DOCSLIB.ORG

Deletion and Reduced Expression of the Fanconi Anemia FANCA Gene in Sporadic Acute Myeloid Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deletion and Reduced Expression of the Fanconi Anemia FANCA Gene in Sporadic Acute Myeloid Leukemia Leukemia (2004) 18, 420–425 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $25.00 www.nature.com/leu Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia MD Tischkowitz1, NV Morgan1, D Grimwade1,2, C Eddy1, S Ball3, I Vorechovsky4, S Langabeer2, R Sto¨ger1, SV Hodgson1 and CG Mathew1 1Department of Medical and Molecular Genetics, Division of Genetics and Development Guy’s, King’s and St Thomas’ School of Medicine, King’s College London, Guy’s Hospital, London, UK; 2Department of Haematology, University College London, London, UK; 3Department of Haematology, St George’s Hospital, London, UK; and 4Human Genetics Division, School of Medicine, Southampton University Hospital, Tremona Road, Southampton, UK Fanconi anemia (FA) is an autosomal recessive chromosomal Since the incidence of AML is highly elevated in FA patients, instability disorder caused by mutations in one of seven known it is possible that inherited or acquired mutations in the FA genes genes (FANCA,C,D2,E,F,G and BRCA2). Mutations in the FANCA gene are the most prevalent, accounting for two-thirds contribute to the etiology of sporadic AML. Epidemiological of FA cases. Affected individuals have greatly increased risks studies assessing incidence of malignancies (including AML) in of acute myeloid leukemia (AML). This raises the question as to FA families have failed to demonstrate an increased incidence in whether inherited or acquired mutations in FA genes might be heterozygous individuals.14,15 However, it is conceivable that involved in the development of sporadic AML. Quantitative genomic instability may result from a second somatic mutation fluorescent PCR was used to screen archival DNA from in an FA carrier or from one or two somatic mutations in a sporadic AML cases for FANCA deletions, which account for 16 40% of FANCA mutations in FA homozygotes. Four hetero- progenitor cell resulting in malignancy. Another chromosome zygous deletions were found in 101 samples screened, which is instability syndrome, ataxia telangiectasia (AT) has been 35-fold higher than the expected population frequency for implicated in sporadic leukemias; the AT gene, ATM,is germline FANCA deletions (Po0.0001). Sequencing FANCA in frequently deleted or mutated in T-cell prolymphocytic leuke- the AML samples with FANCA deletions did not detect mia,17–19 and ATM mutations have also been detected in mutations in the second allele and there was no evidence of sporadic non-Hodgkin’s lymphomas18 and B-cell chronic epigenetic silencing by hypermethylation. However, real-time 20 quantitative PCR analysis in these samples showed reduced lymphocytic leukemia. Moreover, heterozygous carriers of expression of FANCA compared to nondeleted AML samples AT mutations have a phenotype at the gene expression level that 21 and to controls. These findings suggest that gene deletions and differs from control individuals. Thus, heterozygosity for an reduced expression of FANCA may be involved in the promo- ATM mutation may predispose to these malignancies. tion of genetic instability in a subset of cases of sporadic AML. Current evidence regarding the role of FA mutations in Leukemia (2004) 18, 420–425. doi:10.1038/sj.leu.2403280 sporadic hematological malignancies including AML is limited; Published online 29 January 2004 Keywords: Fanconi anemia; acute myeloid leukemia; DNA repair; an analysis of 79 cases of adult AML for FANCA point mutations gene deletions found 13 exonic nucleotide changes, none of which led to truncation of FANCA.22 Five changes were novel missense mutations leading to nonconservative amino-acid substitutions Introduction in four cases, none of which was present in 79 normal controls. One additional