DOCSLIB.ORG

Construction and Screening of a Genomic Library Specific for Mouse

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Construction and Screening of a Genomic Library Specific for Mouse Proc. Nati. Acad. Sci. USA Vol. 86, pp. 8482-8486, November 1989 Genetics Construction and screening of a genomic library specific for mouse chromosome 16 (somatic cell hybrids/repetitive DNA/chromosome-specific libraries/cDNA screening/chromosome map) UTE HOCHGESCHWENDER*, J. GREGOR SUTCLIFFE, AND MILES B. BRENNAN*t Department of Molecular Biology, MB 10, Research Institute of Scripps Clinic, 10666 North Torrey Pines Road, La Jolla, CA 92037 Communicated by George R. Stark, August 9, 1989 ABSTRACT We have established a protocol for producing source of anonymous RFLP markers, the library could be libraries of specific mouse chromosomes. The mouse DNA- used directly to screen for candidate clones ofspecific genes. containing clones from a genomic library of a hamster-mouse We applied this general strategy in assembling a repre- somatic cell hybrid containing only one mouse chromosome are sentative genomic library of mouse chromosome 16 consis- identified by screening with radiolabeled mouse repetitive ting of 14,200 individual clones, equal to about two "chro- sequences after specifically blocking hamster repetitive se- mosome equivalents." Each clone occupies an individual quences; 95% of the mouse DNA-containing clones are iden- well in a microtiter tray, allowing repeated plating and tified. We have applied this protocol in producing a library of hybridization analysis of the library. mouse chromosome 16, consisting of 14,200 clones or two To exploit fully this or any other chromosome-specific "chromosome equivalents." Each clone occupies an individual library, it is necessary to screen the library with cDNA well in a microtiter tray, allowing the entire library to be probes to identify clones containing expressed sequences. repeatedly and reproducibly plated and analyzed by hybrid- However, cDNA probes contain sequences that are highly ization. Further, we have established a protocol for making repeated in the genome, and the hybridization of these cDNA probes specifically depleted of highly repetitive se- sequences to their cognates in a large fraction of genomic quences for probing libraries of genomic clones. By screening clones obscures the hybridization signal from the high- the chromosome 16 library with cDNA probes from mouse liver complexity fraction of the cDNA. In screenings of the and brain, we demonstrate the feasibility of identifying ex- chromosome 16-specific library with cDNA probes of adult pressed sequences and characterizing their patterns of expres- brain and adult liver, we demonstrate the feasibility of sion. Such chromosome-specific libraries can facilitate the specifically depleting cDNA probes of sequences highly isolation of dermed genetic loci as well as form the basis for the repeated in the genome and of correctly identifying the production of integrated transcriptional, genetic, and physical expression patterns of sequences in genomic clones. maps of entire chromosomes. MATERIALS AND METHODS Two major reasons for obtaining a complete collection of Cells. Baby hamster kidney (BHK) and Chinese hamster genomic clones for a single mammalian chromosome are the ovary (CHO) cells, NIH 3T3 mouse cells, and 9-6Az2 ham- analysis ofthe arrangement ofgenes on the chromosome and ster-mouse hybrid cells (5) were grown in Dulbecco's mod- the isolation of specific genetic loci mapped to the particular ified Eagle's medium with 10% (vol/vol) fetal bovine serum chromosome. With these goals in mind, we devised protocols (BHK, CHO, 9-6Az2) or bovine serum (NIH 3T3). The for producing mouse chromosome-specific libraries and for 9-6Az2 line contains only mouse chromosome 16. The pres- screening these libraries for transcribed sequences. While ence ofmouse chromosome 16 in our cultures was verified by human chromosome-specific libraries can be made from the probing a Southern blot of restriction endonuclease-digested DNA of flow-sorted chromosomes, the similarity in DNA DNA from mouse, hamster, and the hybrid cell line with the content, base composition, and centric heterochromatin of plasmid pMx34 (6)-a probe for the Mx gene known to lie on mouse chromosomes has thus far prevented their purification chromosome 16 (7). The hybrid line exhibited the mouse by this method (1, 2), although it may be possible to make use hybridization pattern superimposed upon the hamster pat- of Robertsonian translocation strains to purify fused chro- tern, thus proving that our hybrid contained mouse chromo- mosomes. The strategy for producing mouse chromosome- some 16 (data not shown). The intensity of hybridization to specific libraries is to screen genomic libraries from somatic the mouse band in the hybrid sample was submolar, consis- cell hybrids, which contain only a single chromosome from tent with the known mitotic instability of mouse chromo- one of the parent species, with repetitive DNA from that somes in hybrid lines. species. A similar approach has been used to identify human