DOCSLIB.ORG

The Secretome Mouse Provides a Genetic Platform to Delineate Tissue-Specific in Vivo Secretion

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Secretome Mouse Provides a Genetic Platform to Delineate Tissue-Specific in Vivo Secretion The secretome mouse provides a genetic platform to delineate tissue-specific in vivo secretion Jie Liua,b,1, Ji Yong Janga,1, Mehdi Piroozniac, Shihui Liua,d, and Toren Finkela,b,2 aAging Institute, University of Pittsburgh School of Medicine/UPMC, Pittsburgh, PA 15219; bDepartment of Medicine, Division of Cardiology, University of Pittsburgh/UPMC, Pittsburgh, PA 15219; cBioinformatics and Computational Core Facility, National Heart, Lung, and Blood Institute, NIH, Bethesda, MD 20892; and dDepartment of Medicine, Division of Infectious Disease, University of Pittsburgh/UPMC, Pittsburgh, PA 15219 Edited by Christine E. Seidman, HHMI, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, and approved December 11, 2020 (received for review March 23, 2020) At present, it remains difficult to deconvolute serum in order to under basal conditions and following a wide variety of physiological identify the cell or tissue origin of a given circulating protein. Here, or pathological stresses. by exploiting the properties of proximity biotinylation, we de- scribe a mouse model that enables the elucidation of the in vivo Results tissue-specific secretome. As an example, we demonstrate how we Determining the in Vitro Secretome Using Proximity Biotinylation. In can readily identify in vivo endothelial-specific secretion as well as an effort to tag and purify secreted proteins, we constructed how this model allows for the characterization of muscle-derived ER-BioIDHA containing the promiscuous biotinylation enzyme serum proteins that either increase or decrease with exercise. This BioID2 in frame with an HA-epitope tag and the KDEL peptide genetic platform should, therefore, be of wide utility in under- C-terminal ER retention sequence (Fig. 1A). To allow the expression standing normal and disease physiology and for the rational de- of ER-BioIDHA in a wide variety of cell types, we incorporated this sign of tissue-specific disease biomarkers. construct into a lentiviral vector. Subsequent lentiviral-mediated delivery to primary endothelial cells in culture demonstrated protein secretion | biotinylation | mouse model ER-BioIDHA extensively colocalized with the ER resident pro- tein calnexin (Fig. 1B). In cells expressing ER-BioIDHA, the addition uman plasma contains a complex mixture of thousands of of exogenous biotin (50 μM) resulted in the accumulation of intra- Hproteins derived from multiple tissues. While the tissue cellular biotinylated proteins as evidenced by streptavidin-dependent MEDICAL SCIENCES origin of certain abundant proteins, such as albumin, are known, immunohistochemistry (Fig. 1C). As would be expected, this accu- the complete contribution of any given cell type to the plasma mulation of biotinylated proteins was not evident when the culture proteome currently remains difficult to elucidate. Such infor- medium was not supplemented with exogenous biotin (Fig. 1C). mation would undoubtedly be useful as there is a growing real- Given that ER-BioIDHA localizes to the ER lumen, we predicted that ization that the abundance of certain serum proteins might many of these intracellular biotinylated proteins would eventually provide unique insight into human health (1, 2). Moreover, if appear in the conditioned medium of ER-BioIDHA-expressing cells. one wishes to derive sensitive disease biomarkers, it would be Streptavidin purified supernatants of primary endothelial cells useful to know the total compendium of proteins that derive expressing either ER-BioIDHA or a green fluorescent protein (GFP) from a given cell or tissue implicated in the disease process. This control demonstrated that in the presence of exogenous biotin, tissue-specific in vivo secretome would serve as a rational entry only endothelial cells expressing ER-BioIDHA secreted multiple point for subsequent biomarker development. In an effort to provide a molecular platform to capture the Significance tissue-specific secretome, we have exploited the properties of proximity biotinylation (3). This technique provides a way of using a modified version of the bacterial enzyme BirA to cova- Serum is a complex mixture of proteins that originate from a lently biotinylate proteins within an approximate 10-nm range wide range of cells and tissues. At present, it is impossible to know what set of proteins any given tissue contributes to the (4). The utility of proximity-dependent biotin identification circulating