Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis This information is current as Kyoko Takahashi, Yutaka Sugi, Akira Hosono and Shuichi of October 4, 2021. Kaminogawa J Immunol 2009; 183:6522-6529; Prepublished online 21 October 2009; doi: 10.4049/jimmunol.0901271 http://www.jimmunol.org/content/183/10/6522 Downloaded from References This article cites 34 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/10/6522.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 4, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Epigenetic Regulation of TLR4 Gene Expression in Intestinal Epithelial Cells for the Maintenance of Intestinal Homeostasis1 Kyoko Takahashi,2 Yutaka Sugi, Akira Hosono, and Shuichi Kaminogawa Intestinal epithelial cells (IECs) are continuously exposed to large numbers of commensal bacteria but are relatively insensitive to them, thereby averting an excessive inflammatory reaction. In this study, we show that the low responsiveness of human IEC lines to LPS was mainly brought about by a down-regulation of TLR4 gene transcription. Additionally, the presence of an IEC-specific repressor element in the 5؅ region of the TLR4 gene and binding of a NF to the element was shown. The transcription factor ZNF160, which was expressed more abundantly in a LPS-low responder IEC line than in a LPS-high responder IEC line, repressed TLR4 gene transcription. ZNF160 is known to interact with the scaffold protein KAP1 via its N terminus to recruit histone deacetylase. Histone deacetylation, as well as DNA methylation, at the 5؅ region of the TLR4 gene was significantly higher in LPS-low responder IEC lines than in a monocyte line or a LPS-high responder IEC line. It was demonstrated that TLR4 gene transcription was repressed by these epigenetic regulations, which were, at least in part, dependent on ZNF160. Down-regulaton Downloaded from of TLR4 gene expression by these mechanisms in IECs possibly contributes to the maintainance of homeostasis in the intestinal commensal system. The Journal of Immunology, 2009, 183: 6522–6529. he intestinal immune system, which is the largest immune cell balances (14, 15). Third, production of IgA against the com- system in the body, plays an essential role in the mainte- mensals is involved in keeping the number of the commensals at nance of health. In addition to food, pathogenic bacteria an appropriate level (16). Additionally, it is also important that http://www.jimmunol.org/ T 3 and viruses enter the intestinal tract through the oral cavity. On the intestinal epithelial cells (IECs), which form the boundary be- other hand, an enormous number of commensal bacteria inhabit tween the lumen and the internal milieu, acquire hyporesponsive- the intestinal tract. The intestinal immune system accurately rec- ness to the commensals, because the lumenal surface of the epi- ognizes these different organisms, discriminates between safe/ben- thelium is continually exposed to the commensals or their eficial and dangerous components, and attacks only those that are components. hazardous to the host. IECs not only physically separate luminal contents from the Lately, the crucial role of the symbiosis between the commensal internal milieu but also actively participate in the immune reac- bacteria and the intestinal immune system in maintaining good tions as a frontline defense in the mucosal immune system. IECs health has attracted considerable attention. For instance, the de- have been shown to receive stimulation from intestinal commensal by guest on October 4, 2021 velopment of GALTs such as Peyer’s patches and the induction of bacteria through TLRs, the pattern recognition receptors for mi- oral tolerance are known to be impaired or delayed in germ-free crobial components, to maintain their homeostasis (17). However, animals (1–5). Moreover, a correlation between the incidence of to prevent triggering excessive inflammatory reactions, they do not atopic eczema in children and the composition of their intestinal respond in a sensitive manner to the commensals. Specifically, microbiota has been reported (6–11). The following phenomena IECs contribute to the maintenance of intestinal homeostasis by observed specifically