Purification of Nucleic Acids. High molecular weight DNA and mouse chromosome-specific restriction fragment length from tissue culture cells was isolated as described by Brison polymorphism (RFLP) markers from libraries of hamster- et al. (8). DNA from mice was prepared by removing the human and hamster-mouse somatic cell hybrids (3, 4). How- brain, washing it briefly in phosphate-buffered saline before ever, to extend this approach to the production of repre- homogenizing it gently in 10 mM Tris/1 mM EDTA, pH 7.5 sentative mouse chromosome-specific libraries, it is neces- (TE buffer) in a loose pestle glass homogenizer. The homog- sary that the vast majority, rather than only a fraction (4), of enate was lysed by addition of NaDodSO4 to 1% and then the mouse DNA-containing clones be identified. Such a further processed like DNA from tissue culture cells. When quantitative increase in the representation in the library the DNA was to be sheared, it was sonicated extensively at would allow a qualitative difference in its use: rather than a Abbreviation: RFLP, restriction fragment length polymorphism. *Present address: Brookdale Center for Molecular Biology, The The publication costs of this article were defrayed in part by page charge Mount Sinai School of Medicine, One Gustave L. Levy Place, New payment. This article must therefore be hereby marked "advertisement" York, NY 10029. in accordance with 18 U.S.C. §1734 solely to indicate this fact. tTo whom reprint requests should be addressed. 8482 Downloaded by guest on September 29, 2021 Genetics: Hochgeschwender et al. Proc. Natl. Acad. Sci. USA 86 (1989) 8483 high power until the size of the DNA fragments was about 500 (9) (pH 7.0) at room temperature, heated to 680C in a large nucleotides as shown by electrophoresis in an agarose gel. volume of 99% formamide (16), washed several times with Phage DNA and plasmid DNA preparations were done TE buffer, and stored at 40C until next use. following standard procedures (9). Screening Somatic Cell Hybrid Libraries. Phage lifts were Total cellular RNA was prepared from fresh mouse tissues prepared by using Biotrans membranes (ICN) according to by the procedure of Chirgwin et al. (10). Enrichment for the supplier's recommendations. No more than five filters poly(A)+ RNA was performed by the procedure of Aviv and were hybridized in one plastic bag. For screening the somatic Leder (11). cell hybrid libraries, filters were first prehybridized at 680C Construction of Libraries. Phage libraries of genomic DNA overnight in the general hybridization solution [6x SSC were constructed by following standard procedures (9). DNA containing 0.5% NaDodSO4, 0.2% sodium pyrophosphate, from BHK cells and NIH 3T3 cells was digested to comple- Sx Denhardt's solution (9), and 10 mM EDTA; lx SSC = tion with BamHI and ligated into phage AEMBL3 (12). DNA 0.15 M NaCI/0.015 M sodium citrate, pH 7] supplemented from 9-6Az2 cells was digested partially with the enzyme with salmon sperm carrier DNA to a final concentration of Sau3AI, and the 9- to 23-kilobase (kb) fragments were 100 gg/ml. This first prehybridization was followed by a isolated on DE-81 paper (Whatman) and ligated into phage second overnight prehybridization in which the general hy- ADASH (Stratagene). DNA from NIH 3T3 cells was digested bridization solution was supplemented with sheared hamster to completion with EcoRI and ligated into phage AZAP DNA (to a final concentration of 100 in addition to the (Stratagene). Ligated DNAs were packaged in vitro (Giga- ,ug/ml) pack; Stratagene) and plated on strain LE 392/P2 (AEMBL3 salmon sperm carrier DNA. This second prehybridization and ADASH libraries) or BB4 (ref. 13; AZAP library). Li- step was followed by an overnight hybridization step, for braries were plated and screened as primary libraries, except which the general hybridization solution was supplemented for the AEMBL 3-NIH 3T3 and -BHK libraries, which were with 100 ,ug ofsalmon sperm carrier DNA and ofyeast carrier amplified. Phage clones from the AZAP-NIH 3T3 library were RNA per ml and with 32P-labeled mouse genomic DNA at 1 converted into plasmid clones by the supplier's automatic x 107 cpm/ml. Filters were first washed at room temperature excision protocol. in 2x SSC/0.1% NaDodSO4, followed by two stringent Preparation of Radioactive Probes. High molecular weight washes in 0.5x SSC/0.1% NaDodSO4 at 680C. genomic DNA was labeled with 32P by nick translation (14). Positive plaques were picked into individual wells of mi- DNAs of phage and plasmid clones were labeled by random crotiter plates containing 0.1 ml of SM medium (9). Initially, hexamer oligonucleotide priming (15). Radioactive cDNA the library was stored at 40C. Later, dimethyl sulfoxide was probes were constructed by first synthesizing unlabeled added to 7% (vol/vol), and the plates were stored at -70°C cDNA from 2 ,ug of poly(A)+ RNA by using an oligo(dT) sealed in plastic bags. For plating, trays were thawed, primer (9). The RNA template was removed by treating for aliquots were plated, and trays were refrozen and stored at 20 min at 68°C with 0.1 M sodium hydroxide, the cDNA was -70°C.
