PLATINUM The Journal of Threatened Taxa (JoTT) is dedicated to building evidence for conservaton globally by publishing peer-reviewed artcles OPEN ACCESS online every month at a reasonably rapid rate at www.threatenedtaxa.org. All artcles published in JoTT are registered under Creatve Commons Atributon 4.0 Internatonal License unless otherwise mentoned. JoTT allows unrestricted use, reproducton, and distributon of artcles in any medium by providing adequate credit to the author(s) and the source of publicaton. Journal of Threatened Taxa Building evidence for conservaton globally www.threatenedtaxa.org ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) Communication Morphological and molecular phylogenetic studies on Battarrea phalloides (Agaricales): a new report to Indian mycobiota R. Kantharaja & M. Krishnappa 26 May 2020 | Vol. 12 | No. 8 | Pages: 15881–15888 DOI: 10.11609/jot.5679.12.8.15881-15888 For Focus, Scope, Aims, Policies, and Guidelines visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-0 For Artcle Submission Guidelines, visit htps://threatenedtaxa.org/index.php/JoTT/about/submissions#onlineSubmissions For Policies against Scientfc Misconduct, visit htps://threatenedtaxa.org/index.php/JoTT/about/editorialPolicies#custom-2 For reprints, contact <[email protected]> The opinions expressed by the authors do not refect the views of the Journal of Threatened Taxa, Wildlife Informaton Liaison Development Society, Zoo Outreach Organizaton, or any of the partners. The journal, the publisher, the host, and the part- Publisher & Host ners are not responsible for the accuracy of the politcal boundaries shown in the maps by the authors. Member Threatened Taxa Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2020 | 12(8): 15881–15888 ISSN 0974-7907 (Online) | ISSN 0974-7893 (Print) PLATINUM OPEN ACCESS DOI: htps://doi.org/10.11609/jot.5679.12.8.15881-15888 #5679 | Received 03 January 2020 | Final received 13 April 2020 | Finally accepted 03 May 2020 C o m Morphological and molecular phylogenetc studies on Batarrea phalloides m u (Agaricales): a new report to Indian mycobiota n i c R. Kantharaja 1 & M. Krishnappa 2 a t i 1, 2 Department of PG Studies and Research in Botany, Kuvempu University, Jnana Sahyadri, Shankaraghata, Shivamogga, o Karnataka 577451, India. n 1 [email protected] (corresponding author),2 [email protected] Abstract: The Scaly-stalked Pufall Batarrea phalloides (Dicks.) Pers. is recorded for the frst tme in India. The fungus is reported from many countries across the contnents and typically uncommon and rare in all regions. It is Red Listed in most of the European countries and is under assessment in IUCN Global Fungal Red List Initatve. The Indian sample of B. phalloides is reported from Kadur Taluk of Chikkamagaluru District, Karnataka with morpho-molecular data. Keywords: Elaters, Morpho-molecular, nrITS, Red List, Scaly-stalked Pufall. Editor: R.K. Verma, Tropical Forest Research Insttute, Jabalpur, India. Date of publicaton: 26 May 2020 (online & print) Citaton: Kantharaja, R. & M. Krishnappa (2020). Morphological and molecular phylogenetc studies on Batarrea phalloides (Agaricales): a new report to Indian mycobiota. Journal of Threatened Taxa 12(8): 15881–15888. htps://doi.org/10.11609/jot.5679.12.8.15881-15888 Copyright: © Kantharaja & Krishnappa 2020. Creatve Commons Atributon 4.0 Internatonal License. JoTT allows unrestricted use, reproducton, and distributon of this artcle in any medium by providing adequate credit to the author(s) and the source of publicaton. Funding: Department of Science and Technology - Science and Engineering Research Board (DST - SERB), Government of India. Competng interests: The authors declare no competng interests. Author details: R. Kantharaja is a research scholar in the Department of Botany. Kuvempu University. Jnana Sahyadri. Shankaraghata. Currently working on morpho - molecular systematcs of Agaricales in Central Western Ghats region of Karnataka. India. Dr. M. Krishnappa is a mycologist and Professor in Department of Botany. Kuvempu University. Jnana Sahyadri. Shankaraghata. Whose research mainly focuses on fungal diversity and biology, fungal taxonomy, endophytc fungi and fungal diseases of plants. Since 20 years he is working on macrofungi and honored as Fellow of Mycological Society of India for the year 2014. He has over 130 research publicatons in diferent thrust areas of life science. Author contributon: RK carried out the research work, wrote the artcle. MK guided in every step and corrected mistakes in the artcle. Acknowledgements: We acknowledge the support from the Department of Botany, Kuvempu University, Shankaraghata, Karnataka to carry out the research and also the Department of Science and Technology, Science and Engineering Research Board (DST-SERB), Government of India for the fnancial support through a project grant (EEQ/2016/000363). 