 was achieved by either the two-tailed Student‟s t-test for unpaired data or the

Mann-Whitney test.

Chapter 3: Results

AIM 1 To determine the expression of ABCA5 in human brain and any changes in its expression associated with PD

3.1. EXPRESSION OF ABCA5 IN THE HUMAN BRAIN

Although the brain is a very lipid-rich organ, little is known about ABCA5 transporters.

Since GWAS revealed a reduced risk of PD is associated with polymorphisms in the

ABCA5 gene, identifying whether the expression of ABCA5 is associated with PD pathology would indicate a role for ABCA5 in disease pathogenesis. This section therefore evaluates the expression of ABCA5 in PD brain compared to controls, and whether any change observed is specific for this ABCA transporter. The aim of this study is to determine the expression of ABCA5 in human brain and any changes in its expression associated with PD.

First, to determine whether the expression of ABCA5 is altered in PD brain, extracts from frozen putamen, anterior cingulate and visual cortex samples from 10 sporadic PD

30 and 10 control cases (Table 1) were studied. The putamen and the anterior cingulate cortex were chosen as PD affected regions because of the extensive loss of synaptic terminals and abnormal deposition of α-synuclein protein. The visual cortex was chosen as a disease-free control region being unaffected in PD. The substantianigra was deliberately not chosen as this region has extensive neuronal and RNA loss that would render quantitative comparisons with control brains uninformative. As described in chapter 2, brain tissues were homogenized and RNA extracted with Trizol reagent.

RNA was reversed transcribed into cDNA, which was then used as a template in qPCR assays for measurement of ABCA5 mRNA expression.

There was a significant loss of ABCA5 expression in the anterior cingulate cortex in PD compared to controls, with an average decrease in expression levels of 77% (Fig. 3). No significant change was observed in the expression levels in either the putamen or the visual cortex (Fig. 3).

3 Control 2 PD

1 * ABCA5 mRNA Expression mRNA ABCA5 0 Putamen Anterior Cingulate Cortex Visual Cortex

Figure 3. Analysis of ABCA5 expression in PD affected brain regions (putamen and anterior cingulate cortex) and non-affected region (visual cortex) in both PD brain and disease-free control brains as measured by qRT-PCR. Data represent mean (n=10) and SE as error bars. * p<0.05.

Secondly, to determine if the decrease in expression in the PD anterior cingulate cortex was unique to ABCA5, the mRNA expression of ABCA1 was measured. In contrast to

ABCA5, the expression levels of ABCA1 was unchanged in both the putamen and the anterior cingulate cortex (Fig. 4), and was significant increased in the unaffected visual cortex (Fig. 4). This data shows that the change in ABCA expression in the PD brain is selective for ABCA5 and not ABCA1.

1.5 *

1 Control PD 0.5 ABCA1 mRNA Expression mRNA ABCA1

0 Putamen Anterior Cingulate Visual Cortex Cortex

Figure 4. Expression of ABCA1 measured in PD affected brain regions (putamen and anterior cingulate cortex) and non-affected region (visual cortex) as by qRT-PCR. Data represent mean (n=10) and SE as error bars. * p<0.05.

AIM 2 To investigate the impact of ABCA5 on α-synuclein production in neurons

3.2. EXPRESSION OF α-SYNUCLEIN IN THE HUMAN BRAIN

The aim of this study is to investigate the impact of ABCA5 on α-synuclein production in neurons. Since the accumulation of α-synuclein is a pathological hallmark of PD, it is important to know whether or not the change of ABCA5 expression is related to α- synuclein. Hence, the gene expression of α-synuclein in the same regions of the same cases (Table 1) was measured using the same methods.

There was also a significant decrease in α-synuclein expression the anterior cingulate cortex of the PD cases compared to controls (Fig. 5), with no change in the putamen or visual cortex (Fig. 5). Linear regression showed a correlation between the expression of

ABCA5 and α-synuclein in the anterior cingulate cortex across all cases (R=0.48; p=0.05).

2 Control PD 1 * synuclein mRNA Expression mRNA synuclein - α 0 Putamen Anterior Cingulate Visual Cortex Cortex

Figure 5.Analysis of α-synuclein mRNA expression in putamen, anterior cingulate cortex and visual cortex as by qRT-PCR. Data represent mean (n=10) and SE as error bars. * p<0.05.

3.2.1. Impact of ABCA5 expression on α-synuclein expression in SK-N-SH cells

To investigate whether ABCA5 expression impacts on the expression of α-synuclein at both the gene and protein levels, SK-N-SH cells were seeded in 12-well plates and transiently transfected with ABCA5 cDNA to increase ABCA5 expression levels. After

48 h, RNA was extracted from these cells with Trizol reagent and reverse transcribed into cDNA to be used as templates in qPCR assays. mRNA levels of α-synuclein were then measured.

There was a significant upregulation of α-synuclein mRNA expression in cells transiently transfected with ABCA5 cDNA (Fig. 6a). This indicates that the levels of

ABCA5 mRNA impact on the levels of α-synuclein mRNA. However, there was no significant difference in the α-synuclein protein level (Fig. 6b,c).

