1 Cross-talk between PRMT1-mediated methylation and ubiquitylation on RBM15 controls RNA splicing
2 Li Zhang1*, Ngoc-Tung Tran1*, Hairui Su1*, Rui Wang2, Yuheng Lu11, Haiping Tang4, Sayura Aoyagi10,
3 Ailan Guo10, Alireza Khodadadi-Jamayran1, Dewang Zhou1, Kun Qian5, Todd Hricik3, Jocelyn Côté6,
4 Xiaosi Han8, Wenping Zhou7, Suparna Laha9, Omar Abdel-Wahab3, Ross L. Levine3, Glen Raffel9,
5 Yanyan Liu7, Dongquan Chen12, Haitao Li4, Tim Townes1, Hengbin Wang1, Haiteng Deng4, Y. George
6 Zheng5, Christina Leslie11, Minkui Luo2, and Xinyang Zhao1
7 8 1. Department of Biochemistry and Molecular Genetics, UAB Stem Cell Institute, The University of 9 Alabama at Birmingham, Birmingham, AL 35294, USA. 10 2. Program of Molecular Pharmacology, Sloan Kettering Institute, New York, NY 10021, USA. 11 3. HOPP, Sloan Kettering Institute, New York, NY 10021, USA. 12 4. School of Life Sciences, Tsinghua University, Beijing, 100084 China. 13 5. Department of Pharmaceutical & Biomedical Sciences, The University of Georgia, Athens, GA 14 30602, USA 15 6. Department of Cellular and Molecular Medicine, University of Ottawa, 451 Smyth Road, Ottawa, 16 ON K1H 8M5, Canada. 17 7. Department of Internal Medicine, Affiliated Cancer Hospital of Zhengzhou University & Henan 18 Cancer Hospital, Zhengzhou 450008, China 19 8. Department of Neurology, Comprehensive Cancer Center, The University of Alabama at 20 Birmingham, Birmingham, AL 35294, USA. 21 9. Division of Hematology and Oncology, University of Massachusetts Medical School, 364 22 Plantation St, Worcester, MA 01605, USA. 23 10. Cell Signaling Inc. 3 Trask lane, Danvers, MA 01923, USA. 24 11. Computational Biology Program, Sloan Kettering Institute, New York, NY 10021, USA. 25 12. Division of Preventive Medicine, The University of Alabama at Birmingham, Birmingham, AL 26 35294, USA. 27 28 * These authors contribute equally.
29 Corresponding Author: Xinyang Zhao Ph.D. email: [email protected], Tel: 205-975-5016 Fax: 205-975- 30 3335. 31 32 33 Keywords: PRMT1, RUNX1, c-MPL, GATA1, CNOT4, ubiquitylation, megakaryopoiesis, leukemia, 34 hematopoiesis, RNA metabolism, RNA splicing 35 36 Major Organism: Human 37 38 Impact Statement: Inhibiting PRMT1 enzymatic activity promotes megakaryocyte differentiation via 39 RBM15-mediated RNA metabolism, which is dysregulated in hematological malignancies. 40
1 41 Abstract:
42 RBM15, an RNA binding protein, determines cell-fate specification of many tissues including blood. We
43 demonstrate that RBM15 is methylated by protein arginine methyltransferase 1 (PRMT1) at residue
44 R578 leading to its degradation via ubiquitylation by an E3 ligase (CNOT4). Overexpression of PRMT1 in
45 acute megakaryocytic leukemia cell lines blocks megakaryocyte terminal differentiation by
46 downregulation of RBM15 protein level. Restoring RBM15 protein level rescues megakaryocyte terminal
47 differentiation blocked by PRMT1 overexpression. At the molecular level, RBM15 binds to pre-mRNA
48 intronic regions of genes important for megakaryopoiesis such as GATA1, RUNX1, TAL1 and c-MPL.
49 Furthermore, preferential binding of RBM15 to specific intronic regions recruits the splicing factor SF3B1
50 to the same sites for alternative splicing. Therefore, PRMT1 regulates alternative RNA splicing via
51 reducing RBM15 protein concentration. Targeting PRMT1 may be a curative therapy to restore
52 megakaryocyte differentiation for acute megakaryocytic leukemia.
2 53 Introduction:
54 RNA binding proteins control post-transcriptional processing such as alternative RNA splicing,
55 polyadenylation and protein translation, which is a prevalent part of gene regulation in normal cell
56 differentiation and in cancer development (Cabezas-Wallscheid et al., 2014; Chen et al., 2014; de Klerk
57 and t Hoen, 2015; Shapiro et al., 2011). Arginine methylation of RNA binding proteins by protein arginine
58 methyltransferases (PRMTs) regulates RNA splicing (Bedford and Clarke, 2009; Bezzi et al., 2013;
59 Cheng et al., 2007; Sinha et al., 2010), subcellular localizations (Matsumoto et al., 2012; Nichols et al.,
60 2000; Tradewell et al., 2012) as well as the binding affinity to RNA molecules (Rho et al., 2007).
61 Nevertheless, the role of arginine methylation in regulating protein stability remains unknown. Here we
62 demonstrate that an RNA binding protein, RBM15, is methylated by PRMT1, which triggers its
63 ubiquitylation by an E3 ligase CNOT4.
64
65 RBM15 belongs to the Split Ends (Spen) family of proteins. Spen proteins are evolutionally conserved
66 RNA binding proteins, which are involved in transcriptional regulation of NOTCH, WNT and MAPK signal
67 transduction pathways (Chang et al., 2008; Chen and Rebay, 2000; Oswald et al., 2002; Rebay et al.,
68 2000; Su et al., 2015). Recently SPEN and RBM15 have been shown to be essential for Xist-mediated X
69 chromosome inactivation (Chu et al., 2015; McHugh et al., 2015; Minajigi et al., 2015; Moindrot et al.,
70 2015; Monfort et al., 2015). Genetic studies in Drosophila have shown that spen is required for cell-fate
71 decision during development (Kolodziej et al., 1995). FPA, the RBM15 homolog in Arabidopsis, controls
72 flowering via regulating alternative polyadenylation of antisense RNAs at the FLC locus (Hornyik et al.,
73 2010). RBM15 is essential for the development of multiple tissues in mouse knockout models, in
74 particular, for the maintenance of the homeostasis of long-term hematopoietic stem cells and for
75 megakaryocyte (MK) and B cell differentiation (Niu et al., 2009; Raffel et al., 2009; Xiao et al., 2015).
76 Furthermore, RBM15 is involved in the chromosome translocation t(1;22) which produces the RBM15-
77 MKL1 fusion protein associated with acute megakaryoblastic leukemia (AMKL) (Ma et al., 2001; Mercher
78 et al., 2001).
3 79
80 Spen proteins consist of two domains: an RNA binding domain and a SPOC (Spen Paralog and Ortholog
81 C-terminal) domain. Previously, SPEN proteins such as RBM15 and SHARP have been shown to use
82 the SPOC domains to recruit histone deacetylases for transcriptional regulation of Notch pathway and
83 steroid receptor-dependent transcriptional regulation, and to recruit MLL complexes to promoters for
84 histone H3K4 methylation (Ariyoshi and Schwabe, 2003; Lee and Skalnik, 2012; Ma et al., 2007; Oswald
85 et al., 2002; Shi et al., 2001; Xiao et al., 2015). Additionally, RBM15 is also involved in RNA export
86 (Uranishi et al., 2009; Zolotukhin et al., 2008; Zolotukhin et al., 2009). RBM15 resides mainly within
87 nuclear RNA splicing speckles by confocal microscopy (Horiuchi et al., 2013b), suggesting that RBM15 is
88 involved in RNA splicing. However, how spen proteins control cell differentiation is not described at
89 molecular level.
90
91 In this report, we linked cellular differentiation to RBM15-regulated RNA metabolism using
92 megakaryocyte differentiation as a model. We demonstrated that RBM15 binds to specific introns of pre-
93 mRNA of genes such as RUNX1, GATA1 and TPOR (aka c-MPL or MPL), which play critical roles in
94 megakaryocyte differentiation, and to 3’UTRs of genes involved in RNA splicing and metabolic
95 regulation. Reducing RBM15 protein concentration by PRMT1-mediated methylation favors the
96 production of the alternatively spliced isoforms: RUNX1a, GATA1s and c-MPL-exon9-, a truncated c-
97 MPL isoform. We also found that RBM15 promotes megakaryocyte maturation in human primary cells.
98 Therefore, PRMT1-RBM15 pathway fine-tunes cell differentiation via controlling the RBM15 protein
99 concentration.
100
101 Results
102
103 RBM15 is methylated by PRMT1
104
4 105 In AMKL, MK differentiation is blocked. Gene expression data from AMKL patient samples (Bourquin et
106 al., 2006) shows a higher PRMT1 expression level than other types of acute myeloid leukemia.
107 Furthermore, high expression of PRMT1 is correlated with poor survival rate in acute myeloid leukemia
108 (Figure 1-figure supplement 1). These clinical data strongly support that PRMT1 might be a key player
109 in leukemogenesis. We applied bioorthogonal profiling of protein methylation (BPPM) technology (Figure
110 1-figure supplement 2) (Wang et al., 2011) to identify proteins methylated by PRMT1 in
111 megakaryocytes. We found that RBM15 is methylated at R578 by mass spectrometry analysis (Figure 1-
112 figure supplement 3A). Alignment of the RBM15 sequences covering the methylation site shows that
113 the methylation site is conserved across diverse species (Figure 1A) and downstream of the RBM15
114 RNA binding domains (Figure 1-figure supplement 3B).
115
116 We validated that two generic antibodies against mono-methyl arginine proteins and against di-methyl
117 arginine proteins (Cell Signaling Inc.), can recognize the methylated peptides from RBM15 (NP_073605)
118 R578 region specifically in dot blots (Figure 1-figure supplement 3C&D). We observed that affinity
119 purified Flag-tagged RBM15 protein is more efficiently methylated than the R578K mutant in western
120 blots in transfected 293T cells (Figure 1B, compare lanes 1 and 2) as well as in leukemia cells (Figure
121 1-figure supplement 3E). Given that the R578 is the last arginine in the RDRDRD repeat, we mutated
122 all three arginines, but we still detected low methylation background indicating other arginine residues
123 not in the repeat are methylated (Figure 1-figure supplement 3F).
124
125 To determine whether PRMT1 is responsible, we overexpressed the two major isoforms of PRMT1 (V1
126 i.e. Q99873 and V2 i.e. Q99873-3) respectively in 293T cells together with wild type RBM15 (Figure 1C).
127 Overexpressing either isoform enhanced the mono-methylation of RBM15 (Figure 1C, compare lanes 1,
128 2 and 3) and the V2 dimethylated RBM15 more effectively than the V1. Given that the V2 contains
129 additional amino acids in the N terminal region relative to V1 (Figure 1D), it is striking that the PRMT1 V2
130 is primarily responsible for the dimethylation of RBM15 in vivo (Figure 1C).
5 131
132 In vitro methylation assays showed that the RBM15 peptide was dimethylated as efficiently as the
133 histone H4 peptide without monomethylated peptides detected (Figure 1-figure supplement 3G). We
134 then used purified Flag-RBM15 from 293T cells to conduct in vitro methylation assays. Only the wild type
135 RBM15 protein but not the R578K mutant was effectively dimethylated by PRMT1 in vitro (Figure 1E).
136 These results together with in vivo methylation data collectively argue that mono-methylated RBM15 is a
137 transient intermediate in vivo.
138
139 To confirm that PRMT1 is responsible for in vivo methylation, we made MEG-01 stable cell lines
140 expressing doxycycline-inducible shRNA against PRMT1. We detected the methylated form of RBM15
141 with both mono-methyl and dimethyl antibodies. Reducing the expression of PRMT1 decreased the
142 methylation level of the endogenous RBM15 (Figure 1F). When the leukemia cells were treated with
143 DB75 (a PRMT1 inhibitor) (Yan et al., 2014), RBM15 methylation was reduced (Figure 1G). The
144 methylation of RBM15 was further confirmed by an antibody raised against dimethylated RBM15 at R578
145 (Figure 1-figure supplement 4). Therefore, we concluded that PRMT1 enzymatic activity is responsible
146 for the methylation of RBM15 at R578. RBM15 might be methylated by other PRMTs and at other sites
147 since some methylation signals especially the monomethylation signals are present despite PRMT1
148 knock-down or inhibition and in the R578K mutant respectively. Nevertheless the PRMT1-dependent
149 R578 methylation forms the majority of dimethylated species.
150
151 RBM15 protein stability is determined by its methylation status
152
153 When RBM15 was co-expressed together with PRMT1, RBM15 protein level was reduced. Strikingly, the
154 V2 isoform (detected by V2 specific antibody) caused a greater reduction of RBM15 protein level (Figure
155 2A), which coincided with the PRMT1 V2’s capability for RBM15 dimethylation (Figure 1C). To further
156 confirm that methylation triggers protein degradation, we used non-specific methyltransferase inhibitors
6 157 (adox + MTA) (Figure 2B, left panel) as well as DB75 (Figure 2B right panel) to treat MEG-01 cells.
158 Consistently, PRMT1 knockdown increased RBM15 protein level (Figure 2C, left panel) but not the
159 RBM15 mRNA level (Figure 2C, right panel) in MEG-01 cells as well as in other leukemia cells (data not
160 shown). Conversely, overexpression of PRMT1 V2 (Figure 2D, left panel) reduced RBM15 protein level.
161 Given that the RBM15 mRNA levels in PRMT1 knockdown cells and in PRMT1 overexpressing cells
162 were the same as in the control MEG-01 cells (Figure 2D middle and right panels), we concluded that
163 PRMT1 controls RBM15 at protein level. Finally we observed that the specific knockdown of PRMT1 V2
164 resulted in higher RBM15 protein level (Figure 2E). Taken together, we concluded that the PRMT1 V2
165 enzymatic activity plays a major role in regulating the stability of the RBM15 protein.
166
167 When we co-expressed RBM15 R578K together with PRMT1 V2 protein in 293T cells, we found that the
168 mutant protein remained stable regardless of overexpression of PRMT1 V2 (Figure 2F, compare lanes 4
169 and 2). Thus, methylation of RBM15 at R578 is the direct cause for protein degradation. To further
170 determine whether RBM15 degradation is affected by methylation on R578, we compared the half-life of
171 the wild type versus the mutant RBM15 proteins. The Flag-tagged RBM15 mutant has longer half-life
172 compared with the wild type RBM15 (Figure 2G). Tag does not affect protein stability as the tagged
173 RBM15 and endogenous RBM15 have similar half-life.
174
175 RBM15 degradation is an ubiquitylation-mediated process
176
177 We showed that the proteasome inhibitor MG132 stabilized the RBM15 protein, which indicates that the
178 degradation is mediated by ubiquitylation (Figure 3A). To further confirm that the RBM15 protein is
179 ubiquitylated, we used nickel beads to purify the poly-ubiquitylated form of RBM15 under denaturing
180 conditions from 293T cells expressing the poly-histidine tagged ubiquitin and Flag-tagged RBM15
181 (Figure 3B).
182
7 183 To investigate whether methylation of RBM15 by PRMT1 is required for RBM15 ubiquitylation, we
184 mutated the methylation site to lysine. Compared with the wild type RBM15 protein, significantly less
185 R578K RBM15 protein was modified by ubiquitin (Figure 3C compare lanes 4 and 5,) when the
186 respective plasmids were co-expressed in 293T cells. Thus, methylation on R578 for protein
187 ubiquitylation is one major pathway for RBM15 degradation. To validate endogenous RBM15 is also
188 ubiquitylated in a methylation-dependent manner, we treated the MEG-01 cells with PRMT1 inhibitor
189 DB75. After DB75 treatment, less ubiquitylated RBM15 protein were observed (Figure 3D).
190
191 CNOT4 is the E3 ligase responsible for RBM15 ubiquitylation
192
193 PRMT1 has been shown to physically interact with the CCR4-NOT complex via the CAF1 (aka CNOT7)
194 subunit for RNA export (Kerr et al., 2011; Robin-Lespinasse et al., 2007). Furthermore, CNOT4, a
195 subunit of the CCR4-NOT complex, has been shown to be an E3 ligase (Albert et al., 2002). To examine
196 whether CNOT4 might be responsible for ubiquitylation of RBM15, we co-expressed CNOT4 with RBM15
197 in 293T cells. Strikingly, when RBM15 was co-expressed with PRMT1 and CNOT4, RBM15 was more
198 severely ubiquitylated than RBM15 expressed with PRMT1 or CNOT4 alone (Figure 3E). We also
199 detected the interaction between PRMT1 and RBM15 wild type and mutant proteins in 293T cells
200 (Figure 3E lanes 3,4 and 7,8). Moreover, only the wild type not the mutant RBM15 interacted with HA-
201 tagged CNOT4 (Figure 3E lane 3, 4). In Figure 3E and Figure 3C, we showed that the RBM15 R578K,
202 which cannot be methylated by PRMT1, had significantly less ubiquitylated RBM15 protein. This data
203 strongly suggest that the methylation is required for subsequent ubiquitylation by the CNOT4 complex.