proteome. Here, we describe a genetic model called (BioID) has been extensively documented as this method allows the secretome mouse. We show this transgenic mouse, which for a convenient strategy to elucidate protein–protein interac- employs proximity biotinylation, provides a robust strategy for tions (3). We realized, however, that this methodology might also delineating the tissue-specific secretome. We demonstrate the provide a method to more generally tag proteins and thereby utility of the secretome mouse by identifying the set of in vivo provide a platform to elucidate tissue-specific secretion. HA proteins secreted by endothelial cells as well as by skeletal Here, we describe the construction and analysis of ER-BioID , muscle with and without exercise. This genetic strategy should, an epitope tagged version of BioID that constitutively localizes to therefore, be useful in delineating a wide range of in vivo the lumen of the endoplasmic reticulum (ER). Given that most physiology and for the rational development of disease- membrane and secreted proteins transit through the ER, expression relevant biomarkers. of ER-BioIDHA provides a method of biotinylating those proteins destined for conventional secretion. We have generated a floxed Author contributions: J.L. and T.F. designed research; J.L. and J.Y.J. performed research; HA transgenic mouse expressing ER-BioID (termed the "secretome J.L. and S.L. contributed new reagents/analytic tools; J.L. and M.P. analyzed data; and T.F. mouse") that allows for tissue-specific expression of ER-BioIDHA. wrote the paper. When crossed with Cre-recombinase-expressing mice and given Competing interest statement: A provisional patent has been filed by T.F. and J.L. exogenous biotin in their diet, these animals secrete biotinylated This article is a PNAS Direct Submission. proteins in a tissue-specific fashion. These biotin-tagged serum Published under the PNAS license. proteins can be rapidly identified using a simple one-step strepta- 1J.L. and J.Y.J. contributed equally to this work. vidin purification followed by mass spectroscopy. Here, we provide 2To whom correspondence may be addressed. Email: [email protected]. initial data on endothelial and muscle in vivo secretion using the This article contains supporting information online at https://www.pnas.org/lookup/suppl/ secretome mouse. However, we believe this platform should allow doi:10.1073/pnas.2005134118/-/DCSupplemental. for the rapid identification of the secretome of any cell or tissue Published January 11, 2021. PNAS 2021 Vol. 118 No. 3 e2005134118 https://doi.org/10.1073/pnas.2005134118 | 1of8 Downloaded by guest on September 29, 2021 A B Calnexin HA Calnexin/HA/DAPI IgK-SP BioID2 HA KDEL - Secreted into ER lumen ER-BioIDHA BioID2 HA KDEL ER retenon signal + media lysate C ER-BioIDHA DEGFP ER-BioIDHA GFP ER-BioIDHA Calnexin SA Calnexin/SA/DAPI Bion : + - + - Bion : + - + - - 250- 250- 150- 150- IP: SA - 100- WB : SA 100- WB : HA 75- 75- 50- Bion 37- 50- 25- 37- 20- + 15- 25- 20- 25- HA 15- 50- tubulin Fig. 1. Expression of ER-BioIDHA allows for the rapid purification of secreted proteins from endothelial cells. (A) Diagram of the ER-BioIDHA construct. (B) Expression of ER-BioIDHA in endothelial cells colocalizes with the ER resident protein calnexin. Primary endothelial cells were infected with a lentivirus encoding ER-BioIDHA or the pLJM1 empty vector lentivirus (−). Expression of BioID was determined using the HA-epitope with 4′,6-diamidino-2-phenylindole (DAPI) used as a nuclear counterstain. (C) Detection of biotinylated proteins using streptavidin (SA)-based immunohistochemistry in endothelial cell- expressing ER-BioIDHA in the presence (50 μM) or absence of exogenous biotin. (D) Detection of secreted biotinylated proteins using SA-based purification and SA-based Western blotting. Conditioned media of endothelial cells expressing ER-BioIDHA or GFP in the presence or absence of exogenous biotin was assessed. Initial cell lysate was assessed for ER-BioIDHA expression (HA epitope) and tubulin as a loading control. (E) ER-BioIDHA protein was not detected in the supernatant (media) of ER-BioIDHA or GFP-expressing cells as assessed by HA-epitope assessment. Protein lysate from endothelial cells expressing ER-BioIDHA serve as a positive control. biotinylated proteins into the conditioned medium (Fig. 1D and SI (Fig. 2A). We noted a number of specific proteins whose abun- Appendix,Fig.S1). Of note, we did not observe that ER-BioIDHA dance in the culture medium markedly increased following in- itself was evident in the culture medium, suggesting that biotinylation duction of EndoMT (Fig. 2B and SI Appendix, Table S1). occurred intracellularly (Fig. 1E). Included in the list of secreted proteins are proteins that might The detection of the secretome of cells in culture is often be expected to increase with a transition to a more mesenchymal complicated by abundant serum proteins present in culture phenotype including the extracellular matrix protein papilin as medium. While it is theoretically possible to perform these types well as collagen Type 8 and