(a)

2 * 1.5

0.5 synuclein synuclein mRNA Expression - α 0 Control ABCA5

(b)

(c)

200

150

100 Levels

synuclein synuclein Protein 50 - α 0 Control ABCA5

Figure 6.Impact of increased ABCA5 mRNA on α-synuclein expression in SK-N-SH neurons. SK- N-SH neuronal cells were transiently transfected with ABCA5 cDNA and empty vector (control) as described in chapter 2. After 48 h, the cells were collected and analysed by western blotting. Histograms of α-synuclein mRNA expression measured by qRT-PCR are shown in (a). Western blots of cellular α-synuclein and β-Actin are shown in (b) where β-Actin was used as a loading control. Histograms of α-synuclein in protein levels (c) are also shown. Data represent means (n=6) and SEM error bars. This experiment was repeated twice more. * p<0.05 vs. controls.

AIM 3 To determine the function of ABCA5 as a lipid transporter in neurons and its potential regulation

3.3. FUNCTION AND REGULATION OF ABCA5

At this stage, virtually nothing is known about the functional role of ABCA5 in the human brain. ABCA5 is highly homologous with other members of the ABCA transporter subfamily, and studies in macrophages from ABCA5 deficient mice show significantly suppressed cholesterol efflux (Ye et al., 2010). Moreover, Kim and

Halliday (2012) have recently reported an up-regulation of ABCA5 expression by sphingomyelin, providing evidence that ABCA5 may act as a lipid transporter with sphingomyelin one of the substrates. Thus this section assesses the impact of ABCA5 on lipid transport and its regulation.

3.3.1. ABCA5 as a cholesterol transporter

SK-N-SH neurons were transiently transfected with ABCA5 cDNA, and used in the

BODIPY-cholesterol efflux assays. Cells were labelled with BODIPY-cholesterol and cholesterol efflux to extracellular acceptors present in the media examined. For this study, apoE3 discs were chosen as the extracellular acceptor because apoE3 is the neutral apoE isoform known as a lipid acceptor in the human brain. In the presence of apoE discs, cholesterol efflux was increased by ABCA5 transfection by 12.6% compared to mock-transfected cells (Fig. 7a). As studies have reported that ABCA1 and

ABCG1 transfections also stimulate cholesterol efflux to apoE discs (Kim et al., 2007), comparisons to ABCG1 transfections as a positive control were used (Fig. 7b). These data confirmed that ABCA5 is a lipid transporter, raising the possibility that apoE discs present in the CNS may also function as acceptors for ABCA5-mediated cholesterol efflux.

(a)

* 60

40 Control ABCA5 20 Cholesterol Efflux(%) Cholesterol

0 4 24 Duration (h)

(b)

60 *

40 Control ABCG1 20 Cholesterol Efflux(%) Cholesterol

0 4 24 Duration (h)

Figure 7.Impact of ABCA5 on cellular cholesterol efflux. Cholesterol efflux from SK-

N-SH cells to media containing 15 µg/mL of apolipoprotein E (apoE discs) only, or with addition of transfected ABCA5 cDNA (a), or ABCG1 cDNA (b) were assessed after 4 hr and 24 hr. Data are mean with error bars indicating SEM. Significance determined using the Student‟s t-test; * p< 0.05. 38

3.3.1. PPAR-activator induces ABCA5 expression in SK-N-SH cells

Peroxisome proliferator-activated receptor (PPAR) and liver X receptor (LXR) are two major regulators of lipid homeostasis in human cells. PPARs and LXRs bind to specific response elements in target genes as heterodimers with retinoid X receptors (RXRs), which are also members of the nuclear receptor superfamily. It is known that a number of ABCA subfamily members are regulated by these two master regulators, such as

ABCA1 (Chinetti et al., 2001) and ABCA12 (Jiang et al., 2008). Therefore PPAR and

LXR were chosen for testing whether ABCA5 expression was controlled by similar regulators. To determine whether these two regulators influence ABCA5 gene expression, cells were treated with LXR (T0901317) and PPAR (pioglitazone) ligands in combination of RXR ligand (9-cis retinoic acid). qPCR analyses for PPAR/RXR stimulation demonstrated a pioglitazone induced up- regulation of ABCA5 mRNA expression by almost 10 folds when compared to the untreated cells (Fig. 8a), whereas there was no significant difference with LXR/RXR treatment (Fig. 8b).

(a)

5 mRNA Expression mRNA

0 Control Pioglitazone

(b)

1 ABCA5 mRNA levels mRNA ABCA5

0 Control T0901317

Figure 8.Regulation of ABCA5. SK-N-SH neuronal cells grown on 12-well plates were treated with 50 µM pioglitazone or 10 µM T0901317 or vehicle only (control) for 48 hr and the expression of ABCA5 measured at the mRNA level by qRT-PCR. PPAR- activator (pioglitazone) induced ABCA5 gene expression (a) but LXR-activator

(T0901317) had no effect on ABCA5 (b). -actin was used as an internal control. Data represent mean (n=6) and SEM as error bars, *p<0.05. This experiment was repeated twice more.