204
205 To further confirm that CNOT4 is the enzyme responsible for endogenous RBM15 ubiquitylation, we
206 showed that CNOT4 knockdown (western blot in Figure 3F and real-time PCR in Figure 3-figure
207 supplement 2A) increased the amount of endogenous RBM15 protein in MEG-01 cells (Figure 3F).
208 When MEG-01 cells were treated with DB75, CNOT4 knockdown did not further stabilize the RBM15
8 209 protein (Figure 3F). These results confirm that methylation is required for the subsequent degradation of
210 the RBM15 protein. We used CRISPR technology to knockout one allele of CNOT4 gene in 293T cells.
211 We also found that removal of one allele of CNOT4 stabilized the endogenous RBM15 protein levels
212 (Figure 3-figure supplement 2B&C).
213
214 We then purified the RBM15 and CNOT4 proteins (Figure 3-figure supplement 1) to do in vitro
215 ubiquitylaton assay. The methylated RBM15 protein (Flag-tagged) by PRMT1 was more efficiently
216 ubiquitylated by CNOT4 than the purified RBM15 R578 in vitro (Figure 3G compare lane 5 to lane 3).
217 Taken together, we demonstrated that the RBM15 protein stability is negatively regulated by PRMT1-
218 mediated methylation at R578, and CNOT4 is an E3 ligase responsible for degrading the methylated
219 RBM15. To understand further whether the methylation site on RBM15 is sufficient to bind to CNOT4
220 complex, we synthesized two RBM15 peptides covering the arginine methylation sites to pull-down
221 CNOT4 from cell extract. The di-methylated peptide bound specifically to the CNOT4 protein (Figure
222 3H), which is agreeable with the coimmunprecipitation data in Figure 3E showing that CNOT4 only
223 interacted with wild type RBM15 proteins. This result implies that either CNOT4 or subunits in the
224 CNOT4 complex directly interacts with RBM15 via the methylation mark.
225
226 PRMT1 V2 inhibits MK maturation via a methylation-ubiquitylation switch on RBM15
227
228 PRMT1 RNA levels were measured in isolated mouse long-term hematopoietic stem cells (LT-HSC),
229 short-term hematopoietic stem cells (ST-HSC), progenitor cells and terminally differentiated lineages.
230 PRMT1 expression level was the lowest in LT-HSC and higher especially in myeloid progenitor cells
231 (Figure 4-figure supplement 1A-D). Megakaryocyte-erythrocyte progenitor (MEP) cells expressed the
232 highest level of PRMT1. We also checked the expression of PRMT1 and RBM15 in human cells with
233 HemaExplorer (Bagger et al., 2013). The expression profiles of PRMT1 and RBM15 in different lineages
234 are shared between humans and mice (Figure 4-figure supplement 1E-G). The mRNA level of RBM15
9 235 does not change as dramatically as that of PRMT1 among different lineages, which implies that post-
236 transcriptional modification such as arginine methylation of RBM15 might contribute to the regulation of
237 RBM15 protein levels.
238
239 To understand the biological functions of PRMT1 in MK differentiation, we used PMA to stimulate MEG-
240 01 cells into mature MK cells (Ogura et al., 1988). Upon PMA stimulation, we observed upregulation of
241 the RBM15 protein within 12 hours and simultaneous down-regulation of the PRMT1 V2 protein (Figure
242 4A left and middle panels). During the incubation period, neither the RBM15 mRNA level (Figure 4A,
243 right panel) nor the total PRMT1 protein level (mainly V1 isoform) changed more than 1.5 folds,
244 nevertheless we found that RBM15 protein level was significantly increased. The methyl-RBM15 level
245 reduced coinciding with the decrease of the isoform V2 protein (detected by V2-specific antibody). Thus
246 we conclude the isoform V2 –mediated methylation is one mechanism for upregulating RBM15 protein
247 level, although we cannot rule out other possibilities such as enhanced protein translation. To assess
248 RBM15 effects on MK differentiation, we ectopically expressed the wild type and the R578K mutant
249 proteins in MEG-01 cells by retroviruses respectively. After stimulation with PMA for 7 days, more CD41+
250 cells (Figure 4B) as well as higher levels of polyploidy (Figure 4C) were detected. In comparison to wild
251 type RBM15, the RBM15 R578K generated more CD41+ cells, which may be explained by increased
252 RBM15 R578K stability (Figure 3).
253
254 However, the cell line differentiation system can only mimic certain aspects of normal megakaryopoiesis.
255 For example, we cannot detect CD42 in MEG-01 cells upon PMA stimulation. Therefore, we performed
256 MK differentiation assays with adult human CD34+ cells. Compared to the control, DB75 treated cells
257 produced a higher percentage of CD61+CD42+ mature MK cells (Figure 4D). Conversely, ectopic
258 expression of PRMT1 V2 in CD34+ cells promoted the generation of single positive CD61+ MK progenitor
259 cells but blocked MK cell maturation (Figure 4E). Like PRMT1 overexpression, knockdown of RBM15 by
260 shRNAs blocked MK maturation (Figure 4F, Figure 4-figure supplement 2), and overexpression of
10 261 both RBM15 and its mutant promoted the maturation of CD34+ cells (Figure 4G). Overexpression of
262 RBM15 or RBM15 R578K rescued megakaryocyte differentiation in CD34+ cells expressing PRMT1 V2
263 (Figure 4H). Taken together, PRMT1 controls megakaryopoiesis via controlling RBM15 protein levels.
264
265 RBM15 binds to pre-mRNA of genes in megakaryocyte differentiation
266 To understand how RBM15 protein level controls megakaryocytic differentiation, we affinity purified
267 RBM15-associated proteins from 293T cells, which express endogenous RBM15 protein. Mass
268 spectrometry analysis showed that RBM15 was associated with ASH2 and WTAP, two known RBM15-
269 bound proteins (Horiuchi et al., 2013a; Lee and Skalnik, 2012) as well as proteins involved in RNA
270 splicing (Figure 7-source data 1), which is consistent with prior findings that RBM15 resides in nuclear
271 splicing speckles (Horiuchi et al., 2013b). Thus, we reasoned that RBM15 might regulate alternative
272 splicing. We performed RIP (RNA immunoprecipitation assay) under stringent wash conditions with an
273 RBM15 antibody recognizing the N-terminal region, followed by RT-PCR to detect genes known
274 important for megakaryocyte differentiation. We detected the bindings of RUNX1, GATA1 and c-MPL
275 mRNAs with RBM15, while we did not detect that of control GAPDH mRNA (Figure 5A). Then we took
276 an unbiased approach to identify global RBM15 target genes using RIP-seq. We have identified 1297
277 genes to which RBM15 binds directly (Figure 5-source data 1). 55% of RBM15 binding sites are in
278 intronic regions, and 41% are in 3’UTR regions with the remainder in 5’UTRs and CDS elements (Figure
279 5B). Gene ontology pathway analysis showed RBM15 regulates genes involved in differentiation and
280 signal transduction via binding to intronic regions whereas genes involved in RNA splicing and metabolic
281 pathways via binding to 3’UTRs (Figure 5C&D). We found that overexpression of PRMT1 V1 and V2
282 isoforms as well as reducing the expression level of RBM15 enhanced mitochondria biogenesis in MEG-
283 01 cells (Figure 5-figure supplement 3), which implies that PRMT1-RBM15 axis regulates metabolism.
284 Among the RBM15 targeting genes with binding sites in introns are transcription factors known to be
285 important for megakaryocyte differentiation: RUNX1, GATA1, and TAL1 (Figure 5-figure supplement
286 1,2). Although the transcription factor LEF1 has not yet been linked to MK differentiation, LEF1 has been
11 287 shown to interact with RUNX1 genetically and biochemically (Daga et al., 1996; Mayall et al., 1997;
288 McNerney et al., 2013). Although RBM15 binding peaks on c-MPL pre-mRNA did not achieve
289 significance according to the stringent statistical algorithms used for the RIP-seq data (Figure 5-figure
290 supplement 2), we were able to confirm by real-time PCR assay (Figure 7).
291 To further investigate how RBM15 regulates alternative RNA splicing, we performed RNA-seq assays
292 with RNA isolated from MEG-01 cells with or without RBM15 knockdown. The gene expression profile
293 analysis showed that RBM15 knock-down alters metabolism and endoplasmic reticulum stress response
294 pathways as well as proteins involved in chromatin assembly (Figure 5-source data 2). We then used
295 two programs (DEXSeq and MISO) to detect the alterations of exon usage. DEXSeq detected 9704
296 differential exon usage events with P value lower than 0.05 and fold change higher than 1.2 fold. The
297 MISO program detected 2027 differential exon usage events with Bayes factor higher than 2. RBM15
298 regulates differential exon usage in all eight categories in either directions (Figure 5 E&F). Significant
299 exon usage changes of 156 genes in the RIP-seq group were detected by both programs (Figure 5-
300 source data 3) including transcription factors RUNX1, GATA1, STAT5A, TAF9, TAL1, LEF1 and
301 ZNF160 as well as chromatin remodeling factors such as macroH2A, DEK, BRD9, TLE3, NCOR1 and
302 HDAC4. RUNX1, GATA1, STAT5A and TAL1(SCL) are well-studied transcription factors for their roles in
303 megakaryocyte differentiation (Crispino, 2005; Olthof et al., 2008; Tijssen et al., 2011). Signal
304 transduction genes important for hematopoiesis such as RPTOR and CDC42 (Kaushansky and
305 Kaushansky, 2014) were found on the list as well. Therefore, RBM15 protein level may affect
306 hematopoiesis via multiple pathways. At a molecular level, RBM15 not only affects alternative RNA
307 splicing such as RUNX1, GATA1, TAL1, STAT5A, LEF1 but also affects UTR utilization (e.g. TAL1),
308 mixed exon usage (e.g. CDC42) and intron retention (e.g. macroH2A) (Figure 5-figure supplement 4).
309 The MISO program was used to analyze how GATA1 is alternatively spliced. After knocking down
310 RBM15, we found skipping of exon 2 on GATA1 (Figure 5G) and validated our results by resolving
311 GATA1 isoforms in an agarose gel (Figure 5H).
312
12 313 RBM15 regulates alternative splicing of genes important for megakaryocyte differentiation
314 GATA1 has two different isoforms: full length GATA1 (GATA1fl), and short form GATA1 (GATA1s), which
315 is generated by skipping the exon 2 (Rainis et al., 2003). In Down syndrome leukemia, GATA1fl mRNA
316 translates the GATA1s protein when mutations on GATA1fl mRNA create an alternative translation start
317 site. Using isoform specific probes targeting to the exon junctions of GATA1s and GATA1fl to perform
318 real time PCR assays, we found that reducing RBM15 protein level favored the accumulation of GATA1s
319 as the ratio of GATA1fl/GATA1s was reduced (Figure 6A top panel). Conversely, overexpression of
320 RBM15 reversed the ratio of GATA1fl/GATA1s in favor of GATA1fl. The RBM15 R578K protein, which is
321 more stable, altered the ratio more than the wild type RBM15. Furthermore, overexpression of V2 in
322 MEG-01 cells reduced the ratio of GATA1fl to GATA1s similar to the effect of RBM15 knockdown. When
323 we used inducible cell lines to knockdown PRMT1, we observed a higher ratio of GATA1fl/GATA1s like
324 in cells overexpressing RBM15 (Figure 6A). To further probe the importance of PRMT1 enzymatic
325 activity in alternative splicing, we used PRMT1 inhibitor DB75 to treat MEG-01 cells, CMK cells and CMY
326 cells which all derived from AMKL leukemia patients. All three AMKL cell lines had higher
327 GATA1fl/GATA1s ratio when treated with DB75 (Figure 6-figure supplement 1). Both isoforms of
328 GATA1 can support megakaryocyte differentiation, but only GATA1s supports unrestricted proliferation
329 due to losing the interaction with E2F1 (Li et al., 2000). Therefore, fine-tuning the ratio between two
330 different GATA1 isoforms regulates the balance between proliferation and differentiation of
331 megakaryocyte progenitors.
332 .
333 RUNX1 is required for megakaryocyte differentiation as shown in a conditional RUNX1 knockout mouse
334 model (Ichikawa et al., 2004). Individual RUNX1 isoforms regulate hematopoiesis differently (Komeno et
335 al., 2014b; Tsuzuki and Seto, 2012). RBM15 bound to RUNX1 pre-mRNA in intronic regions and in
336 3’UTR (Figure 5-figure supplement 2). The MISO program found that RUNX1 is alternatively spliced by
337 skipping exon 6 which generates RUNX1-Exon 6- protein. Overexpression of RUNX1-Exon 6- in
338 transgenic mice leads to reduced pool of hematopoietic stem cells (Komeno et al., 2014a)(Figure 5
13 339 figure supplement 4). Given that RBM15 binds to the 3’UTR in exon 8 as well as to intronic regions
340 flanking exon 7a, we investigated whether knockdown of RBM15 causes alternative 3’UTR usage to
341 generate RUNX1a which uses exon7a’ 3’UTR. In RBM15 knock-down MEG-01 cells, the ratio between
342 RUNX1a and RUNX1b,c switched in favor of RUNX1a. RUNX1a which lacks the transactivation domain
343 acts as a dominant negative regulator to antagonize the function of RUNX1b,c (Ran et al., 2013a).
344 Increasing the amount of RUNX1a may interfere with the differentiation into mature megakaryocytes.
345 Consistent with RBM15 knockdown data, we showed that overexpression of RBM15 as well as
346 knockdown of PRMT1 tilted the isoform balance toward RUNX1b,c. In agreement with the PRMT1
347 knockdown data, overexpression of PRMT1 V2 switched the ratio in favor of RUNX1a (Figure 6A middle
348 panel).
349
350 The thrombopoietin receptor (TPOR, aka. c-MPL) is upregulated during megakaryocyte differentiation. c-
351 MPL has at least 4 described isoforms in humans (Figure 6-figure supplement 2). Using reported
352 primers (Li et al., 2000) to amplify cDNA from MEG-01 cells, we found an additional band on the PAGE
353 gel, which was identified as an undescribed isoform lacking exon 9 (c-MPL-exon9-) through sequencing.
354 The c-MPL-exon9- mRNA was predicted to yield a truncated protein (Figure 6-figure supplement 2).
355 Thus we designed specific primer spanning the junction between exon 8 and exon 10 to detect c-MPL-
356 exon9- mRNA. We also used a pair of primers, the forward primer spanning exon 8 and exon 9 and
357 reverse primer annealing to exon 9, to detect the full length MPL (i.e. c-MPL-exon 9+). The c-MPL-
358 exon9-/c-MPL-exon9+ ratio was higher in favor of c-MPL-exon9- (Figure 6A, bottom panel) when
359 RBM15 protein level is reduced. Furthermore, when RBM15 or RBM15 R578K was overexpressed, the
360 ratio is down in favor of c-MPL-exon9+. Given that c-MPL exon9+ is required for MK differentiation, the
361 data further support for the positive role of RBM15 at megakaryocyte maturation. All other isoforms with
362 part of exon 9 or with both exon 9 and 10 missing were spliced in the same way by RBM15-PRMT1
363 pathway (Figure 6-figure supplement 3). Thus, RBM15 enhances the inclusion of exons to produce full-
14 364 length functional c-MPL like in RUNX1’s case. Consistent with our data, mouse Rbm15 regulates c-Mpl
365 alternative splicing in the same fashion (Xiao et al., 2014) .
366
367 We monitored the isoform ratios using human adult CD34+ cells in pro-MK differentiation medium over a
368 time course. We found that the GATA1fl/GATA1s ratio was increased, and the RUNX1a/RUNX1b,c ratio
369 and c-MPL-exon9-/c-MPL-exon9+ ratio were decreased during the course of differentiation (Figure 6B).
370 We observed that the isoform ratio changes in the DB75-treated CD34+ cells (Figure 6C) exactly like in
371 the DB75-treated MEG-01 cells (Figure 6 figure supplement 1). Based on these data, we concluded
372 that RBM15 regulates alternative RNA splicing of genes important for MK differentiation. By controlling
373 the RBM15 protein dosage, PRMT1 thereby regulates MK differentiation.
