DOCSLIB.ORG

DNA Methylation Signature of Human Hippocampus in Alzheimer's

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Methylation Signature of Human Hippocampus in Alzheimer's Altuna et al. Clinical Epigenetics (2019) 11:91 https://doi.org/10.1186/s13148-019-0672-7 RESEARCH Open Access DNA methylation signature of human hippocampus in Alzheimer’s disease is linked to neurogenesis Miren Altuna1,2, Amaya Urdánoz-Casado1, Javier Sánchez-Ruiz de Gordoa1,2, María V. Zelaya3, Alberto Labarga4, Julie M. J. Lepesant5, Miren Roldán1, Idoia Blanco-Luquin1, Álvaro Perdones4, Rosa Larumbe1,2, Ivonne Jericó2, Carmen Echavarri1,2, Iván Méndez-López1,6, Luisa Di Stefano5 and Maite Mendioroz1,2* Abstract Background: Drawing the epigenome landscape of Alzheimer’s disease (AD) still remains a challenge. To characterize the epigenetic molecular basis of the human hippocampus in AD, we profiled genome-wide DNA methylation levels in hippocampal samples from a cohort of pure AD patients and controls by using the Illumina 450K methylation arrays. Results: Up to 118 AD-related differentially methylated positions (DMPs) were identified in the AD hippocampus, and extended mapping of specific regions was obtained by bisulfite cloning sequencing. AD-related DMPs were significantly correlated with phosphorylated tau burden. Functional analysis highlighted that AD-related DMPs were enriched in poised promoters that were not generally maintained in committed neural progenitor cells, as shown by ChiP-qPCR experiments. Interestingly, AD-related DMPs preferentially involved neurodevelopmental and neurogenesis- related genes. Finally, InterPro ontology analysis revealed enrichment in homeobox-containing transcription factors in the set of AD-related DMPs. Conclusions: These results suggest that altered DNA methylation in the AD hippocampus occurs at specific regulatory regions crucial for neural differentiation supporting the notion that adult hippocampal neurogenesis may play a role in AD through epigenetic mechanisms. Keywords: DNA methylation, Alzheimer’s, Hippocampus, Adult neurogenesis, Poised promoters, Homeobox, Neurodevelopment, Epigenetics Background studying epigenetic alterations in AD to shed some light on Alzheimer’s disease (AD) is the leading cause of age-related the pathogenesis of the disease. DNA methylation is a dementia and one of the major global challenges of our major epigenetic modification that involves the attachment time [1]. As knowledge about AD increases, so does the ap- of a methyl group to the 5-carbon position of a cytosine preciation of the pathogenic complexity of the disorder [2]. residue and usually occurs at cytosine-guanine dinucleo- Currently, AD is considered a complex disease that arises tides (CpG). These CpG dinucleotides are clustered in the from the interaction between environmental and genetic genome constituting CpG islands, which are enriched in factors [3], modulated through epigenetic mechanisms. the promoter of more than half of human genes and other Since epigenetics acts as an interface between the environ- important regulatory regions. ment and the genome, a major focus has been upon DNA methylation is known to be altered in complex diseases including AD. Indeed, a number of gene-specific * Correspondence: [email protected]; [email protected] differences in DNA methylation have been reported so far 1Neuroepigenetics Laboratory, Navarrabiomed, Public University of Navarre [4–8]. More recently, genome-wide approaches have un- (UPNA), IdiSNA (Navarra Institute for Health Research), c/ Irunlarrea, 3, 31008 covered additional gene-specific methylation differences Pamplona, Spain 2Department of Neurology, Complejo Hospitalario de Navarra, IdiSNA across different brain regions in AD [9, 10]. By using Illu- (Navarra Institute for Health Research), Pamplona, Spain mina Infinium HumanMethylation450K arrays, several Full list of author information is available at the end of the article © The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Altuna et