Further experiments confirmed that PPAR induced ABCA5 gene expression in a time- and dose-dependent manner. SK-N-SH cells were treated for 48 h with increasing doses of pioglitazone (10 - 50 µM/mL). As shown in Fig. 9a, treatment with PPAR ligands at

10 and 50µM/mL for 48 h both resulted in significant increases in mRNA levels of

ABCA5 to 10 and 20 folds, respectively, of the levels of untreated cells. SK-N-SH cells were then treated with PPAR/RXR ligands at a fixed concentration of 10 µM/mL for increasing durations (0 – 48 h). As shown in Fig. 9b, treatment with PPAR at 10µM/mL for 24 and 48 h resulted in significant increases in ABCA5 mRNA expression by 3 and

10 folds compared to the untreated group.

(a)

35 30 * 25 20 15 10 * 5 mRNA Expression mRNA 0 0 10 50 Pioglitazone (µM)

(b)

14 12 * 10 8 6 4 * 2 mRNA Expression mRNA 0 6 24 48 Duration (hr)

Fig. 9. PPAR-activator (pioglitazone) increased ABCA5 expression in a dose and time- dependent manner. SK-N-SH cells were treated for 48 h with PPAR at an increasing dose (0-50 µM/mL) to show the dose-effect responses (a). SK-N-SH cells were then treated with PPAR 10 µM/mL for an increasing duration (6-48 h) showing the time- effect responses (b). mRNA levels of ABCA5 were measured by qRT-PCR. Data represent mean (n=6) and SEM as error bars, *p<0.05. This experiment was repeated twice more.

Chapter 4: Discussion

ABCA5 has been recently associated with PD (Simon-Sanchez et al., 2009), although there is little information on its expression levels in human brain or its association with

PD-relevant molecular changes. This study focuses on measuring ABCA5 expression levels in PD and control brain, and in cell lines explored some of its potential functions and mechanisms for its regulation.

The levels of ABCA5 gene expression were evaluated in sporadic PD brain tissues compared to controls. RT-PCR revealed a significant decrease in ABCA5 gene expression in PD anterior cingulate cortex compared to disease-free controls. This decrease was selective for the anterior cingulate cortex (ACC), and was not observed in the putamen or visual cortex. The difference in PD pathology between these regions is that in the putamen there is a substantial loss of the dopamine terminals from the SN, whereas in the anterior cingulate cortex there is deposition of α-synuclein without significant neuronal loss. No pathology is observed in the visual cortex of PD patients, although oxidative stress occurs in this region in association with reduced blood flow

(Cheng et al., 2011). The selective reduction of ABCA5 in the region with significant α- synuclein deposition suggests that this change in ABCA5 is associated with the molecular deposition of α-synuclein in PD affected brain regions.

In order to know if this change is unique for ABCA5, the gene expression of ABCA1 was also assessed. In macrophages there is a compensatory up-regulation of ABCA1 in the absence of ABCA5, indicative of a functional relationship between these two transporters (Ye et al., 2010). In the present study ABCA1 gene expression was significant increased in PD visual cortex, but remained unchanged in the region of degeneration (putamen) and in the region containing insoluble α-synucleinLewy body inclusions (anterior cingulate cortex). This data suggests that ABCA5 is selectively involved in pathological deposition of α-synuclein in PD brain.

To assess whether ABCA5 expression affects the expression of α-synuclein, mRNA levels were evaluated in the same brain samples. Interestingly, there was a similar, related reduction in gene expression for both ABCA5 and α-synuclein in the PD anterior cingulate cortex. Cell experiments confirmed this association between ABCA5 and α- synuclein expression levels. These experiments showed an up-regulation of α-synuclein gene expression in cells transiently transfected with ABCA5 cDNA, although this increase was not associated with an increase in soluble α-synuclein protein levels.

Although Quinn et al. (2012) have previously reported that changes in α-synuclein gene expression do not associate with changes in α-synuclein protein levels in PD brain, it may be that differentiated protein fractions (soluble versus insoluble fractions) are required to see more of the insoluble form of the protein.

Since ABCA5 is highly homologous to other members of the ABCA lipid-transporting family, it was predicted that ABCA5 may also function as a lipid transporter. Previous work indicated that lipid-free ApoE stimulated cholesterol efflux from neurons

(Michikawa et al., 2000) and ABCA5 is strongly expressed in primary human neurons

(Kim & Halliday, 2012). This link may suggest that ABCA5 removes cholesterol from neurons. The present study confirmed this hypothesis by demonstrating that ABCA5 promotes cholesterol efflux to ApoE discs. Although ABCA5 expression stimulates cholesterol efflux, other specific substrate(s) for ABCA5 may also exist with sphingomyelin being another good candidate (Kim & Halliday, 2012).

Lipids might also regulate ABC transporter expression. ABCA5 gene expression was reported to be up-regulated upon sphingomyelin stimulation (Kim & Halliday, 2012).

