DOCSLIB.ORG

Download Download

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Download PLATINUM The Journal of Threatened Taxa (JoTT) is dedicated to building evidence for conservaton globally by publishing peer-reviewed artcles OPEN ACCESS online every month at a reasonably rapid rate at www.threatenedtaxa.org. All artcles published in JoTT are registered under Creatve Commons Atributon 4.0 Internatonal License unless otherwise mentoned. JoTT allows unrestricted use, reproducton, and distributon of artcles in any medium by providing adequate credit to the author(s) and the source of publicaton. Journal of Threatened Taxa Building evidence for conservaton globally www.threatenedtaxa.org ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) Communication Morphological and molecular phylogenetic studies on Battarrea phalloides (Agaricales): a new report to Indian mycobiota R. Kantharaja & M. Krishnappa 26 May 2020 | Vol. 12 | No. 8 | Pages: 15881–15888 DOI: 10.11609/jot.5679.12.8.15881-15888 For Focus, Scope, Aims, Policies, and Guidelines visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-0 For Artcle Submission Guidelines, visit htps://threatenedtaxa.org/index.php/JoTT/about/submissions#onlineSubmissions For Policies against Scientfc Misconduct, visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-2 For reprints, contact <[email protected]> The opinions expressed by the authors do not refect the views of the Journal of Threatened Taxa, Wildlife Informaton Liaison Development Society, Zoo Outreach Organizaton, or any of the partners. The journal, the publisher, the host, and the part- Publisher & Host ners are not responsible for the accuracy of the politcal boundaries shown in the maps by the authors. Member Threatened Taxa Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2020 | 12(8): 15881–15888 ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) PLATINUM OPEN ACCESS DOI: htps://doi.org/10.11609/jot.5679.12.8.15881-15888 #5679 | Received 03 January 2020 | Final received 13 April 2020 | Finally accepted 03 May 2020 C o m Morphological and molecular phylogenetc studies on Batarrea phalloides m u (Agaricales): a new report to Indian mycobiota n i c R. Kantharaja 1 & M. Krishnappa 2 a t i 1, 2 Department of PG Studies and Research in Botany, Kuvempu University, Jnana Sahyadri, Shankaraghata, Shivamogga, o Karnataka 577451, India. n 1 [email protected] (corresponding author),2 [email protected] Abstract: The Scaly-stalked Pufall Batarrea phalloides (Dicks.) Pers. is recorded for the frst tme in India. The fungus is reported from many countries across the contnents and typically uncommon and rare in all regions. It is Red Listed in most of the European countries and is under assessment in IUCN Global Fungal Red List Initatve. The Indian sample of B. phalloides is reported from Kadur Taluk of Chikkamagaluru District, Karnataka with morpho-molecular data. Keywords: Elaters, Morpho-molecular, nrITS, Red List, Scaly-stalked Pufall. Editor: R.K. Verma, Tropical Forest Research Insttute, Jabalpur, India. Date of publicaton: 26 May 2020 (online & print) Citaton: Kantharaja, R. & M. Krishnappa (2020). Morphological and molecular phylogenetc studies on Batarrea phalloides (Agaricales): a new report to Indian mycobiota. Journal of Threatened Taxa 12(8): 15881–15888. htps://doi.org/10.11609/jot.5679.12.8.15881-15888 Copyright: © Kantharaja & Krishnappa 2020. Creatve Commons Atributon 4.0 Internatonal License. JoTT allows unrestricted use, reproducton, and distributon of this artcle in any medium by providing adequate credit to the author(s) and the source of publicaton. Funding: Department of Science and Technology - Science and Engineering Research Board (DST - SERB), Government of India. Competng interests: The authors