374
375 RBM15 controls alternative splicing via its interaction with SF3B1
376
377 To understand the detailed mechanism of how RBM15 regulates alternative splicing, we identified
378 RBM15-associated splicing factors such as SF3B1 and U2AF, known proteins in committed RNA splicing
379 A complex that binds to branch point region (Figure 7-source data 1). Furthermore, we confirmed the
380 interaction between SF3B1 and RBM15 by co-immunoprecipitation with anti-Flag antibody for Flag-
381 tagged RBM15 proteins (Figure 7A) and with anti-RBM15 antibody (Figure 7B). To further confirm that
382 PRMT1 enzymatic activity is important for alternative RNA splicing, we inhibited PRMT1 activity with
383 DB75 or shPRMT1. The interaction between SF3B1 and RBM15 was subject to methylation regulation.
384 One simple explanation is that RBM15 might recruit more SF3B1 because of more RBM15 and SF3B1
385 proteins available. It is also possible that methylation might be directly involved in RBM15 and SF3B1
386 interaction. Given that co-immunoprecipitation assays cannot distinguish the direct and indirect protein-
387 protein interaction in a protein complex, RBM15’s interaction with SF3B1 only implies that RBM15
388 recruits the 3’RNA splicing complex. Since SF3B1 is often mutated in leukemia cells, we sequenced the
15 389 SF3B1 gene in MEG-01 cells and confirmed that SF3B1 was not mutated in this cell line. Thus the
390 interaction is between two wild type proteins.
391
392 From the RIP-seq data, we found that RBM15 was specifically associated with intronic region close to
393 5’end of the intron 1 of GATA1 (Figure 7C). We validated the RIP-seq data by real-time PCR with primer
394 sets covering the GATA1 intron 1. Analysis of immunoprecipitated RNA associated with SF3B1 indicated
395 that SF3B1 also preferentially bound to the same region that RBM15 bound to. Furthermore, with RBM15
396 knockdown, less SF3B1 was associated with GATA1 pre-mRNA (Figure 7D). On the other hand,
397 GAPDH has similar level of SF3B1 binding to introns regardless of RBM15 expression level. Thus,
398 RBM15 is responsible for recruiting SF3B1 to pre-mRNA molecules. In this case, RBM15 facilitates the
399 inclusion of GATA1 exon 2. For c-MPL pre-mRNA, RBM15 preferentially bound to the intron 8 and intron
400 10 of the pre-mRNA molecules with two distinct peaks (Figure 7E left), while SF3B1 (Figure 7E right)
401 did bind to regions between the two RBM15 bound peaks at higher level than other regions. When we
402 used RBM15 knockdown MEG-01 cells to do SF3B1 RIP on c-MPL pre-mRNA, we found that SF3B1
403 binding was significantly reduced in RBM15 bound regions (Figure 7E right). In this case, RBM15
404 functions as a splicing enhancer for inclusion of exons 9 and 10. In aggregate, these data show that
405 RBM15 is responsible for recruiting SF3B1 containing branch point recognition complex to introns, and
406 methylation controls the RBM15 dosage thereby controls alternative RNA splicing (Figure 7F).
407
408 Discussion
409 We report here that PRMT1 V2 dimethylates RBM15 within the sequence (LYRDRDR(me2)DLY).
410 Although the most common sequence for arginine methylation is arginine flanked by glycines, PRMT1
411 has been previously reported to methylate arginines in PGC1-α and in RUNX1 flanked by other amino
412 acids (Teyssier et al., 2005; Zhao et al., 2008). Recent proteomics work further proves that the
413 methylation motif can be very diverse (Guo et al., 2014). Since we can still detect a low level of mono-
414 methylation signal after R578K mutation, we believe that the mono-methylation signals come from
16 415 additional arginines methylated by PRMT1 or other arginine methyltransferases. Protein mono-
416 methylation sites in general are redundant and prevalent which are catalyzed by multiple protein arginine
417 methyltransferases (Dhar et al., 2013). Nevertheless, these potential sites are not involved in
418 methylation-mediated ubiquitylation. Another surprising result is that the V2 isoform, which contains
419 additional amino acids on the N-terminus, primarily dimethylates RBM15 in vivo (Figure 1C). Data from
420 PMA treated MEG-01 cells argue that the V2 isoform is more relevant to MK maturation (Figure 4A).
421 Although it has been demonstrated that V1 and V2 have different substrate specificities in vivo (Goulet et
422 al., 2007), RBM15 is the first V2 specific substrate identified. Of note, the V2 isoform only comprises less
423 than 5% of total PRMT1 level, but V2 is mainly responsible for oncogenic activities in colon and breast
424 cancers (Baldwin et al., 2012; Papadokostopoulou et al., 2009). We cannot completely exclude a role for
425 V1 in RBM15 methylation due to the inability to knockdown V1 specifically. Because developing inhibitors
426 specific for PRMT1 V2 isoform will potentially alleviate off-target effects, which remain a major
427 impediment for developing anti-PRMT1 inhibitors, our data offers new clues on how to achieve V2
428 specific inhibition. RBM15 is involved in chromosome translocation t(1;22), which produces the fusion
429 product RBM15-MKL1 (Ma et al., 2001; Mercher et al., 2001). Whether the fusion protein, which retains
430 R578, is methylated by PRMT1 is still an unanswered question.
431
432 It was previously reported that methylation of a transcriptional coactivator p/CIP by PRMT4 or CARM1
433 leads to its degradation, however the mechanism was incomplete (Naeem et al., 2007). Here we report
434 that PRMT1 methylation triggers protein degradation via ubiquitylation by the E3 ligase CNOT4. CNOT4
435 is loosely associated with the other subunits of CCR4-NOT complex (Lau et al., 2009). Apart from
436 deadenylation activity of other CCR4-NOT complex, CNOT4 has been shown to ubiquitylate a histone
437 demethylase Jhd2, which is responsible for erasing the histone H3K4 trimethylation marks in yeast
438 (Mersman et al., 2009). Given that RBM15 interacts with histone methyltransferases complexes to
439 maintain histone H3K4 methylation level (Lee and Skalnik, 2012; Xiao et al., 2015), our data provide new
440 insights into a potential crosstalk between methyltransferases and demethylases.
17 441
442 Recently the E3 ligase WWP2 has been shown to recognize the methylated lysine in SOX2 through its
443 HECT domain (Fang et al., 2014). Given that CNOT4 is within a large CCR4-NOT complex with 9
444 subunits, we have not determined which domain in CNOT4 or other subunits of CCR4-NOT complex
445 recognizes the methylated RBM15. The peptide pull-down experiments strongly support that methylated
446 region on RBM15 is sufficient for binding to CNOT4. Since we found that the RING domain on CNOT4
447 alone was not sufficient for binding to methylated RBM15 (data not shown), it is possible that more than
448 one region on CNOT4 or other subunits in CCR4-NOT complex might interact with RBM15.
449
450 In order to investigate the biological significance of PRMT1-mediated methylation of RBM15, we
451 analyzed the role of PRMT1-RBM15 axis in hematopoiesis. Normal MK differentiation can be divided into
452 two phases: from hematopoietic stem cells to MK progenitor cells and from MK progenitor cells into
453 mature polyploidy MK cells. There are examples that genes such as ARHGEF1 important (ARHGEF1,2
454 are in Figure 5-source data 1) for MK differentiation often play opposite roles at different phases (Gao
455 et al., 2012; Smith et al., 2012). The number of MEP progenitor cells increases, while the polypoidy of
456 mature megakaryocytes decreases in Rbm15 knockout mice (Niu et al., 2009). Consistent with this,
457 RBM15 knockdown in human primary cells like Rbm15 knockdown in mice produces low percentage of
458 mature megakaryocytes (Figure 4F). PRMT1 promotes the production of MEP cells, but PRMT1 has to
459 be turned off to generate mature, polyploid CD41+/CD61+CD42+ MK cells. Because both PRMT1 and
460 RBM15 are ubiquitously expressed in all tissues, PRMT1-RBM15 might regulate differentiation in the
461 same fashion in other tissues such as cardiac tissue, spleen and placenta where RBM15 has been
462 shown to be essential for development (Raffel et al., 2009).
463
464 According to the Oncomine database (www.oncomine.com), PRMT1 is highly expressed in acute
465 myeloid and lymphoid leukemia (AML and ALL) as well as in solid tumors (Rhodes et al., 2007). PRMT1
466 accounts for 4% gene mutations, amplifications and deletions in solid tumors (see www.cbioportal.org)
18 467 (Gao et al., 2013). The relevance of PRMT1 inhibition in cancer therapies is summarized in reviews
468 (Greenblatt and Nimer, 2014; Yang and Bedford, 2013). The roles of PRMT1 in supporting cancer cell
469 proliferation are shown in AML1-ETO and MLL-EEN initiated leukemia (Cheung et al., 2007; Shia et al.,
470 2012). A PRMT1-mediated MK block may therefore be contributory to AMKL leukemogenesis. Apart from
471 their functions in megakaryocyte differentiation, RUNX1, GATA1 and c-MPL as well as other epigenetic
472 factors such as BRD4 found in this study are dysregulated in a broad spectrum of hematological
473 malignancies as well as in solid tumors (Baratta et al., 2015; Crawford et al., 2008; Crispino, 2005;
474 Harada et al., 2004; Pikman et al., 2006). Thus, dysregulation of PRMT1-RBM15 pathway might be a
475 common mechanism in leukemia and solid tumors.
476
477 The role of RNA splicing is increasingly appreciated in hematological malignancies (Cazzola et al.,
478 2013). The RNA splicing patterns vary widely from hematopoietic stem cells to progenitor cells in
479 humans (Chen et al., 2014). Our studies offer mechanisms on how RNA splicing is regulated during
480 hematopoiesis. RBM15 directly recruits the SF3B1 branch point recognition complex to introns. SF3B1
481 has been found to have mutations in myelodysplastic syndrome and in leukemia (Yoshida et al., 2011).
482 Given that SF3B1 knockout mouse cannot mimic defects seen in myelodysplastic syndromes (Wang et
483 al., 2014), mutations in SF3B1 are likely gain-of-function mutations. Whether altered interactions
484 between RBM15 and SF3B1 mutants contribute to hematological malignancies warrants future study.
485
486 One direct consequence of RNA splicing is the altered concentration ratios between functional proteins
487 and their alternatively spliced dominant negative counterparts. The physiological significance for multiple
488 isoforms of c-MPL is to attenuate signaling from full-length c-MPL during megakaryocyte maturation. In
489 transgenic mouse exclusively expressing full-length c-MPL, excessive production of platelets is observed
490 (Tiedt et al., 2009). Abnormal expression of GATA1s and RUNX1a are associated with leukemia
491 (Crispino, 2005; Liu et al., 2009). By controlling isoform ratios, HSCs fine-tune the lineage preference
19 492 and the magnitude of lineage production during differentiation. This type of regulation is very important
493 for HSCs to respond quickly to ever-changing environmental clues.
494
495 RBM15 by binding to introns flanking the alternatively spliced exons enhances the inclusion of the exons
496 to produce full length c-MPL mRNA (Figure 7E). In the case of GATA1, RBM15 binds to intron 1 to
497 recruit SF3B1 to the same location (Figure 7D). As a result, RBM15 enhances the inclusion of exon 2 to
498 generate the GATA1fl mRNA (Figure 6A). RBM15 facilitate the production of more full length RUNX1b,c
499 by skipping the exon which encodes RUNX1a. Knockdown RBM15 also facilitate the generation of
500 RUNX1-exon6-. Based on our proteomic data, RBM15 binds to RNA binding proteins which are involved
501 in RNA surveillance, transport and degradation (Figure 7-source data 1). Consistently, we also detected
502 RBM15 association with matured mRNAs (Figure 5A). In addition, RBM15 associates with
503 transcriptional elongation factors such as Tho2 and CTR9 besides its role in transcription initiation by
504 positively regulating histone H3K4 methylation (Xiao et al., 2015). We speculate that RBM15 participates
505 in regulating the whole life cycle of a messenger RNA. This is reminiscent of the functions of CCR4-NOT
506 complex (Miller and Reese, 2012). RBM15 has been shown to be part of RBM20-mediated RNA splicing
507 network in cardiomyocytes (Maatz et al., 2014; Raffel et al., 2009). Thus, RBM15 is involved in
508 development of other tissues in addition to hematopoiesis. Further experiments to define the specificity
509 and affinity of RBM15 binding sequences will help us to understand the mechanisms of alternative
510 splicing mediated by RBM15.
511
512 Apart from binding to introns, RBM15 binds to 3’UTR of metabolic enzymes, splicing factors as well as a
513 few long noncoding RNA molecules and microRNAs (Figure 5-source data 2). Given that splicing
514 factors can be involved in alternative RNA polyadenylation and RNA export, it is not surprising that
515 RBM15 binds to 3’UTRs for alternative RNA polyadenylation, export as well as for RNA splicing (Castelo-
516 Branco et al., 2004; Kyburz et al., 2006). Analysis by the MISO program indicates that RBM15 regulates
517 alternative RNA splicing of genes such as HK1 by binding to 3’UTR. In the future, deeper sequencing of
20 518 RNA samples and performing high resolution PAR-CLIP assays (Hafner et al., 2010) with RBM15
519 antibodies will further define the RBM15-mediated RNA metabolism.
520
521 In summary, our findings demonstrated a new role for PRMT1 in regulating RNA metabolism. Given that
522 both RBM15 and PRMT1 are evolutionarily conserved proteins from plants to mammals, our studies on
523 the PRMT1-RBM15 pathway offer mechanistic insights into how RBM15 may regulate cell fate decision
524 in multi-cellular organisms at post-transcriptional levels.
525
526 Materials and Methods
527 Using BPPM technology to profile PRMT1 methylated proteins
528 To reveal proteome-wide substrates of protein methyltransferases such as PRMT1 in the context of
529 complex cellular components, we took advantage of the emerging Bioorthogonal Profiling of Protein
530 Methylation (BPPM) technology (Luo, 2012; Wang and Luo, 2013). In BPPM, designated
531 methyltransferases are engineered to process sulfonium-alkyl SAM analogues as alternative cofactors
532 and thus transfer the distinct sulfonium alkyl handles to substrates (Figure 1-figure supplement 2A).
533 Because the alkyl handles contain a terminal-alkyne for the azide-alkyne Huisgen cycloaddition (the click
534 reaction), we can then couple the chemical moiety with a biotin-containing azide probe for amenable
535 target enrichment and characterization. With the previously-identified Y39F-M48G PRMT1 mutant and
536 the matched 4-propargyloxy-but-2-enyl SAM (Pob-SAM) as BPPM reagents (Wang et al., 2011), RBM15
537 in the context of Meg-01 cells was readily labeled by the enzyme-cofactor pair, modified by a biotin-
538 containing azide probe, and enriched by streptavidin beads (Figure 1-figure supplement 2B). As the
539 negative control, the label efficiency dropped significantly in the absence of the Y39F-M48G PRMT1
540 variant. The tagged proteins were subsequently purified with streptavidin beads for mass spectrometry
541 analysis. RBM15 was identified among the methylated proteins. We verified the mass spectrometry data
542 with direct western blot with RBM15 antibody against biotinylated proteins (Figure 1-figure supplement
543 2C). To further map the RBM15 methylation sites, Flag tagged RBM15 protein was purified from
21 544 transient transfected 293T cells for tandem mass spectrometry analysis. A mono-methylation site was
545 found at R578, which lies between the RNA binding domain and the SPOC domain (Figure 1-figure
546 supplement 3A).
547 Plasmids:
548 The human RBM15 cDNA in pCDNA3 vector was kindly provided by Dr. Barbara Felber (NIH). The
549 nucleotide sequences of all constructs were verified by sequencing. The retrovirus expression vector
550 Migr1 was used to overexpress RBM15 and its mutant. pTripZ (Openbiosystems) was used to
551 overexpress the PRMT1-V1 and PRMT1-V2 proteins by replacing RFP with PRMT1-V1 or PRMT1-V2
552 cDNA. The lentivirus expressing shRNA against PRMT1, RBM15, and CNOT4 were purchased from
553 Openbiosystems (ThermoScientific Inc.). The sequences are available in Supplementary File 1. pRS
554 and pRS-shPRMT1-V2 plasmids were reported previously (Baldwin et al., 2012).
555 Viral production and transduction
556 For virus production, 293T cells were cotransfected with retroviral or lentiviral plasmids with helper
557 plasmids as described (Vu et al., 2013). Cells stably expressing PRMT1-V1 and PRMT1-V2 or
558 knockdown RBM15 or PRMT1 were selected with 5 µg/ml puromycin, and GFP-positive cells stably
559 expressing Flag-RBM15 and Flag-RBM15-R were sorted on a FACSAria cell sorter. BD FACS
560 LSRFortessa was used to do FACS analysis.
561 New isoform of c-MPL
562 The gene bank number for this new c-MPL isoform is KF964490.
563 Cell culture
564 HEK293T cells were cultured in DMEM supplemented with 10% FBS and transient transfected by
565 lipofectamine 2000 (Invitrogen, Grand Island, USA). The pcDNA3 empty vectors were added to all
566 transfections to balance total DNA. The human leukemic cell line MEG-01 was cultured in RPMI1640
22 567 medium containing 10% FBS with 100U/ml penicillin and 100ug/ml streptomycin. The generic methyl-
568 transferase inhibitors: Adox (adenosine, periodate oxidized, Sigma, #7154) and MTA (5’-Deoxy-5’-
569 (methylthio) adenosine, Sigma, #D5011) were purchased from Sigma, St. Louis, USA. PMA (20nM) was
570 added to stimulate Meg-01 cells to differentiate into megakaryocytes. The differentiated cells were
571 labeled with anti-CD41 antibody and CD42 antibody (BD) and analyzed by FACS Fortessa machine.