missense mutation A3982G (causing the amino- acid change T1328A) had previously been reported to be Fanconi anemia (FA) is an autosomal recessive DNA disorder 23 characterized by hypersensitivity to DNA crosslinking agents.1 pathogenic, and the other seven nucleotide changes were Affected individuals have characteristic congenital abnormal- polymorphisms. A recent analysis of FANCC in 97 cases of ities, develop bone marrow failure at an early age, and have a sporadic pediatric AML found no evidence of known pathogenic greatly increased risk of developing myelodysplasia (MDS), mutations, although one polymorphic variant was present at 2–4 four-fold greater frequency in the AML cases compared to acute myeloid leukemia (AML) and solid malignancies. A 24 25 report on 754 FA patients diagnosed over a 20-year period controls. Xie et al analyzed cellular lysates from 10 sporadic showed that the risks of developing bone marrow failure and AML cell lines for FANCA, C, F and G protein expression using MDS or AML by age 40 years were 90 and 33% respectively.3 A Western blotting. Aberrant FA protein profiles, including the recent survey of cancer incidence in 145 FA patients reported absence or reduced presence of protein, were observed in five nine cases of myeloid leukemia with a median age-of-onset of out of the 10 cell lines. In cell lysates from primary AML blasts, 11.3 years, and a ratio of observed to expected cases of 785.4 11 out of 15 cases also had aberrant profiles. Further evidence Complementation analysis by cell fusion and correction of that disruption of the FA pathway may be implicated in the etiology of some sporadic AML cases is provided by Lensch crosslinker hypersensitivity has delineated at least eight com- 26 plementation groups; FA-A, B, C, D1, D2, E, F, G,5 six genes et al, who reported a case of acquired cytogenetic instability have been cloned, FANCA, C, D2, E, F, G,6–12 and a recent in a 68-year-old man with AML and demonstrated FANCA report has shown biallelic inactivation of BRCA2 in FA-D1 cell dysfunction in tumor cells, while lymphoblastoid cells from the lines.13 same individual had normal FANCA function. The high incidence of AML in FA homozygotes and the evidence for deficiency of FA proteins and their complexes in Correspondence: Dr MD Tischkowitz, Clinical Genetics Unit, Institute sporadic AML,25,26 have led us to examine the role of of Child Health, 30, Guilford Street, London WC1N 1EH, UK; Fax: þ 44 20 78138141; E-mail: [email protected] inactivation of the FA pathway in the development of sporadic Received 17 July 2003; accepted 4 December 2003; Published online AML. We selected the FANCA gene for analysis since mutations 29 January 2004 in this gene account for 70% of all cases of FA. The mutation FANCA gene deletions in AML MD Tischkowitz et al 421 profile of FANCA is highly heterogeneous with over 100 the FANCA CpG island. Following sodium bisulfite conversion, different mutations described,23,27–29 and there is a 40% PCR reactions to amplify the FANCA CpG island sequence were incidence of large deletions, which remove 1–43 exons from performed on a Techne Genius thermocycler in oil-free 25 ml the gene.28,30 Screening for these mutations thus accounts for reactions. A measure of 12.5 ml of sodium bisulfite-converted nearly 30% of all FA mutations across all complementation DNA was added to 12.5 ml of the reaction mix containing 2 Â groups. Taq Polymerase buffer (67 mM Tris-HCl, pH 8.8, 16.6 mM (NH4)2SO4, 1.5 mM MgCl2, 170 mg BSA/ml), 400 mM each dNTP (Pharmacia) and 0.4 mM of each primer (1F, 50 TAGGT- Materials and methods TAGTTTGGAATTTTTGGG 30;1R50 AGAGAAAAAATG- GAAAAAAAA 30). After an initial denaturation of 5 min at Samples 941C, a touch-down protocol was used: five cycles of 941C for 20 s, 601C for 30 s (reducing by 11C/cycle) and 721C annealing Samples were obtained from tissue banks at the Departments of for 40 s, followed by a further 30 cycles of 941C for 20 s, 