declare no competng interests. Author details: R. Kantharaja is a research scholar in the Department of Botany. Kuvempu University. Jnana Sahyadri. Shankaraghata. Currently working on morpho - molecular systematcs of Agaricales in Central Western Ghats region of Karnataka. India. Dr. M. Krishnappa is a mycologist and Professor in Department of Botany. Kuvempu University. Jnana Sahyadri. Shankaraghata. Whose research mainly focuses on fungal diversity and biology, fungal taxonomy, endophytc fungi and fungal diseases of plants. Since 20 years he is working on macrofungi and honored as Fellow of Mycological Society of India for the year 2014. He has over 130 research publicatons in diferent thrust areas of life science. Author contributon: RK carried out the research work, wrote the artcle. MK guided in every step and corrected mistakes in the artcle. Acknowledgements: We acknowledge the support from the Department of Botany, Kuvempu University, Shankaraghata, Karnataka to carry out the research and also the Department of Science and Technology, Science and Engineering Research Board (DST-SERB), Government of India for the fnancial support through a project grant (EEQ/2016/000363). 15881 J TT Morpho-molecular studies on Batarrea phalloides Kantharaja & Krishnappa INTRODUCTION by Martn & Johannesson (2000), Martn et al. (2013) and Jeferies & McLain (2014), the shreds of evidence Batarrea phalloides (Sandy Stlt Ball, Sandy Stlt suggest both taxa are conspecifc. In additon, Martn Pufall, Scaly-stalked Pufall), previously known & Johannesson (2000) considered spore ornamentaton gasteromycete in Batarreaceae (Corda 1842), and now as a non-molecular character for lineage recogniton and a distnctve saprobic basidiomycetous agaric fungus, depicted three main lineages phylogenetcally, they have easily recognizable with a scaly lacerated stem growing diferences in their spore ornamentaton as—(a) spores up to 40cm in height, forming a reddish-brown spore with anastomosing truncate ridges, (b) fnely verrucose, case inside a thin greyish skin. It is rare, uncommon and and (c) fnely retculate. occurs in small scatered populatons or sometmes even The present study describes B. phalloides as a new appears as single basidiomata. report to Indian mycobiota based on morphological Batarrea phalloides is red-listed in several European characters and multgene phylogenetc analysis. countries and is one of the non-lichenized fungi aforded legal protecton by being included in schedule 8 of Materials and Methods the Wildlife and Countryside Act, 1981 in the United The Scaly-stalked Pufall like basidiomata of Kingdom (Jefries & McLain 2004). The species is Batarrea phalloides were collected from Aladahalli currently under assessment for additon to the IUCN: Village (13.546N & 75.875E) of Kadur Taluk (Figure 1), The Global Fungal Red List Initatve (htp://iucn.ekoo. Western Ghats region of Karnataka during July 2019. se/iucn/species_view/159853). Sixteen species have been described in the genus Sampling and morphological characterizaton Batarrea Pers. since 1801 (Index Fungorum, htp:// The sporomas of diferent stages were collected www.indexfungorum.org/) and most of them are and phenotypic characters were recorded using a feld conspecifc to Batarrea phalloides. Early taxonomic key (Atri et al. 2017). Microscopic characters were discussions about the worthiness of morphological recorded using a light microscope (Olympus CH20i) characters for separatng B. phalloides and B. stevenii and the sporocarps were shade-dried and stored in the were evaluated using modern phylogenetc approach Department of Botany, Kuvempu University for further Figure 1. Geographic locaton of Batarrea phalloides 15882 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2020 | 12(8): 15881–15888 J TT Morpho-molecular studies on Batarrea phalloides Kantharaja & Krishnappa Table 1. List of primers utlized to amplify nrITS and nrLSU gene sequences obtained from Eurofns Genomics India Pvt. sequences. Ltd. Bengaluru were checked and trimmed using MEGA Amplifying X (Kumar et al. 2018). Consensus sequences were Primer Sequence Tm [°C] gene generated using BioEdit sequence alignment editor 1 ITS 1 TCCGTAGGTGAACCTTGCGG 60.99 nrITS v.7.2.5 (Hall, CA) by Clustal W (Madeira et al. 2019). 