572 Coimmunoprecipitation and Immunoblot analysis
573 Transfected 293T cells from 10-cm dish were lysed in 1 ml of lysis buffer (20mM Hepes, pH 7.9, 150 mM
574 NaCl, 1mM MgCl2, 1% NP40, 10 mM NaF, 0.2 mM NaVO4, 10 mM β-glycerol phosphate) with freshly
575 added DTT (1 mM) and a proteinase inhibitor cocktail (Roche, Indianapolis, USA). The cells were
576 incubated for 30 minutes on ice and sonicated with a Bioruptor Sonicator (Diagenode, Denville, USA).
577 The extracts were cleared by centrifugation at 12,000×g for 15 min at 4 °C. Immunoprecipitations were
578 performed at 4°C in lysis buffer in the presence of RNaseA (10µg/ml) using indicated antibody and 50 µl
579 of 50% (V/V) slurry of Protein A agarose (Roche, Indianapolis, USA) or anti-Flag M2 agarose (Sigma, St.
580 Louis, USA) for 4 hours. The precipitates were extensively washed and resuspended in 2×SDS-PAGE
581 sample buffer directly. The immunopurified protein and cell lysates were resolved by 10% SDS-PAGE
582 and transferred to PVDF membranes (Millipore, Billerica, USA) for western blot assays. The proteins
583 were visualized by the Immobilon Western Chemiluminescent horseradish peroxidase substrate
584 detection kit (Millipore). PRMT1-V2 specific antibody was reported (Baldwin et al., 2012). The other
585 antibodies used were commercially available, including anti-Flag M2 Ab (#F1804, Sigma), RBM15
586 monoclonal antibody (#66059-1-1g, Proteintech, Chicago), RBM15 polyclonal antibody (#: 10587-1-AP,
587 Proteintech, Chicago), PRMT1 (#07404, Upstate Biotechnology), SF3B1 (#PA5-19679, Thermo
588 Scientific), Ub (#U5397, Sigma) and GAPDH (#MA5-15738, Thermo Scientific, Waltham).
589 Detection of in vivo Ubiquitylation
590 HEK293T cells transfected with Flag-RBM15 and His-ubiquitin expression plasmids for 40 hours were
591 treated with 10 µM MG132 for 6 hours before harvesting. Cells were lysed in buffer A (6 M guanidine-
23 592 HCl, 0.1 M Na2HPO4/NaH2PO4, pH 7.5, 10 mM imidazole) at 4°C for 15 minutes. The lysate was
593 sonicated for 20 cycles in Bioruptor Sonicator. After cleaned by centrifugation at 12,000g for 30 minutes
594 at 4°C, the supernatant was incubated with Ni2+-NTA beads (QIAGEN, Valencia, USA) for 3 hours at
595 room temperature. The beads were sequentially washed with buffer A, buffer B (1.5 M guanidine-HCl, 25
596 mM Na2HPO4/NaH2PO4, 20 mM Tris-Cl [pH 6.8], 17.5 mM imidazole), and buffer C (25 mM Tris-Cl [pH
597 6.8], 20 mM imidazole). The ubiquitin-conjugated proteins were boiled in 2×SDS-PAGE loading buffer
598 containing 200 mM imidazole and subjected to immunoblot analysis.
599 Real-time PCR Assay
600 Total RNA was prepared using RNeasy plus Kit (QIAGEN). cDNA was generated by the Verso cDNA
601 synthesis Kit (Thermo Scientific) with random hexamer primers. Real-time PCR assays were performed
602 with Absolute Blue qPCR SYBR green Mix (Thermo Scientific) or Taqman Universal Master Mix II
603 (Applied Biosystems, for GATA1-FL and GATA1-S) on a ViiA 7 system (Applied Biosystems). Primers
604 are listed in Supplementary File 2. GAPDH was used as an internal control for normalization. Relative
605 expression level was calculated by ∆(∆ct) method and all results were expressed as mean values±
606 standard errors from at least 3 independent experiments.
607 GATA1 isoforms can be detected by regular PCR reactions with the primers: GATA1 Ex1 F :
608 ATCACACTGAGCTTGCCACA, GATA1 Ex3 R: AGCTTGGGAGAGGAATAGGC in Figure 5H.
609
610 Identification of protein methylation by mass spectrometry
611 For identification of methylation sites of targeted proteins, samples were separated by 10% of SDS
612 PAGE. The gel band were excised from the gel, reduced with 10 mM DTT and alkylated with 55 mM
613 iodoacetamide. Then in-gel digestion was carried out with the sequencing grade modified trypsin
614 (Promega, Fitchburg, WI) in 50 mM ammonium bicarbonate at 37 C overnight. The peptides were
615 extracted twice with 1% trifluoroacetic acid in 50% acetonitrile aqueous solution for 30 min. The
616 extractions were then centrifuged in a speedvac to reduce the volume.
24 617
618 For LC-MS/MS analysis, the digested product was separated by a 60 min gradient elution at a flow rate
619 0.30 µL/min using an UltiMate 3000 RSLCnano System (Thermo Scientific, USA) which was directly
620 interfaced with a Thermo Q Exactive benchtop mass spectrometer. The analytical column was a home-
621 made fused silica capillary column (75 µm ID, 150 mm length; Upchurch, Oak Harbor, WA) packed with
622 C-18 resin (300 Å, 5 µm, Varian, Lexington, MA). Mobile phase A consisted of 0.1% formic acid, and
623 mobile phase B consisted of 100% acetonitrile and 0.1% formic acid. The mass spectrometer was
624 operated in the data-dependent acquisition mode using the Xcalibur 2.2.0 software and there is a single
625 full-scan mass spectrum in the Orbitrap (400-1800 m/z, 70,000 resolution) followed by 8 MS/MS scans
626 under the higher energy collision dissociation (HCD). The MS/MS spectra from each LC-MS/MS run
627 were searched against the selected database using an in-house Mascot or Proteome Discovery
628 searching algorithm.
629 Peptide pulldown assay
630 The peptide pulldown method is published before (Vu et al., 2013). Briefly, two peptides (Biotin-
631 LLYRDRDRME2ADLYPDSDWV and Biotin-LLYRDRDRDLYPDSDWV) with or without methylation on
632 R578 were synthesized. Biotin was added for binding to streptavidin beads. 200 μl of the whole cell
633 extract (10mg/ml in H lysis buffer) prepared as mentioned in co-immunoprecipitation assays was used to
634 incubate with peptides (at final concentration of 1 μM) overnight at 4°C. The beads were washed with
635 wash buffer (300mM NaCl, 1mM DTT, 20mM Tris pH 7.4 and 0.1% NP40) five times. Protein bound to
636 the beads were boiled in SDS sample buffer and resolved in 10% SDS PAGE.
637 Survival analysis:
638 RNA-seq data of 200 acute myeloid leukemia (AML) samples were downloaded from the Cancer
639 Genome Atlas (TCGA). The PRMT1 expression levels were used for survival analysis using Kaplan
640 Meier (K-M) curves and log-rank tests. Samples with available clinical outcomes (survival month, n=103)
25 641 data were included in the analysis. Logarithm 2-based transformations of each gene were performed
642 prior to any analysis. Significant association was determined at 5% type I error level.
643 Target CNOT4 by CRISPR 644 645 Two guide RNAs were designed to target exon 2 of human CNOT4 at two different sites using the
646 CRISPR design tool (Zhang’s lab) (Ran et al., 2013b). The distance between target sites is roughly
647 100bp. Two gRNAs were cloned into pX330 vector, and transient transfected into 293T cells. Single cells
648 were selected by serial dilution. Single cell colonies were screened for internal deletion by PCR using 2
649 primers: F: TTCCCCTAAAATGTGTTATGATGA; R : CCAGTGCAGTGTTCTTTCCA. Guide RNA
650 sequences: (1) CACCG GGATGTCATGTCCTCAGCGT; (2) CACCGGTGGATGCCAAAGTGTGCGT.
651 Developing anti-peptide antibody against RBM15
652 RBM15 N-terminal sequence (Acetyl-RTAGRDPVPRRSPRWRRAVPLC) was used to develop rabbit
653 polyclonal antibody against RBM15 by GeneMed Synthesis Inc. (St. Antonio, Texas) for RNA
654 immunoprecipitation assay.
655
656 RNA immunoprecipitation assay
657 Ten millions of MEG-01 cells grown at the exponential phase were cross-linked by 1% of formaldehyde
658 in 37°C incubator for 10 minutes. Cells were washed twice with ice-cold PBS, lysed in H-lysis buffer
659 (20mM HEPES pH7.9, 300mM NaCl, 1mM MgCl2, 1% NP40, NaF 10mM, 0.2mM NaVO4, 10mM β-
660 glycerol phosphate, 5% glycerol, 1mM DTT, 40 U/ml RNaseOUT, and proteinase inhibitors), and then
661 sonicated by Bioruptor (Diagenode) to fragments with average sizes of 200bp (DNA) for 30 minutes at
662 4oC. After the lysate was spun down, the supernatant was incubated with RBM15 antibody overnight at
663 4oC. Beads were washed five times with stringent buffer (50mM Tris pH7.5, 1M NaCl, 1mM EDTA,
664 0.1%SDS, 1% Na Deoxycholate, 1M Urea, and 1% NP40), and once with TE buffer (10mM Tris pH 7.9,
665 1mM EDTA). Immunoprecipitated RNA were eluted by incubating with 150μl RIP elution buffer (50mM
666 Tris-Cl pH 7.9, 5mM EDTA, 1% SDS, 200mM NaCl and 267 μg/ml of proteinase K) for 1h at 45°C.
26 667 Genomic DNA was removed by DnaseI Turbo (Ambion). RNA was extracted by Trizol (Invitrogen) and
668 cDNA was synthesized with random priming (Thermo Verso cDNA synthesis kit). The cDNA was
669 analyzed by qRT-PCR.
670 We did two biological replicates for RIP-seq experiments with anti-RBM15 antibody and normal IgG
671 respectively. The RNA was converted into cDNA using SureSelect single strand RNA selection kit
672 (Illumina) and sequenced with Illumina 2000 sequencer.
673
674 Primary cell culture for megakaryocyte differentiation
675 G-CSF mobilized peripheral human blood cells were used to purify CD34+ cells. These CD34+ cells were
676 spinfected with lentiviruses and grown in basic cytokine mix (100ng/ml of SCF, 100ng/ml FLt3 ligand,
677 50ng/ml of IL-6 and 20ng/ml of TPO) with IMDM medium plus 20% BIT (Stem cell Technology). For
678 megakaryocyte differentiation, we cultured the CD34+ cells with 50ng/ml TPO and 2ng/ml of SCF. The
679 maturation of MK cells was assessed for the percentage of CD41+CD42+ or CD61+CD42+ populations as
680 well as the percentage of polyploidy with PI staining by FACS analysis.
681
682 Computational analysis of RIP-seq data and RNA-seq data
683 We first trimmed adaptor sequences and low quality bases from paired end RIP sequencing reads using
684 Trimmomatic (Bolger et al., 2014). Processed reads were then mapped to hg19 genome with the STAR
685 (Dobin et al., 2013) aligner. RIP reads from all samples were summarized into read coverage profiles on
686 all chromosomes, and peaks were identified with a custom algorithm (Loeb et al., 2012) by convolving
687 the read coverage signal with the second derivative of a Gaussian filter (bandwidth = 300). For each
688 peak, we used DESeq (Anders and Huber, 2010) to test if there was significant difference in read counts
689 within the peak region between RBM15 samples and control samples after correcting for library size
690 differences. 1515 peaks with more reads in RBM15 samples and FDR < 5% were defined as significant
27 691 RBM15 binding sites. Each peak was annotated with information including gene name and region (i.e.
692 intron, 3’UTR, 5’UTR, CDS) according to the overlapping RefSeq transcript.
693 We did 100bp pair ends sequencing for the RNA samples. More than 100 million reads per sample were
694 collected. All the reads were mapped to the human reference genome (GRCh37/hg19) using STAR with
695 a Gene Transfer File (GTF version GRCh37.70). The mean insert sizes and the standard deviations
696 were calculated using Picard-tools (v1.126) (http://broadinstitute.github.io/picard/).
697 Differential exon usage was calculated by DEXSeq (Anders et al., 2012) and an even-based analysis
698 using MISO (Katz et al., 2010) to measure the abundance of event types: skipped exon (SE), mixed exon
699 usage (MXE), alternative first exon (AFE), alternative last exon (ALE), alternative 5’ or 3’ splicing sites
700 (A5SS or A3SS) and tandom 3’UTR use (T3UTR). The Read Per Million (RPM) normalized BigWig files
701 were generated using BEDTools (v2.17.0) and bedGraphToBigWig tool (v4). And all the downstream
702 statistical analyses and generating plots were performed in R (v3.1.1) (http://www.r-project.org/).
703
704 In vitro ubiquitylation assay
705 In vitro ubiquitination assay was performed essentially as described (Wang et al., 2004). Briefly, RBM15
706 or RBM15 R578K with or without PRMT1-mediated methylation were incubated with HA-CNOT4 in 32.5
707 μl reaction mixture containing 50 mM Tris (pH7.5), 5 mM MgCl2, 2 mM NaF, 2 mM ATP, 10 mM Okadaic
708 acid, 0.6 M DTT, 0.1 mg E1, 0.2 mg UBCH5C and1 mg recombinant ubiquitin (Sigma). Reactions were
709 carried out for 1 hour at 37°C before stopping with SDS sample loading buffer and resolving by 8% SDS-
710 PAGE. Ubiquitination was detected by Western blot with anti-Flag antibody.
711 Acknowledgements
712 We would like to thank Drs. Nouria Hernandez (UNIL), Stephen Nimer (UMCCC), Michael Crowley, Chris
713 Klug, Kevin Pawlik, Ching-Yi Chen, William Placzek, Camelia Iancu-Rubin (MSH) for help; Dr. John
714 Crispino (NWU), Thomas Mercher (INSERM, Paris) and Dr. Barbara Felber (NIH) for reagents. YL is
28 715 supported by CNSF (#81270570). We would like to thank the UAB Comprehensive Flow Cytometry
716 Core as part of RDCC (P30AR048311 and P30AI027767) for technical support.
717 Additional information
718 Competing Interests:
719 All authors declare that con competing interests exist.
720 Funding
The University of Alabama at New Investigator Start-up Xinyang Zhao
Birmingham
China National Science 81270570 Yanyan Liu
Foundation
721
722 Figure legends
723
724 Figure 1. RBM15 is methylated by PRMT1 at R578 in mammalian cells. (A) Alignment of RBM15
725 sequences among different species shows R578 within a conserved protein region. (B) RBM15-Flag and
726 its mutant (R578K), affinity purified with anti-Flag antibody from transfected 293T cells, were detected by
727 western blot (WB) with anti-monomethyl arginine antibody. (C) Flag-tagged RBM15 was affinity purified
728 by Flag antibody for WB with two generic antibodies against mono-methyl arginine and dimethyl arginine
729 respectively. The 293T cells overexpressing wild type RBM15-Flag protein with PRMT1 V2 (lane 2) and
730 V1 (lane 3) respectively were treated with 20nM MG132 for 6 hours before harvesting. (D) The
731 differences between N terminal sequences of PRMT1 V1 and V2 isoforms. (E) In vitro methylation
732 assays. Affinity purified RBM15 protein was methylated by incubation with purified HA-PRMT1 and 0.15
733 mM of S-adenosyl-methionine at 30°C for four hours. The methylated RBM15 was detected by anti-
734 dimethyl arginine antibody in WB. (F) RBM15 was immunoprecipitated with a mouse monoclonal anti-
735 RBM15 antibody from whole cell extract prepared from a MEG-01 stable cell line expressing inducible
736 shRNA against PRMT1. Normal IgG was used as immunoprecipitation controls. The immunoprecipitated
29 737 RBM15 was detected by WB with antibodies against mono-methyl arginine (mono-R100) and
738 asymmetrical dimethyl arginine (D4H5) respectively. As controls, we did WB with anti-PRMT5 and anti-
739 PRMT4 antibodies. (G) Detection of methylated RBM15 in MEG-01 stable cell lines expressing Flag-
740 RBM15 and R578K mutant proteins respectively after a PRMT1 inhibitor (DB75) treatment for 24 h.
741 RBM15 is affinity purified by anti-Flag antibody and detected by WB with mono-methyl arginine antibody
742 and dimethyl arginine antibody.
743 Figure 1-figure supplement 1. PRMT1 is overexpressed in AMKL leukemia and associated with short
744 survival rate in AML.
745 Figure 1-figure supplement 2. RBM15 is discovered as a PRMT1 substrate via BPPM.
746 Figure 1-figure supplement 3. Mapping the methylation site for RBM15.
747 Figure 1-figure supplement 4. RBM15 methylation status is further confirmed by a methyl-RBM15
748 antibody.