551C Hematology of University College Hospital, London, St for 30 s, 721C annealing for 40 s (increasing by 2 s with each George’s Hospital, London and the Karolinska Institute, Sweden. cycle), and a final extension step of 5 min at 721C. For the A total of 101 samples were analyzed. A total of 22 samples second (seminested) PCR, 0.5 ml of the first PCR end-product (22%) were selected for monosomy 7, since this is one of the was transferred to a new 24.5 ml PCR mixture with the same final commonest recurring cytogenetic findings in AML arising on a concentration of reagents as above, but using a different reverse background of FA,2 and the rest were randomly selected. The primer (2R, 50 GGAAATGAATGGGGTTGGTAATG 30). The median age was 58 years (range 16–90 years). FAB group was: conditions for this PCR were the same as above, but without the M1 ¼ 3, M2 ¼ 19, M3 ¼ 15, M4 ¼ 23, M5 ¼ 10, M6 ¼ 3, M7 ¼ 1, initial 5-cycle touch-down step. unknown ¼ 27. Risk classification based on cytogenetic analy- The PCR product was purified and sequenced using a sis31 was: adverse ¼ 25, intermediate ¼ 32, favorable ¼ 16, commercial sequencing kit (Applied Biosystems, Warrington, unknown ¼ 28. The study had ethical approval (MREC 99/7/45). UK) according to the manufacturer’s instructions. The reverse primer was the same as that used for the second PCR, with a 0 T different forward primer (2F, 5 GTAGG( /C)GTATTTTTTAG- Quantitative fluorescent PCR analysis of FANCA gene GATTAATATG 30). The resulting amplicon had an expected dosage length of 221 bp and was predicted to contain 24 CpG dinucleotides. The product was cleaned and analyzed using The FANCA multiplex quantitative fluorescent PCR (QF-PCR) an ABI 310 Genetic Analyzer (Applied Biosystems, Warrington, gene dosage assay used has been previously described by UK). Sequence data were analyzed using Sequence Navigator Morgan et al.28 This multiplex amplifies five exons (5, 11, 17, software (Applied Biosystems, Warrington, UK), specifically 21, and 31) and uses exon 1 of the myelin protein zero (MPZ) assessing each CpG island to determine whether a thymine was gene as a non-FA gene control.
Load more

Recommended publications
  • Structure and Function of the Human Recq DNA Helicases
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2005 Structure and function of the human RecQ DNA helicases Garcia, P L Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-34420 Dissertation Published Version Originally published at: Garcia, P L. Structure and function of the human RecQ DNA helicases. 2005, University of Zurich, Faculty of Science. Structure and Function of the Human RecQ DNA Helicases Dissertation zur Erlangung der naturwissenschaftlichen Doktorw¨urde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultat¨ der Universitat¨ Z ¨urich von Patrick L. Garcia aus Unterseen BE Promotionskomitee Prof. Dr. Josef Jiricny (Vorsitz) Prof. Dr. Ulrich H ¨ubscher Dr. Pavel Janscak (Leitung der Dissertation) Z ¨urich, 2005 For my parents ii Summary The RecQ DNA helicases are highly conserved from bacteria to man and are required for the maintenance of genomic stability. All unicellular organisms contain a single RecQ helicase, whereas the number of RecQ homologues in higher organisms can vary. Mu- tations in the genes encoding three of the five human members of the RecQ family give rise to autosomal recessive disorders called Bloom syndrome, Werner syndrome and Rothmund-Thomson syndrome. These diseases manifest commonly with genomic in- stability and a high predisposition to cancer. However, the genetic alterations vary as well as the types of tumours in these syndromes. Furthermore, distinct clinical features are observed, like short stature and immunodeficiency in Bloom syndrome patients or premature ageing in Werner Syndrome patients. Also, the biochemical features of the human RecQ-like DNA helicases are diverse, pointing to different roles in the mainte- nance of genomic stability.