2 ITS 4 TCCTCCGCTTATTGATATGC 55.25 BLAST search in the GenBank (htps://blast.ncbi.nlm.nih. 3 LROR ACCCGCTGAACTTAAGC 52.77 nrLSU gov/Blast.cgi) nucleotde database to identfy the related 4 LR5 TCCTGAGGGAAACTTCG 52.77 taxa by sequence similarity and both nrITS and nrLSU sequences were deposited to GenBank with accession numbers MN450310 and MN700164, respectvely. studies (Image 1). To identfy the surface ornamentaton Molecular phylogenetc analysis was performed by of spores, scanning electron microscopy was carried out using nrITS and nrLSU sequences separately. Datasets in ZEISS EVO CSEM. of 17 nrITS sequences (Table 2) and 15 nrLSU sequences (Table 3) including those retrieved from the NCBI DNA Extracton, PCR and Phylogenetc analysis GenBank are used to assess the alignment confdence The total genomic DNA was extracted from the score in the GUIDANCE web server (htp://guidance. freshly collected sporocarp using the CTAB method tau.ac.il) by MAFFT algorithm (Katoh et al. 2019) to (Doyle & Doyle 1987) with modifcatons. 100mg of construct 100 alternatve guide trees. Using GUIDANCE inner stpe tssue was directly homogenized with 500µl outputs the columns showing less than 93% confdence of 2X CTAB extracton bufer pre-warmed to 65°C in a scores are removed and aligned in BioEdit v.7.2.5. 1.5ml microcentrifuge tube with the help of micro- The alignment fle obtained is further used to analyze pestle, followed by vortexing and incubated in a water the maximum likelihood in RAxML GUI v.2.0.0.0 using bath at 65°C for
Load more

Recommended publications
  • Universidad De Concepción Facultad De Ciencias Naturales Y
    Universidad de Concepción Facultad de Ciencias Naturales y Oceanográficas Programa de Magister en Ciencias mención Botánica DIVERSIDAD DE MACROHONGOS EN ÁREAS DESÉRTICAS DEL NORTE GRANDE DE CHILE Tesis presentada a la Facultad de Ciencias Naturales y Oceanográficas de la Universidad de Concepción para optar al grado de Magister en Ciencias mención Botánica POR: SANDRA CAROLINA TRONCOSO ALARCÓN Profesor Guía: Dr. Götz Palfner Profesora Co-Guía: Dra. Angélica Casanova Mayo 2020 Concepción, Chile AGRADECIMIENTOS Son muchas las personas que han contribuido durante el proceso y conclusión de este trabajo. En primer lugar quiero agradecer al Dr. Götz Palfner, guía de esta tesis y mi profesor desde el año 2014 y a la Dra. Angélica Casanova, quienes con su experiencia se han esforzado en enseñarme y ayudarme a llegar a esta instancia. A mis compañeros de laboratorio, Josefa Binimelis, Catalina Marín y Cristobal Araneda, por la ayuda mutua y compañía que nos pudimos brindar en el laboratorio o durante los viajes que se realizaron para contribuir a esta tesis. A CONAF Atacama y al Proyecto RT2716 “Ecofisiología de Líquenes Antárticos y del desierto de Atacama”, cuyas gestiones o financiamientos permitieron conocer un poco más de la diversidad de hongos y de los bellos paisajes de nuestro desierto chileno. Agradezco al Dr. Pablo Guerrero y a todas las personas que enviaron muestras fúngicas desertícolas al Laboratorio de Micología para identificarlas y que fueron incluidas en esta investigación. También agradezco a mi familia, mis padres, hermanos, abuelos y tíos, que siempre me han apoyado y animado a llevar a cabo mis metas de manera incondicional.