in the intestinal mucosa are thought to be partially tolerating the commensals and regulating mucosal inflam- involved in establishment and maintenance of the symbiosis, al- mation. Decreased expression of specific TLRs and accessory mol- though the precise underlying mechanisms have not yet been fully ecules such as MD2 in IECs has been reported as one of the mech- elucidated. First, maturation of a specific population of dendritic anisms controlling the hyporesponsiveness (18, 19). Additionally, cells expressing CD103, which preferentially induce T cells with the expression of Toll-interacting protein, a negative regulator of regulatory properties, is accelerated in the intestine (12, 13). Sec- intracellular signals from TLRs, is known to be increased in IECs ond, the commensal bacteria regulate the differentiation of effector (18). In contrast, excessive responses to the commensals and in- T cells and achieve appropriate Th1/Th2 and Th17/regulatory T creased expression of specific TLRs, including TLR4, are often observed in patients with inflammatory bowel disease (20). There- fore, expression of these molecules is thought to be regulated by Food and Physiological Functions Laboratory, College of Bioresource Sciences, Ni- hon University, Fujisawa-shi, Kanagawa, Japan cell type-specific mechanisms in IECs to maintain the intestinal symbiosis. Here we have analyzed the regulatory mechanisms of Received for publication April 22, 2009. Accepted for publication September 18, 2009. TLR4 gene expression in IECs to elucidate one of the mechanisms The costs of publication of this article were defrayed in part by the payment of page for maintaining the intestinal homeostasis. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported in part by a Grant-in Aid for Young Scientists from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to K.T.) 3 Abbreviations used in this paper: IEC, intestinal epithelial cell; DN, dominant neg- and a Grant-in Aid for Scientific Research from Japan Society for the Promotion of ative; qPCR, quantitative PCR; ChIP, chromatin immunoprecipitation; 5-aza-dC, Science (to S.K.). 5-aza-2Ј-deoxycytidine; TSA, trichostatin A; siRNA, small interfering RNA; KRAB, 2 Address correspondence and reprint requests to Dr. Kyoko Takahashi, Food and Kruppel-associated box; KAP, KRAB-associated protein; ICSBP, interferon consen- Physiological Functions Laboratory, College of Bioresource Sciences, Nihon Univer- sus sequence-binding protein. sity, 1866 Kameino, Fujisawa-shi, Kanagawa 252-8510, Japan. E-mail address: [email protected] Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901271 The Journal of Immunology 6523 Materials and Methods nt Ϫ675/ϩ188 region, 5Ј-gcggtacCTTCAGTATATTCCATTCTGAAA Ј Ϫ ϩ Ј Cell culture TC-3 ; for amplification of the nt 218/ 188 region, 5 -gcggtacCACC GTCATCCTAGAGAGTTACAAG-3Ј; for amplification of the nt The human epithelial colonic adenocarcinoma cell lines Caco-2 and HT-29 Ϫ6/ϩ188 region, 5Ј-gcggtacCAGAATGCTAAGGTTGCCGCTTTC-3Ј. and the human epithelial colonic carcinoma cell lines HCT 116 and T84, The nucleotides denoted by lowercase letters were inserted to introduce a as well as the human monocyte line THP-1, were purchased from DS KpnI site (underlined). The synthetic oligonucleotide 5Ј-gaagatctCTGG Pharma Biomedical. The human epithelial colonic adenocarcinoma cell CATCATCCTCACTGCTTCTG-3Ј was used as a common reverse primer line SW480 was provided by the Cell Resource Center for Biomedical (nucleotides denoted by small letters were inserted to introduce a BglII site Research Institute of Development, Aging, and Cancer Center at Tohoku (underlined)). University (Miyagi, Japan). Caco-2 cells were cultured in Eagle’s MEM The TLR4 siRNA expression plasmid was constructed as follows: a (Nissui) supplemented with nonessential amino acids (Invitrogen). HCT double-stranded DNA was generated by annealing the following 116 and HT-29 cells were cultured in McCoy’s 5a medium (MP Biomedi- synthetic oligonucleotides: top strand, 5Ј-GATCCGCTCACAATC cals). T84, SW480, and THP-1 cells were cultured in a 1/1 mixture of TTACCAATCTCTGTGAAGCCACGATGGGAATTGGTAAGATTGTG Ham’s F12 (Nissui) and DMEM (Nissui), a 1/1 mixture of L15 (MP