    [Show full text]
  • Open Full Page
    CCR PEDIATRIC ONCOLOGY SERIES CCR Pediatric Oncology Series Recommendations for Childhood Cancer Screening and Surveillance in DNA Repair Disorders Michael F. Walsh1, Vivian Y. Chang2, Wendy K. Kohlmann3, Hamish S. Scott4, Christopher Cunniff5, Franck Bourdeaut6, Jan J. Molenaar7, Christopher C. Porter8, John T. Sandlund9, Sharon E. Plon10, Lisa L. Wang10, and Sharon A. Savage11 Abstract DNA repair syndromes are heterogeneous disorders caused by around the world to discuss and develop cancer surveillance pathogenic variants in genes encoding proteins key in DNA guidelines for children with cancer-prone disorders. Herein, replication and/or the cellular response to DNA damage. The we focus on the more common of the rare DNA repair dis- majority of these syndromes are inherited in an autosomal- orders: ataxia telangiectasia, Bloom syndrome, Fanconi ane- recessive manner, but autosomal-dominant and X-linked reces- mia, dyskeratosis congenita, Nijmegen breakage syndrome, sive disorders also exist. The clinical features of patients with DNA Rothmund–Thomson syndrome, and Xeroderma pigmento- repair syndromes are highly varied and dependent on the under- sum. Dedicated syndrome registries and a combination of lying genetic cause. Notably, all patients have elevated risks of basic science and clinical research have led to important in- syndrome-associated cancers, and many of these cancers present sights into the underlying biology of these disorders. Given the in childhood. Although it is clear that the risk of cancer is rarity of these disorders, it is recommended that centralized increased, there are limited data defining the true incidence of centers of excellence be involved directly or through consulta- cancer and almost no evidence-based approaches to cancer tion in caring for patients with heritable DNA repair syn- surveillance in patients with DNA repair disorders.
    [Show full text]
  • Fanconi Anemia, Bloom Syndrome and Breast Cancer
    A multiprotein complex in DNA damage response network of Fanconi anemia, Bloom syndrome and Breast cancer Weidong Wang Lab of Genetics, NIA A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia Bloom Syndrome . Genomic Instability: -sister-chromatid exchange . Cancer predisposition . Mutation in BLM, a RecQ DNA Helicase . BLM participates in: HR-dependent DSB repair Recovery of stalled replication forks . BLM works with Topo IIIa and RMI to Suppress crossover recombination Courtesy of Dr. Ian Hickson A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia P I l o r t n o BLM IP kDa C HeLa BLAP 250 Nuclear Extract 200- BLM* FANCA* 116- TOPO IIIα* 97- BLAP 100 MLH1* BLM IP BLAP 75 * 66- RPA 70 IgG H 45- * 30- RPA32 IgG L 20- * 12- RPA14 Meetei et al. MCB 2003 A Multi-protein Complex Connects Two Genomic Instability Diseases: Bloom Syndrome and Fanconi Anemia P I A C N A F BLM IP HeLa FANCM= FAAP 250 BLAP 250 Nuclear Extract BLM* BLM* * FANCA* FANCA TOPO IIIα* TOPO IIIα* FAAP 100 BLAP 100 FANCB= FAAP 95 MLH1 FANCA IP BLM IP BLAP 75 BLAP 75 RPA70*/FANCG* RPA 70* FANCC*/FANCE* IgG H FANCL= FAAP 43 FANCF* RPA32* IgG L Meetei et al. MCB 2003 Meetei et al. Nat Genet. 2003, 2004, 2005 BRAFT-a Multisubunit Machine that Maintains Genome Stability and is defective in Fanconi anemia and Bloom syndrome BRAFT Super-complex Fanconi Anemia Bloom Syndrome Core Complex Complex 12 polypeptides 7 polypeptides FANCA BLM Helicase (HJ, fork, D-loop), fork FANCC regression, dHJ dissolution Topo IIIα Topoisomerase, FANCE dHJ dissolution FANCF BLAP75 RMI1 FANCG Stimulates dHJ dissolution.