    [Show full text]
  • Qrno. 1 2 3 4 5 6 7 1 CP 2903 77 100 0 Cfcl3
    QRNo. General description of Type of Tariff line code(s) affected, based on Detailed Product Description WTO Justification (e.g. National legal basis and entry into Administration, modification of previously the restriction restriction HS(2012) Article XX(g) of the GATT, etc.) force (i.e. Law, regulation or notified measures, and other comments (Symbol in and Grounds for Restriction, administrative decision) Annex 2 of e.g., Other International the Decision) Commitments (e.g. Montreal Protocol, CITES, etc) 12 3 4 5 6 7 1 Prohibition to CP 2903 77 100 0 CFCl3 (CFC-11) Trichlorofluoromethane Article XX(h) GATT Board of Eurasian Economic Import/export of these ozone destroying import/export ozone CP-X Commission substances from/to the customs territory of the destroying substances 2903 77 200 0 CF2Cl2 (CFC-12) Dichlorodifluoromethane Article 46 of the EAEU Treaty DECISION on August 16, 2012 N Eurasian Economic Union is permitted only in (excluding goods in dated 29 may 2014 and paragraphs 134 the following cases: transit) (all EAEU 2903 77 300 0 C2F3Cl3 (CFC-113) 1,1,2- 4 and 37 of the Protocol on non- On legal acts in the field of non- _to be used solely as a raw material for the countries) Trichlorotrifluoroethane tariff regulation measures against tariff regulation (as last amended at 2 production of other chemicals; third countries Annex No. 7 to the June 2016) EAEU of 29 May 2014 Annex 1 to the Decision N 134 dated 16 August 2012 Unit list of goods subject to prohibitions or restrictions on import or export by countries- members of the
    [Show full text]
  • Diversity, Nutritional Composition and Medicinal Potential of Indian Mushrooms: a Review
    Vol. 13(4), pp. 523-545, 22 January, 2014 DOI: 10.5897/AJB2013.13446 ISSN 1684-5315 ©2014 Academic Journals African Journal of Biotechnology http://www.academicjournals.org/AJB Review Diversity, nutritional composition and medicinal potential of Indian mushrooms: A review Hrudayanath Thatoi* and Sameer Kumar Singdevsachan Department of Biotechnology, College of Engineering and Technology, Biju Patnaik University of Technology, Bhubaneswar-751003, Odisha, India. Accepted 2 January, 2014 Mushrooms are the higher fungi which have long been used for food and medicinal purposes. They have rich nutritional value with high protein content (up to 44.93%), vitamins, minerals, fibers, trace elements and low calories and lack cholesterol. There are 14,000 known species of mushrooms of which 2,000 are safe for human consumption and about 650 of these possess medicinal properties. Among the total known mushrooms, approximately 850 species are recorded from India. Many of them have been used in food and folk medicine for thousands of years. Mushrooms are also sources of bioactive substances including antibacterial, antifungal, antiviral, antioxidant, antiinflammatory, anticancer, antitumour, anti-HIV and antidiabetic activities. Nutriceuticals and medicinal mushrooms have been used in human health development in India as food, medicine, minerals among others. The present review aims to update the current status of mushrooms diversity in India with their nutritional and medicinal potential as well as ethnomedicinal uses for different future prospects in pharmaceutical application. Key words: Mushroom diversity, nutritional value, therapeutic potential, bioactive compound. INTRODUCTION Mushroom is a general term used mainly for the fruiting unexamined mushrooms will be only 5%, implies that body of macrofungi (Ascomycota and Basidiomycota) there are 7,000 yet undiscovered species, which if and represents only a short reproductive stage in their life discovered will be provided with the possible benefit to cycle (Das, 2010).
    [Show full text]
  • A Unique Signal Distorts the Perception of Species Richness
    Microb Ecol DOI 10.1007/s00248-013-0266-4 SHORT COMMENTARY A Unique Signal Distorts the Perception of Species Richness and Composition in High-Throughput Sequencing Surveys of Microbial Communities: a Case Study of Fungi in Indoor Dust Rachel I. Adams & Anthony S. Amend & John W. Taylor & Thomas D. Bruns Received: 24 January 2013 /Accepted: 8 July 2013 # The Author(s) 2013. This article is published with open access at Springerlink.com Abstract Sequence-based surveys of microorganisms in sequenced to an even depth. Next, we used in silico manip- varied environments have found extremely diverse assem- ulations of the observed data to confirm that a unique signa- blages. A standard practice in current high-throughput se- ture can be identified with HTS approaches when the source quence (HTS) approaches in microbial ecology is to se- is abundant, whether or not the taxon identity is distinct. quence the composition of many environmental samples at Lastly, aerobiology of indoor fungi is discussed. once by pooling amplicon libraries at a common concentra- tion before processing on one run of a sequencing platform. Biomass of the target taxa, however, is not typically deter- mined prior to HTS, and here, we show that when abun- Introduction dances of the samples differ to a large degree, this standard practice can lead to a perceived bias in community richness Use of high-throughput sequencing (HTS) has transformed and composition. Fungal signal in settled dust of five uni- the field of microbial ecology. Traditionally, sampling depth, versity teaching laboratory classrooms, one of which was defined both in terms of the number of samples and intensity used for a mycology course, was surveyed.
