ATP-Binding Cassette Cholesterol Transporter Family and Hyperlipidemia
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
The Translational Expression of ABCA2 and ABCA3 Is a Strong Prognostic Biomarker for Multidrug Resistance in Pediatric Acute Lymphoblastic Leukemia
Journal name: OncoTargets and Therapy Article Designation: Original Research Year: 2017 Volume: 10 OncoTargets and Therapy Dovepress Running head verso: Aberuyi et al Running head recto: ABCA2/A3 transporters and multidrug-resistant ALL open access to scientific and medical research DOI: http://dx.doi.org/10.2147/OTT.S140488 Open Access Full Text Article ORIGINAL RESEARCH The translational expression of ABCA2 and ABCA3 is a strong prognostic biomarker for multidrug resistance in pediatric acute lymphoblastic leukemia Narges Aberuyi1 Purpose: The aim of this work was to study the correlation between the expressions of the Soheila Rahgozar1 ABCA2 and ABCA3 genes at the mRNA and protein levels in children with acute lymphoblastic Zohreh Khosravi Dehaghi1 leukemia (ALL) and the effects of this association on multidrug resistance (MDR). Alireza Moafi2 Materials and methods: Sixty-nine children with de novo ALL and 25 controls were Andrea Masotti3,* enrolled in the study. Mononuclear cells were isolated from the bone marrow. The mRNA Alessandro Paolini3,* levels of ABCA2 and ABCA3 were measured by real-time polymerase chain reaction (PCR). Samples with high mRNA levels were assessed for respective protein levels by Western blot- 1 Department of Biology, Faculty ting. Following the first year of treatment, persistent monoclonality of T-cell gamma receptors of Science, University of Isfahan, 2Department of Pediatric- or immunoglobulin H (IgH) gene rearrangement was assessed and considered as the MDR. Hematology-Oncology, Sayed-ol- The tertiary structure of ABCA2 was predicted using Phyre2 and I-TASSER web systems Shohada Hospital, Isfahan University and compared to that of ABCA3, which has been previously reported. -
Examining the Role of ABC Lipid Transporters in Pulmonary Lipid Homeostasis and Inflammation Amanda B
Chai et al. Respiratory Research (2017) 18:41 DOI 10.1186/s12931-017-0526-9 REVIEW Open Access Examining the role of ABC lipid transporters in pulmonary lipid homeostasis and inflammation Amanda B. Chai1, Alaina J. Ammit2,3* and Ingrid C. Gelissen1 Abstract Respiratory diseases including asthma and chronic obstructive pulmonary disease (COPD) are characterised by excessive and persistent inflammation. Current treatments are often inadequate for symptom and disease control, and hence new therapies are warranted. Recent emerging research has implicated dyslipidaemia in pulmonary inflammation. Three ATP-binding cassette (ABC) transporters are found in the mammalian lung – ABCA1, ABCG1 and ABCA3 – that are involved in movement of cholesterol and phospholipids from lung cells. The aim of this review is to corroborate the current evidence for the role of ABC lipid transporters in pulmonary lipid homeostasis and inflammation. Here, we summarise results from murine knockout studies, human diseases associated with ABC transporter mutations, and in vitro studies. Disruption to ABC transporter activity results in lipid accumulation and elevated levels of inflammatory cytokines in lung tissue. Furthermore, these ABC-knockout mice exhibit signs of respiratory distress. ABC lipid transporters appear to have a crucial and protective role in the lung. However, our knowledge of the underlying molecular mechanisms for these benefits requires further attention. Understanding the relationship between cholesterol and inflammation in the lung, and the role that ABC transporters play in this may illuminate new pathways to target for the treatment of inflammatory lung diseases. Keywords: ABC transporters, ABCA1, ABCG1, ABCA3, Lipids, Surfactant, Pulmonary inflammation Background lung tissue of patients with COPD [5]. -
Genotyping of Breech Flystrike Resource – Update