al. Clinical Epigenetics (2019) 11:91 Page 2 of 16 genes have been found to be differentially methylated in estimated by using the CETS R package as previously AD brain autopsy samples, including some genes previ- described [14, 21]. No statistically significant differences ously identified as harboring genetic variants for AD, such were found in cell proportions between the AD group as ANK1 (ankyrin-1) or BIN1 (amphiphysin II) [11–14]. and the control group (control mean neuronal cell pro- Importantly, a number of these DNA methylation marks portion = 0.18 versus AD mean neuronal cell propor- are present in early stages of AD, suggesting that such tion = 0.20, p value = 0.64). changes might play a role in the onset of the disorder [12]. On the whole, these reports are providing significant data Characterization of differentially methylated positions in to enrich our understanding of AD pathogenesis [15, 16]. the AD hippocampus So far, genome-wide DNA methylation studies on AD Differential methylation analysis between the AD and have been performed across different brain regions in- control hippocampus was performed by using the cluding prefrontal, frontal, and superior temporal neo- limma package (R/Bioconductor). After adjusting for cortex, along with entorhinal cortex. In this study, we age and false discovery rate (FDR) correction, the ana- have taken a complementary strategy to profile lysis revealed 118 AD-related differentially methylated genome-wide DNA methylation in the human hippo- positions (DMPs) (absolute β-difference ≥ 0.1 and ad- campus, a brain region particularly vulnerable to AD justed p value ≤ 0.05) located next to 159 genes (Fig. 1, [17–19] and the core of pathological protein tau de- Table 1). Most of the DMPs, 102 (86.4%), were hyper- posits [20]. We have applied Infinium HumanMethyla- methylated in AD cases compared to controls (Fig. 2a– tion450 BeadChip array to hippocampal samples c). Inspection of methylation patterns revealed that obtained from a homogeneous cohort of pure AD AD-related DMPs showed a mild-to-moderate effect brains and controls. As a result, we report on novel size, as the average absolute β-difference was 0.12 (SD = gene-specific DNA methylation changes, recurrent 0.02) (Fig. 2b). These results are in line with previous across multiple affected subjects, which occur in the AD methylome studies, which showed recurrent gains AD hippocampus. This DNA methylation signature of in DNA methylation of a mild-to-moderate effect size the AD hippocampus correlates with tau burden and in other brain regions [9–14]. Indeed, up to 17 (10.7%) also with specific changes in histone marks. Finally, in differentially methylated genes in our study are found silico functional analysis of these changes points to mo- among the top-ranked genes in previous AD methy- lecular and biological alterations that may be especially lome studies performed on frontal, temporal, or ento- relevant to the pathogenesis of AD, including adult rhinal cortex [11, 12, 14](Additionalfile1:TableS2). brain neurogenesis. Genomic distribution of AD-related DMPs was next analyzed. We observed that DMPs were more likely to Results locate in CpG islands, showing a 1.5-fold enrichment (p Hippocampal samples from AD patients and controls value < 0.001) compared with random expectation based DNA methylation changes were evaluated in 36 post- on all probes included in the analysis. In addition, sig- mortem hippocampal samples obtained from 26 pa- nificant enrichment was found at first exon (2.4-fold, p tients with AD and 12 control subjects. To avoid value < 0.001) and body (1.2-fold, p value < 0.05) regions spurious molecular findings related to multiprotein de- (Fig. 2d). Moreover, up to 13 (8.1%) genes were associ- posits, only AD cases with pure deposits of p-tau and ated with 2 or more AD-related DMPs which would sug- β-amyloid were eligible for the study and controls were gest the presence of hotspots of aberrant methylation free of any protein aggregates. This approach