    [Show full text]
  • Download Download
    LITERATURE UPDATE FOR TEXAS FLESHY BASIDIOMYCOTA WITH NEW VOUCHERED RECORDS FOR SOUTHEAST TEXAS David P. Lewis Clark L. Ovrebo N. Jay Justice 262 CR 3062 Department of Biology 16055 Michelle Drive Newton, Texas 75966, U.S.A. University of Central Oklahoma Alexander, Arkansas 72002, U.S.A. [email protected] Edmond, Oklahoma 73034, U.S.A. [email protected] [email protected] ABSTRACT This is a second paper documenting the literature records for Texas fleshy basidiomycetous fungi and includes both older literature and recently published papers. We report 80 literature articles which include 14 new taxa described from Texas. We also report on 120 new records of fleshy basdiomycetous fungi collected primarily from southeast Texas. RESUMEN Este es un segundo artículo que documenta el registro de nuevas especies de hongos carnosos basidiomicetos, incluyendo artículos antiguos y recientes. Reportamos 80 artículos científicamente relacionados con estas especies que incluyen 14 taxones con holotipos en Texas. Así mismo, reportamos unos 120 nuevos registros de hongos carnosos basidiomicetos recolectados primordialmente en al sureste de Texas. PART I—MYCOLOGICAL LITERATURE ON TEXAS FLESHY BASIDIOMYCOTA Lewis and Ovrebo (2009) previously reported on literature for Texas fleshy Basidiomycota and also listed new vouchered records for Texas of that group. Presented here is an update to the listing which includes literature published since 2009 and also includes older references that we previously had not uncovered. The authors’ primary research interests center around gilled mushrooms and boletes so perhaps the list that follows is most complete for the fungi of these groups. We have, however, attempted to locate references for all fleshy basidio- mycetous fungi.
    [Show full text]
  • A Note on Battarrea Phalloides in Turkey
    MANTAR DERGİSİ/The Journal of Fungus Nisan(2021)12(1)1-9 Geliş(Recevied) :26.09.2020 Research Article Kabul(Accepted) :12.11.2020 Doi: 10.30708.mantar.800585 A Note on Battarrea phalloides in Turkey 1*, 2 1 Ilgaz AKATA Deniz ALTUNTAŞ , Ergin ŞAHİN , Hakan ALLI3, ŞANLI KABAKTEPE4 *Corresponding author: [email protected] 1 Ankara University, Faculty of Science, Department of Biology, Ankara, Turkey Orcid ID: 0000-0002-1731-1302/ [email protected] Orcid ID: 0000-0003-1711-738X/ [email protected] 2Ankara University, Graduate School of Natural and Applied Sciences, Ankara, Turkey Orcid ID: 0000-0003-0142-6188/ [email protected] 3Muğla Sıtkı Koçman University, Faculty of Science, Department of Biology, Muğla, Turkey Orcid ID: 0000-0001-8781-7089/ [email protected] 4Malatya Turgut Ozal University, Battalgazi Vocat Sch., Battalgazi, Malatya, Turkey Orcid ID: 0000-0001-8286-9225/[email protected] Abstract: The current study was conducted based on a Battarrea sample obtained from Muğla province (Turkey). The sample was identified based on both conventional methods and ITS rDNA region-based molecular phylogeny. By taking into account the high sequence similarity between the sample (ANK Akata & Altuntaş 690) and Battarrea phalloides the relevant specimen was considered to be B. Phalloides and the morphological data also strengthen this finding. In this study, photos of macro and microscopic structures, a short description, scanning electron microscope (SEM) images of spores and elaters, and the ITS rDNA region-based molecular phylogeny of the samples were given. Also, the distribution of B. phalloides specimens identified thus far from Turkey was revealed for the first time in this study.
