DOCSLIB.ORG

The Maintenance of Intestinal Homeostasis Expression In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Maintenance of Intestinal Homeostasis Expression In Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis This information is current as Kyoko Takahashi, Yutaka Sugi, Akira Hosono and Shuichi of October 4, 2021. Kaminogawa J Immunol 2009; 183:6522-6529; Prepublished online 21 October 2009; doi: 10.4049/jimmunol.0901271 http://www.jimmunol.org/content/183/10/6522 Downloaded from References This article cites 34 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/10/6522.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 4, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis1 Kyoko Takahashi,2 Yutaka Sugi, Akira Hosono, and Shuichi Kaminogawa Intestinal epithelial cells (IECs) are continuously exposed to large numbers of commensal bacteria but are relatively insensitive to them, thereby averting an excessive inflammatory reaction. In this study, we show that the low responsiveness of human IEC lines to LPS was mainly brought about by a down-regulation of TLR4 gene transcription. Additionally, the presence of an IEC-specific repressor element in the 5؅ region of the TLR4 gene and binding of a NF to the element was shown. The transcription factor ZNF160, which was expressed more abundantly in a LPS-low responder IEC line than in a LPS-high responder IEC line, repressed TLR4 gene transcription. ZNF160 is known to interact with the scaffold protein KAP1 via its N terminus to recruit histone deacetylase. Histone deacetylation, as well as DNA methylation, at the 5؅ region of the TLR4 gene was significantly higher in LPS-low responder IEC lines than in a monocyte line or a LPS-high responder IEC line. It was demonstrated that TLR4 gene transcription was repressed by these epigenetic regulations, which were, at least in part, dependent on ZNF160. Down-regulaton Downloaded from of TLR4 gene expression by these mechanisms in IECs possibly contributes to the maintainance of homeostasis in the intestinal commensal system. The Journal of Immunology, 2009, 183: 6522–6529. he intestinal immune system, which is the largest immune cell balances (14, 15). Third, production of IgA against the com- system in the body, plays an essential role in the mainte- mensals is involved in keeping the number of the commensals at nance of health. In addition to food, pathogenic bacteria an appropriate level (16). Additionally, it is also important that http://www.jimmunol.org/ T 3 and viruses enter the intestinal tract through the oral cavity. On the intestinal epithelial cells (IECs), which form the boundary be- other hand, an enormous number of commensal bacteria inhabit tween the lumen and the internal milieu, acquire hyporesponsive- the intestinal tract. The intestinal immune system accurately rec- ness to the commensals, because the lumenal surface of the epi- ognizes these different organisms, discriminates between safe/ben- thelium is continually exposed to the commensals or their eficial and dangerous components, and attacks only those that are components. hazardous to the host. IECs not only physically separate luminal contents from the Lately, the crucial role of the symbiosis between the commensal internal milieu but also actively participate in the immune reac- bacteria and the intestinal immune system in maintaining good tions as a frontline defense in the mucosal immune system. IECs health has attracted considerable attention. For instance, the de- have been shown to receive stimulation from intestinal commensal by guest on October 4, 2021 velopment of GALTs such as Peyer’s patches and the induction of bacteria through TLRs, the pattern recognition receptors for mi- oral tolerance are known to be impaired or delayed in germ-free crobial components, to maintain their homeostasis (17). However, animals (1–5). Moreover, a correlation between the incidence of to prevent triggering excessive inflammatory reactions, they do not atopic eczema in children