749 Figure 2. PRMT1 V2 isoform destabilizes RBM15 via methylation. (A) WB for RBM15 in 293T cells
750 overexpressing PRMT1 V1 and V2 respectively. PRMT1 V2 was detected by anti-V2 specific antibody
751 (PRMT1 V2). PRMT1 V1 and V2 were detected by an antibody for all isoforms (labeled as PRMT1). (B)
752 The level of the RBM15 protein as detected by WB in MEG-01 cells treated with methyltransferase
753 inhibitors (Adox and MTA mix) or DB75. (C) RBM15 protein level was measured by WB in MEG-01 cells
754 with two doxycycline-inducible shRNA against PRMT1 (on the left). In the middle and right sides are real
755 time PCR results to show the mRNA levels of total amount of PRMT1, PRMT1 V2, and RBM15 in
756 shPRMT1#1 stable MEG-01 cell line (middle) and in shPRMT1#2 stable MEG-01 cells (right). All data
757 are presented as mean ± SD from three independent experiments. (D) RBM15 protein level was
758 measured by WB in MEG-01 cells induced by doxycycline to express PRMT1 V2 isoform. On the right
759 are the real-time PCR charts for PRMT1 V2 and RBM15 mRNA levels. Data are presented as mean ±
760 SD from three independent experiments. (E) RBM15 protein level was accessed by WB in a MEG-01
761 stable cell line expressing shRNA against V2. The names of antibodies are listed on right. The pRS
762 vector retrovirus infected MEG-01 cells were used as control. (F) WB with anti-Flag antibody to detect
30 763 the protein levels of RBM15 wild type and R578K mutant proteins in 293T cells overexpressing PRMT1
764 V2 and RBM15 proteins. (G) The half-life of the RBM15 proteins in MEG-01 cells, and stable cell lines
765 overexpressing Flag tagged RBM15 and RBM15 R578K were assessed by WB respectively.
766 Cyclohemixide were added to stop protein synthesis 30 minutes before harvesting cells as the 0 time
767 point. The half-life curves were plotted by GraphPad Prism 6.
768
769 Figure 3. The RBM15 is ubiquitylated in a methylation-dependent manner. (A) Western blots for the
770 RBM15 protein from MEG-01 cells treated with the proteasome inhibitor MG132. (B) The ubiquitylated
771 RBM15-Flag was detected by anti-Flag antibody. The poly-ubiquitylated RBM15 was purified with nickel
772 beads under denaturing conditions (6M of guanidine-HCl) from 293T cells expressing RBM15-Flag and
773 poly-histidine-tagged ubiquitin. (C) The ubiquitylated RBM15 was measured by anti-ubiquitin antibody
774 after affinity purified with Flag antibody from MG132 treated 293T cells expressing RBM15-Flag or
775 R578K-Flag and ubiquitin. (D) IP-western blot for poly-ubiquitylated RBM15 in DB75 treated MEG-01
776 cells. The endogenous RBM15 protein was immunoprecipitated by anti-RBM15 antibody and then blotted
777 with anti-ubiquitin antibody and anti-RBM15 antibody. (E) The ubiquitylated RBM15 was detected by anti-
778 Ub antibody after RBM15-Flag as well as its mutant was affinity purified from 293T cells transfected with
779 combinations of plasmids shown above the gel. CNOT4 was detected via its HA tag. (F) WB to detect
780 RBM15 protein levels in two MEG-01 cell lines expressing two different shCNOT4 respectively. PRMT1
781 inhibitor (DB75) was used to treat the cells expressing shCNOT4 RNAs. The efficiency of shCNOT4
782 knockdown was checked by real-time PCR. (G) In vitro ubiquitylation assays with CNOT4 and RBM15.
783 Purified PRMT1 was added to methylate RBM15 in vitro in lanes 5 and 6 first before incubating with
784 CNOT4 for in vitro ubiquitylation assays. All components were affinity purified from 293T cells. The
785 ubiquitylated RBM15-Flag was detected by WB with anti-Flag antibody. (H) CNOT4 from MEG-01 whole
786 cell extract was pulled down with methylated and nonmethylated peptides of RBM15. CNOT4 was
787 detected by WB with anti-CNOT4 antibody.
788 Figure 3-figure supplement 1. Purified proteins used in vitro methylation and ubiquitylation assays.
31 789 Figure 3-figure supplement 2. The efficiency of CNOT4 knockdowns.
790
791 Figure 4. PRMT1 controls the protein level of RBM15 in megakaryocyte maturation. (A) WB to measure
792 the protein levels in MEG-01 cells stimulated to maturation by PMA. The left panel (WB results) showed
793 the protein levels by antibodies against GAPDH, RBM15, Methyl-RBM15, PRMT1 with a PRMT1
794 antibody against all isoforms and PRMT1 V2 with specific V2 antibody during the course of maturation.
795 The middle panel shows the quantitation of the protein bands in the western blots on the left normalized
796 to GAPDH. The right panel showed the decrease of PRMT1 V2 by real time PCR during maturation with
797 GAPDH mRNA as an internal control. Real-time PCR data were presented as means ± SD from three
798 independent experiments. (B) Histograms of CD41+ cells on PMA treated MEG-01 cells overexpressing
799 RBM15 and RBM15R578K mutant proteins respectively on day 3. The percentage of CD41+ cells was
800 calculated according to matched antibody isotype control. Three independent experiments were done
801 with statistics shown on the left. P*** <0.001, P** <0.01. (C) FACS analysis of the polyploid status of
802 PMA treated cells overexpressing RBM15 and R578K mutant proteins by PI staining. Vector: lentivirus
803 vector. P*** <0.001. (D) The matured MK cells were measured by CD61+CD42+. Human adult CD34+
804 cells in pro-megakaryocyte differentiation medium were treated with DB75 for three days. Three
805 independent experiments were done with P*< 0.05. (E) Human adult CD34+ cells were infected with
806 lentivirus expressing PRMT1 V2 or lentivirus vector and grown in pro-MK differentiation medium for five
807 days. Three independent experiments were done with P***<0.001. (F) Human adult CD34+ cells were
808 infected with two lentiviruses expressing shRNAs against RBM15 and grown in pro-MK differentiation
809 medium. Three biological replicates were used for P value. P** <0.01. (G) Human adult CD34+ cells were
810 infected with lentiviruses expressing RBM15 or R578K proteins and grown in pro-MK differentiation
811 medium for five days. Three independent experiments were done with P**<0.01. (H) Human adult CD34+
812 cells were infected with lentiviruses expressing RBM15 or R578K together with a lentivirus expressing
813 PRMT1 V2 and grown in pro-MK differentiation medium. Three biological replicates were used for P
814 value. P**<0.01.
32 815 Figure 4-figure supplement 1. Relative expression levels of PRMT1 isoforms and RBM15 in different
816 hematopoietic lineages derived from mouse and human.
817 Figure 4-figure supplement 2. RBM15 protein level in MEG-01 cell lines expressing two shRNA
818 constructs against RBM15 respectively by western blots.
819
820 Figure 5. Analysis of RBM15 target genes. (A) Real-time PCR assays for detecting RNA associated with
821 RBM15 in MEG-01 cells by RNA immunoprecipitation assays (RIP) with the RBM15 antibody. The levels
822 of RBM15-associated mRNAs were calculated as mean ± SD from three independent experiments. (B)
823 The distribution of RBM15 binding sites. All the RBM15 target genes were listed in Figure 5 -source
824 data 2. (C) Gene ontology (GO) pathway analysis (FDR<0.01) showed pathways associated with genes
825 which have RBM15 binding sites in introns. (D) GO pathway analysis (FDR <0.01) revealed pathways
826 associated with genes containing RBM15 binding sites in 3’UTR regions. (E) Differential exon usage
827 events detected by MISO program. T3UTR: tandem UTR. SE: skipped exon. RI: retention intron. MXE:
828 mutually exclusive exon usage. ALE: alternative last exon. AFE: alternative first exon. A5SS: alternative
829 5’ splicing sites. A3SS: alternative 3’ splicing sites. (F) The changes of percentage splice-in events in
830 different splicing categories when RBM15 is knocked down. (G) MISO plot for skipping of GATA1 exon 2
831 when RBM15 was knocked down. (H) Isoforms of GATA1fl and GATA1s were detected by PCR using
832 RNA extracted from MEG-01 cells with or without RBM15 knockdown.
833 Figure 5-figure supplement 1. RBM15 binding to pre-mRNA of genes known important for
834 hematopoiesis.
835 Figure 5-figure supplemental 2. The RBM15 binding profiles on the c-MPL (panel A) and RUNX1
836 (panel B) pre-mRNAs.
837 Figure 5-figure supplement 3. The mitochondria biogenesis is regulated by the PRMT1-RBM15
838 pathway.
839 Figure 5-figure supplement 4. Representative genes detected by MISO and DEXSeq in the RIP group.
33 840 Figure 5-source data 1: Identification of RNAs associated with RBM15 by RNA immunoprecipitation
841 assay with anti-RBM15 antibody. Genes related to MK differentiation are highlighted.
842 Figure 5-source data 2: Analysis of gene expression profile changes with RNA-seq data from RBM15
843 knockdown MEG-01 cells. Genes related to MK differentiation are highlighted.
844 Figure 5-source data 3: Analysis of differential exon usage regulated by RBM15 with RNA-seq data
845 from RBM15 knockdown MEG-01 cells. Genes related to MK differentiation are highlighted.
846 Figure 6. Methylation of RBM15 controls alternative splicing of genes (RUNX1, GATA1 and c-MPL)
847 important for megakaryocyte differentiation. (A) Alternative splicing of RUNX1, GATA1, c-MPL in MEG-
848 01 cells and MEG-01 derived stable cell lines overexpressing RBM15 and PRMT1 V2 or knocking down
849 RBM15 and PRMT1 V2. The ratios of different isoforms were calculated from real-time PCR assays with
850 isoform specific primers. At least three independent experiments were performed. P****: <0.01; P***:
851 <0.05; P**: <0.2 and P*: <0.3 as compared to their respective vector control groups. (B) Time course for
852 alternative splicing of RUNX1, GATA1 and c-MPL in human adult CD34+ cells grown in pro-MK
853 differentiation medium. Three independent experiments were used to calculate the standard deviation.
854 (C) The alternative splicing of GATA1, RUNX1 and c-MPL was measured as ratio change in human adult
855 CD34+ cells treated with DB75 overnight in basic cytokine mix. Three independent experiments were
856 used to calculate the P values.
857 Figure 6-figure supplement 1. Alternative splicing of GATA1 is regulated by PRMT1 in acute
858 megakaryoblastic leukemia cell lines.
859 Figure 6-figure supplement 2. Schematic diagram of MPL isoforms.
860 Figure 6-figure supplement 3. Alternative splicing of c-MPL is measured as the ratios of different
861 isoforms by real-time PCR assays.
862
863 Figure 7. RBM15 directly recruits the intron binding splicing factor, SF3B1, for alternative RNA splicing.
864 (A) The interaction between SF3B1 and RBM15 in the context of PRMT1-mediated methylation. RBM15-
865 Flag and RBM15 R578K-Flag expressed from two MEG-01 cell lines with or without DB75 treatment
34 866 were immunoprecipitated with anti-Flag antibody for detecting interaction with SF3B1 by WB. (B) The
867 endogenous SF3B1 was co-immunopreciptiated with anti-RBM15 antibody in MEG-01 cells expressing
868 inducible shPRMT1. Normal mouse serum was used as a negative control. (C) RBM15 binding profile on
869 GATA1 pre-mRNA based on RIP-seq data. The green peaks were the binding sites for RBM15 and the
870 blue profile was the binding profile for normal IgG. Two biological replicates were used for bioinformatic
871 analysis. The significant peaks were shaded with pink squares. (D) The regions where RBM15 (RIP with
872 RBM15 antibody, left panel) and SF3B1 (RIP with SF3B1 antibody right panel) bound on GATA1 pre-
873 mRNA in MEG-01 cells (solid bar) and RBM15 knockdown MEG-01 cells (open bar) were mapped by
874 real-time PCR assays. The locations of primers on the pre-mRNA of GATA1 were shown on the bottom.
875 Three biological replicates were used to calculate the standard deviations. GAPDH intron 1 was used as
876 negative controls for both antibodies. (E) The regions on c-MPL pre-mRNA, where RBM15 and SF3B1
877 bound in MEG-01 cell lines expressing shRBM15 (square line) or expressing pLKO vector (solid dot line),
878 were assessed by RIP with RBM15 (left panel) and SF3B1 antibodies (right panel). The locations of
879 primers on the pre-mRNA of c-MPL were shown on the bottom. Three biological replicates were used for
880 standard deviations. (F) A model for RBM15-mediated regulation of alternative RNA splicing. RBM15 and
881 SF3B1 cooperate to produce GATA1fl and low level of RBM15 leads to lower SF3B1 binding and
882 skipping of the exon 2. PRMT1-mediated methylation of RBM15 controls the ubiquitylation of RBM15 by
883 CNOT4, thus controls the balance between proliferation and differentiation in megakaryopoiesis.
884 Figure 7-source data 1: Mass spectrometry analysis of RBM15-associated proteins.
885 Figure 1-figure supplement 1. PRMT1 is overexpressed in AMKL leukemia and associated with short
886 survival rate in AML. (A) PRMT1 is overexpressed in AMKL leukemia compared to other types of AML.
887 Microarray data set (GSE4119) (Bourquin et.al. 2006) was analyzed by NCBI GEO2R tool. Expression
888 values were exported from NCBI GEO2R tool and then re-plotted by GraphPad PRISM 5 software. (B)
889 PRMT1 high expression is correlated with low survival rate in acute myeloid leukemia.
890
35 891 Figure 1-figure supplement 2. RBM15 is discovered as a PRMT1 substrate via BPPM. (A) Schematic
892 description of substrate identification with PRMT1 Y39FM48G and Pob-SAM using BPPM technology.
893 (B) HEK293T cells were transfected with either empty vector or the PRMT1 Y39FM48G mutant, followed
894 with treatment of Adox to induce hypomethylation. These cells were then lysed to release the PRMT1
895 substrates as previously described and the cell lysates were treated with Pob-SAM cofactor. The
896 terminal alkyne-modified substrates were conjugated with the cleavable azido-azo-biotin probe, followed
897 by streptavidin enrichment, sodium dithionite elution and western blotting detection. (C) Western blotting
898 analysis of the pull-down substrate of PRMT1. The eluted targets of PRMT1 were incubated with RBM15
899 antibody. The pull-down sample from 293T cells transfected with PRMT1 Y39FM48G variant showed
900 significantly higher level of RBM15 compared to the control group. Cell lysates without streptavidin
901 enrichment were assessed by anti-RBM15 western blotting as loading control (Input panel).
902
903 Figure 1-figure supplement 3. Mapping the methylation site for RBM15. (A) Tandem Mass
904 Spectrometry analysis for Flag-tagged RBM15 purified from 293T cells overexpressing RBM15-Flag. The
905 arrow indicates the modified peptide. (B) Schematic diagram shows domains on RBM15. (C) Dot blot to
906 test the antibody (Mono-R100 from Cell Signaling) recognizing monomethylated RBM15 peptide based
907 on mass spectrometry analysis. Nitrocellulose membrane was spotted with peptides with no modification,
908 with arginine mono-methylated or with arginine asymmetrically dimethylated. The peptide sequences
909 were listed on the right side of the dot blot gel. (D) Dot blot to test the antibody (D4H5 from Cell
910 Signaling) which recognizes asymmetrically dimethylated RBM15 peptide. Peptides were spotted in the
911 same order as in panel C. (E) IP-Western blot for RBM15 protein in Meg-01 cell lines expressing Flag-
912 tagged RBM15 and Flag-tagged RBM15 R578K respectively. The anti-monomethyl arginine antibody
913 was used for immunoprecipitation and the ectopically expressed RBM15 proteins were detected by Flag
914 antibody. (F) IP-Western blotting assays for detecting methylated RBM15 and R3K mutant expressed in
915 293T cells. RBM15-R3K stands for RBM15 protein with all the arginines in the LYRDRDRD sequence
916 mutated to lysines. (G) The in vitro methylation reaction with peptide (LYRDRDRDLY) incubated with
36 917 purified PRMT1. H4 peptide (20 mer) was used as a positive control. The methylated peptide was
918 detected by the D4H5 dimethyl arginine antibody not by the mono-methyl antibody.