    [Show full text]
  • Antioxidants of Edible Mushrooms
    Molecules 2015, 20, 19489-19525; doi:10.3390/molecules201019489 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Review Antioxidants of Edible Mushrooms Maja Kozarski 1, Anita Klaus 2, Dragica Jakovljevic 3, Nina Todorovic 3, Jovana Vunduk 2, Predrag Petrović 4, Miomir Niksic 2, Miroslav M. Vrvic 3,5 and Leo van Griensven 6,* 1 Department for Chemistry and Biochemistry, Faculty of Agriculture, University of Belgrade, Nemanjina 6, Belgrade 11080, Serbia; E-Mail: [email protected] 2 Department for Industrial Microbiology, Faculty of Agriculture, University of Belgrade, Nemanjina 6, Belgrade 11080, Serbia; E-Mails: [email protected] (A.K.); [email protected] (J.V.); [email protected] (M.N.) 3 Institute of Chemistry, Technology and Metallurgy, University of Belgrade, Njegoseva 12, Belgrade 11001, Serbia; E-Mails: [email protected] (D.J.); [email protected] (N.T.); [email protected] (M.M.V.) 4 Institute of Chemical Engineering, Faculty of Technology and Metallurgy, University of Belgrade, Karnegijeva 4, Belgrade 11060, Serbia; E-Mail: [email protected] 5 Faculty of Chemistry, University of Belgrade, Studentski trg 12–16, Belgrade 11000, Serbia 6 Plant Research International, Wageningen University and Research Centre, Droevendaalsesteeg 1, Wageningen 6700 AA, The Netherlands * Author to whom correspondence should be addressed; E-Mail: [email protected] or [email protected]; Tel.: +31-748-0992; Fax: +31-741-8094. Academic Editor: David D. Kitts Received: 4 September 2015 / Accepted: 21 October 2015 / Published: 27 October 2015 Abstract: Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS) lead to a range of health disorders in humans.
    [Show full text]
  • SOP) for INTEGRATED PEST MANAGEMENT (IPM
    STANDARD OPERATING PROCEDURES (SOP) for INTEGRATED PEST MANAGEMENT (IPM) Version: 01; June, 2014 Dr. S. N. Sushil Plant Protection Advisor Dte. of PPQ&S, Faridabad June 5, 2014 Ram Asre Addl. PPA (IPM) Dte. of PPQ&S, Faridabad List of Contributors Technical guidance and Supervision: Dr. S. N. Sushil, Plant Protection Adviser & Ram Asre, Addl. Plant Protection Adviser (IPM) Sl. Chapter Contributors No. (1) Dr. V.K. Srivastava, JD (PP), HQ, Faridabad; Group Leader Standardization of FFS Curriculum, HRD; (2) Dr. Jasveer Singh, DD (E), HQ, Faridabad Orientation Training (2 1. (3) Sh. R. Murali, DD (E), HQ, Faridabad days), Refresher Training (5 days) and SLTP (long (4) Dr. G.P. Singh, AD (E), CIPMC, Gorakhpur duration) (5) Sh. Yogesh Kunwar, PPO (WS), HQ, Faridabad Conservation & (1) Sh. Ram Asre, APPA (IPM), HQ, Faridabad 2. A ugmentation of Bio- (2) Dr. C. S. Patni, PPO (PP), CIPMC, Faridabad control agents (1) Dr. K.S. Kapoor, DD (E); Co-ordinator, HQ, Faridabad Pests Surveillance & 3. Monitoring (2) Sh. P.K. Ghosh, AD (E), CIPMC, Kolkata (1) Dr. Shbhas Kumar, DD (WS), HQ, Faridabad Weed ecology and 4. (2) Sh. Arunabha Chakraborty, PPO (E), HQ, Faridabad Management (3) Sh. Yogesh Kunwar, PPO (WS), HQ, Faridabad (1) Dr. M. S. Akhtar, AD (E), CIPMC, Faridabad Member Secretary Laboratory Manual for 5. M ass Rearing of Bio- (2) Dr. Umesh Kumar, PPO (PP), CIPMC, Lucknow control agents (3) Dr. Navendu Nair, PPO (E), CIPMC, Agartala 6. C ompiled by (1) Dr. M. S. Akhtar, AD (E), CIPMC, Faridabad Member Secretary 7. Design & Layout (1) Sh.