Klucken et al. (2000) has demonstrated that ABCA5 mRNA expression can be down- regulated by the induction of HDL-mediated cholesterol efflux, and Ye et al. (2008) reported an induction of mouse Abca5 expression in Kupffer cells by high cholesterol 45 and fat diet feeding. Moreover, cholesterol can also induce ABCA1 expression

(Langmann et al., 2006) and since ABCA5 share many similarities with ABCA1, cholesterol may not only be a substrate for ABCA5 but also an inducer. It is of interest that multiple studies have provided evidence that high cholesterol is a risk factor for PD

(Bar-On et al., 2008; Bar-On et al., 2006; Hu et al., 2008). Therefore, further investigation of ABCA5 may provide more insights on how manipulating cholesterol transport in neurons could help with the disease process.

One of the mechanisms affecting the transcription of the ABCA5 gene was treatment with PPARγ and RXR ligands. These ligands increased ABCA5 expression in SK-N-

SH cells in a time- and dose-dependent manner. Previous studies have shown that

PPARγ agonists induce the expression of LXR, thereby stimulating ABCA1 expression, which facilitates cholesterol efflux to lipid-poor apoA-I in an LXR-dependent manner.

However, in the present study LXR agonists had no effect on ABCA5 gene expression, which means that PPARγ ligands directly activate ABCA5, enabling LXR-independent efflux of cholesterol to high density lipoprotein (HDL). Similar findings have been observed in differentiated macrophages (Langmann et al., 2006).

The precise mechanism by which ABCA5 is involved in the pathogenesis of PD remains unclear and warrants further investigation. This study has revealed new insights into novel potential molecular targets that could be exploited to potentially change α- synuclein aggregation and provide possible therapeutic avenues for PD treatment.

The main findings of this thesis include:

1. ABCA5 gene expression is significantly decreased in the anterior cingulate

cortex of PD compared to disease-free control brains and this change is unique

to ABCA5

2. Expression of α-synuclein is significantly decreased in the anterior cingulate

cortex of PD compared to disease-free control brains

3. Transiently expressed ABCA5 significantly up-regulated α-synuclein mRNA

expression but not soluble protein levels

4. Transiently expressed ABCA5 potently stimulated the efflux of cholesterol from

neurons to ApoE discs

5. ABCA5 gene expression is up-regulated by PPAR and this up-regulation is

time- and dose-dependent

5. REFERENCES

Aiello, R. J., Brees, D., Bourassa, P. A., Royer, L., Lindsey, S., Coskran, T., . . . Francone, O. L. (2002). Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol, 22(4), 630-637.

Albrecht, C., & Viturro, E. (2007). The ABCA subfamily--gene and protein structures, functions and associated hereditary diseases. Pflugers Arch, 453(5), 581-589.

Allikmets, R., Singh, N., Sun, H., Shroyer, N. F., Hutchinson, A., Chidambaram, A., . . . Lupski, J. R. (1997). A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat Genet, 15(3), 236-246.

Attie, A. D., Kastelein, J. P., & Hayden, M. R. (2001). Pivotal role of ABCA1 in reverse cholesterol transport influencing HDL levels and susceptibility to atherosclerosis. Journal of Lipid Research, 42(11), 1717-1726.

Balsinde, J., Perez, R., & Balboa, M. A. (2006). Calcium-independent phospholipase A2 and apoptosis. Biochim Biophys Acta, 1761(11), 1344-1350.

Bar-On, P., Crews, L., Koob, A. O., Mizuno, H., Adame, A., Spencer, B., & Masliah, E. (2008). Statins reduce neuronal alpha-synuclein aggregation in in vitro models of Parkinson's disease. [Comparative Study Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't]. J Neurochem, 105(5), 1656-1667.

Bar-On, P., Rockenstein, E., Adame, A., Ho, G., Hashimoto, M., & Masliah, E. (2006). Effects of the cholesterol-lowering compound methyl-beta-cyclodextrin in models of alpha- synucleinopathy. [Research Support, N.I.H., Extramural]. J Neurochem, 98(4), 1032- 1045.

Bras, J., Singleton, A., Cookson, M. R., & Hardy, J. (2008). Emerging pathways in genetic Parkinson's disease: Potential role of ceramide metabolism in Lewy body disease. FEBS J, 275(23), 5767-5773.

Broccardo, C., Luciani, M., & Chimini, G. (1999). The ABCA subclass of mammalian transporters. [Research Support, Non-U.S. Gov't Review]. Biochim Biophys Acta, 1461(2), 395-404.

Broersen, K., van den Brink, D., Fraser, G., Goedert, M., & Davletov, B. (2006). Alpha-synuclein adopts an alpha-helical conformation in the presence of polyunsaturated fatty acids to hinder micelle formation. Biochemistry, 45(51), 15610-15616.

Brunham, L. R., Kruit, J. K., Iqbal, J., Fievet, C., Timmins, J. M., Pape, T. D., . . . Hayden, M. R. (2006). Intestinal ABCA1 directly contributes to HDL biogenesis in vivo. J Clin Invest, 116(4), 1052-1062.

Byrne, E. J., Lowe, J., Godwin-Austen, R. B., Arie, T., & Jones, R. (1987). Dementia and Parkinson's disease associated with diffuse cortical Lewy bodies. [Case Reports Letter]. Lancet, 1(8531), 501.