maxi- gain in the human hippocampus affected by AD. mizes the chances of finding true molecular associa- tions with AD, even though reducing the number of Validation and additional mapping of DMPs older controls. Among the 118 AD-related DMPs, we selected 7 DMPs Neuropathological and demographic features of sub- to be validated based on their genomic location in or jects, including age, gender, ABC score, and postmortem near genes relevant to brain function or AD pathology, interval (PMI), are listed in Additional file 1: Table S1. including some of the candidate hotspots, i.e., HAND2, AD subjects were older than controls (81.2 ± 12.1 versus HOXA3, HIST1H3E, NXN, PAX3, RBMS1,andRHOB. 50.7 ± 21.5; p value< 0.01), and no differences were All the selected genes were successfully validated by bi- found regarding gender (p value = 0.16). The PMI ranged sulfite cloning sequencing since a significant correlation from 1.4 to 33 h and were not significantly different be- was shown between the 450K array data and methyla- tween groups (8.2 ± 4.2 h in controls versus 7.9 ± 7.1 h in tion levels obtained by bisulfite cloning sequencing
Load more

Recommended publications
  • Hearing Aging Is 14.1±0.4% GWAS-Heritable
    medRxiv preprint doi: https://doi.org/10.1101/2021.07.05.21260048; this version posted July 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC 4.0 International license . Predicting age from hearing test results with machine learning reveals the genetic and environmental factors underlying accelerated auditory aging Alan Le Goallec1,2+, Samuel Diai1+, Théo Vincent1, Chirag J. Patel1* 1Department of Biomedical Informatics, Harvard Medical School, Boston, MA, 02115, USA 2Department of Systems, Synthetic and Quantitative Biology, Harvard University, Cambridge, MA, 02118, USA +Co-first authors *Corresponding author Contact information: Chirag J Patel [email protected] Abstract With the aging of the world population, age-related hearing loss (presbycusis) and other hearing disorders such as tinnitus become more prevalent, leading to reduced quality of life and social isolation. Unveiling the genetic and environmental factors leading to age-related auditory disorders could suggest lifestyle and therapeutic interventions to slow auditory aging. In the following, we built the first machine learning-based hearing age predictor by training models to predict chronological age from hearing test results (root mean squared error=7.10±0.07 years; R-Squared=31.4±0.8%). We defined hearing age as the prediction outputted by the model on unseen samples, and accelerated auditory aging as the difference between a participant’s hearing age and age. We then performed a genome wide association study [GWAS] and found that accelerated hearing aging is 14.1±0.4% GWAS-heritable.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • Table S1. 49 Histone Variants Were Identified with High Sequence Coverage Through LC-MS/MS Analysis Electronic Supplementary
    Electronic Supplementary Material (ESI) for Analytical Methods. This journal is © The Royal Society of Chemistry 2020 Table S1. 49 histone variants were identified with high sequence coverage through LC-MS/MS analysis Sequence Uniprot IDs Protein Name Protein Description Coverage Ratio E2+/E2- RSD P07305 H10_HUMAN 67.5% Histone H1.0 OS=Homo sapiens GN=H1F0 PE=1 SV=3 4.85 23.3% Histone H1.1 OS=Homo sapiens GN=HIST1H1A PE=1 Q02539 H11_HUMAN 74.4% SV=3 0.35 92.6% Histone H1.2 OS=Homo sapiens GN=HIST1H1C PE=1 P16403 H12_HUMAN 67.1% SV=2 0.73 80.6% Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 P16402 H13_HUMAN 63.8% SV=2 0.75 77.7% Histone H1.4 OS=Homo sapiens GN=HIST1H1E PE=1 P10412 H14_HUMAN 69.0% SV=2 0.70 80.3% Histone H1.5 OS=Homo sapiens GN=HIST1H1B PE=1 P16401 H15_HUMAN 79.6% SV=3 0.29 98.3% Testis-specific H1 histone OS=Homo sapiens GN=H1FNT Q75WM6 H1FNT_HUMAN 7.8% \ \ PE=2 SV=3 Histone H1oo OS=Homo sapiens GN=H1FOO PE=2 Q8IZA3 H1FOO_HUMAN 5.2% \ \ SV=1 Histone H1t OS=Homo sapiens GN=HIST1H1T PE=2 P22492 H1T_HUMAN 31.4% SV=4 1.42 65.0% Q92522 H1X_HUMAN 82.6% Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 1.15 33.2% Histone H2A type 1 OS=Homo sapiens GN=HIST1H2AG P0C0S8 H2A1_HUMAN 99.2% PE=1 SV=2 0.57 26.8% Q96QV6 H2A1A_HUMAN 58.0% Histone H2A type 1-A OS=Homo sapiens 0.90 11.2% GN=HIST1H2AA PE=1 SV=3 Histone H2A type 1-B/E OS=Homo sapiens P04908 H2A1B_HUMAN 99.2% GN=HIST1H2AB PE=1 SV=2 0.92 30.2% Histone H2A type 1-C OS=Homo sapiens Q93077 H2A1C_HUMAN 100.0% GN=HIST1H2AC PE=1 SV=3 0.76 27.6% Histone H2A type 1-D OS=Homo sapiens P20671