919
920 Figure 1-figure supplement 4. RBM15 methylation status is further confirmed by a methyl-RBM15
921 antibody. (A) Dot blot for the anti-methyl-RBM15 antibody. Synthesized RBM15 peptides with different
922 methylation status on arginine 578 were spotted for blotting with the anti-methyl RBM15 antibody. (B to
923 D) RBM15 methylation status was measured by anti-methyl-RBM15 antibody by western blotting. (B)
924 The whole cell extracts from 293T cells expressing PRMT1 were used for western blotting with the anti-
925 methyl RBM15 antibody. Empty vector was used as a control. (C) The whole cell lysates from 293T cells
926 expressing wild type (WT) RBM15 or R578K mutant were used for western blotting. (D) A stable MEG-01
927 cell line expressing doxycycline (Dox)-inducible shPRMT1 was used to knock down PRMT1. The
928 expression of methyl-RBM15 was measured by western blotting with anti-methyl RBM15 antibody,
929 RBM15 antibody, PRMT1 antibody and GAPDH antibody respectively.
930
931 Figure 3-figure supplement 1. Purified proteins used in vitro methylation and ubiquitylation assays. (A)
932 The Flag tagged RBM15 protein was affinity purified by anti-Flag antibody from 293T cells
933 overexpressing FLAG RBM15 protein as shown by Coomassie staining of 10% SDS-PAGE. (B) Affinity
934 purified HA-CNOT4 and HA-PRMT1 proteins were shown by silver staining. Both proteins were produced
935 in 293T cells transfected with pCDNA3-HA-PRMT1 and pCDNA3-HA-CNOT4 respectively. Anti-HA
936 antibody (12Ca5) column was used to purify these proteins. Proteins were eluted by 0.5mg/ml of HA
937 peptide (Sigma) in PBS.
938
939 Figure 3-figure supplement 2. The efficiency of CNOT4 knockdowns. (A) Real-time PCR assays for
940 CNOT4 in MEG-01 cells expressing shCNOT4. (B) Western blots to show the knockdown efficiencies of
941 two shRBM15 constructs in MEG-01 cells. (C) Using CRISPR to knockdown CNOT4 in 293T cells (A5 is
37 942 a 293T cell line with only one wild type allele of CNOT4) as shown by real-time PCR on the left and by
943 western blot on the right. RBM15 protein level goes up in CNOT4+/- cells by western blot assays.
944
945 Figure 4-figure supplement 1. Relative expression levels of PRMT1 isoforms and RBM15 in different
946 hematopoietic lineages derived from mouse and human. (A-C) The relative expression levels of total
947 PRMT1 (including V1 and V2) (A), PRMT1 V2 (B) and RBM15 (C) in different mouse lineages were
948 measured by real-time PCR. The expression level is normalized to GAPDH, then normalized to the level
949 in long-term hematopoietic stem cells (LT-HSC). (D) The surface markers we used to sort mouse
950 lineages. (E) The expression level of PRMT1 in different human hematopoietic lineages. (F) The
951 expression level of RBM15 in different human hematopoietic lineages based on database from
952 HemaExplorer. (G) The abbreviations for the different human hematopoietic lineages used in panels (E)
953 and (F).
954
955 Figure 4-figure supplement 2. RBM15 protein levels in MEG-01 cell lines expressing two shRNA
956 constructs against RBM15 respectively by western blots.
957
958 Figure 5-figure supplement 1. RBM15 binding to pre-mRNA of genes known important for
959 hematopoiesis. (A) RBM15 binding peaks on pre-mRNA of CDC42. (B) RBM15 binding sites on pre-
960 mRNA of macroH2A (H2AFZ). (C) RBM15 binding on pre-mRNA of TAL1. (D) RBM15 binding peaks on
961 pre-mRNA of LEF1.
962
963 Figure 5-figure supplement 2. The RBM15 binding profiles on the c-MPL (A) and RUNX1 (B) pre-
964 mRNAs. The red bar is calculated as significant peaks in bioinformatics analysis.
965
966 Figure 5-figure supplement 3. The mitochondria biogenesis is regulated by the PRMT1-RBM15
967 pathway. The mitotracker (MitoTracker deep red FM, Invitrogen) was used to stain active mitochondria in
38 968 MEG-01 stable cell lines infected with lentivirus vector, lentivirus expressing shRBM15, and lentivirus
969 overexpressing PRMT1 V1 and V2 respectively. The cell nuclei were stained with Hoechst.
970
971 Figure 5-figure supplement 4. Representative genes detected by MISO and DEXSeq in the genes
972 detected by RIP. In the MISO diagram, the red graph is for MEG-01 cells, and the orange diagrams are
973 for two MEG-01 cell lines expressing two shRBM15 RNAs respectively. (A) TAL1 (aka SCL) skips exon 2
974 and 3 as detected by DEXSeq and use alternative short 3’UTR after RBM15 was knocked down. TAL1
975 has the exon 2 (1:47691115-47691561) skipped in RBM15 knockdown cells, which losses protein coding
976 ability for transcript (bottom panel). (B) MacroH2A (H2AFZ) retains intron (4:100870543-100870820)
977 when RBM15 protein level is reduced. (C) RUNX1 has multiple exon usage alteration events as
978 demonstrated by DEXSeq on the top. The E017 marks the change for generating RUNX1a (E7a is
979 included) when RBM15 is knocked down. The bottom is MISO analysis showing that Exon 6 is skipped to
980 generate a RUNX1 protein without the transcriptional repression region. This isoform was reported
981 (Komeno et.al 2014). (D) CDC42 skips the exon 2a (1:22400587-22400712) or exon 2b (1:22400647-
982 22400712). Although the open reading frame is still intact with the skipping events, the change of 5’UTR
983 might cause changing in efficiency of protein translation.
984 Figure 6-figure supplement 1. Alternative splicing of GATA1 is regulated by PRMT1 in acute
985 megakaryoblastic leukemia cell lines. P value was calculated from three independent repeats. ****P <
986 0.01, *** P < 0.05.
987
988 Figure 6-figure supplement 2. Schematic diagram of MPL isoforms. (A) A new isoform of MPL (c-MPL-
989 exon9-) (Genebank No. KF964490) was detected in MEG-01 cells. We synthesized cDNA from Meg-01
990 cells using Verso cDNA synthesis kit (Thermo Scientific) and performed regular PCR with primers as
39 991 reported (Li et al., 2000). Direct ligation of exon 8 with exon 10 generates a truncated MPL protein as
992 shown below. (B) Schematic diagram of c-MPL isoforms generated by alternative splicing.
993
994 Figure 6-figure supplement 3. Alternative splicing of c-MPL is measured as the ratios of different
995 isoforms by real-time PCR assays. The data are the averages from three independent experiments with
996 SD. (A) the ratio between c-MPL72minus-exon9/c-Mpl-exon9+. (B) the ratio between c-MPL-tr/c-MPL-
997 exon 9+. The c-MPL-tr stands for c-MPL isoform without exon 9 and exon 10. We also observed that the
998 ratio of the c-MPL isoform with 72bp missing in the exon 9 (i.e. c-MPL-72minus-exon9+) to c-MPL-exon
999 9+ mRNA is similarly changed like the ratio of c-MPL-exon 9-/c-MPL-exon 9+ mRNA upon
1000 overexpression or knock-down of RBM15 or of PRMT1. We discovered that the ratio of c-MPL-tr (which
1001 misses both exon 9 and exon 10) to c-MPL-exon9+ was changed likewise when the RBM15 level is
1002 changed as shown in Figure 6.
1003 Supplementary File 1: The real-time PCR primers for human genes.
1004 Supplementary File 2: shRNA sequences for knocking down CNOT4 and RBM15 genes in human cells.
1005
40 1006 References
1007 Albert, T.K., Hanzawa, H., Legtenberg, Y.I., de Ruwe, M.J., van den Heuvel, F.A., Collart, M.A., 1008 Boelens, R., and Timmers, H.T. (2002). Identification of a ubiquitin-protein ligase subunit within the 1009 CCR4-NOT transcription repressor complex. The EMBO journal 21, 355-364. 1010 Anders, S., and Huber, W. (2010). Differential expression analysis for sequence count data. Genome 1011 biology 11, R106. 1012 Anders, S., Reyes, A., and Huber, W. (2012). Detecting differential usage of exons from RNA-seq data. 1013 Genome Res 22, 2008-2017. 1014 Ariyoshi, M., and Schwabe, J.W. (2003). A conserved structural motif reveals the essential transcriptional 1015 repression function of Spen proteins and their role in developmental signaling. Genes Dev 17, 1909-1920. 1016 Bagger, F.O., Rapin, N., Theilgaard-Monch, K., Kaczkowski, B., Thoren, L.A., Jendholm, J., Winther, 1017 O., and Porse, B.T. (2013). HemaExplorer: a database of mRNA expression profiles in normal and 1018 malignant haematopoiesis. Nucleic Acids Res 41, D1034-1039. 1019 Baldwin, R.M., Morettin, A., Paris, G., Goulet, I., and Cote, J. (2012). Alternatively spliced protein 1020 arginine methyltransferase 1 isoform PRMT1v2 promotes the survival and invasiveness of breast cancer 1021 cells. Cell Cycle 11, 4597-4612. 1022 Baratta, M.G., Schinzel, A.C., Zwang, Y., Bandopadhayay, P., Bowman-Colin, C., Kutt, J., Curtis, J., 1023 Piao, H., Wong, L.C., Kung, A.L., et al. (2015). An in-tumor genetic screen reveals that the BET 1024 bromodomain protein, BRD4, is a potential therapeutic target in ovarian carcinoma. Proc Natl Acad Sci U 1025 S A 112, 232-237. 1026 Bedford, M.T., and Clarke, S.G. (2009). Protein arginine methylation in mammals: who, what, and why. 1027 Mol Cell 33, 1-13. 1028 Bezzi, M., Teo, S.X., Muller, J., Mok, W.C., Sahu, S.K., Vardy, L.A., Bonday, Z.Q., and Guccione, E. 1029 (2013). Regulation of constitutive and alternative splicing by PRMT5 reveals a role for Mdm4 pre-mRNA 1030 in sensing defects in the spliceosomal machinery. Genes Dev 27, 1903-1916. 1031 Bolger, A.M., Lohse, M., and Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence 1032 data. Bioinformatics 30, 2114-2120. 1033 Bourquin, J.P., Subramanian, A., Langebrake, C., Reinhardt, D., Bernard, O., Ballerini, P., Baruchel, A., 1034 Cave, H., Dastugue, N., Hasle, H., et al. (2006). Identification of distinct molecular phenotypes in acute 1035 megakaryoblastic leukemia by gene expression profiling. Proc Natl Acad Sci U S A 103, 3339-3344. 1036 Cabezas-Wallscheid, N., Klimmeck, D., Hansson, J., Lipka, D.B., Reyes, A., Wang, Q., Weichenhan, D., 1037 Lier, A., von Paleske, L., Renders, S., et al. (2014). Identification of regulatory networks in HSCs and 1038 their immediate progeny via integrated proteome, transcriptome, and DNA Methylome analysis. Cell 1039 Stem Cell 15, 507-522. 1040 Castelo-Branco, P., Furger, A., Wollerton, M., Smith, C., Moreira, A., and Proudfoot, N. (2004). 1041 Polypyrimidine tract binding protein modulates efficiency of polyadenylation. Mol Cell Biol 24, 4174- 1042 4183. 1043 Cazzola, M., Rossi, M., and Malcovati, L. (2013). Biologic and clinical significance of somatic mutations 1044 of SF3B1 in myeloid and lymphoid neoplasms. Blood 121, 260-269. 1045 Chang, J.L., Lin, H.V., Blauwkamp, T.A., and Cadigan, K.M. (2008). Spenito and Split ends act 1046 redundantly to promote Wingless signaling. Dev Biol 314, 100-111. 1047 Chen, F., and Rebay, I. (2000). split ends, a new component of the Drosophila EGF receptor pathway, 1048 regulates development of midline glial cells. Curr Biol 10, 943-946.
41 1049 Chen, L., Kostadima, M., Martens, J.H., Canu, G., Garcia, S.P., Turro, E., Downes, K., Macaulay, I.C., 1050 Bielczyk-Maczynska, E., Coe, S., et al. (2014). Transcriptional diversity during lineage commitment of 1051 human blood progenitors. Science 345, 1251033. 1052 Cheng, D., Cote, J., Shaaban, S., and Bedford, M.T. (2007). The arginine methyltransferase CARM1 1053 regulates the coupling of transcription and mRNA processing. Mol Cell 25, 71-83. 1054 Cheung, N., Chan, L.C., Thompson, A., Cleary, M.L., and So, C.W. (2007). Protein arginine- 1055 methyltransferase-dependent oncogenesis. Nat Cell Biol 9, 1208-1215. 1056 Chu, C., Zhang, Q.C., da Rocha, S.T., Flynn, R.A., Bharadwaj, M., Calabrese, J.M., Magnuson, T., 1057 Heard, E., and Chang, H.Y. (2015). Systematic discovery of Xist RNA binding proteins. Cell 161, 404- 1058 416. 1059 Crawford, N.P., Alsarraj, J., Lukes, L., Walker, R.C., Officewala, J.S., Yang, H.H., Lee, M.P., Ozato, K., 1060 and Hunter, K.W. (2008). Bromodomain 4 activation predicts breast cancer survival. Proc Natl Acad Sci 1061 U S A 105, 6380-6385. 1062 Crispino, J.D. (2005). GATA1 in normal and malignant hematopoiesis. Semin Cell Dev Biol 16, 137-147. 1063 Daga, A., Karlovich, C.A., Dumstrei, K., and Banerjee, U. (1996). Patterning of cells in the Drosophila 1064 eye by Lozenge, which shares homologous domains with AML1. Genes Dev 10, 1194-1205. 1065 de Klerk, E., and t Hoen, P.A. (2015). Alternative mRNA transcription, processing, and translation: 1066 insights from RNA sequencing. Trends Genet 31, 128-139. 1067 Dhar, S., Vemulapalli, V., Patananan, A.N., Huang, G.L., Di Lorenzo, A., Richard, S., Comb, M.J., Guo, 1068 A., Clarke, S.G., and Bedford, M.T. (2013). Loss of the major Type I arginine methyltransferase PRMT1 1069 causes substrate scavenging by other PRMTs. Scientific reports 3, 1311. 1070 Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and 1071 Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21. 1072 Fang, L., Zhang, L., Wei, W., Jin, X., Wang, P., Tong, Y., Li, J., Du, J.X., and Wong, J. (2014). A 1073 methylation-phosphorylation switch determines Sox2 stability and function in ESC maintenance or 1074 differentiation. Mol Cell 55, 537-551. 1075 Gao, J., Aksoy, B.A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S.O., Sun, Y., Jacobsen, A., Sinha, 1076 R., Larsson, E., et al. (2013). Integrative Analysis of Complex Cancer Genomics and Clinical Profiles 1077 Using the cBioPortal. Science signaling 6, pl1. 1078 Gao, Y., Smith, E., Ker, E., Campbell, P., Cheng, E.C., Zou, S., Lin, S., Wang, L., Halene, S., and 1079 Krause, D.S. (2012). Role of RhoA-specific guanine exchange factors in regulation of endomitosis in 1080 megakaryocytes. Dev Cell 22, 573-584. 1081 Goulet, I., Gauvin, G., Boisvenue, S., and Cote, J. (2007). Alternative splicing yields protein arginine 1082 methyltransferase 1 isoforms with distinct activity, substrate specificity, and subcellular localization. J 1083 Biol Chem 282, 33009-33021. 1084 Greenblatt, S.M., and Nimer, S.D. (2014). Chromatin modifiers and the promise of epigenetic therapy in 1085 acute leukemia. Leukemia 28, 1396-1406. 1086 Guo, A., Gu, H., Zhou, J., Mulhern, D., Wang, Y., Lee, K.A., Yang, V., Aguiar, M., Kornhauser, J., Jia, 1087 X., et al. (2014). Immunoaffinity enrichment and mass spectrometry analysis of protein methylation. Mol 1088 Cell Proteomics 13, 372-387. 1089 Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, 1090 M., Jr., Jungkamp, A.C., Munschauer, M., et al. (2010). Transcriptome-wide identification of RNA- 1091 binding protein and microRNA target sites by PAR-CLIP. Cell 141, 129-141.