Project No: ON-00515 Contract No: PO4500010753 AWI Project Manager: Bridget Peachey Contractor Name: CSIRO Agriculture and Food Prepared by: Dr Sonja Dominik Publication Date: July 2019 Genotyping of breech flystrike resource – update Published by Australian Wool Innovation Limited, Level 6, 68 Harrington Street, THE ROCKS, NSW, 2000 This publication should only be used as a general aid and is not a substitute for specific advice. To the extent permitted by law, we exclude all liability for loss or damage arising from the use of the information in this publication. AWI invests in research, development, innovation and marketing activities along the global supply chain for Australian wool. AWI is grateful for its funding, which is primarily provided by Australian woolgrowers through a wool levy and by the Australian Government which provides a matching contribution for eligible R&D activities © 2019 Australian Wool Innovation Ltd. All rights reserved. Contents Executive Summary .................................................................................................................... 3 1 Introduction/Hypothesis .................................................................................................... 5 2 Literature Review ............................................................................................................... 6 3 Project Objectives .............................................................................................................. 8 4 Success in Achieving Objectives ........................................................................................ -
Genome-Wide Analysis of ATP-Binding
Tian et al. BMC Genomics (2017) 18:330 DOI 10.1186/s12864-017-3706-6 RESEARCH ARTICLE Open Access Genome-wide analysis of ATP-binding cassette (ABC) transporters in the sweetpotato whitefly, Bemisia tabaci Lixia Tian1, Tianxue Song2, Rongjun He1, Yang Zeng1, Wen Xie1, Qingjun Wu1, Shaoli Wang1, Xuguo Zhou3* and Youjun Zhang1* Abstract Background: ABC transporter superfamily is one of the largest and ubiquitous groups of proteins. Because of their role in detoxification, insect ABC transporters have gained more attention in recent years. In this study, we annotated ABC transporters from a newly sequenced sweetpotato whitefly genome. Bemisia tabaci Q biotype is an emerging global invasive species that has caused extensive damages to field crops as well as ornamental plants. Results: A total of 55 ABC transporters containing all eight described subfamilies (A to H) were identified in the B. tabaci Q genome, including 8 ABCAs, 3 ABCBs, 6 ABCCs, 2 ABCDs, 1 ABCE, 3 ABCFs, 23 ABCGs and 9 ABCHs. In comparison to other species, subfamilies G and H in both phloem- and blood-sucking arthropods are expanded. The temporal expression profiles of these 55 ABC transporters throughout B. tabaci developmental stages and their responses to imidacloprid, a neonicotinoid insecticide, were investigated using RNA-seq analysis. Furthermore, the mRNA expression of 24 ABC transporters (44% of the total) representing all eight subfamilies was confirmed by the quantitative real-time PCR (RT-qPCR). Furthermore, mRNA expression levels estimated by RT-qPCR and RNA-seq analyses were significantly correlated (r =0.684,p <0.01). Conclusions: It is the first genome-wide analysis of the entire repertoire of ABC transporters in B. -
A Single-Cell Transcriptomic Landscape of Primate Arterial Aging
ARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China. -
Datasheet: MCA2682A647 Product Details