and the composition of their intestinal respond in a sensitive manner to the commensals. Specifically, microbiota has been reported (6–11). The following phenomena IECs contribute to the maintenance of intestinal homeostasis by observed specifically in the intestinal mucosa are thought to be partially tolerating the commensals and regulating mucosal inflam- involved in establishment and maintenance of the symbiosis, al- mation. Decreased expression of specific TLRs and accessory mol- though the precise underlying mechanisms have not yet been fully ecules such as MD2 in IECs has been reported as one of the mech- elucidated. First, maturation of a specific population of dendritic anisms controlling the hyporesponsiveness (18, 19). Additionally, cells expressing CD103, which preferentially induce T cells with the expression of Toll-interacting protein, a negative regulator of regulatory properties, is accelerated in the intestine (12, 13). Sec- intracellular signals from TLRs, is known to be increased in IECs ond, the commensal bacteria regulate the differentiation of effector (18). In contrast, excessive responses to the commensals and in- T cells and achieve appropriate Th1/Th2 and Th17/regulatory T creased expression of specific TLRs, including TLR4, are often observed in patients with inflammatory bowel disease (20). There- fore, expression of these molecules is thought to be regulated by Food and Physiological Functions Laboratory, College of Bioresource Sciences, Ni- hon University, Fujisawa-shi, Kanagawa, Japan cell type-specific mechanisms in IECs to maintain the intestinal symbiosis. Here we have analyzed the regulatory mechanisms of Received for publication April 22, 2009. Accepted for publication September 18, 2009. TLR4 gene expression in IECs to elucidate one of the mechanisms The costs of publication of this article were defrayed in part by the payment of page for maintaining the intestinal homeostasis. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported in part by a Grant-in Aid for Young Scientists from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to K.T.) 3 Abbreviations used in this paper: IEC, intestinal epithelial cell; DN, dominant neg- and a Grant-in Aid for Scientific Research from Japan Society for the Promotion of ative; qPCR, quantitative PCR; ChIP, chromatin immunoprecipitation; 5-aza-dC, Science (to S.K.). 5-aza-2Ј-deoxycytidine; TSA, trichostatin A; siRNA, small interfering RNA; KRAB, 2 Address correspondence and reprint requests to Dr. Kyoko Takahashi, Food and Kruppel-associated box; KAP, KRAB-associated protein; ICSBP, interferon consen- Physiological Functions Laboratory, College of Bioresource Sciences, Nihon Univer- sus sequence-binding protein. sity, 1866 Kameino, Fujisawa-shi, Kanagawa 252-8510, Japan. E-mail address: [email protected] Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901271 The Journal of Immunology 6523 Materials and Methods nt Ϫ675/ϩ188 region, 5Ј-gcggtacCTTCAGTATATTCCATTCTGAAA Ј Ϫ ϩ Ј Cell culture TC-3 ; for amplification of the nt 218/ 188 region, 5 -gcggtacCACC GTCATCCTAGAGAGTTACAAG-3Ј; for amplification of the nt The human epithelial colonic adenocarcinoma cell lines Caco-2 and HT-29 Ϫ6/ϩ188 region, 5Ј-gcggtacCAGAATGCTAAGGTTGCCGCTTTC-3Ј. and the human epithelial colonic carcinoma cell lines HCT 116 and T84, The nucleotides denoted by lowercase letters were inserted to introduce a as well as the human monocyte line THP-1, were purchased from DS KpnI site (underlined). The synthetic oligonucleotide 5Ј-gaagatctCTGG Pharma Biomedical. The human epithelial colonic adenocarcinoma cell CATCATCCTCACTGCTTCTG-3Ј was used as a common reverse primer line SW480 was provided by the Cell Resource Center for Biomedical (nucleotides denoted by small letters were inserted to introduce a BglII site Research Institute of Development, Aging, and Cancer Center at Tohoku (underlined)). University (Miyagi, Japan). Caco-2 cells were cultured in Eagle’s MEM The TLR4 siRNA expression plasmid was constructed as follows: a (Nissui) supplemented with nonessential amino acids (Invitrogen). HCT double-stranded DNA was generated by annealing the following 116 and HT-29 cells were cultured in McCoy’s 5a medium (MP Biomedi- synthetic oligonucleotides: top strand, 5Ј-GATCCGCTCACAATC cals). T84, SW480, and THP-1 cells were cultured in a 1/1 mixture of TTACCAATCTCTGTGAAGCCACGATGGGAATTGGTAAGATTGTG Ham’s F12 (Nissui) and DMEM (Nissui), a 1/1 mixture of L15 (MP