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • Epigenetic Regulation of DNA Repair Genes and Implications for Tumor Therapy ⁎ ⁎ Markus Christmann , Bernd Kaina
    Mutation Research-Reviews in Mutation Research xxx (xxxx) xxx–xxx Contents lists available at ScienceDirect Mutation Research-Reviews in Mutation Research journal homepage: www.elsevier.com/locate/mutrev Review Epigenetic regulation of DNA repair genes and implications for tumor therapy ⁎ ⁎ Markus Christmann , Bernd Kaina Department of Toxicology, University of Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany ARTICLE INFO ABSTRACT Keywords: DNA repair represents the first barrier against genotoxic stress causing metabolic changes, inflammation and DNA repair cancer. Besides its role in preventing cancer, DNA repair needs also to be considered during cancer treatment Genotoxic stress with radiation and DNA damaging drugs as it impacts therapy outcome. The DNA repair capacity is mainly Epigenetic silencing governed by the expression level of repair genes. Alterations in the expression of repair genes can occur due to tumor formation mutations in their coding or promoter region, changes in the expression of transcription factors activating or Cancer therapy repressing these genes, and/or epigenetic factors changing histone modifications and CpG promoter methylation MGMT Promoter methylation or demethylation levels. In this review we provide an overview on the epigenetic regulation of DNA repair genes. GADD45 We summarize the mechanisms underlying CpG methylation and demethylation, with de novo methyl- TET transferases and DNA repair involved in gain and loss of CpG methylation, respectively. We discuss the role of p53 components of the DNA damage response, p53, PARP-1 and GADD45a on the regulation of the DNA (cytosine-5)- methyltransferase DNMT1, the key enzyme responsible for gene silencing. We stress the relevance of epigenetic silencing of DNA repair genes for tumor formation and tumor therapy.
    [Show full text]
  • Posttranslational Regulation of the Fanconi Anemia Cancer Susceptibility Pathway
    DNA repair interest group 04/21/15 Posttranslational Regulation of the Fanconi Anemia Cancer Susceptibility Pathway Assistant professor Department of Pharmacological Sciences Stony Brook University Hyungjin Kim, Ph.D. DNA Repair System Preserves Genome Stability DNA DAMAGE X-rays DNA DAMAGE Oxygen radicals UV light X-rays RESPONSE Alkylating agents Polycyclic aromatic Anti-tumor agents Replication Spontaneous reactions hydrocarbons (cisplatin, MMC) errors Cell-cycle arrest Cell death Uracil DNA REPAIR Abasic site (6-4)PP Interstrand cross-link Base pair mismatch DEFECT 8-Oxiguanine Bulky adduct Double-strand break Insertion/deletion Single-strand break CPD Cancer • Mutations • Chromosome Base- Nucleotide- Fanconi anemia (FA) aberrations Mismatch excision repair excision repair pathway repair (BER) (NER) HR/NHEJ DNA REPAIR Adapted from Hoeijmakers (2001) Nature DNA Repair Mechanism as a Tumor Suppressor Network Cancer is a disease of DNA repair Environmental Mutagen Oncogenic Stress • Hereditary cancers: mutations in DNA repair genes (BRCA1, BRCA2, MSH2, etc) DNA damage response Checkpoint, • Sporadic cancers: DNA repair - Oncogene-induced replication stress - Inaccurate DNA repair caused by selection of somatic mutations in DNA repair genes Tumorigenesis Genome instability Germ-line and Somatic Disruption of DNA Repair Is Prevalent in Cancer The Cancer Genome Atlas (TCGA): Genomic characterization and sequence analysis of various tumors from patient samples TCGA network, (2011) Nature Clinical and Cellular Features of Fanconi Anemia (FA)
    [Show full text]
  • Evolutionary Genomics of Human Intellectual Disability Bernard Crespi,1 Kyle Summers2 and Steve Dorus3
    Evolutionary Applications ISSN 1752-4571 ORIGINAL ARTICLE Evolutionary genomics of human intellectual disability Bernard Crespi,1 Kyle Summers2 and Steve Dorus3 1 Department of Biosciences, Simon Fraser University, Burnaby, BC, Canada 2 Department of Biology, East Carolina University, Greenville, NC, USA 3 Department of Biology and Biochemistry, University of Bath, Bath, UK Keywords Abstract genetic, genomic, intellectual disability, positive selection. Previous studies have postulated that X-linked and autosomal genes underlying human intellectual disability may have also mediated the evolution of human Correspondence cognition. We have conducted the first comprehensive assessment of the extent Dr Bernard Crespi, Department of Biological and patterns of positive