Chen, C. T., Green, J. T., Orr, S. K., & Bazinet, R. P. (2008). Regulation of brain polyunsaturated fatty acid uptake and turnover. Prostaglandins Leukot Essent Fatty Acids, 79(3-5), 85- 91.

Cheng, D., Jenner, A. M., Shui, G., Cheong, W. F., Mitchell, T. W., Nealon, J. R., . . . Garner, B. (2011). Lipid pathway alterations in Parkinson's disease primary visual cortex. [Research Support, N.I.H., Extramural Research Support, Non-U.S. Gov't]. PLoS One, 6(2), e17299.

Chinetti, G., Lestavel, S., Bocher, V., Remaley, A. T., Neve, B., Torra, I. P., . . . Staels, B. (2001). PPAR-alpha and PPAR-gamma activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. [Research Support, Non-U.S. Gov't]. Nat Med, 7(1), 53-58.

Darios, F., & Davletov, B. (2006). Omega-3 and omega-6 fatty acids stimulate cell membrane expansion by acting on syntaxin 3. Nature, 440(7085), 813-817.

Dean, M., Hamon, Y., & Chimini, G. (2001). The human ATP-binding cassette (ABC) transporter superfamily. Journal of Lipid Research, 42(7), 1007-1017.

Goldstein, D. S. (2006). Orthostatic hypotension as an early finding in Parkinson's disease. Clinical Autonomic Research, 16(1), 46-54.

Graff, C. L., & Pollack, G. M. (2004). Drug transport at the blood-brain barrier and the choroid plexus. Curr Drug Metab, 5(1), 95-108.

Halliday, G., Ng, T., Rodriguez, M., Harding, A., Blumbergs, P., Evans, W., . . . Kril, J. (2002). Consensus neuropathological diagnosis of common dementia syndromes: testing and standardising the use of multiple diagnostic criteria. [Research Support, Non-U.S. Gov't]. Acta Neuropathol, 104(1), 72-78.

Herbert, S. P., & Walker, J. H. (2006). Group VIA calcium-independent phospholipase A2 mediates endothelial cell S phase progression. Journal of Biological Chemistry, 281(47), 35709-35716.

Hu, G., Antikainen, R., Jousilahti, P., Kivipelto, M., & Tuomilehto, J. (2008). Total cholesterol and the risk of Parkinson disease. [Research Support, Non-U.S. Gov't]. Neurology, 70(21), 1972-1979.

Ikeda, Y., Abe-Dohmae, S., Munehira, Y., Aoki, R., Kawamoto, S., Furuya, A., . . . Ueda, K. (2003). Posttranscriptional regulation of human ABCA7 and its function for the apoA-I- dependent lipid release. Biochem Biophys Res Commun, 311(2), 313-318.

Illing, M., Molday, L. L., & Molday, R. S. (1997). The 220-kDa rim protein of retinal rod outer segments is a member of the ABC transporter superfamily. Journal of Biological Chemistry, 272(15), 10303-10310.

Jakes, R., Spillantini, M. G., & Goedert, M. (1994). Identification of two distinct synucleins from human brain. FEBS Lett, 345(1), 27-32.

Jiang, Y. J., Lu, B., Kim, P., Paragh, G., Schmitz, G., Elias, P. M., & Feingold, K. R. (2008). PPAR and LXR activators regulate ABCA12 expression in human keratinocytes. [Research Support, N.I.H., Extramural Research Support, U.S. Gov't, Non-P.H.S.]. J Invest Dermatol, 128(1), 104-109.

Jo, E., McLaurin, J., Yip, C. M., St George-Hyslop, P., & Fraser, P. E. (2000). alpha-Synuclein membrane interactions and lipid specificity. Journal of Biological Chemistry, 275(44), 34328-34334.

Kaminski, W. E., Orso, E., Diederich, W., Klucken, J., Drobnik, W., & Schmitz, G. (2000). Identification of a novel human sterol-sensitive ATP-binding cassette transporter (ABCA7). Biochem Biophys Res Commun, 273(2), 532-538.

Kaminski, W. E., Piehler, A., & Wenzel, J. J. (2006). ABC A-subfamily transporters: structure, function and disease. Biochim Biophys Acta, 1762(5), 510-524.

Karube, H., Sakamoto, M., Arawaka, S., Hara, S., Sato, H., Ren, C. H., . . . Kato, T. (2008). N- terminal region of alpha-synuclein is essential for the fatty acid-induced oligomerization of the molecules. FEBS Lett, 582(25-26), 3693-3700.

Kelsell, D. P., Norgett, E. E., Unsworth, H., Teh, M. T., Cullup, T., Mein, C. A., . . . O'Toole, E. A. (2005). Mutations in ABCA12 underlie the severe congenital skin disease harlequin ichthyosis. American Journal of Human Genetics, 76(5), 794-803.

Kim, W. S., Bhatia, S., Elliott, D. A., Agholme, L., Kagedal, K., McCann, H., . . . Garner, B. (2010). Increased ATP-binding cassette transporter A1 expression in Alzheimer's disease hippocampal neurons. J Alzheimers Dis, 21(1), 193-205.