Load more

Recommended publications
  • C8cc08685k1.Pdf
    Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2018 Supporting Information Minimalist Linkers Suitable for Irreversible Inhibitors in Simultaneous Proteome Profiling, Live-Cell Imaging and Drug Screening Cuiping Guo,Yu Chang, Xin Wang, Chengqian Zhang, Piliang Hao*, Ke Ding and Zhengqiu Li* School of Pharmacy, Jinan University, Guangzhou, China 510632 *Corresponding author ([email protected]) 1. General Information All chemicals were purchased from commercial vendors and used without further purification, unless indicated otherwise. All reactions requiring anhydrous conditions were carried out under argon or nitrogen atmosphere using oven-dried glassware. AR-grade solvents were used for all reactions. Reaction progress was monitored by TLC on pre-coated silica plates (Merck 60 F254 nm, 0.25 µm) and spots were visualized by UV, iodine or other suitable stains. Flash column chromatography was carried out using silica gel (Qingdao Ocean). All NMR spectra (1H-NMR, 13C-NMR) were recorded on Bruker 300 MHz/400 MHz NMR spectrometers. Chemical shifts were reported in parts per million (ppm) referenced with respect to appropriate internal standards or residual solvent peaks (CDCl3 = 7.26 ppm, DMSO-d6 = 2.50 ppm). The following abbreviations were used in reporting spectra, br s (broad singlet), s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd (doublet of doublets). Mass spectra were obtained on Agilent LC-ESI-MS system. All analytical HPLC were carried out on Agilent system. Water with 0.1% TFA and acetonitrile with 0.1% TFA were used as eluents and the flow rate was 0.5 mL/min.
    [Show full text]
  • Divergence of Human and Mouse Brain Transcriptome Highlights Alzheimer Disease Pathways
    Divergence of human and mouse brain transcriptome highlights Alzheimer disease pathways Jeremy A. Millera,b, Steve Horvathc,d, and Daniel H. Geschwindb,c,1 aInterdepartmental Program for Neuroscience, Departments of cHuman Genetics and dBiostatistics, and bProgram in Neurogenetics and Neurobehavioral Genetics, Department of Neurology and Semel Institute, University of California, Los Angeles, CA 90095-1769 Edited by Joseph S. Takahashi, Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, TX, and approved June 1, 2010 (received for review December 10, 2009) Because mouse models play a crucial role in biomedical research works by merging data from many microarray studies, and then related to the human nervous system, understanding the similari- applying weighted gene coexpression network analysis (WGCNA) ties and differences between mouse and human brain is of (4–7). WGCNA elucidates the higher-order relationships between fundamental importance. Studies comparing transcription in hu- genes based on their coexpression relationships, delineating modules man and mouse have come to varied conclusions, in part because of of biologically related genes and permitting a robust view of their relatively small sample sizes or underpowered methodologies. transcriptome organization (3, 5, 8, 9). Within groups of highly coexpressed genes (“modules”) that comprise the core functional To better characterize gene expression differences between mouse fi and human, we took a systems-biology approach by using weighted units of the transcriptional network, WGCNA also identi es gene coexpression network analysis on more than 1,000 micro- the most highly connected, or most central genes within each module, referred to as “hubs.” We find that both gene expression arrays from brain.