Darwinian selection on intellectual disability genes in Sciences, 8888 University Drive, Simon Fraser humans. We report three main findings. First, as noted in some previous University, Burnaby, BC V5A 1S6, Canada. reports, intellectual disability genes with primary functions in the central ner- Tel.: 778 782-3533; fax: 778 782-3496; e-mail: [email protected] vous system exhibit a significant concentration to the X chromosome. Second, there was no evidence for a higher incidence of recent positive selection on Received: 20 July 2009 X-linked than autosomal intellectual disability genes, nor was there a higher Accepted: 28 July 2009 incidence of selection on such genes overall, compared to sets of control genes. First published online: 7 September 2009 However, the X-linked intellectual disability genes inferred to be subject to recent positive selection were concentrated in the Rho GTP-ase pathway, a key doi:10.1111/j.1752-4571.2009.00098.x signaling pathway in neural development and function.
    [Show full text]
  • Overexpression of the Fanconi Anemia a Gene in Hela and MCF10A Cells
    Korean J Hematol Vol. 41, No. 1, March, 2006 □ Original Article □ Overexpression of the Fanconi Anemia A Gene in Hela and MCF10A Cells Woo Hyun Park, Ph.D. Department of Physiology, Chonbuk National University Medical School, Jeonju, Korea Background: Fanconi Anemia (FA) is an autosomal recessive inherited disease, which is characterized by developmental abnormalities, progressive bone marrow failure and a predisposition to cancer. The phenotypes of FA cells show extreme sensitivities towards oxygen and DNA cross linking agents, such as diepoxybutane and mitomycin C (MMC). Methods: In the current study, retroviruses expressing the FANCA gene were prepared to create the stable cell lines, Hela (cervical carcinoma) and MCF10A (breast). The expression of FANCA protein in the Hela and MCF10A stable cells, following puromycin selection, was checked using Western blot. The difference in the cell growth between the parent and FANCA expressing cells following MMC treatment was checked using the MTT assay. Results: The expression of exogenous FANCA protein in the Hela and MCF10A stable cells was observed using Western blot. The MCF10A cells expressing exogenous FANCA were resistant to MMC concentrations with the range 0.01～1µM compared with the MCF10 parent cells. However, at an MMC concentration of 10µM, there was no difference in the susceptibility between the parent and FANCA expressing MCF10 cells. The Hela cells expressing FANCA showed no resistance at any MMC con- centration (0.01～10µM). Conclusion: FANCA protein is an important factor for
    [Show full text]
  • Distinct Roles of BRCA2 in Replication Fork Protection in Response to Hydroxyurea and DNA Interstrand Cross-Links
    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Distinct roles of BRCA2 in replication fork protection in response to hydroxyurea and DNA interstrand cross-links Kimberly A. Rickman,1 Raymond J. Noonan,1 Francis P. Lach,1 Sunandini Sridhar,1 Anderson T. Wang,1,5 Avinash Abhyankar,2 Athena Huang,1 Michael Kelly,3 Arleen D. Auerbach,4 and Agata Smogorzewska1 1Laboratory of Genome Maintenance, The Rockefeller University, New York, New York 10065, USA; 2New York Genome Center, New York, New York 10013, USA; 3Tufts Medical Center, Boston, Massachusetts 02111, USA; 4Human Genetics and Hematology, The Rockefeller University, New York, New York 10065, USA DNA interstrand cross-links (ICLs) are a form of DNA damage that requires the interplay of a number of repair proteins including those of the Fanconi anemia (FA) and the homologous recombination (HR) pathways. Pathogenic variants in the essential gene BRCA2/FANCD1, when monoallelic, predispose to breast and ovarian cancer, and when biallelic, result in a severe subtype of Fanconi anemia. BRCA2 function in the FA pathway is attributed to its role as a mediator of the RAD51 recombinase in HR repair of programmed DNA double-strand breaks (DSB). BRCA2 and RAD51 functions are also required to protect stalled replication forks from nucleolytic degradation during re- sponse to hydroxyurea (HU). While RAD51 has been shown to be necessary in the early steps of ICL repair to prevent aberrant nuclease resection, the role of BRCA2 in this process has not been described. Here, based on the analysis of BRCA2 DNA-binding domain (DBD) mutants (c.8488-1G>A and c.8524C>T) discovered in FA patients presenting with atypical FA-like phenotypes, we establish that BRCA2 is necessary for the protection of DNA at ICLs.