Load more

Recommended publications
  • New York Science Journal 2016;9(10) 19 Gene Library Ma Hongbao Brookdale University Hospital A
    New York Science Journal 2016;9(10) http://www.sciencepub.net/newyork Gene Library Ma Hongbao Brookdale University Hospital and Medical Center, Brooklyn, New York 11212, USA [email protected] Abstract: A gene library is a collection of gene clones that represents the genetic material of an organism. There are different types of gene libraries, including cDNA libraries, genomic libraries and randomized mutant libraries. The applications of these libraries depend on the source of the original DNA fragments. Generally in a gene library each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct. As the population of organisms is grown in culture, the DNA molecules contained within them are copied and propagated. [Ma Hongbao. Gene Library. N Y Sci J 2016;9(10):19-23]. ISSN 1554-0200 (print); ISSN 2375-723X (online). http://www.sciencepub.net/newyork. 4. doi:10.7537/marsnys091016.04. Keywords: gene; library; clone; organism; DNA; molecule; copy A gene library is a collection of gene clones that cDNA libraries are useful in reverse genetics, but they represents the genetic material of an organism. In only represent a very small (less than 1%) portion of molecular biology, a library is a collection of DNA the overall genome in a given organism. The fragments stored and propagated in a population of applications of cDNA libraries include: (1) Discovery micro-organisms through the process of molecular of novel genes; (2) Cloning of full-length cDNA cloning.
    [Show full text]
  • Library Construction and Screening
    Library construction and screening • A gene library is a collection of different DNA sequences from an organism, • which has beenAlso called genomic libraries or gene banks. • cloned into a vector for ease of purification, storage and analysis. Uses of gene libraries • To obtain the sequences of genes for analysis, amplification, cloning, and expression. • Once the sequence is known probes, primers, etc. can be synthesized for further diagnostic work using, for example, hybridization reactions, blots and PCR. • Knowledge of a gene sequence also offers the possibility of gene therapy. • Also, gene expression can be used to synthesize a product in particular host cells, e.g. synthesis of human gene products in prokaryotic cells. two types of gene library depending upon the source of the DNA used. 1.genomic library. 2.cDNA library Types of GENE library: • genomic library contains DNA fragments representing the entire genome of an organism. • cDNA library contains only complementary DNA molecules synthesized from mRNA molecules in a cell. Genomic Library : • Made from nuclear DNA of an organism or species. • DNA is cut into clonable size pieces as randomly possible using restriction endonuclease • Genomic libraries contain whole genomic fragments including gene exons and introns, gene promoters, intragenic DNA,origins of replication, etc Construction of Genomic Libraries 1. Isolation of genomic DNA and vector. 2.Cleavage of Genomic DNA and vector by Restriction Endonucleases. 3.Ligation of fragmented DNA with the vector. 4.Transformation of
    [Show full text]
  • Construction of Small-Insert Genomic DNA Libraries Highly Enriched
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 3419-3423, April 1992 Genetics Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences (marker-selected libraries/CA repeats/sequence-tagged sites/genetic mapping/dog genome) ELAINE A. OSTRANDER*tt, PAM M. JONG*t, JASPER RINE*t, AND GEOFFREY DUYKt§ *Department of Molecular and Cellular Biology, 401 Barker Hall, University of California, Berkeley, CA 94720; tHuman Genome Center, Lawrence Berkeley Laboratory, 1 Cyclotron Road, 74-157, Berkeley, CA 94720; and §Department of Genetics, Howard Hughes Medical Institute, Harvard Medical School, 25 Shattuck Street, Boston, MA 02115 Communicated by Philip Leder, January 8, 1992 ABSTRACT We describe an efficient method for the con- Generation of a high-density map of markers for an entire struction of small-insert genomic libraries enriched for highly genome or a single chromosome requires the isolation and polymorphic, simple sequence repeats. With this approach, characterization of hundreds of markers such as microsatel- libraries in which 40-50% of the members contain (CA). lite repeats (10, 11). Two simple yet tedious approaches have repeats are produced, representing an =50-fold enrichment generally been used for this task. One approach is to screen over conventional small-insert genomic DNA libraries. Briefly, a large-insert genomic library with an end-labeled (CA),, or a genomic library with an average insert size of less than 500 (TG),, oligonucleotide (n > 15). Clones that hybridize to the base pairs was constructed in a phagemid vector. Ampliflcation probe are purified and divided into subclones, which are of this library in a dut ung strain ofEscherchia coli allowed the screened by hybridization for a fragment containing the recovery of the library as closed circular single-stranded DNA repeat.