42 1092 Harada, H., Harada, Y., Niimi, H., Kyo, T., Kimura, A., and Inaba, T. (2004). High incidence of somatic 1093 mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid 1094 leukemia with myelodysplasia. Blood 103, 2316-2324. 1095 Horiuchi, K., Kawamura, T., Iwanari, H., Ohashi, R., Naito, M., Kodama, T., and Hamakubo, T. (2013a). 1096 Identification of Wilms' tumor 1-associating protein complex and its role in alternative splicing and the 1097 cell cycle. J Biol Chem. 1098 Horiuchi, K., Kawamura, T., Iwanari, H., Ohashi, R., Naito, M., Kodama, T., and Hamakubo, T. (2013b). 1099 Identification of Wilms' tumor 1-associating protein complex and its role in alternative splicing and the 1100 cell cycle. J Biol Chem 288, 33292-33302. 1101 Hornyik, C., Terzi, L.C., and Simpson, G.G. (2010). The spen family protein FPA controls alternative 1102 cleavage and polyadenylation of RNA. Dev Cell 18, 203-213. 1103 Ichikawa, M., Asai, T., Saito, T., Seo, S., Yamazaki, I., Yamagata, T., Mitani, K., Chiba, S., Ogawa, S., 1104 Kurokawa, M., et al. (2004). AML-1 is required for megakaryocytic maturation and lymphocytic 1105 differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med 10, 1106 299-304. 1107 Katz, Y., Wang, E.T., Airoldi, E.M., and Burge, C.B. (2010). Analysis and design of RNA sequencing 1108 experiments for identifying isoform regulation. Nat Methods 7, 1009-1015. 1109 Kaushansky, A., and Kaushansky, K. (2014). Systems biology of megakaryocytes. Advances in 1110 experimental medicine and biology 844, 59-84. 1111 Kerr, S.C., Azzouz, N., Fuchs, S.M., Collart, M.A., Strahl, B.D., Corbett, A.H., and Laribee, R.N. (2011). 1112 The Ccr4-Not complex interacts with the mRNA export machinery. PloS one 6, e18302. 1113 Kolodziej, P.A., Jan, L.Y., and Jan, Y.N. (1995). Mutations that affect the length, fasciculation, or ventral 1114 orientation of specific sensory axons in the Drosophila embryo. Neuron 15, 273-286. 1115 Komeno, Y., Yan, M., Matsuura, S., Lam, K., Lo, M.C., Huang, Y.J., Tenen, D.G., Downing, J.R., and 1116 Zhang, D.E. (2014a). Runx1 exon 6 related alternative splicing isoforms differentially regulate 1117 hematopoiesis in mice. Blood. 1118 Komeno, Y., Yan, M., Matsuura, S., Lam, K., Lo, M.C., Huang, Y.J., Tenen, D.G., Downing, J.R., and 1119 Zhang, D.E. (2014b). Runx1 exon 6-related alternative splicing isoforms differentially regulate 1120 hematopoiesis in mice. Blood 123, 3760-3769. 1121 Kyburz, A., Friedlein, A., Langen, H., and Keller, W. (2006). Direct interactions between subunits of 1122 CPSF and the U2 snRNP contribute to the coupling of pre-mRNA 3' end processing and splicing. Mol 1123 Cell 23, 195-205. 1124 Lau, N.C., Kolkman, A., van Schaik, F.M., Mulder, K.W., Pijnappel, W.W., Heck, A.J., and Timmers, 1125 H.T. (2009). Human Ccr4-Not complexes contain variable deadenylase subunits. Biochem J 422, 443- 1126 453. 1127 Lee, J.H., and Skalnik, D.G. (2012). Rbm15-Mkl1 interacts with the Setd1b histone H3-Lys4 1128 methyltransferase via a SPOC domain that is required for cytokine-independent proliferation. PloS one 7, 1129 e42965. 1130 Li, J., Sabath, D.F., and Kuter, D.J. (2000). Cloning and functional characterization of a novel c-mpl 1131 variant expressed in human CD34 cells and platelets. Cytokine 12, 835-844. 1132 Liu, X., Zhang, Q., Zhang, D.E., Zhou, C., Xing, H., Tian, Z., Rao, Q., Wang, M., and Wang, J. (2009). 1133 Overexpression of an isoform of AML1 in acute leukemia and its potential role in leukemogenesis. 1134 Leukemia 23, 739-745.
43 1135 Loeb, G.B., Khan, A.A., Canner, D., Hiatt, J.B., Shendure, J., Darnell, R.B., Leslie, C.S., and Rudensky, 1136 A.Y. (2012). Transcriptome-wide miR-155 binding map reveals widespread noncanonical microRNA 1137 targeting. Mol Cell 48, 760-770. 1138 Luo, M. (2012). Current chemical biology approaches to interrogate protein methyltransferases. ACS 1139 chemical biology 7, 443-463. 1140 Ma, X., Renda, M.J., Wang, L., Cheng, E.C., Niu, C., Morris, S.W., Chi, A.S., and Krause, D.S. (2007). 1141 Rbm15 modulates Notch-induced transcriptional activation and affects myeloid differentiation. Mol Cell 1142 Biol 27, 3056-3064. 1143 Ma, Z., Morris, S.W., Valentine, V., Li, M., Herbrick, J.A., Cui, X., Bouman, D., Li, Y., Mehta, P.K., 1144 Nizetic, D., et al. (2001). Fusion of two novel genes, RBM15 and MKL1, in the t(1;22)(p13;q13) of acute 1145 megakaryoblastic leukemia. Nat Genet 28, 220-221. 1146 Maatz, H., Jens, M., Liss, M., Schafer, S., Heinig, M., Kirchner, M., Adami, E., Rintisch, C., Dauksaite, 1147 V., Radke, M.H., et al. (2014). RNA-binding protein RBM20 represses splicing to orchestrate cardiac 1148 pre-mRNA processing. J Clin Invest 124, 3419-3430. 1149 Matsumoto, K., Nakayama, H., Yoshimura, M., Masuda, A., Dohmae, N., Matsumoto, S., and Tsujimoto, 1150 M. (2012). PRMT1 is required for RAP55 to localize to processing bodies. RNA Biol 9, 610-623. 1151 Mayall, T.P., Sheridan, P.L., Montminy, M.R., and Jones, K.A. (1997). Distinct roles for P-CREB and 1152 LEF-1 in TCR alpha enhancer assembly and activation on chromatin templates in vitro. Genes Dev 11, 1153 887-899. 1154 McHugh, C.A., Chen, C.K., Chow, A., Surka, C.F., Tran, C., McDonel, P., Pandya-Jones, A., Blanco, M., 1155 Burghard, C., Moradian, A., et al. (2015). The Xist lncRNA interacts directly with SHARP to silence 1156 transcription through HDAC3. Nature 521, 232-236. 1157 McNerney, M.E., Brown, C.D., Wang, X., Bartom, E.T., Karmakar, S., Bandlamudi, C., Yu, S., Ko, J., 1158 Sandall, B.P., Stricker, T., et al. (2013). CUX1 is a haploinsufficient tumor suppressor gene on 1159 chromosome 7 frequently inactivated in acute myeloid leukemia. Blood 121, 975-983. 1160 Mercher, T., Coniat, M.B., Monni, R., Mauchauffe, M., Nguyen Khac, F., Gressin, L., Mugneret, F., 1161 Leblanc, T., Dastugue, N., Berger, R., et al. (2001). Involvement of a human gene related to the 1162 Drosophila spen gene in the recurrent t(1;22) translocation of acute megakaryocytic leukemia. Proc Natl 1163 Acad Sci U S A 98, 5776-5779. 1164 Mersman, D.P., Du, H.N., Fingerman, I.M., South, P.F., and Briggs, S.D. (2009). Polyubiquitination of 1165 the demethylase Jhd2 controls histone methylation and gene expression. Genes Dev 23, 951-962. 1166 Miller, J.E., and Reese, J.C. (2012). Ccr4-Not complex: the control freak of eukaryotic cells. Crit Rev 1167 Biochem Mol Biol 47, 315-333. 1168 Minajigi, A., Froberg, J.E., Wei, C., Sunwoo, H., Kesner, B., Colognori, D., Lessing, D., Payer, B., 1169 Boukhali, M., Haas, W., et al. (2015). Chromosomes. A comprehensive Xist interactome reveals cohesin 1170 repulsion and an RNA-directed chromosome conformation. Science 349. 1171 Moindrot, B., Cerase, A., Coker, H., Masui, O., Grijzenhout, A., Pintacuda, G., Schermelleh, L., 1172 Nesterova, T.B., and Brockdorff, N. (2015). A Pooled shRNA Screen Identifies Rbm15, Spen, and Wtap 1173 as Factors Required for Xist RNA-Mediated Silencing. Cell Rep 12, 562-572. 1174 Monfort, A., Di Minin, G., Postlmayr, A., Freimann, R., Arieti, F., Thore, S., and Wutz, A. (2015). 1175 Identification of Spen as a Crucial Factor for Xist Function through Forward Genetic Screening in 1176 Haploid Embryonic Stem Cells. Cell Rep 12, 554-561. 1177 Naeem, H., Cheng, D., Zhao, Q., Underhill, C., Tini, M., Bedford, M.T., and Torchia, J. (2007). The 1178 activity and stability of the transcriptional coactivator p/CIP/SRC-3 are regulated by CARM1-dependent 1179 methylation. Mol Cell Biol 27, 120-134.
44 1180 Nichols, R.C., Wang, X.W., Tang, J., Hamilton, B.J., High, F.A., Herschman, H.R., and Rigby, W.F. 1181 (2000). The RGG domain in hnRNP A2 affects subcellular localization. Exp Cell Res 256, 522-532. 1182 Niu, C., Zhang, J., Breslin, P., Onciu, M., Ma, Z., and Morris, S.W. (2009). c-Myc is a target of RNA- 1183 binding motif protein 15 in the regulation of adult hematopoietic stem cell and megakaryocyte 1184 development. Blood 114, 2087-2096. 1185 Ogura, M., Morishima, Y., Okumura, M., Hotta, T., Takamoto, S., Ohno, R., Hirabayashi, N., Nagura, H., 1186 and Saito, H. (1988). Functional and morphological differentiation induction of a human 1187 megakaryoblastic leukemia cell line (MEG-01s) by phorbol diesters. Blood 72, 49-60. 1188 Olthof, S.G., Fatrai, S., Drayer, A.L., Tyl, M.R., Vellenga, E., and Schuringa, J.J. (2008). Downregulation 1189 of signal transducer and activator of transcription 5 (STAT5) in CD34+ cells promotes megakaryocytic 1190 development, whereas activation of STAT5 drives erythropoiesis. Stem Cells 26, 1732-1742. 1191 Oswald, F., Kostezka, U., Astrahantseff, K., Bourteele, S., Dillinger, K., Zechner, U., Ludwig, L., Wilda, 1192 M., Hameister, H., Knochel, W., et al. (2002). SHARP is a novel component of the Notch/RBP-Jkappa 1193 signalling pathway. The EMBO journal 21, 5417-5426. 1194 Papadokostopoulou, A., Mathioudaki, K., Scorilas, A., Xynopoulos, D., Ardavanis, A., Kouroumalis, E., 1195 and Talieri, M. (2009). Colon cancer and protein arginine methyltransferase 1 gene expression. 1196 Anticancer Res 29, 1361-1366. 1197 Pikman, Y., Lee, B.H., Mercher, T., McDowell, E., Ebert, B.L., Gozo, M., Cuker, A., Wernig, G., Moore, 1198 S., Galinsky, I., et al. (2006). MPLW515L is a novel somatic activating mutation in myelofibrosis with 1199 myeloid metaplasia. PLoS medicine 3, e270. 1200 Raffel, G.D., Chu, G.C., Jesneck, J.L., Cullen, D.E., Bronson, R.T., Bernard, O.A., and Gilliland, D.G. 1201 (2009). Ott1 (Rbm15) is essential for placental vascular branching morphogenesis and embryonic 1202 development of the heart and spleen. Mol Cell Biol 29, 333-341. 1203 Rainis, L., Bercovich, D., Strehl, S., Teigler-Schlegel, A., Stark, B., Trka, J., Amariglio, N., Biondi, A., 1204 Muler, I., Rechavi, G., et al. (2003). Mutations in exon 2 of GATA1 are early events in megakaryocytic 1205 malignancies associated with trisomy 21. Blood 102, 981-986. 1206 Ran, D., Shia, W.J., Lo, M.C., Fan, J.B., Knorr, D.A., Ferrell, P.I., Ye, Z., Yan, M., Cheng, L., Kaufman, 1207 D.S., et al. (2013a). RUNX1a enhances hematopoietic lineage commitment from human embryonic stem 1208 cells and inducible pluripotent stem cells. Blood 121, 2882-2890. 1209 Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013b). Genome engineering 1210 using the CRISPR-Cas9 system. Nature protocols 8, 2281-2308. 1211 Rebay, I., Chen, F., Hsiao, F., Kolodziej, P.A., Kuang, B.H., Laverty, T., Suh, C., Voas, M., Williams, A., 1212 and Rubin, G.M. (2000). A genetic screen for novel components of the Ras/Mitogen-activated protein 1213 kinase signaling pathway that interact with the yan gene of Drosophila identifies split ends, a new RNA 1214 recognition motif-containing protein. Genetics 154, 695-712. 1215 Rho, J., Choi, S., Jung, C.R., and Im, D.S. (2007). Arginine methylation of Sam68 and SLM proteins 1216 negatively regulates their poly(U) RNA binding activity. Arch Biochem Biophys 466, 49-57. 1217 Rhodes, D.R., Kalyana-Sundaram, S., Mahavisno, V., Varambally, R., Yu, J., Briggs, B.B., Barrette, T.R., 1218 Anstet, M.J., Kincead-Beal, C., Kulkarni, P., et al. (2007). Oncomine 3.0: genes, pathways, and networks 1219 in a collection of 18,000 cancer gene expression profiles. Neoplasia 9, 166-180. 1220 Robin-Lespinasse, Y., Sentis, S., Kolytcheff, C., Rostan, M.C., Corbo, L., and Le Romancer, M. (2007). 1221 hCAF1, a new regulator of PRMT1-dependent arginine methylation. J Cell Sci 120, 638-647. 1222 Shapiro, I.M., Cheng, A.W., Flytzanis, N.C., Balsamo, M., Condeelis, J.S., Oktay, M.H., Burge, C.B., and 1223 Gertler, F.B. (2011). An EMT-driven alternative splicing program occurs in human breast cancer and 1224 modulates cellular phenotype. PLoS genetics 7, e1002218.
45 1225 Shi, Y., Downes, M., Xie, W., Kao, H.Y., Ordentlich, P., Tsai, C.C., Hon, M., and Evans, R.M. (2001). 1226 Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes Dev 15, 1227 1140-1151. 1228 Shia, W.J., Okumura, A.J., Yan, M., Sarkeshik, A., Lo, M.C., Matsuura, S., Komeno, Y., Zhao, X., 1229 Nimer, S.D., Yates, J.R., 3rd, et al. (2012). PRMT1 interacts with AML1-ETO to promote its 1230 transcriptional activation and progenitor cell proliferative potential. Blood 119, 4953-4962. 1231 Sinha, R., Allemand, E., Zhang, Z., Karni, R., Myers, M.P., and Krainer, A.R. (2010). Arginine 1232 methylation controls the subcellular localization and functions of the oncoprotein splicing factor 1233 SF2/ASF. Mol Cell Biol 30, 2762-2774. 1234 Smith, E.C., Thon, J.N., Devine, M.T., Lin, S., Schulz, V.P., Guo, Y., Massaro, S.A., Halene, S., 1235 Gallagher, P., Italiano, J.E., Jr., et al. (2012). MKL1 and MKL2 play redundant and crucial roles in 1236 megakaryocyte maturation and platelet formation. Blood 120, 2317-2329. 1237 Su, H., Liu, Y., and Zhao, X. (2015). SPEN family RNA binding proteins are novel tumor suppressors 1238 coupling transcriptional regulation with RNA processing. Cancer translational medicine 1. 1239 Teyssier, C., Ma, H., Emter, R., Kralli, A., and Stallcup, M.R. (2005). Activation of nuclear receptor 1240 coactivator PGC-1alpha by arginine methylation. Genes Dev 19, 1466-1473. 1241 Tiedt, R., Coers, J., Ziegler, S., Wiestner, A., Hao-Shen, H., Bornmann, C., Schenkel, J., Karakhanova, S., 1242 de Sauvage, F.J., Jackson, C.W., et al. (2009). Pronounced thrombocytosis in transgenic mice expressing 1243 reduced levels of Mpl in platelets and terminally differentiated megakaryocytes. Blood 113, 1768-1777. 1244 Tijssen, M.R., Cvejic, A., Joshi, A., Hannah, R.L., Ferreira, R., Forrai, A., Bellissimo, D.C., Oram, S.H., 1245 Smethurst, P.A., Wilson, N.K., et al. (2011). Genome-wide analysis of simultaneous GATA1/2, RUNX1, 1246 FLI1, and SCL binding in megakaryocytes identifies hematopoietic regulators. Dev Cell 20, 597-609. 1247 Tradewell, M.L., Yu, Z., Tibshirani, M., Boulanger, M.C., Durham, H.D., and Richard, S. (2012). 1248 Arginine methylation by PRMT1 regulates nuclear-cytoplasmic localization and toxicity of FUS/TLS 1249 harbouring ALS-linked mutations. Hum Mol Genet 21, 136-149. 1250 Tsuzuki, S., and Seto, M. (2012). Expansion of functionally defined mouse hematopoietic stem and 1251 progenitor cells by a short isoform of RUNX1/AML1. Blood 119, 727-735. 1252 Uranishi, H., Zolotukhin, A.S., Lindtner, S., Warming, S., Zhang, G.M., Bear, J., Copeland, N.G., 1253 Jenkins, N.A., Pavlakis, G.N., and Felber, B.K. (2009). The RNA-binding motif protein 15B 1254 (RBM15B/OTT3) acts as cofactor of the nuclear export receptor NXF1. J Biol Chem 284, 26106-26116. 1255 Vu, L.P., Perna, F., Wang, L., Voza, F., Figueroa, M.E., Tempst, P., Erdjument-Bromage, H., Gao, R., 1256 Chen, S., Paietta, E., et al. (2013). PRMT4 Blocks Myeloid Differentiation by Assembling a Methyl- 1257 RUNX1-Dependent Repressor Complex. Cell Rep 5, 1625-1638. 1258 Wang, C., Sashida, G., Saraya, A., Ishiga, R., Koide, S., Oshima, M., Isono, K., Koseki, H., and Iwama, 1259 A. (2014). Depletion of Sf3b1 impairs proliferative capacity of hematopoietic stem cells but is not 1260 sufficient to induce myelodysplasia. Blood 123, 3336-3343. 1261 Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R.S., and Zhang, Y. (2004). 1262 Role of histone H2A ubiquitination in Polycomb silencing. Nature 431, 873-878. 1263 Wang, R., and Luo, M. (2013). A journey toward Bioorthogonal Profiling of Protein Methylation inside 1264 living cells. Current opinion in chemical biology 17, 729-737. 1265 Wang, R., Zheng, W., Yu, H., Deng, H., and Luo, M. (2011). Labeling substrates of protein arginine 1266 methyltransferase with engineered enzymes and matched S-adenosyl-L-methionine analogues. J Am 1267 Chem Soc 133, 7648-7651. 1268 Xiao, N., Laha, S., Das, S.P., Morlock, K., Jesneck, J.L., and Raffel, G.D. (2014). Ott1(Rbm15) regulates 1269 thrombopoietin response in hematopoietic stem cells through alternative splicing of c-Mpl. Blood.