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors
    11902 • The Journal of Neuroscience, September 8, 2010 • 30(36):11902–11916 Development/Plasticity/Repair Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors Kangxin Jin,1,2 Haisong Jiang,1,2 Zeqian Mo,3 and Mengqing Xiang1,2 1Center for Advanced Biotechnology and Medicine and Department of Pediatrics, 2Graduate Program in Molecular Genetics, Microbiology and Immunology, and 3Department of Cell Biology and Neuroscience, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 The establishment of functional retinal circuits in the mammalian retina depends critically on the proper generation and assembly of six classes of neurons, five of which consist of two or more subtypes that differ in morphologies, physiological properties, and/or sublaminar positions. How these diverse neuronal types and subtypes arise during retinogenesis still remains largely to be defined at the molecular level. Here we show that all four family members of the early B-cell factor (Ebf) helix-loop-helix transcription factors are similarly expressedduringmouseretinogenesisinseveralneuronaltypesandsubtypesincludingganglion,amacrine,bipolar,andhorizontalcells, and that their expression in ganglion cells depends on the ganglion cell specification factor Brn3b. Misexpressed Ebfs bias retinal precursors toward the fates of non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, whereas a dominant-negative Ebf suppresses the differentiation of these cells as well as ganglion cells. Reducing Ebf1 expression by RNA interference (RNAi) leads to an inhibitory effect similar to that of the dominant-negative Ebf, effectively neutralizes the promotive effect of wild-type Ebf1, but has no impact on the promotive effect of an RNAi-resistant Ebf1.
    [Show full text]
  • A Study of Chemotherapy Resistance in Acute Myeloid Leukemia
    A Study of Chemotherapy Resistance in Acute Myeloid Leukemia A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Susan Kay Rathe IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY David A. Largaespada October, 2013 © Susan Kay Rathe 2013 Acknowledgements Funding: The leukemia research was funded by The Leukemia & Lymphoma Society (grant 7019-04). The MMuFLR workflow was funded by The Children's Cancer Research Fund. University of Minnesota Resources: The BioMedical Genomics Center provided services for gene expression microarray, RNA sequencing, oligo preparation, and Sanger sequencing. The Minnesota Supercomputing Institute maintains the Galaxy Software, as well as provides data management services and training. The Masonic Cancer Center Bioinformatics Core provided guidance in the analysis of the RNA-seq data. The FDA Drug Screen was performed at the Institute for Therapeutics Discovery and Development. Colleagues: First and foremost, I would like to recognize Dr. David Largaespada for his mentorship and the opportunity to continue research he started while a postdoc in Dr. Neal Copeland’s lab. I would also like to thank the many members of the Largaespada lab who provided direct or indirect assistance to my research. Dr. Bin Yin continued Dr. Largaespada’s work on the BXH-2 AML cell lines by making drug resistant derivatives and provided training in cell culture and drug assay techniques. Dr. Won-Il Kim developed the TNM mouse model and provided training in mouse related experimental techniques. Miechaleen Diers did all of the tail vein injections for the AML transplants and assisted with necropsies.