    [Show full text]
  • Associated 16P11.2 Deletion in Drosophila Melanogaster
    ARTICLE DOI: 10.1038/s41467-018-04882-6 OPEN Pervasive genetic interactions modulate neurodevelopmental defects of the autism- associated 16p11.2 deletion in Drosophila melanogaster Janani Iyer1, Mayanglambam Dhruba Singh1, Matthew Jensen1,2, Payal Patel 1, Lucilla Pizzo1, Emily Huber1, Haley Koerselman3, Alexis T. Weiner 1, Paola Lepanto4, Komal Vadodaria1, Alexis Kubina1, Qingyu Wang 1,2, Abigail Talbert1, Sneha Yennawar1, Jose Badano 4, J. Robert Manak3,5, Melissa M. Rolls1, Arjun Krishnan6,7 & 1234567890():,; Santhosh Girirajan 1,2,8 As opposed to syndromic CNVs caused by single genes, extensive phenotypic heterogeneity in variably-expressive CNVs complicates disease gene discovery and functional evaluation. Here, we propose a complex interaction model for pathogenicity of the autism-associated 16p11.2 deletion, where CNV genes interact with each other in conserved pathways to modulate expression of the phenotype. Using multiple quantitative methods in Drosophila RNAi lines, we identify a range of neurodevelopmental phenotypes for knockdown of indi- vidual 16p11.2 homologs in different tissues. We test 565 pairwise knockdowns in the developing eye, and identify 24 interactions between pairs of 16p11.2 homologs and 46 interactions between 16p11.2 homologs and neurodevelopmental genes that suppress or enhance cell proliferation phenotypes compared to one-hit knockdowns. These interac- tions within cell proliferation pathways are also enriched in a human brain-specific network, providing translational relevance in humans. Our study indicates a role for pervasive genetic interactions within CNVs towards cellular and developmental phenotypes. 1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802, USA. 2 Bioinformatics and Genomics Program, The Huck Institutes of the Life Sciences, The Pennsylvania State University, University Park, PA 16802, USA.
    [Show full text]
  • The Human Genome Project
    TO KNOW OURSELVES ❖ THE U.S. DEPARTMENT OF ENERGY AND THE HUMAN GENOME PROJECT JULY 1996 TO KNOW OURSELVES ❖ THE U.S. DEPARTMENT OF ENERGY AND THE HUMAN GENOME PROJECT JULY 1996 Contents FOREWORD . 2 THE GENOME PROJECT—WHY THE DOE? . 4 A bold but logical step INTRODUCING THE HUMAN GENOME . 6 The recipe for life Some definitions . 6 A plan of action . 8 EXPLORING THE GENOMIC LANDSCAPE . 10 Mapping the terrain Two giant steps: Chromosomes 16 and 19 . 12 Getting down to details: Sequencing the genome . 16 Shotguns and transposons . 20 How good is good enough? . 26 Sidebar: Tools of the Trade . 17 Sidebar: The Mighty Mouse . 24 BEYOND BIOLOGY . 27 Instrumentation and informatics Smaller is better—And other developments . 27 Dealing with the data . 30 ETHICAL, LEGAL, AND SOCIAL IMPLICATIONS . 32 An essential dimension of genome research Foreword T THE END OF THE ROAD in Little has been rapid, and it is now generally agreed Cottonwood Canyon, near Salt that this international project will produce Lake City, Alta is a place of the complete sequence of the human genome near-mythic renown among by the year 2005. A skiers. In time it may well And what is more important, the value assume similar status among molecular of the project also appears beyond doubt. geneticists. In December 1984, a conference Genome research is revolutionizing biology there, co-sponsored by the U.S. Department and biotechnology, and providing a vital of Energy, pondered a single question: Does thrust to the increasingly broad scope of the modern DNA research offer a way of detect- biological sciences.