Datasheet: MCA2682A647 Description: RAT ANTI MOUSE ABCA2:Alexa Fluor® 647 Specificity: ABCA2 Other names: ATP BINDING CASSETTE 2 Format: ALEXA FLUOR® 647 Product Type: Monoclonal Antibody Clone: 9A2-51.3 Isotype: IgG2a Quantity: 100 TESTS/1ml Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Flow Cytometry (1) Neat - 1/10 Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Suggested working dilutions are given as a guide only. It is recommended that the user titrates the product for use in their own system using appropriate negative/positive controls. (1)Membrane permeabilisation is required for this application. Bio-Rad recommends the use of Leucoperm™ (Product Code BUF09) for this purpose. Target Species Mouse Product Form Purified IgG conjugated to Alexa Fluor® 647- liquid Max Ex/Em Fluorophore Excitation Max (nm) Emission Max (nm) Alexa Fluor®647 650 665 Preparation Purified IgG prepared by affinity chromatography on Protein G from tissue culture supernatant Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 1% Bovine Serum Albumin Approx. Protein IgG concentration 0.05mg/ml Concentrations Immunogen ABCA2 transfected HeLa cells. External Database UniProt: Links Page 1 of 3 P41234 Related reagents Entrez Gene: 11305 Abca2 Related reagents Synonyms Abc2 Specificity Rat anti Mouse ABCA2 antibody, clone 9A2-51.3 recognizes murine adenosine triphosphate (ATP) binding cassette transporter 2 (ABCA2). -
5' Untranslated Region Elements Show High Abundance and Great
International Journal of Molecular Sciences Article 0 5 Untranslated Region Elements Show High Abundance and Great Variability in Homologous ABCA Subfamily Genes Pavel Dvorak 1,2,* , Viktor Hlavac 2,3 and Pavel Soucek 2,3 1 Department of Biology, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic 2 Biomedical Center, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic; [email protected] (V.H.); [email protected] (P.S.) 3 Toxicogenomics Unit, National Institute of Public Health, 100 42 Prague, Czech Republic * Correspondence: [email protected]; Tel.: +420-377593263 Received: 7 October 2020; Accepted: 20 November 2020; Published: 23 November 2020 Abstract: The 12 members of the ABCA subfamily in humans are known for their ability to transport cholesterol and its derivatives, vitamins, and xenobiotics across biomembranes. Several ABCA genes are causatively linked to inborn diseases, and the role in cancer progression and metastasis is studied intensively. The regulation of translation initiation is implicated as the major mechanism in the processes of post-transcriptional modifications determining final protein levels. In the current bioinformatics study, we mapped the features of the 50 untranslated regions (50UTR) known to have the potential to regulate translation, such as the length of 50UTRs, upstream ATG codons, upstream open-reading frames, introns, RNA G-quadruplex-forming sequences, stem loops, and Kozak consensus motifs, in the DNA sequences of all members of the subfamily. Subsequently, the conservation of the features, correlations among them, ribosome profiling data as well as protein levels in normal human tissues were examined. The 50UTRs of ABCA genes contain above-average numbers of upstream ATGs, open-reading frames and introns, as well as conserved ones, and these elements probably play important biological roles in this subfamily, unlike RG4s. -
Molecular Structure of a Novel Cholesterol-Responsive a Subclass ABC Transporter, ABCA9
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Regensburg Publication Server BBRC Biochemical and Biophysical Research Communications 295 (2002) 408–416 www.academicpress.com Molecular structure of a novel cholesterol-responsive A subclass ABC transporter, ABCA9 Armin Piehler,1 Wolfgang E. Kaminski,1 Juurgen€ J. Wenzel, Thomas Langmann, and Gerd Schmitz* Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Franz-Josef-Strauß-Allee 11, D-93042, Regensburg, Germany Received 25 May 2002 Abstract We recently identified a novel ABC A subclass transporter, ABCA6, in human macrophages. Here, we report the molecular cloning of an additional ABC A subfamily transporter from macrophages denoted ABCA9. The identified coding sequence is 4.9 kb in size and codes for a 1624 amino acid protein product. In accordance with the proposed nomenclature, the novel transporter was designated ABCA9. The putative full-length ABC transporter polypeptide consists of two transmembrane domains and two nu- cleotide binding folds and thus conforms to the group of full-size ABC transporters. We identified alternative ABCA9 mRNA variants in human macrophages that predict the existence of three truncated forms of the novel transporter. Among the human ABC A subfamily transporters, ABCA9 exhibits the highest amino acid sequence homology with ABCA8 (72%) and ABCA6 (60%), respectively. The striking amino acid sequence similarity between these transporter molecules supports the notion that they represent an evolutionary more recently emerged subgroup within the family of ABC A transporters, which we refer to as ‘‘ABCA6-like transporters.’’ ABCA9 mRNA is ubiquitously expressed with the highest mRNA levels in heart, brain, and fetal tissues. -
Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice. -
Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing -
ABCA5 (NM 018672) Human Tagged ORF Clone – RC213865 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213865 ABCA5 (NM_018672) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ABCA5 (NM_018672) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ABCA5 Synonyms: ABC13; EST90625; HTC3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC213865 representing NM_018672 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCACTGCAATTAGGGAGGTAGGAGTTTGGAGACAGACCAGAACACTTCTACTGAAGAATTACTTAA TTAAATGCAGAACCAAAAAGAGTAGTGTTCAGGAAATTCTTTTTCCACTATTTTTTTTATTTTGGTTAAT ATTAATTAGCATGATGCATCCAAATAAGAAATATGAAGAAGTGCCTAATATAGAACTCAATCCTATGGAC AAGTTTACTCTTTCTAATCTAATTCTTGGATATACTCCAGTGACTAATATTACAAGCAGCATCATGCAGA AAGTGTCTACTGATCATCTACCTGATGTCATAATTACTGAAGAATATACAAATGAAAAAGAAATGTTAAC ATCCAGTCTCTCTAAGCCGAGCAACTTTGTAGGTGTGGTTTTCAAAGACTCCATGTCCTATGAACTTCGT TTTTTTCCTGATATGATTCCAGTATCTTCTATTTATATGGATTCAAGAGCTGGCTGTTCAAAATCATGTG AGGCTGCTCAGTACTGGTCCTCAGGTTTCACAGTTTTACAAGCATCCATAGATGCTGCCATTATACAGTT GAAGACCAATGTTTCTCTTTGGAAGGAGCTGGAGTCAACTAAAGCTGTTATTATGGGAGAAACTGCTGTT GTAGAAATAGATACCTTTCCCCGAGGAGTAATTTTAATATACCTAGTTATAGCATTTTCACCTTTTGGAT ACTTTTTGGCAATTCATATCGTAGCAGAAAAAGAAAAAAAAATAAAAGAATTTTTAAAGATAATGGGACT TCATGATACTGCCTTTTGGCTTTCCTGGGTTCTTCTATATACAAGTTTAATTTTTCTTATGTCCCTTCTT ATGGCAGTCATTGCGACAGCTTCTTTGTTATTTCCTCAAAGTAGCAGCATTGTGATATTTCTGCTTTTTT -
ABC Transporter Activity Linked to Radiation Resistance And
Ingram et al. Experimental Hematology & Oncology 2013, 2:26 http://www.ehoonline.org/content/2/1/26 Experimental Hematology & Oncology RESEARCH Open Access ABC transporter activity linked to radiation resistance and molecular subtype in pediatric medulloblastoma Wendy J Ingram1,2,4*,LisaMCrowther1, Erica B Little1,RuthFreeman1, Ivon Harliwong1, Desi Veleva1, Timothy E Hassall2, Marc Remke3, Michael D Taylor3 and Andrew R Hallahan1,2 Abstract Background: Resistance to radiation treatment remains a major clinical problem for patients with brain cancer. Medulloblastoma is the most common malignant brain tumor of childhood, and occurs in the cerebellum. Though radiation treatment has been critical in increasing survival rates in recent decades, the presence of resistant cells in a substantial number of medulloblastoma patients leads to relapse and death. Methods: Using the established medulloblastoma cell lines UW228 and Daoy, we developed a novel model system to enrich for and study radiation tolerant cells early after radiation exposure. Using fluorescence-activated cell sorting, dead cells and cells that had initiated apoptosis were removed, allowing surviving cells to be investigated before extensive proliferation took place. Results: Isolated surviving cells were tumorigenic in vivo and displayed elevated levels of ABCG2, an ABC transporter linked to stem cell behavior and drug resistance. Further investigation showed another family member, ABCA1, was also elevated in surviving cells in these lines, as well as in early passage cultures from pediatric medulloblastoma patients. We discovered that the multi-ABC transporter inhibitors verapamil and reserpine sensitized cells from particular patients to radiation, suggesting that ABC transporters have a functional role in cellular radiation protection.