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Hemolysin from Escherichia Coli Uses Endogenous Amplification Through P2X Receptor Activation to Induce Hemolysis
    ␣-Hemolysin from Escherichia coli uses endogenous amplification through P2X receptor activation to induce hemolysis Marianne Skalsa, Niklas R. Jorgensenb, Jens Leipzigera, and Helle A. Praetoriusa,1 aDepartment of Physiology and Biophysics, Water and Salt Research Center, Aarhus University, Ole Worms Alle 1160, 8000 Aarhus C, Denmark; and bDepartment for Clinical Biochemistry, Roskilde Hospital, Koegevej 3-7, 4000 Roskilde, Denmark Edited by Sucharit Bhakdi, University of Mainz, Mainz, Germany, and accepted by the Editorial Board January 6, 2009 (received for review July 22, 2008) Escherichia coli is the dominant facultative bacterium in the normal and are referred to as P2X1–7. All P2X receptors are permeable to intestinal flora. E. coli is, however, also responsible for the majority small monovalent cations and some have significant calcium per- of serious extraintestinal infections. There are distinct serotypical meability (11). Here we show that human, murine, and equine differences between facultative and invasive E. coli strains. Inva- erythrocytes use a combination of P2X1 and P2X7 receptor acti- sive strains frequently produce virulence factors such as ␣-hemolysin vation for full HlyA-induced hemolysis to occur. This is particularly (HlyA), which causes hemolysis by forming pores in the erythrocyte interesting, as prolonged stimulation of P2X7 receptors are known membrane. The present study reveals that this pore formation to increase the plasma membrane permeability to an extent that triggers purinergic receptor activation to mediate the full hemo- eventually leads to lysis of certain cells (12). In macrophages it has lytic action. Non-selective ATP-receptor (P2) antagonists (PPADS, been shown that pannexin1, a recently discovered pore-forming suramin) and ATP scavengers (apyrase, hexokinase) concentration protein, is required for this increment in permeability (12, 13).
    [Show full text]
  • Profiling of Transcripts and Proteins Modulated by the E7 Oncogene in the Lung Tissue of E7-Tg Mice by the Omics Approach
    MOLECULAR MEDICINE REPORTS 2: 129-137, 2009 129 Profiling of transcripts and proteins modulated by the E7 oncogene in the lung tissue of E7-Tg mice by the omics approach EUNJIN KIM1*, JEONGWOO KANG1,3*, MINCHUL CHO1, SOJUNG LEE1, EUNHEE SEO1, HEESOOK CHOI1, YUMI KIM1, JUNGHEE KIM1, KUM YONG KANG2, KWANG PYO KIM2, JAEYONG HAN3, YHUNYHONG SHEEN4, YOUNG NA YUM5, SUE-NIE PARK5 and DO-YOUNG YOON1 Departments of 1Bioscience and Biotechnology, and 2Molecular Biotechnology, Konkuk University, Hwayang-dong 1, Gwangjin-gu, Seoul 143-701; 3Laboratory of Animal Genetic Engineering, Department of Food and Animal Biotechnology, Seoul National University, Seoul 151-742; 4School of Pharmacy, Ewha Womans University, Seoul 120-750; 5Korea Food and Drug Administration, #194 Tongil-ro, Eunpyung-gu, Seoul 122-704, Korea Received August 18, 2008; Accepted November 10, 2008 DOI: 10.3892/mmr_00000073 Abstract. The E6 and E7 oncoproteins of human papilloma suggest that the E7 oncogene modulates the expression levels virus (HPV) type 16 have been known to cooperatively induce of cell cycle-related (cyclin B1, cyclin E2) and cell adhesion- the immortalization and transformation of primary keratino- and migration-related (actinin ·1, CD166) factors, which may cytes. We established an E7 transgenic mouse model to play important roles in cellular transformation in cancer. In screen HPV-related biomakers using the omics approach. addition, the solubilization of the rigid intermediate filament The methods used to identify HPV-modulated factors were network by specific proteolysis mediated via up-regulating genomics analysis by microarray using the Affymetrix 430 gelsolin and down-regulating cofilin-1, as well as increased 2.0 array to screen E7-modulated genes, and proteomics levels of endoplasmic reticulum protein calnexin with chap- analysis using nano-LC-ESI-MS/MS to screen E7-modulated erone functions, might also be involved in E7-lung epithelial proteins with the lung tissue of E7 transgenic mice.