Kim, W. S., Guillemin, G. J., Glaros, E. N., Lim, C. K., & Garner, B. (2006). Quantitation of ATP- binding cassette subfamily-A transporter gene expression in primary human brain cells. Neuroreport, 17(9), 891-896.

Kim, W. S., & Halliday, G. M. (2012). Changes in Sphingomyelin Level Affect Alpha-Synuclein and ABCA5 Expression. Journal of Parkinsons Disease, 2(1), 41-46.

Kim, W. S., Rahmanto, A. S., Kamili, A., Rye, K. A., Guillemin, G. J., Gelissen, I. C., . . . Garner, B. (2007). Role of ABCG1 and ABCA1 in regulation of neuronal cholesterol efflux to apolipoprotein E discs and suppression of amyloid-beta peptide generation. [Research Support, Non-U.S. Gov't]. J Biol Chem, 282(5), 2851-2861.

Klein, I., Sarkadi, B., & Varadi, A. (1999). An inventory of the human ABC proteins. Biochim Biophys Acta, 1461(2), 237-262.

Klucken, J., Buchler, C., Orso, E., Kaminski, W. E., Porsch-Ozcurumez, M., Liebisch, G., . . . Schmitz, G. (2000). ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. [Research Support, Non-U.S. Gov't]. Proc Natl Acad Sci U S A, 97(2), 817-822.

LaDu, M. J., Gilligan, S. M., Lukens, J. R., Cabana, V. G., Reardon, C. A., Van Eldik, L. J., & Holtzman, D. M. (1998). Nascent astrocyte particles differ from lipoproteins in CSF. [Research Support, Non-U.S. Gov't Research Support, U.S. Gov't, P.H.S.]. J Neurochem, 70(5), 2070-2081.

Lambert, J. C., Heath, S., Even, G., Campion, D., Sleegers, K., Hiltunen, M., . . . Initiative, E. A. D. (2009). Genome-wide association study identifies variants at CLU and CR1 associated with Alzheimer's disease. Nature Genetics, 41(10), 1094-U1068.

Langmann, T., Klucken, J., Reil, M., Liebisch, G., Luciani, M. F., Chimini, G., . . . Schmitz, G. (1999). Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun, 257(1), 29-33.

Langmann, T., Mauerer, R., & Schmitz, G. (2006). Human ATP-binding cassette transporter TaqMan low-density array: analysis of macrophage differentiation and foam cell formation. [Research Support, Non-U.S. Gov't]. Clin Chem, 52(2), 310-313.

Langmann, T., Mauerer, R., Zahn, A., Moehle, C., Probst, M., Stremmel, W., & Schmitz, G. (2003). Real-time reverse transcription-PCR expression profiling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clinical Chemistry, 49(2), 230-238.

Lawn, R. M., Wade, D. P., Garvin, M. R., Wang, X., Schwartz, K., Porter, J. G., . . . Oram, J. F. (1999). The Tangier disease gene product ABC1 controls the cellular apolipoprotein- mediated lipid removal pathway. J Clin Invest, 104(8), R25-31.

Li, Z., Mintzer, E., & Bittman, R. (2006). First synthesis of free cholesterol-BODIPY conjugates. J Org Chem, 71(4), 1718-1721.

Linton, K. J. (2007). Structure and function of ABC transporters. Physiology (Bethesda), 22, 122- 130.

Luciani, M. F., Denizot, F., Savary, S., Mattei, M. G., & Chimini, G. (1994). Cloning of two novel ABC transporters mapping on human chromosome 9. Genomics, 21(1), 150-159.

Maeda, A., Maeda, T., Golczak, M., & Palczewski, K. (2008). Retinopathy in mice induced by disrupted all-trans-retinal clearance. Journal of Biological Chemistry, 283(39), 26684- 26693.

Michikawa, M., Fan, Q. W., Isobe, I., & Yanagisawa, K. (2000). Apolipoprotein E exhibits isoform-specific promotion of lipid efflux from astrocytes and neurons in culture. [Research Support, Non-U.S. Gov't]. J Neurochem, 74(3), 1008-1016.

Nagata, K., Yamamoto, A., Ban, N., Tanaka, A. R., Matsuo, M., Kioka, N., . . . Ueda, K. (2004). Human ABCA3, a product of a responsible gene for abca3 for fatal surfactant deficiency in newborns, exhibits unique ATP hydrolysis activity and generates intracellular multilamellar vesicles. Biochem Biophys Res Commun, 324(1), 262-268.

O'Brien, J. S., & Sampson, E. L. (1965). Lipid composition of the normal human brain: gray matter, white matter, and myelin. Journal of Lipid Research, 6(4), 537-544.

Oram, J. F., & Vaughan, A. M. (2000). ABCA1-mediated transport of cellular cholesterol and phospholipids to HDL apolipoproteins. Curr Opin Lipidol, 11(3), 253-260.

Parkinson, J. (2002). An essay on the shaking palsy. 1817. J Neuropsychiatry Clin Neurosci, 14(2), 223-236; discussion 222.