    [Show full text]
  • Liste Rouge Des Espèces Menacées En Suisse: Champignons Supérieurs
    > L’environnement pratique > Listes rouges / Gestion des espèces 18 > Liste rouge 07 Champignons supérieurs Liste rouge des espèces menacées en Suisse Édition 2007 > L’environnement pratique > Listes rouges / Gestion des espèces > Liste rouge Champignons supérieurs Liste rouge des espèces menacées en Suisse Édition 2007 Auteurs: Beatrice Senn-Irlet, Guido Bieri, Simon Egli Publié par l’Office fédéral de l’environnement OFEV et par l’Institut fédéral de recherches sur la forêt, la neige et le paysage WSL Berne, 2007 Valeur juridique de cette publication Impressum Liste rouge de l’OFEV au sens de l’article 14, 3e alinéa de Éditeur l’ordonnance du 16 janvier 1991 sur la protection de la nature et du Office fédéral de l’environnement (OFEV), Berne paysage (RS 451.1) www.admin.ch/ch/f/sr/45.html Institut fédéral de recherches sur la forêt, la neige et le paysage (WSL), Birmensdorf ZH La présente publication est une aide à l’exécution élaborée par l’OFEV en tant qu’autorité de surveillance. Destinée en premier lieu Auteurs aux autorités d’exécution, elle concrétise des notions juridiques Beatrice Senn-Irlet, biodiversité et conservation biologique, WSL indéterminées provenant de lois et d’ordonnances et favorise ainsi Guido Bieri, wildbild une application uniforme de la législation. Si les autorités d’exécution Simon Egli, dynamique forestière, WSL en tiennent compte, elles peuvent partir du principe que leurs décisions seront conformes au droit fédéral. D’autres solutions sont Responsables aussi licites dans la mesure où elles sont conformes au droit en Francis Cordillot et Stephan Lussi, Division Gestion des espèces OFEV vigueur.
    [Show full text]
  • Fungal Genomes Tell a Story of Ecological Adaptations
    Folia Biologica et Oecologica 10: 9–17 (2014) Acta Universitatis Lodziensis Fungal genomes tell a story of ecological adaptations ANNA MUSZEWSKA Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5A, 02-106 Warsaw, Poland E-mail: [email protected] ABSTRACT One genome enables a fungus to have various lifestyles and strategies depending on environmental conditions and in the presence of specific counterparts. The nature of their interactions with other living and abiotic elements is a consequence of their osmotrophism. The ability to degrade complex compounds and especially plant biomass makes them a key component of the global carbon circulation cycle. Since the first fungal genomic sequence was published in 1996 mycology has benefited from the technolgical progress. The available data create an unprecedented opportunity to perform massive comparative studies with complex study design variants targeted at all cellular processes. KEY WORDS: fungal genomics, osmotroph, pathogenic fungi, mycorrhiza, symbiotic fungi, HGT Fungal ecology is a consequence of osmotrophy Fungi play a pivotal role both in encountered as leaf endosymbionts industry and human health (Fisher et al. (Spatafora et al. 2007). Since fungi are 2012). They are involved in biomass involved in complex relationships with degradation, plant and animal infections, other organisms, their ecological fermentation and chemical industry etc. repertoire is reflected in their genomes. They can be present in the form of The nature of their interactions with other resting spores, motile spores, amebae (in organisms and environment is defined by Cryptomycota, Blastocladiomycota, their osmotrophic lifestyle. Nutrient Chytrydiomycota), hyphae or fruiting acquisition and communication with bodies. The same fungal species symbionts and hosts are mediated by depending on environmental conditions secreted molecules.