46 1270 Xiao, N., Laha, S., Das, S.P., Morlock, K., Jesneck, J.L., and Raffel, G.D. (2015). Ott1 (Rbm15) regulates 1271 thrombopoietin response in hematopoietic stem cells through alternative splicing of c-Mpl. Blood 125, 1272 941-948. 1273 Yan, L., Yan, C., Qian, K., Su, H., Kofsky-Wofford, S.A., Lee, W.C., Zhao, X., Ho, M.C., Ivanov, I., and 1274 Zheng, Y.G. (2014). Diamidine compounds for selective inhibition of protein arginine methyltransferase 1275 1. J Med Chem 57, 2611-2622. 1276 Yang, Y., and Bedford, M.T. (2013). Protein arginine methyltransferases and cancer. Nat Rev Cancer 13, 1277 37-50. 1278 Yoshida, K., Sanada, M., Shiraishi, Y., Nowak, D., Nagata, Y., Yamamoto, R., Sato, Y., Sato-Otsubo, A., 1279 Kon, A., Nagasaki, M., et al. (2011). Frequent pathway mutations of splicing machinery in 1280 myelodysplasia. Nature 478, 64-69. 1281 Zhao, X., Jankovic, V., Gural, A., Huang, G., Pardanani, A., Menendez, S., Zhang, J., Dunne, R., Xiao, 1282 A., Erdjument-Bromage, H., et al. (2008). Methylation of RUNX1 by PRMT1 abrogates SIN3A binding 1283 and potentiates its transcriptional activity. Genes Dev 22, 640-653. 1284 Zolotukhin, A.S., Schneider, R., Uranishi, H., Bear, J., Tretyakova, I., Michalowski, D., Smulevitch, S., 1285 O'Keeffe, S., Pavlakis, G.N., and Felber, B.K. (2008). The RNA transport element RTE is essential for 1286 IAP LTR-retrotransposon mobility. Virology 377, 88-99. 1287 Zolotukhin, A.S., Uranishi, H., Lindtner, S., Bear, J., Pavlakis, G.N., and Felber, B.K. (2009). Nuclear 1288 export factor RBM15 facilitates the access of DBP5 to mRNA. Nucleic Acids Res 37, 7151-7162.
1289
47 A R578 B
Human RBM15-FlagR578K RBM15-FlagVector Dog Pig Mono-methyl-R IP: Flag Mouse Flag Rat Horse Flag Chicken Zebrafish Input PRMT1 Frog GAPDH Ruler
C RBM15-Flag + + + - D PRMT1 V2 - +-- PR M T1 V1: MAAAEAANCIM E ------VSCGQAESSEKPN PRMT1 V1 -- - + PR M T1 V2: M AAAEAANCIM E NFVATLANGMSLQPPLEE VSCGQAESSEKPN Mono-methyl-R Dimethyl-R IP: Flag Flag PRMT1 F IP antibodies IgG anti-RBM15 Dox -++ - E HA-PRMT1 ++ - - + RBM15 RBM15-Flag - + - + - IP:RBM15 Mono-methyl-R RBM15-R578K-Flag --+ - + Dimethyl-R Dimethyl-R Flag RBM15
PRMT1 PRMT1 Input PRMT5 CARM1 G Migr1 RBM15 WT R578K RBM15 DB75 -++ -+- GAPDH Mono-methyl-R IP: Flag Dimethyl-R
Flag
Figure 1. RBM15 is methylated by PRMT1 at R578 in mammalian cells. AB
12 hrs VectorRBM15-FlagRBM15-FlagRBM15-Flag +V1 +V2 24 hrs RBM15 24 hrs PRMT1 V2 DMSOAdox/MTADMSOAdox/MTA DMSO DB75 RBM15 RBM15 PRMT1 GAPDH GAPDH GAPDH
shPRMT1#1 shPRMT1#2 Dox- Dox- 1.4 C Dox+ Dox+ 1.2 1.2 shPRMT1#1 shPRMT1#2 1.0 1.0 Dox -++ - 0.8 0.8 RBM15 0.6 0.6 PRMT1 0.4 0.4 0.2 0.2 GAPDH 0 0 Relative mRNA Expression Relative mRNA PRMT1PRMT1-V2 RBM15 Expression Relative mRNA PRMT1PRMT1-V2 RBM15
1.4 D 25 Dox- Dox- 1.2 Dox+ TripZ-PRMT1 V2 20 Dox+ 1.0 Dox - + 15 0.8 RBM15 0.6 10 PRMT1 0.4 5 GAPDH 0.2 0 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA 0 PRMT1-V2 RBM15
WT RBM15 R578K RBM15 F E pRS pRS-shPRMT1-V2 PRMT1 V2 - + - + RBM15 RBM15
PRMT1 V2 PRMT1
GAPDH GAPDH
G 0 30’ 1h 2h 3h 5h 150 RBM15 WT MEG-01 R578K Tubulin 100 MEG-01 RBM15-Flag RBM15-Flag Tubulin 50
MEG-01 Percentage Left R578K- RBM15-R578K-Flag 0 RBM15-Flag Tubulin 01234 5（Hours）
Figure 2. PRMT1 V2 isoform destabilizes RBM15 via methylation. A B C D DMSO DB75 RBM15-Flag ++ DMSO MG132 R578K-RBM15-Flag ----+ + His-Ub - + RBM15 RBM15-Flag - - ++ - - IP:RBM15 GAPDH Ni-NTA His-Ub +--+- + RBM15-F-(Ub)n Pull-down RBM15-F-(Ub)n
RBM15-F-(Ub)n WB: Ub WB: Flag IP:Flag WB: Ub WB: RBM15 WB: Flag Input WB: Flag Input WB: Tubulin WB:GAPDH 12 3 45 6 E PRMT1 V2 - - ++ --++ HA-CNOT4 - + +- -++- RBM15-Flag + + ++ ---- RBM15-R578K-Flag - - --++++ DMSO DB75 Ub + + ++++++ F
RBM15-F-(Ub)n Vector shCNOT4#1shCNOT4#2s VectorV shCNOT4#1shCNOT4#2 WB: Ub RBM15
IP: Flag CNOT4 WB: Flag PRMT1 V2 WB: PRMT1 WB: HA PRMT1 GAPDH WB: Flag
WB: HA Input WB: PRMT1
WB: GAPDH 1234 5 67 8 GHHA-PRMT1 + - - - + + RBM15-Flag - - + - + - RBM15-R578K-Flag - - - + - + Non-methylMethyl Peptide Peptide HA-CNOT4 + + + + + + Pull-down UBA1 + + + +++ WB: CNOT4 UbcH5b + + + +++ Input Ub + + + +++
WB: Flag RBM15-F-(Ub)n
RBM15-Flag
WB: PRMT1
WB: CNOT4 12 34 5 6
Figure 3. The RBM15 is ubiquitylated in a methylation-dependent manner. A 8 01224487296(hour) 1.8 RBM15 RBM15 1.6 PRMT1-V2 6 Methyl-RBM15 1.2 RBM5 PRMT 4 PRMT1 Methyl-RBM15 PRMT1 V2 0.8 PRMT1-V2 2 0.4 1 Relative Expression GAPDH Relative Expression 0 0 01224 48 72 96(hour) 0 12 24 48 72 96(hour) BC 60 *** VectorWT RBM15 R578K RBM15 Isotype ** 20 *** Vector *** WT RBM15 ** *** r 15 Cells
R578K RBM15 40 e
+
b m
u 4N 39.3% 4N 40.2% 4N 40.2% 10
N
20 l l
Cell Number e
C >4N 8.66% >4N 12.5% >4N 15.2% 5 % of CD41 0 CD41 0
Vector Propidium Iodide % of Polyploid Cells (> 4N) Vector WT RBM15 T RBM15 R578K RBM15 W R578K RBM15 D Control DB75 E Vector PRMT1 V2 40 0.021% 22.5% 0.11% 32.8% 0.44% 23% 0.065% 0.33% 30 Cells * Cells + 30 + 20 CD42 CD42 + 20 + CD42 CD42 10 10 ***
38.1% 39.4% 29.6% 37.5% % of CD61 72.7% 3.89% 89.6% 10.0% 0 0 % of CD61 Control DB75 Control PRMT1-V2 CD61 CD61 F Control shRBM15#1 shRBM15#2 40 **
Cells ** 31.8% 19.4% 21.7% + 30 CD42
+ 20
CD42 10
% of CD41 0
CD41 Vector shRBM15#1shRBM15#2 G Control WT RBM15 R578K RBM15 80 ** Cells ** + 60 CD42
43.6% 61.0% 67.7% + 40 CD42 20
% of CD41 0 CD41 Vector WT RBM15R578K RBM15 PRMT1-V2 PRMT1-V2 H Control PRMT1-V2 WT RBM15 R578K RBM15 ** 60 *** ** 25.13.94% 25.127.3% 25.140.1% Cells
25.1% + ns 40 ** CD42
+ ** CD42 20
0 % of CD61 CD61 Control PRMT1-V2PRMT1-V2 PRMT1-V2 R578K RBM15 Figure 4. PRMT1 controls the protein level of RBM15 in megakaryocyte maturation. WT RBM15 A B
1.5 IgG anti-RBM15 Ab RBM15 binding sites p=0.023 p=0.006 * p=0.036 ** * 1.0 Intron (760) p=0.015 p=0.083 * % of Input 0.5 5’UTR(7) p=0.02 * *** 3’UTR(443)
0 CDS(87)
GAPDH GATA1flGATA1s RUNX1 b,RUNX1a c c-MPL-Exon9-c-MPL-Exon9+ D P Value (- log10) Glycolysis C P Value (- log10) RNA processing Regulation of cellular catabolic process Respiratory electron transport mRNA metabolic process Calcium ion transport Tricarboxylic acid cycle Regulation of cell adhesion mRNA processing Platelet activation Aerobic respiration Regulation of Ras protein signal transduction RNA splicing, via transesterification reactions Regulation of localization organic acid metabolic process Anatomical structure morphogenesis cellular amino acid metabolic process Regulation of GTPase activity mRNA splicing via spliceosome oxoacid metabolic process Regulation of GTP catabolic process small molecule metabolic process Regulation of signal trunsduction energy derivation by oxidation of organic Regulation of response to stimulus Oxidation-reduction process Regulation of cell communication Carboxylic acid metabolic process Biological adhesion Generation of precursor metabolites and energy 0234567024681014 8 12
E SplicingTypes Event # F H 1 PSI Decrease PSI Increase T3UTR 86 SE 614 0.8 shRBM15 Control RI 124 #1 #2 0.6 700bp MXE 62 600bp ALE 317 0.4 500bp 400bp AFE 505 Relative Fraction 0.2 A5SS 137 0 A3SS 176 T3UTR SE RI MXE ALE AFE A5SS A3SS Alternative Splicing Types
G MEG-01
shRBM15 #1
shRBM15 #2
Figure 5. Analysis of RBM15 target genes. AC3 B GATA1fl/GATA1s GATA1fl/GATA1s GATA1fl/GATA1s **** 3.5 **** 2.5 3.0 p=0.0114 2 * 2.5 2.0 **** 2.0 1.5 1.5 1 1.0 1.0 **** **** 0.5 **** 0.5 Relative Alternative Splicing Ratio Relative Relative Alternative Splicing Ratio Relative
0 Alternative Splicing Ratio Relative 0 0 Day 0 Day 4 Day 10 DMSO DB75
Vector Vector WT RBM15 shRBM15#1shRBM15#2 R578K RBM15 PRMT1 V2-Dox shPRMT1#1-DoxshPRMT1#1+DoxshPRMT1#2-DoxshPRMT1#2+DoxPRMT1 V2+Dox 1.2 RUNX1a/RUNX1b,c 1.5 RUNX1a/RUNX1b,c
2.5 RUNX1a/RUNX1b,c 1.0 *** ** 0.8 1.0 2.0 ** p=0.014 0.6 *
1.5 0.4 0.5
0.2 1.0 **
*** Alternative Splicing Ratio Relative **** 0 Alternative Splicing Ratio Relative 0 *** Day 0 Day 4 Day 10 DMSO DB75 0.5 Relative Alternative Splicing Ratio Relative c-MPL-Exon9-/Exon9+ c-MPL-Exon9-/Exon9+ 0 1.2 1.5 Vector Vector WT RBM15 shRBM15#1shRBM15#2 1.0 R578K RBM15 shPRMT1#1-DoxshPRMT1#1+DoxshPRMT1#2-DoxshPRMT1#2+DoxPRMT1PRMT1 V2-Dox V2+Dox 0.8 1.0 2.5 c-MPL-Exon9-/Exon9+ 0.6 **** p=0.0386 2.0 0.4 0.5 * * ** 0.2 1.5 Relative Alternative Splicing Ratio Relative 0 Alternative Splicing Ratio Relative 0 Day 0 Day 4 Day 10 DMSO DB75 1.0 * *** *** **
0.5 Relative Alternative Splicing Ratio Relative
0
Vector Vector WT RBM15 shRBM15#1shRBM15#2 R578K RBM15 shPRMT1#1-DoxshPRMT1#1+DoxshPRMT1#2-DoxshPRMT1#2+DoxPRMT1PRMT1 V2-Dox V2+Dox Figure 6. Methylation of RBM15 controls alternative splicing of genes (RUNX1, GATA1 and c-MPL) important for megakaryocyte differentiation. Figure 7. RBM15 directly recruits the intron binding splicing factor, SF3B1, for alternative RNA splicing.
A B IgG anti-RBM15 Migr1 RBM15 WT R578K RBM15 Dox -++ - DB75 -++ -+- RBM15 IP IP: Flag SF3B1 SF3B1 Flag RBM15 SF3B1 SF3B1 Input PRMT1 Input Flag GAPDH GAPDH
C RBM15 binding on GATA1 pre-mRNA Anti-RBM15 IgG
D 10 RBM15 RIP-GATA1 0.4 SF3B1 RIP-GATA1 Vector 8 Vector 0.3 shRBM15 shRBM15 6 0.2 4 % of Input % of Input 0.1 2 0 0
GAPDHIntron 1 Exon 2Intron 2Exon 3Intron 4 GAPDHIntron 1 Exon 2Intron 2Exon 3Intron 4 IntronIntron 1+577 1+1064Intron 1+1986 IntronIntron 1+577 1+1064Intron 1+1986 Exon 2 Exon 3 Primer Intron 1+577 Intron 1+1064 Intron 1+1986 Intron 2 Intron 4 Exon1 Exon2Exon3 Exon4 Position
E RBM15 RIP- c-MPL SF3B1 RIP- c-MPL 0.15 0.15 Vector Vector shRBM15 shRBM15 0.10 0.10
% of Input 0.05 0.05 % of Input
0 0
Exon 8Intron + 8823Intron 8+9099 8+9789Exon 9+11122 Intron Intron8+9099 8+9789Exon 9+11122 Intron 8+10709IntronIntron 10+11641Intron 10+11899Intron 10+11943Intron 10+12481Intron 10+12828Intron 10+13551 10+14048 Exon 8 + 8823 Intron 8+10709Intron Intron10+11899 Intron10+11943 Intron10+12481 Intron10+12828 10+13551 Exon 8+8823 Exon 9+11122 Intron 8+9099 Intron 8+10709 Intron 10+11641 Intron 10+11943 Intron 10+12828 Intron 10+14048 Primer Exon8 Exon9 Exon10 Exon11Exon11 Position Intron 8+9789 Intron 10+11899 Intron 10+12481 Intron 10+13551 F