Petry, F., Ritz, V., Meineke, C., Middel, P., Kietzmann, T., Schmitz-Salue, C., & Hirsch-Ernst, K. I. (2006). Subcellular localization of rat Abca5, a rat ATP-binding-cassette transporter expressed in Leydig cells, and characterization of its splice variant apparently encoding a half-transporter. Biochemical Journal, 393, 79-87. 51

Polymeropoulos, M. H., Lavedan, C., Leroy, E., Ide, S. E., Dehejia, A., Dutra, A., . . . Nussbaum, R. L. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science, 276(5321), 2045-2047.

Quinn, J. G., Coulson, D. T., Brockbank, S., Beyer, N., Ravid, R., Hellemans, J., . . . Johnston, J. A. (2012). alpha-Synuclein mRNA and soluble alpha-synuclein protein levels in post- mortem brain from patients with Parkinson's disease, dementia with Lewy bodies, and Alzheimer's disease. [Research Support, Non-U.S. Gov't]. Brain Res, 1459, 71-80.

Remaley, A. T., Rust, S., Rosier, M., Knapper, C., Naudin, L., Broccardo, C., . . . Brewer, H. B., Jr. (1999). Human ATP-binding cassette transporter 1 (ABC1): genomic organization and identification of the genetic defect in the original Tangier disease kindred. Proc Natl Acad Sci U S A, 96(22), 12685-12690.

Rodriguez-Rodriguez, E., Mateo, I., Llorca, J., Sanchez-Quintana, C., Infante, J., Garcia- Gorostiaga, I., . . . Combarros, O. (2007). Association of genetic variants of ABCA1 with Alzheimer's disease risk. Am J Med Genet B Neuropsychiatr Genet, 144B(7), 964-968.

Rothblat, G. H., de la Llera-Moya, M., Favari, E., Yancey, P. G., & Kellner-Weibel, G. (2002). Cellular cholesterol flux studies: methodological considerations. [Comparative Study Research Support, Non-U.S. Gov't Research Support, U.S. Gov't, P.H.S.]. Atherosclerosis, 163(1), 1-8.

Ruiperez, V., Darios, F., & Davletov, B. (2010). Alpha-synuclein, lipids and Parkinson's disease. Prog Lipid Res, 49(4), 420-428.

Rye, K. A., Bright, R., Psaltis, M., & Barter, P. J. (2006). Regulation of reconstituted high density lipoprotein structure and remodeling by apolipoprotein E. [Research Support, Non-U.S. Gov't]. J Lipid Res, 47(5), 1025-1036.

Sadjadpour, K. (1983). Pyridostigmine bromide and constipation in Parkinson's disease. JAMA, 249(9), 1148.

Sakai, H., Tanaka, Y., Tanaka, M., Ban, N., Yamada, K., Matsumura, Y., . . . Inagaki, N. (2007). ABCA2 deficiency results in abnormal sphingolipid metabolism in mouse brain. Journal of Biological Chemistry, 282(27), 19692-19699.

Sanchez-Ramos, J. R., Ortoll, R., & Paulson, G. W. (1996). Visual hallucinations associated with Parkinson disease. Arch Neurol, 53(12), 1265-1268.

Sankaranarayanan, S., Kellner-Weibel, G., de la Llera-Moya, M., Phillips, M. C., Asztalos, B. F., Bittman, R., & Rothblat, G. H. (2011). A sensitive assay for ABCA1-mediated cholesterol efflux using BODIPY-cholesterol. [Research Support, N.I.H., Extramural]. J Lipid Res, 52(12), 2332-2340.

Schmitz, G., Helmerl, S., Bosserhoff, A. K., Langmann, T., & Ecker, J. (2007). Mapping ATP- binding cassette transporter gene expression profiles in melanocytes and melanoma cells. Melanoma Research, 17(5), 265-273.

Sharon, R., Bar-Joseph, I., Frosch, M. P., Walsh, D. M., Hamilton, J. A., & Selkoe, D. J. (2003). The formation of highly soluble oligomers of alpha-synuclein is regulated by fatty acids and enhanced in Parkinson's disease. Neuron, 37(4), 583-595. 52

Sharon, R., Bar-Joseph, I., Mirick, G. E., Serhan, C. N., & Selkoe, D. J. (2003). Altered fatty acid composition of dopaminergic neurons expressing alpha-synuclein and human brains with alpha-synucleinopathies. Journal of Biological Chemistry, 278(50), 49874-49881.

Shibata, M., Yamada, S., Kumar, S. R., Calero, M., Bading, J., Frangione, B., . . . Zlokovic, B. V. (2000). Clearance of Alzheimer's amyloid-beta(1-40) peptide from brain by LDL receptor-related protein-1 at the blood-brain barrier. Journal of Clinical Investigation, 106(12), 1489-1499.

Simon-Sanchez, J., Schulte, C., Bras, J. M., Sharma, M., Gibbs, J. R., Berg, D., . . . Gasser, T. (2009). Genome-wide association study reveals genetic risk underlying Parkinson's disease. [Research Support, N.I.H., Intramural Research Support, Non-U.S. Gov't]. Nat Genet, 41(12), 1308-1312.