    [Show full text]
  • Disposal of Toxin Heptamers by Extracellular Vesicle Formation and Lysosomal Degradation
    toxins Article Major Determinants of Airway Epithelial Cell Sensitivity to S. aureus Alpha-Toxin: Disposal of Toxin Heptamers by Extracellular Vesicle Formation and Lysosomal Degradation Nils Möller 1,* , Sabine Ziesemer 1, Christian Hentschker 2, Uwe Völker 2 and Jan-Peter Hildebrandt 1 1 Animal Physiology and Biochemistry, University of Greifswald, Felix Hausdorff-Strasse 1, D-17489 Greifswald, Germany; [email protected] (S.Z.); [email protected] (J.-P.H.) 2 Department of Functional Genomics, Interfaculty Institute for Genetics and Functional Genomics, University Medicine Greifswald, Felix Hausdorff-Strasse 8, D-17475 Greifswald, Germany; [email protected] (C.H.); [email protected] (U.V.) * Correspondence: [email protected] Abstract: Alpha-toxin is a major virulence factor of Staphylococcus aureus. Monomer binding to host cell membranes results in the formation of heptameric transmembrane pores. Among human model airway epithelial cell lines, A549 cells were most sensitive toward the toxin followed by 16HBE14o- and S9 cells. In this study we investigated the processes of internalization of pore-containing plasma membrane areas as well as potential pathways for heptamer degradation (lysosomal, proteasomal) or disposal (formation of exosomes/micro-vesicles). The abundance of toxin heptamers upon applying an alpha-toxin pulse to the cells declined both in extracts of whole cells and of cellular membranes of Citation: Möller, N.; Ziesemer, S.; S9 cells, but not in those of 16HBE14o- or A549 cells. Comparisons of heptamer degradation rates un- Hentschker, C.; Völker, U.; der inhibition of lysosomal or proteasomal degradation revealed that an important route of heptamer Hildebrandt, J.-P.
    [Show full text]
  • Calreticulin—Multifunctional Chaperone in Immunogenic Cell Death: Potential Significance As a Prognostic Biomarker in Ovarian
    cells Review Calreticulin—Multifunctional Chaperone in Immunogenic Cell Death: Potential Significance as a Prognostic Biomarker in Ovarian Cancer Patients Michal Kielbik *, Izabela Szulc-Kielbik and Magdalena Klink Institute of Medical Biology, Polish Academy of Sciences, 106 Lodowa Str., 93-232 Lodz, Poland; [email protected] (I.S.-K.); [email protected] (M.K.) * Correspondence: [email protected]; Tel.: +48-42-27-23-636 Abstract: Immunogenic cell death (ICD) is a type of death, which has the hallmarks of necroptosis and apoptosis, and is best characterized in malignant diseases. Chemotherapeutics, radiotherapy and photodynamic therapy induce intracellular stress response pathways in tumor cells, leading to a secretion of various factors belonging to a family of damage-associated molecular patterns molecules, capable of inducing the adaptive immune response. One of them is calreticulin (CRT), an endoplasmic reticulum-associated chaperone. Its presence on the surface of dying tumor cells serves as an “eat me” signal for antigen presenting cells (APC). Engulfment of tumor cells by APCs results in the presentation of tumor’s antigens to cytotoxic T-cells and production of cytokines/chemokines, which activate immune cells responsible for tumor cells killing. Thus, the development of ICD and the expression of CRT can help standard therapy to eradicate tumor cells. Here, we review the physiological functions of CRT and its involvement in the ICD appearance in malignant dis- ease. Moreover, we also focus on the ability of various anti-cancer drugs to induce expression of surface CRT on ovarian cancer cells. The second aim of this work is to discuss and summarize the prognostic/predictive value of CRT in ovarian cancer patients.