    [Show full text]
  • Evolutionary Analysis of Viral Sequences in Eukaryotic Genomes
    Evolutionary analysis of viral sequences in eukaryotic genomes Sean Schneider A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2014 Reading Committee: James H. Thomas, Chair Willie Swanson Phil Green Program Authorized to Offer Degree: Genome Sciences ©Copyright 2014 Sean Schneider University of Washington Abstract Evolutionary analysis of viral sequences in eukaryotic genomes Sean Schneider Chair of the supervisory committee: Professor James H. Thomas Genome Sciences The focus of this work is several evolutionary analyses of endogenous viral sequences in eukaryotic genomes. Endogenous viral sequences can provide key insights into the past forms and evolutionary history of viruses, as well as the responses of host organisms they infect. In this work I have examined viral sequences in a diverse assortment of eukaryotic hosts in order to study coevolution between hosts and the organisms that infect them. This research consisted of two major lines of investigation. In the first portion of this work, I outline the hypothesis that the C2H2 zinc finger gene family in vertebrates has evolved by birth-death evolution in response to sporadic retroviral infection. The hypothesis suggests an evolutionary model in which newly duplicated zinc finger genes are retained by selection in response to retroviral infection. This hypothesis is supported by a strong association (R2=0.67) between the number of endogenous retroviruses and the number of zinc fingers in diverse vertebrate genomes. Based on this and other evidence, the zinc finger gene family appears to act as a “genomic immune system” against retroviral infections. The other major line of investigation in this work examines endogenous virus sequences utilized by parasitic wasps to disable hosts that they infect.
    [Show full text]
  • Changes in Prostate Gene Expression in Men Undergoing an Intensive Nutrition and Lifestyle Intervention
    Changes in prostate gene expression in men undergoing an intensive nutrition and lifestyle intervention Dean Ornish*†‡, Mark Jesus M. Magbanua§, Gerdi Weidner*, Vivian Weinberg¶, Colleen Kemp*, Christopher Green§, Michael D. Mattie§, Ruth Marlin*, Jeff Simkoʈ, Katsuto Shinohara§, Christopher M. Haqq§ and Peter R. Carroll§ §Department of Urology, The Helen Diller Family Comprehensive Cancer Center, and ʈDepartment of Pathology, University of California, 2340 Sutter Street, San Francisco, CA 94115; *Preventive Medicine Research Institute, 900 Bridgeway, Sausalito, CA 94965; †Department of Medicine, School of Medicine, University of California, 505 Parnassus Avenue, San Francisco, CA 94143; and ¶Biostatistics Core, The Helen Diller Family Comprehensive Cancer Center, University of California, 513 Parnassus Avenue, Box 0127, San Francisco, CA 94143 Communicated by J. Craig Venter, The J. Craig Venter Institute, Rockville, MD, April 2, 2008 (received for review February 13, 2008) Epidemiological and prospective studies indicate that comprehensive indolent low-risk prostate cancers, defined by strict clinical and lifestyle changes may modify the progression of prostate cancer. pathologic criteria designed to minimize the risk for metastatic However, the molecular mechanisms by which improvements in diet disease as a result of study participation (9). The 30 men who and lifestyle might affect the prostate microenvironment are poorly enrolled did not undergo surgery or radiation therapy to treat their understood. We conducted a pilot study to examine changes in low-risk tumors; rather, they underwent comprehensive lifestyle prostate gene expression in a unique population of men with low-risk changes (low-fat, whole-foods, plant-based nutrition; stress man- prostate cancer who declined immediate surgery, hormonal therapy, agement techniques; moderate exercise; and participation in a or radiation and participated in an intensive nutrition and lifestyle psychosocial group support).
    [Show full text]
  • Meyer2012.Pdf
    This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: • This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. • A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. • This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. • The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. • When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Characterisation of the Direct Antiproliferative Effects of a Gonadotrophin-releasing Hormone Analogue Colette Meyer A thesis submitted in fulfilment of the requirements of the degree of Doctor of Philosophy The University of Edinburgh 2012 1 Abstract Gonadotrophin-releasing hormone (GnRH) can inhibit proliferation of multiple reproductive tissue cancer cell lines through direct interaction with GnRH receptors (GnRHR) on tumour cells. GnRH analogues may therefore have a role in treating some cancers. The signalling pathways associated with these inhibitory effects are poorly defined, and characterising them may help to understand therapeutic sensitivity. To elucidate these pathways, transcriptomic and proteomic approaches were used to compare the effects of the GnRH agonist Triptorelin in responsive GnRHR-transfected HEK293 cells (SCL60) and unresponsive (HEK293) cells both in vitro for up to 24h and in vivo for up to 7 days.