    [Show full text]
  • A Preliminary Checklist of Arizona Macrofungi
    A PRELIMINARY CHECKLIST OF ARIZONA MACROFUNGI Scott T. Bates School of Life Sciences Arizona State University PO Box 874601 Tempe, AZ 85287-4601 ABSTRACT A checklist of 1290 species of nonlichenized ascomycetaceous, basidiomycetaceous, and zygomycetaceous macrofungi is presented for the state of Arizona. The checklist was compiled from records of Arizona fungi in scientific publications or herbarium databases. Additional records were obtained from a physical search of herbarium specimens in the University of Arizona’s Robert L. Gilbertson Mycological Herbarium and of the author’s personal herbarium. This publication represents the first comprehensive checklist of macrofungi for Arizona. In all probability, the checklist is far from complete as new species await discovery and some of the species listed are in need of taxonomic revision. The data presented here serve as a baseline for future studies related to fungal biodiversity in Arizona and can contribute to state or national inventories of biota. INTRODUCTION Arizona is a state noted for the diversity of its biotic communities (Brown 1994). Boreal forests found at high altitudes, the ‘Sky Islands’ prevalent in the southern parts of the state, and ponderosa pine (Pinus ponderosa P.& C. Lawson) forests that are widespread in Arizona, all provide rich habitats that sustain numerous species of macrofungi. Even xeric biomes, such as desertscrub and semidesert- grasslands, support a unique mycota, which include rare species such as Itajahya galericulata A. Møller (Long & Stouffer 1943b, Fig. 2c). Although checklists for some groups of fungi present in the state have been published previously (e.g., Gilbertson & Budington 1970, Gilbertson et al. 1974, Gilbertson & Bigelow 1998, Fogel & States 2002), this checklist represents the first comprehensive listing of all macrofungi in the kingdom Eumycota (Fungi) that are known from Arizona.
    [Show full text]
  • The Macrofungi Checklist of Liguria (Italy): the Current Status of Surveys
    Posted November 2008. Summary published in MYCOTAXON 105: 167–170. 2008. The macrofungi checklist of Liguria (Italy): the current status of surveys MIRCA ZOTTI1*, ALFREDO VIZZINI 2, MIDO TRAVERSO3, FABRIZIO BOCCARDO4, MARIO PAVARINO1 & MAURO GIORGIO MARIOTTI1 *[email protected] 1DIP.TE.RIS - Università di Genova - Polo Botanico “Hanbury”, Corso Dogali 1/M, I16136 Genova, Italy 2 MUT- Università di Torino, Dipartimento di Biologia Vegetale, Viale Mattioli 25, I10125 Torino, Italy 3Via San Marino 111/16, I16127 Genova, Italy 4Via F. Bettini 14/11, I16162 Genova, Italy Abstract— The paper is aimed at integrating and updating the first edition of the checklist of Ligurian macrofungi. Data are related to mycological researches carried out mainly in some holm-oak woods through last three years. The new taxa collected amount to 172: 15 of them belonging to Ascomycota and 157 to Basidiomycota. It should be highlighted that 12 taxa have been recorded for the first time in Italy and many species are considered rare or infrequent. Each taxa reported consists of the following items: Latin name, author, habitat, height, and the WGS-84 Global Position System (GPS) coordinates. This work, together with the original Ligurian checklist, represents a contribution to the national checklist. Key words—mycological flora, new reports Introduction Liguria represents a very interesting region from a mycological point of view: macrofungi, directly and not directly correlated to vegetation, are frequent, abundant and quite well distributed among the species. This topic is faced and discussed in Zotti & Orsino (2001). Observations prove an high level of fungal biodiversity (sometimes called “mycodiversity”) since Liguria, though covering only about 2% of the Italian territory, shows more than 36 % of all the species recorded in Italy.
    [Show full text]