    [Show full text]
  • Cdna Libraries and Expression Libraries
    Solutions for Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. Your vector would certainly need to have a unique restriction enzyme site, a selectable marker such as the ampicillin resistance gene, and a bacterial origin of replication. Other features may be required depending upon how you plan to use this library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? Prior to transformation, the E. coli cells that you will transform will be sensitive to antibiotic. This allows you to select for cells that obtained a plasmid. c) How do you distinguish bacterial cells that carry a vector from those that do not? Cells that obtained a vector will have obtained the selectable marker (one example is the ampicillin resistance gene).
    [Show full text]
  • Genomic Organization of Borna Disease Virus
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 4362-4366, May 1994 Neurobiology Genomic organization of Borna disease virus (central nervous system Infection/behavioral disorders/negative-strand RNA viruses) THOMAS BRIESE*t, ANETTE SCHNEEMANN*, ANN J. LEWIS*, YOO-SUN PARK*, SARA KIM*, HANNS LUDWIGt, AND W. IAN LIPKIN**§¶ Departments of *Neurology, *Anatomy and Neurobiology, and Microbiology and Molecular Genetics, University of California, Irvine, CA 92717; and tInstitute of Virology, Freie Universitit Berlin, Nordufer 20, D 13353 Berlin, Germany Communicated by Hilary Koprowski, January 27, 1994 ABSTRACT Borna disease virus is a neurotropic negative- RNA. The 5'-terminal sequence from each library was used strand RNA virus that infects a wide range ofvertebrate hosts, to design an oligonucleotide primer for construction of the causing disturbances in movement and behavior. We have next library. cloned and sequenced the 8910-nucleotide viral genome by DNA Sequencing and Sequence Analysis. Plasmid DNA was using RNA from Borna disease virus particles. The viral sequenced on both strands by the dideoxynucleotide chain- genome has complementary 3' and 5' termini and contains termination method (13) using a modified bacteriophage T7 antisense information for five open reading frames. Homology DNA polymerase (Sequenase version 2.0; United States to Filoviridae, Paramyxoviridae, and Rhabdoviridae is found Biochemical). Five to 10 independent clones from each in both cistronic and extracistronic regions. Northern analysis library were sequenced with overlap so that each region of indicates that the virus transcribes mono- and polycistronic the genomic RNA was covered by at least 2 clones. Four RNAs and uses terminatlon/polyadenylylation signals remi- libraries were analyzed, yielding =8.9 kb of continuous niscent ofthose observed in other negative-strand RNA viruses.