    [Show full text]
  • Fanca Deficiency Reduces A/T Transitions in Somatic Hypermutation and Alters Class Switch Recombination Junctions in Mouse B Cells
    Brief Definitive Report Fanca deficiency reduces A/T transitions in somatic hypermutation and alters class switch recombination junctions in mouse B cells Thuy Vy Nguyen,1,2,3 Lydia Riou,2,4 Saïd Aoufouchi,1,2 and Filippo Rosselli1,2,3 1Centre National de la Recherche Scientifique UMR 8200, Institut Gustave Roussy, 94805 Villejuif, France 2Université Paris Sud, 91400 Orsay, France 3Programme Equipe Labellisées, Ligue Contre le Cancer, 75013 Paris, France 4Laboratoire de Radiopathologie, Service Cellules Souches et Radiation, Institut de Radiobiologie Cellulaire et Moléculaire, Direction des Sciences du Vivant, Commissariat à L’énergie Atomique et aux Énergies Alternatives, Institut National de la Santé et de la Recherche Médicale U967, 92265 Fontenay-aux-Roses, France Fanconi anemia is a rare genetic disorder that can lead to bone marrow failure, congenital abnormalities, and increased risk for leukemia and cancer. Cells with loss-of-function mutations in the FANC pathway are characterized by chromosome fragility, altered muta- bility, and abnormal regulation of the nonhomologous end-joining (NHEJ) pathway. So- matic hypermutation (SHM) and immunoglobulin (Ig) class switch recombination (CSR) enable B cells to produce high-affinity antibodies of various isotypes. Both processes are initiated after the generation of dG:dU mismatches by activation-induced cytidine deami- nase. Whereas SHM involves an error-prone repair process that introduces novel point mutations into the Ig gene, the mismatches generated during CSR are processed to create double-stranded breaks (DSBs) in DNA, which are then repaired by the NHEJ pathway. As several lines of evidence suggest a possible role for the FANC pathway in SHM and CSR, we analyzed both processes in B cells derived from Fanca/ mice.