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles Identification of a Multisubunit E3 Ubiquitin Ligase Required for Heterotrimeric G-Protein
    UNIVERSITY OF CALIFORNIA Los Angeles Identification of a multisubunit E3 ubiquitin ligase required for heterotrimeric G-protein beta-subunit ubiquitination and cAMP signaling A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Biology by Brian Daniel Young 2018 © Copyright by Brian Daniel Young 2018 ABSTRACT OF THE DISSERTATION Identification of a multisubunit E3 ubiquitin ligase required for heterotrimeric G-protein beta-subunit ubiquitination and cAMP signaling by Brian Daniel Young Doctor of Philosophy in Molecular Biology University of California, Los Angeles, 2018 Professor James Akira Wohlschlegel, Chair GPCRs are stimulated by extracellular ligands and initiate a range of intracellular signaling events through heterotrimeric G-proteins. Upon activation, G-protein α- subunits (Gα) and the stable βγ-subunit dimer (Gβγ) bind and alter the activity of diverse effectors. These signaling events are fundamental and subject to multiple layers of regulation. In this study, we used an unbiased proteomic mass spectrometry approach to uncover novel regulators of Gβγ. We identified a subfamily of potassium channel tetramerization domain (KCTD) proteins that specifically bind Gβγ. Several KCTD proteins are substrate adaptor proteins for CUL3–RING E3 ubiquitin ligases. Our studies revealed that a KCTD2-KCTD5 hetero-oligomer associates with CUL3 through KCTD5 subunits and recruits Gβγ through both subunits. Using in vitro ubiquitination reactions, we demonstrated that these KCTD proteins promote monoubiquitination of lysine-23 within Gβ1/2. This ubiquitin modification of Gβ1/2 is also observed in human ii cells and is dependent on these substrate adaptor proteins. Because these KCTD proteins bind Gβγ in response to G-protein activation, we investigated their role in GPCR signaling.
    [Show full text]
  • Cross-Talk Between PRMT1-Mediated Methylation and Ubiquitylation on RBM15 Controls RNA Splicing
    1 Cross-talk between PRMT1-mediated methylation and ubiquitylation on RBM15 controls RNA splicing 2 Li Zhang1*, Ngoc-Tung Tran1*, Hairui Su1*, Rui Wang2, Yuheng Lu11, Haiping Tang4, Sayura Aoyagi10, 3 Ailan Guo10, Alireza Khodadadi-Jamayran1, Dewang Zhou1, Kun Qian5, Todd Hricik3, Jocelyn Côté6, 4 Xiaosi Han8, Wenping Zhou7, Suparna Laha9, Omar Abdel-Wahab3, Ross L. Levine3, Glen Raffel9, 5 Yanyan Liu7, Dongquan Chen12, Haitao Li4, Tim Townes1, Hengbin Wang1, Haiteng Deng4, Y. George 6 Zheng5, Christina Leslie11, Minkui Luo2, and Xinyang Zhao1 7 8 1. Department of Biochemistry and Molecular Genetics, UAB Stem Cell Institute, The University of 9 Alabama at Birmingham, Birmingham, AL 35294, USA. 10 2. Program of Molecular Pharmacology, Sloan Kettering Institute, New York, NY 10021, USA. 11 3. HOPP, Sloan Kettering Institute, New York, NY 10021, USA. 12 4. School of Life Sciences, Tsinghua University, Beijing, 100084 China. 13 5. Department of Pharmaceutical & Biomedical Sciences, The University of Georgia, Athens, GA 14 30602, USA 15 6. Department of Cellular and Molecular Medicine, University of Ottawa, 451 Smyth Road, Ottawa, 16 ON K1H 8M5, Canada. 17 7. Department of Internal Medicine, Affiliated Cancer Hospital of Zhengzhou University & Henan 18 Cancer Hospital, Zhengzhou 450008, China 19 8. Department of Neurology, Comprehensive Cancer Center, The University of Alabama at 20 Birmingham, Birmingham, AL 35294, USA. 21 9. Division of Hematology and Oncology, University of Massachusetts Medical School, 364 22 Plantation St, Worcester, MA 01605, USA. 23 10. Cell Signaling Inc. 3 Trask lane, Danvers, MA 01923, USA. 24 11. Computational Biology Program, Sloan Kettering Institute, New York, NY 10021, USA.