    [Show full text]
  • Recombinant DNA Resources for the Comparative Genomics of Ancylostoma Ceylanicum
    bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Recombinant DNA resources for the comparative genomics of Ancylostoma ceylanicum. Authors: Wadim J. Kapulkin1,5,6#, Adriana Magalska1, Ewa Janecka1, Arkadiusz Ciesielski2,4, Malgorzata Lobocka2, Jerzy M. Behnke3, Halina Wedrychowicz1 # corresponding author 1. Faculty of Veterinary Medicine, Grochowska 272, 03-849 Warsaw, Poland 2. Institute for Biochemistry and Biophysics –PAS, Pawinskiego 5a, 02-106 Warsaw, Poland 3. School of Life Science, University of Nottingham, University Park, NG7 2RD Nottingham, U.K. 4. Department of Chemistry, University of Warsaw, Pasteura 1, 02-093 Warsaw, Poland Present affiliation: 5. Veterinary Consultancy, Conrada 16/65, 01-922 Warsaw, Poland 6. Mobile Veterinary Consultancy, Nottingham, U.K. Phone: (+44)7466449215 e-mail: [email protected] Keywords: Ancylostoma ceylanicum, Recombinant DNA library, SL1 spliced leader, cDNA, Bacterial Artificial Chromosome library, NUMTs 1 bioRxiv preprint doi: https://doi.org/10.1101/092494; this version posted December 17, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under
    [Show full text]
  • Construction of Plant Bacterial Artificial Chromosome (Bac) Libraries: an Illustrated Guide
    1 22nd EEDDIITTIIOONN ((22000022)) CONSTRUCTION OF PLANT BACTERIAL ARTIFICIAL CHROMOSOME (BAC) LIBRARIES: AN ILLUSTRATED GUIDE Daniel G. Peterson1, Jeffrey P. Tomkins2, David A. Frisch3, Rod A. Wing2, and Andrew H. Paterson1, 4 1 Center for Applied Genetic Technologies (CAGT), University of Georgia, Athens, GA 30602 2 Clemson University Genomics Institute (CUGI), Clemson University, Clemson, SC 29634 3 Biotechnology Center, University of Wisconsin, Madison, WI 53706 4 Department of Crop and Soil Sciences, and Department of Genetics, University of Georgia, Athens, GA 30602 Corresponding author: Daniel G. Peterson; Plant Genome Mapping Laboratory; University of Georgia; Room 162, Riverbend Research Center; 110 Riverbend Road; Athens, GA 30602, USA Phone: (706) 583-0167, Fax: (706) 583-0160, e-mail: [email protected] 2 PRINCIPAL REVISIONS MADE SINCE ORIGINAL PUBLICATION IN THE JOURNAL OF AGRICULTURAL GENOMICS (JAG), VOLUME 5, 2000: 1) CHAPTER 7 (a) Recent experiments have shown that the Percoll gradient step is not necessary to get nuclear preparations of sufficient quality. Thus this step has been deleted. (b) EGTA and L-lysine have been made standard components of MEB and MPDB solutions. These compounds greatly reduce DNA damage caused by endogenous nucleases. 2) CHAPTERS 7, 9, and 10 - PVP is no longer added to the lysis buffer or wash buffers (WB-A, WB- B, and WB-C). PVP often precipitates out of solution to form a brown gel in which the agarose/nuclei plugs may get stuck. Lysis buffer is now made 6 mM EGTA and 200 mM L-lysine. 3) CHAPTER 13 - We no longer recommend the use of GELase to isolate BAC insert DNA from plugs.
    [Show full text]
  • Construction and Characterization of a Half Million Clone BAC Library of Durum Wheat (Triticum Turgidum Ssp
    Theor Appl Genet (2003) 107:931–939 DOI 10.1007/s00122-003-1331-z A. Cenci · N. Chantret · X. Kong · Y. Gu · O. D. Anderson · T. Fahima · A. Distelfeld · J. Dubcovsky Construction and characterization of a half million clone BAC library of durum wheat (Triticum turgidum ssp. durum) Received: 10 January 2002 / Accepted: 14 March 2003 / Published online: 27 June 2003 Springer-Verlag 2003 Abstract Durum wheat (Triticum turgidum ssp. durum, randomly selected BAC clones was 131 kb, resulting in a 2n =4x = 28, genomes AB) is an economically important coverage of 5.1-fold genome equivalents for each of the cereal used as the raw material to make pasta and two genomes, and a 99.4% probability of recovering any semolina. In this paper we present the construction and gene from each of the two genomes of durum wheat. Six characterization of a bacterial artificial chromosome known copy-number probes were used to validate this (BAC) library of tetraploid durum wheat cv. Langdon. theoretical coverage and gave an estimated coverage of This variety was selected because of the availability of 5.8-fold genome equivalents. Screening of the library substitution lines that facilitate the assignment of BACs to with 11 probes related to grain storage proteins and starch the A and B genome. The selected Langdon line has a 30- biosynthesis showed that the library contains several cM segment of chromosome 6BS from T. turgidum ssp. clones for each of these genes, confirming the value of the dicoccoides carrying a gene for high grain protein library in characterizing the organization of these impor- content, the target of a positional cloning effort in our tant gene families.
    [Show full text]
  • Solutions for Recombinant DNA Unit Exam
    Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ GGATCC 3’ 3’ CCTAGG 5’ Cleavage by BamHI results in a 5’ overhang as seen here: 5’ G 3’ CCTAG b) BclI cleaves after the first T. Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ TGATCA 3’ 3’ ACTAGT 5’ 5’ T Cleavage by BclI results in a 5’ overhang as seen here: 3’ ACTAG c) You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ e) Could you cut the fragment from (d) with either BamHI or BclI? Explain.