15881 J TT Morpho-molecular studies on Batarrea phalloides Kantharaja & Krishnappa INTRODUCTION by Martn & Johannesson (2000), Martn et al. (2013) and Jeferies & McLain (2014), the shreds of evidence Batarrea phalloides (Sandy Stlt Ball, Sandy Stlt suggest both taxa are conspecifc. In additon, Martn Pufall, Scaly-stalked Pufall), previously known & Johannesson (2000) considered spore ornamentaton gasteromycete in Batarreaceae (Corda 1842), and now as a non-molecular character for lineage recogniton and a distnctve saprobic basidiomycetous agaric fungus, depicted three main lineages phylogenetcally, they have easily recognizable with a scaly lacerated stem growing diferences in their spore ornamentaton as—(a) spores up to 40cm in height, forming a reddish-brown spore with anastomosing truncate ridges, (b) fnely verrucose, case inside a thin greyish skin. It is rare, uncommon and and (c) fnely retculate. occurs in small scatered populatons or sometmes even The present study describes B. phalloides as a new appears as single basidiomata. report to Indian mycobiota based on morphological Batarrea phalloides is red-listed in several European characters and multgene phylogenetc analysis. countries and is one of the non-lichenized fungi aforded legal protecton by being included in schedule 8 of Materials and Methods the Wildlife and Countryside Act, 1981 in the United The Scaly-stalked Pufall like basidiomata of Kingdom (Jefries & McLain 2004). The species is Batarrea phalloides were collected from Aladahalli currently under assessment for additon to the IUCN: Village (13.546N & 75.875E) of Kadur Taluk (Figure 1), The Global Fungal Red List Initatve (htp://iucn.ekoo. Western Ghats region of Karnataka during July 2019. se/iucn/species_view/159853). Sixteen species have been described in the genus Sampling and morphological characterizaton Batarrea Pers. since 1801 (Index Fungorum, htp:// The sporomas of diferent stages were collected www.indexfungorum.org/) and most of them are and phenotypic characters were recorded using a feld conspecifc to Batarrea phalloides. Early taxonomic key (Atri et al. 2017). Microscopic characters were discussions about the worthiness of morphological recorded using a light microscope (Olympus CH20i) characters for separatng B. phalloides and B. stevenii and the sporocarps were shade-dried and stored in the were evaluated using modern phylogenetc approach Department of Botany, Kuvempu University for further Figure 1. Geographic locaton of Batarrea phalloides 15882 Journal of Threatened Taxa | www.threatenedtaxa.org | 26 May 2020 | 12(8): 15881–15888 J TT Morpho-molecular studies on Batarrea phalloides Kantharaja & Krishnappa Table 1. List of primers utlized to amplify nrITS and nrLSU gene sequences obtained from Eurofns Genomics India Pvt. sequences. Ltd. Bengaluru were checked and trimmed using MEGA Amplifying X (Kumar et al. 2018). Consensus sequences were Primer Sequence Tm [°C] gene generated using BioEdit sequence alignment editor 1 ITS 1 TCCGTAGGTGAACCTTGCGG 60.99 nrITS v.7.2.5 (Hall, CA) by Clustal W (Madeira et al. 2019). 2 ITS 4 TCCTCCGCTTATTGATATGC 55.25 BLAST search in the GenBank (htps://blast.ncbi.nlm.nih. 3 LROR ACCCGCTGAACTTAAGC 52.77 nrLSU gov/Blast.cgi) nucleotde database to identfy the related 4 LR5 TCCTGAGGGAAACTTCG 52.77 taxa by sequence similarity and both nrITS and nrLSU sequences were deposited to GenBank with accession numbers MN450310 and MN700164, respectvely. studies (Image 1). To identfy the surface ornamentaton Molecular phylogenetc analysis was performed by of spores, scanning electron microscopy was carried out using nrITS and nrLSU sequences separately. Datasets in ZEISS EVO CSEM. of 17 nrITS sequences (Table 2) and 15 nrLSU sequences (Table 3) including those retrieved from the NCBI DNA Extracton, PCR and Phylogenetc analysis GenBank are used to assess the alignment confdence The total genomic DNA was extracted from the score in the GUIDANCE web server (htp://guidance. freshly collected sporocarp using the CTAB method tau.ac.il) by MAFFT algorithm (Katoh et al. 2019) to (Doyle & Doyle 1987) with modifcatons. 100mg of construct 100 alternatve guide trees. Using GUIDANCE inner stpe tssue was directly homogenized with 500µl outputs the columns showing less than 93% confdence of 2X CTAB extracton bufer pre-warmed to 65°C in a scores are removed and aligned in BioEdit v.7.2.5. 1.5ml microcentrifuge tube with the help of micro- The alignment fle obtained is further used to analyze pestle, followed by vortexing and incubated in a water the maximum likelihood in RAxML GUI v.2.0.0.0 using bath at 65°C for
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages12 Page
-
File Size-