    [Show full text]
  • Divergence of Human and Mouse Brain Transcriptome Highlights Alzheimer Disease Pathways
    Divergence of human and mouse brain transcriptome highlights Alzheimer disease pathways Jeremy A. Millera,b, Steve Horvathc,d, and Daniel H. Geschwindb,c,1 aInterdepartmental Program for Neuroscience, Departments of cHuman Genetics and dBiostatistics, and bProgram in Neurogenetics and Neurobehavioral Genetics, Department of Neurology and Semel Institute, University of California, Los Angeles, CA 90095-1769 Edited by Joseph S. Takahashi, Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, TX, and approved June 1, 2010 (received for review December 10, 2009) Because mouse models play a crucial role in biomedical research works by merging data from many microarray studies, and then related to the human nervous system, understanding the similari- applying weighted gene coexpression network analysis (WGCNA) ties and differences between mouse and human brain is of (4–7). WGCNA elucidates the higher-order relationships between fundamental importance. Studies comparing transcription in hu- genes based on their coexpression relationships, delineating modules man and mouse have come to varied conclusions, in part because of of biologically related genes and permitting a robust view of their relatively small sample sizes or underpowered methodologies. transcriptome organization (3, 5, 8, 9). Within groups of highly coexpressed genes (“modules”) that comprise the core functional To better characterize gene expression differences between mouse fi and human, we took a systems-biology approach by using weighted units of the transcriptional network, WGCNA also identi es gene coexpression network analysis on more than 1,000 micro- the most highly connected, or most central genes within each module, referred to as “hubs.” We find that both gene expression arrays from brain.
    [Show full text]
  • Ep 2327796 A1
    (19) & (11) EP 2 327 796 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 01.06.2011 Bulletin 2011/22 C12Q 1/68 (2006.01) (21) Application number: 10184813.3 (22) Date of filing: 09.06.2004 (84) Designated Contracting States: • Spira, Avrum AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Newton, Massachusetts 02465 (US) HU IE IT LI LU MC NL PL PT RO SE SI SK TR (74) Representative: Brown, David Leslie (30) Priority: 10.06.2003 US 477218 P Haseltine Lake LLP Redcliff Quay (62) Document number(s) of the earlier application(s) in 120 Redcliff Street accordance with Art. 76 EPC: Bristol 04776438.6 / 1 633 892 BS1 6HU (GB) (71) Applicant: THE TRUSTEES OF BOSTON Remarks: UNIVERSITY •This application was filed on 30-09-2010 as a Boston, MA 02218 (US) divisional application to the application mentioned under INID code 62. (72) Inventors: •Claims filed after the date of filing of the application/ • Brody, Jerome S. after the date of receipt of the divisional application Newton, Massachusetts 02458 (US) (Rule 68(4) EPC). (54) Detection methods for disorders of the lung (57) The present invention is directed to prognostic vides a minimally invasive sample procurement method and diagnostic methods to assess lung disease risk in combination with the gene expression-based tools for caused by airway pollutants by analyzing expression of the diagnosis and prognosis of diseases of the lung, par- one or more genes belonging to the airway transcriptome ticularly diagnosis and prognosis of lung cancer provided herein.
    [Show full text]