    [Show full text]
  • DNA Libraries (PART-I)
    NPTEL – Biotechnology – Fundamentals of Biotechnology Lecture 10: DNA Libraries (PART-I) Introduction-Gene sequence are arranged in genome in a randon fashion and selecting or isolating a gene is a big task especially when the genomic sequences are not known. A small portion of genome is transcribed to give mRNA where as a major portion remained untranscribed. Hence, there are two ways to represent a genomic sequence information into the multiple small fragments in the form of a library: (1) Genomic library (2) cDNA library. Preparation of Genomic Library-A genomic library represents complete genome in multiple clones containing small DNA fragments. Depending upon organism and size of genome, this library is either prepared in a bacterial vector (discussed later in future lectures) or in yeast artificial chromosome (YAC). An outline of the construction of genomic library is given in Figure 10.1. it has following steps: 1. Isolation of genomic DNA 2. Generation of suitable size DNA fragments 3. Cloning in suitable vector system (depending on size) 4. Transformation in suitable host . Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology Figure 10.1: Contruction of Genomic library. Joint initiative of IITs and IISc – Funded by MHRD Page 2 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology 1. Isolation of genomic DNA- Isolation of genomic DNA has following steps: 1. Lysis of cells with detergent containing lysis buffer. 2. Incubation of cells with digestion buffer containing protease-K, SDS to release genomic DNA from DNA-protein complex. 3. Isolation of genomic DNA by absolute alchol precipitation.
    [Show full text]
  • Practice Problems for Recombinant DNA, Session 4: Cdna Libraries and Expression Libraries
    Practice Problems for Recombinant DNA, Session 4: cDNA Libraries and Expression Libraries Question 1 In a hypothetical scenario you wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer’s market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in E. Coli with the hope of cloning the harE gene. If you succeed you will be a billionaire! You obtain DNA from the fungus, digest it with a restriction enzyme, and clone it into a vector. a) What features must be present on your plasmid that will allow you to use this as a cloning vector to make fungal genomic DNA library. b) You clone your digested genomic DNA into this vector. The E. coli (bacteria) cells that you will transform to create your library will have what phenotype prior to transformation? c) How do you distinguish bacterial cells that carry a vector from those that do not? d) How do you distinguish bacterial cells that carry a recombinant vector from those that carry the original cloning vector? e) You could screen your library by hybridization with a probe. • What information would you need to do this screen? • What would you use as a probe? You would use a segment of SS DNA or denatured DS DNA complementary to the harE gene. • Would the entire harE gene need to be present in a recombinant vector for your screen to work? Explain.
    [Show full text]
  • Construction of Genomic Library Mcba P7 T
    CONSTRUCTION OF GENOMIC LIBRARY Sources: 1. Biotechnology By B.D. Singh, 2. Gene cloning and DNA analysis By TA Brown, 3. Advance and Applied Biotechnology By Marian Patrie, 4. Molecular Biotechnology By Glick et al and 5. Principle of Gene Manipulation By sandy b Primrose et al. Dr. Diptendu Sarkar [email protected] Introduction • A genomic library is an organism specific collection of DNA, covering the entire genome of an organism. • A genomic library is a set of recombinant clones that contains all of the DNA present in an individual organism. • Genomic libraries can be retained for many years,and propagated so that copies can be sent from one research group to another. • It contains all DNA sequences such as : 1. expressed genes, 2. non-expressed genes, 3. exons and introns, 4. promoter and terminator regions and 5. intervening DNA sequences. 12/10/2019 DS/RKMV/MB 2 Construction of genomic library • Construction of a genomic DNA library involves o isolation, o purification and fragmentation of genomic DNA o followed by cloning of the fragmented DNA using suitable vectors. • The eukaryotic cell nuclei are purified by digestion with protease and organic (phenol- chloroform) extraction. • The derived genomic DNA is too large to incorporate into a vector, and needs to be broken up into desirable fragment sizes. • Fragmentation of DNA can be achieved by physical method and enzymatic method. Preparation of a gene library in a cosmid • The library created contains representative vector. copies of all DNA fragments present within the genome. 12/10/2019 DS/RKMV/MB 3 Mechanisms for cleaving DNA (a) Physical method It involves mechanical shearing of genomic DNA using a narrow-gauge syringe needle or sonication to break up the DNA into suitable size fragments that can be cloned.
    [Show full text]