Simons, M., Keller, P., De Strooper, B., Beyreuther, K., Dotti, C. G., & Simons, K. (1998). Cholesterol depletion inhibits the generation of beta-amyloid in hippocampal neurons. Proc Natl Acad Sci U S A, 95(11), 6460-6464.

Sparks, D. L., Scheff, S. W., Hunsaker, J. C., 3rd, Liu, H., Landers, T., & Gross, D. R. (1994). Induction of Alzheimer-like beta-amyloid immunoreactivity in the brains of rabbits with dietary cholesterol. Exp Neurol, 126(1), 88-94.

Spector, A. A., & Yorek, M. A. (1985). Membrane lipid composition and cellular function. Journal of Lipid Research, 26(9), 1015-1035.

Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., & Goedert, M. (1997). Alpha-synuclein in Lewy bodies. [Letter]. Nature, 388(6645), 839-840.

Stacy, M. (2002). Sleep disorders in Parkinson's disease: epidemiology and management. Drugs Aging, 19(10), 733-739.

Takahashi, K., Kimura, Y., Nagata, K., Yamamoto, A., Matsuo, M., & Ueda, K. (2005). ABC proteins: key molecules for lipid homeostasis. Med Mol Morphol, 38(1), 2-12.

Tanaka, Y., Yamada, K., Zhou, C. J., Ban, N., Shioda, S., & Inagaki, N. (2003). Temporal and spatial profiles of ABCA2-expressing oligodendrocytes in the developing rat brain. J Comp Neurol, 455(3), 353-367. doi: 10.1002/cne.10493

Teismann, P., Tieu, K., Choi, D. K., Wu, D. C., Naini, A., Hunot, S., . . . Przedborski, S. (2003). Cyclooxygenase-2 is instrumental in Parkinson's disease neurodegeneration. Proc Natl Acad Sci U S A, 100(9), 5473-5478.

Tsuruoka, S., Ishibashi, K., Yamamoto, H., Wakaumi, M., Suzuki, M., Schwartz, G. J., . . . Fujimura, A. (2002). Functional analysis of ABCA8, a new drug transporter. Biochem Biophys Res Commun, 298(1), 41-45.

Van Den Eeden, S. K., Tanner, C. M., Bernstein, A. L., Fross, R. D., Leimpeter, A., Bloch, D. A., & Nelson, L. M. (2003). Incidence of Parkinson's disease: Variation by age, gender, and Race/Ethnicity. American Journal of Epidemiology, 157(11), 1015-1022.

53 van Hilten, J. J., Weggeman, M., van der Velde, E. A., Kerkhof, G. A., van Dijk, J. G., & Roos, R. A. (1993). Sleep, excessive daytime sleepiness and fatigue in Parkinson's disease. J Neural Transm Park Dis Dement Sect, 5(3), 235-244.

Vaughan, A. M., & Oram, J. F. (2003). ABCA1 redistributes membrane cholesterol independent of apolipoprotein interactions. Journal of Lipid Research, 44(7), 1373-1380.

Wakabayashi, K., Matsumoto, K., Takayama, K., Yoshimoto, M., & Takahashi, H. (1997). NACP, a presynaptic protein, immunoreactivity in Lewy bodies in Parkinson's disease. Neurosci Lett, 239(1), 45-48.

Wooten, R. E., Willingham, M. C., Daniel, L. W., Leslie, C. C., Rogers, L. C., Sergeant, S., & O'Flaherty, J. T. (2008). Novel translocation responses of cytosolic phospholipase A2alpha fluorescent proteins. Biochim Biophys Acta, 1783(8), 1544-1550.

Yamano, G., Funahashi, H., Kawanami, O., Zhao, L. X., Ban, N., Uchida, Y., . . . Inagaki, N. (2001). ABCA3 is a lamellar body membrane protein in human lung alveolar type II cells. [Research Support, Non-U.S. Gov't]. FEBS Lett, 508(2), 221-225.

Ye, D., Hoekstra, M., Out, R., Meurs, I., Kruijt, J. K., Hildebrand, R. B., . . . Van Eck, M. (2008). Hepatic cell-specific ATP-binding cassette (ABC) transporter profiling identifies putative novel candidates for lipid homeostasis in mice. [Research Support, Non-U.S. Gov't]. Atherosclerosis, 196(2), 650-658.

Ye, D., Meurs, I., Ohigashi, M., Calpe-Berdiel, L., Habets, K. L., Zhao, Y., . . . Van Eck, M. (2010). Macrophage ABCA5 deficiency influences cellular cholesterol efflux and increases susceptibility to atherosclerosis in female LDLr knockout mice. [Research Support, Non-U.S. Gov't]. Biochem Biophys Res Commun, 395(3), 387-394.

Zhao, L. X., Zhou, C. J., Tanaka, A., Nakata, M., Hirabayashi, T., Amachi, T., . . . Inagaki, N. (2000). Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2. Biochemical Journal, 350 Pt 3, 865-872.