    [Show full text]
  • Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
    Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • CREB3L2-Pparg Fusion Mutation Identifies a Thyroid Signaling Pathway Regulated by Intramembrane Proteolysis
    Research Article CREB3L2-PPARg Fusion Mutation Identifies a Thyroid Signaling Pathway Regulated by Intramembrane Proteolysis Weng-Onn Lui,3 Lingchun Zeng,1 Victoria Rehrmann,1 Seema Deshpande,5 Maria Tretiakova,1 Edwin L. Kaplan,2 Ingo Leibiger,3 Barbara Leibiger,3 Ulla Enberg,3 Anders Ho¨o¨g,4 Catharina Larsson,3 and Todd G. Kroll1 Departments of 1Pathology and 2Surgery, University of Chicago Medical Center, Chicago, Illinois; Departments of 3Molecular Medicine and Surgery and 4Oncology-Pathology, Karolinska Institute, Karolinska University Hospital, Stockholm, Sweden; and 5Department of Pathology, Emory University School of Medicine, Atlanta, Georgia Abstract cancer in patients; and (c) the implementation of effective molecular-targeted chemotherapies that have relatively few side The discovery of gene fusion mutations, particularly in effects. The discovery of fusion mutations is therefore important, leukemia, has consistently identified new cancer pathways particularly in carcinoma, the most common cancer group in and led to molecular diagnostic assays and molecular-targeted which few gene fusions have been identified (1). The recent chemotherapies for cancer patients. Here, we report our discoveries of ERG (2) and ALK (3) gene fusions in prostate and discovery of a novel CREB3L2-PPARg fusion mutation in lung carcinoma, respectively, increase the prospect that new thyroid carcinoma with t(3;7)(p25;q34), showing that a family diagnostic and therapeutic strategies based on gene fusions will of somatic PPARg fusion mutations exist in thyroid cancer. The be applicable to common epithelial cancers. CREB3L2-PPARg fusion encodes a CREB3L2-PPAR; fusion Families of gene fusions tend to characterize specific cancer protein that is composed of the transactivation domain of types.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • CCNL1 (NM 020307) Human Untagged Clone – SC113160 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC113160 CCNL1 (NM_020307) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCNL1 (NM_020307) Human Untagged Clone Tag: Tag Free Symbol: CCNL1 Synonyms: ania-6a; ANIA6A; BM-001; PRO1073 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_020307, the custom clone sequence may differ by one or more nucleotides ATGGCGTCCGGGCCTCATTCGACAGCTACTGCTGCCGCAGCCGCCTCATCGGCCGCCCCAAGCGCGGGCG GCTCCAGCTCCGGGACGACGACCACGACGACGACCACGACGGGAGGGATCCTGATCGGCGATCGCCTGTA CTCGGAAGTTTCACTTACCATCGACCACTCTCTGATTCCGGAGGAGAGGCTCTCGCCCACCCCATCCATG CAGGATGGGCTCGACCTGCCCAGTGAGACGGACTTACGCATCCTGGGCTGCGAGCTCATCCAGGCCGCCG GCATTCTCCTCCGGCTGCCGCAGGTGGCGATGGCAACGGGGCAGGTGTTGTTTCATCGTTTTTTCTACTC CAAATCTTTCGTCAAACACAGTTTCGAGATTGTTGCTATGGCTTGTATTAATCTTGCATCAAAAATCGAA GAAGCACCTAGAAGAATAAGAGATGTGATTAATGTATTCCACCACCTCCGCCAGTTAAGAGGAAAAAGGA CTCCAAGCCCCCTGATCCTTGATCAGAACTACATTAACACCAAAAATCAAGTTATCAAAGCAGAGAGGAG GGTGCTAAAGGAGTTGGGATTTTGTGTTCATGTCAAGCATCCTCATAAGATCATTGTTATGTATTTACAA GTCTTAGAATGTGAACGTAATCAAACCCTGGTTCAAACTGCCTGGAATTACATGAATGACAGTCTTCGAA CCAATGTGTTTGTTCGATTTCAACCAGAGACTATAGCATGTGCTTGCATCTACCTTGCAGCTAGAGCACT TCAGATTCCGTTGCCAACTCGTCCCCATTGGTTTCTTCTTTTTGGTACTACAGAAGAGGAAATCCAGGAA ATCTGCATAGAAACACTTAGGCTTTATACCAGAAAAAAGCCAAACTATGAATTACTGGAAAAAGAAGTAG AAAAAAGAAAAGTAGCCTTACAAGAAGCCAAATTAAAAGCAAAGGGATTGAATCCGGATGGAACTCCAGC
    [Show full text]