    [Show full text]
  • Supplemental Table 1: Snps Genotyped for NCO, Listed Alphabetically by Gene Name
    Supplemental Table 1: SNPs genotyped for NCO, listed alphabetically by gene name. Gene Name SNP rs# ACVR1 rs10497189 ACVR1 rs10497191 ACVR1 rs10497192 ACVR1 rs10933441 ACVR1 rs1146035 ACVR1 rs1220110 ACVR1 rs17182166 ACVR1 rs17798043 ACVR1 rs4380178 ACVR1 rs6719924 ACVR2 rs1128919 ACVR2 rs10497025 ACVR2 rs1424941 ACVR2 rs1424954 ACVR2 rs17742573 ACVR2 rs2382112 ACVR2 rs4419186 AKT2 rs11671439 AKT2 rs12460555 AKT2 rs16974157 AKT2 rs2304188 AKT2 rs3730050 AKT2 rs7250897 AKT2 rs7254617 AKT2 rs874269 ALOX12B/ALOXE3 rs3809881 ALOX15B rs4792147 ALOX15B rs9898751 AMH rs10407022 AMH rs2074860 AMH rs3746158 AMH rs4806834 AMH rs757595 AMH rs886363 AMHR2 rs10876451 AMHR2 rs11170547 AMHR2 rs11170558 APC rs2229992 APC rs351771 APC rs41115 APC rs42427 APC rs459552 APC rs465899 APEX1 rs2275007 APEX1 rs3136820 15 APEX1 rs938883 APEX1 rs11160711 APEX1 rs1713459 APEX1 rs1713460 APEX1 rs1760941 APEX1 rs2275008 APEX1 rs3120073 APEX1 rs4465523 AR rs12011793 AR rs1204038 AR rs1337080 AR rs1337082 AR rs2207040 AR rs2361634 AR rs5031002 AR rs6152 AR rs962458 ATM rs1800058 ATM rs1800889 ATM rs11212570 ATM rs17503908 ATM rs227060 ATM rs228606 ATM rs3092991 ATM rs4987876 ATM rs4987886 ATM rs4987923 ATM rs4988023 ATM rs611646 ATM rs639923 ATM rs672655 ATR rs2229032 ATR rs10804682 ATR rs11920625 ATR rs13065800 ATR rs13085998 ATR rs13091637 ATR rs1802904 ATR rs6805118 ATR rs9856772 BACH1 rs388707 BACH1 rs1153276 BACH1 rs1153280 BACH1 rs1153284 BACH1 rs1153285 BACH1 rs17743655 BACH1 rs17744121 BACH1 rs2300301 BACH1 rs2832283 16 BACH1 rs411697 BACH1 rs425989 BARD1 rs1048108
    [Show full text]
  • Spectrum of Mutations in the Fanconi Anaemia Group G Gene, FANCG/XRCC9
    European Journal of Human Genetics (2000) 8, 861–868 © 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00 y www.nature.com/ejhg ARTICLE Spectrum of mutations in the Fanconi anaemia group G gene, FANCG/XRCC9 Ilja Demuth1, Marcin Wlodarski1, Alex J Tipping2, Neil V Morgan2, Johan P de Winter3, Michaela Thiel4, Sonja Gr¨asl4, Detlev Schindler4, Alan D D’Andrea5, Cigdem Altay6, H¨ulya Kayserili7, Adriana Zatterale8, J¨urgen Kunze1, Wolfram Ebell9, Christopher G Mathew2, Hans Joenje3, Karl Sperling1 and Martin Digweed1 1Institute of Human Genetics, Charit´e, Campus Virchow, Humboldt University, Berlin, Germany; 2Division of Medical and Molecular Genetics, Guy’s, King’s and St Thomas’ School of Medicine, London, UK; 3Department of Clinical Genetics and Human Genetics, Free University Medical Center, Amsterdam, The Netherlands; 4Institute of Human Genetics, University of W¨urzburg, Germany; 5Department of Pediatric Oncology, Dana-Faber Cancer Institute, Boston, USA; 6Department of Pediatrics, Hematology Unit, Hacettepe University, Ankara; 7Institute of Child Health, Istanbul, Turkey; 8Servizio di Citogenetica, Ospetale Elena d’Aosta, Napoli, Italy; 9Children’s Hospital, Charit´e, Campus Virchow, Humboldt University, Berlin, Germany FANCG was the third Faconi anaemia gene identified and proved to be identical to the previously cloned XRCC9 gene. We present the pathogenic mutations and sequence variants we have so far identified in a panel of FA-G patients. Mutation screening was performed by PCR, single strand conformational polymorphism analysis and protein truncation tests. Altogether 18 mutations have been determined in 20 families – 97% of all expected mutant alleles. All mutation types have been found, with the exception of large deletions, the large majority is predicted to lead to shortened proteins.
    [Show full text]