    [Show full text]
  • Transport Proteins Promoting Escherichia Coli Pathogenesis
    Microbial Pathogenesis 71-72 (2014) 41e55 Contents lists available at ScienceDirect Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath Transport proteins promoting Escherichia coli pathogenesis Fengyi Tang 1, Milton H. Saier Jr. * Department of Molecular Biology, Division of Biological Sciences, University of California at San Diego, La Jolla, CA 92093-0116, USA article info abstract Article history: Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide Received 26 November 2013 annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, Received in revised form gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and 19 March 2014 compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related Accepted 20 March 2014 to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell Available online 18 April 2014 surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity Keywords: Escherichia coli secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex re- fi Pathogenesis ceptors and high-af nity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar Transporters encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in Toxins K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, Iron acquisition different from those of extracellular pathogens. The results presented in this report provide information Intra vs.
    [Show full text]
  • N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
    Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic
    [Show full text]
  • A Selective ER-Phagy Exerts Procollagen Quality Control Via a Calnexin-FAM134B Complex
    Article A selective ER-phagy exerts procollagen quality control via a Calnexin-FAM134B complex Alison Forrester1,†, Chiara De Leonibus1,†, Paolo Grumati2,†, Elisa Fasana3,†, Marilina Piemontese1, Leopoldo Staiano1, Ilaria Fregno3,4, Andrea Raimondi5, Alessandro Marazza3,6, Gemma Bruno1, Maria Iavazzo1, Daniela Intartaglia1, Marta Seczynska2, Eelco van Anken7, Ivan Conte1, Maria Antonietta De Matteis1,8, Ivan Dikic2,9,* , Maurizio Molinari3,10,** & Carmine Settembre1,11,*** Abstract The EMBO Journal (2019) 38:e99847 Autophagy is a cytosolic quality control process that recognizes substrates through receptor-mediated mechanisms. Procollagens, Introduction the most abundant gene products in Metazoa, are synthesized in the endoplasmic reticulum (ER), and a fraction that fails to attain Macroautophagy (hereafter referred to as autophagy) is a homeostatic the native structure is cleared by autophagy. However, how auto- catabolic process devoted to the sequestration of cytoplasmic material phagy selectively recognizes misfolded procollagens in the ER in double-membrane vesicles (autophagic vesicles, AVs) that eventu- lumen is still unknown. We performed siRNA interference, CRISPR- ally fuse with lysosomes where cargo is degraded (Mizushima, 2011). Cas9 or knockout-mediated gene deletion of candidate autophagy Autophagy is essential to maintain tissue homeostasis and counter- and ER proteins in collagen producing cells. We found that the ER- acts both the onset and progression of many disease conditions, such resident lectin chaperone Calnexin (CANX) and the ER-phagy as ageing, neurodegeneration and cancer (Levine et al, 2015). receptor FAM134B are required for autophagy-mediated quality Substrates can be selectively delivered to AVs through receptor- control of endogenous procollagens. Mechanistically, CANX acts as mediated processes. Autophagy receptors harbour a LC3 or GABARAP co-receptor that recognizes ER luminal misfolded procollagens and interaction motif (LIR or GIM, respectively) that facilitate binding of interacts with the ER-phagy receptor FAM134B.
    [Show full text]
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And
    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
    [Show full text]
  • Membrane Topology of the C. Elegans SEL-12 Presenilin
    Neuron, Vol. 17, 1015±1021, November, 1996, Copyright 1996 by Cell Press Membrane Topology of the C. elegans SEL-12 Presenilin Xiajun Li* and Iva Greenwald*²³ [this issue of Neuron]; Thinakaran et al., 1996). In the *Integrated Program in Cellular, Molecular, Discussion, we examine the amino acid sequence in and Biophysical Studies light of the deduced topology. ² Department of Biochemistry and Molecular Biophysics Results ³ Howard Hughes Medical Institute Columbia University Sequence analysis suggests that SEL-12 and human College of Physicians and Surgeons presenilins have ten hydrophobic regions (Figure 1). In New York, New York 10032 this study, we provide evidence that a total of eight of these hydrophobic regions function as transmembrane domains in vivo. Below, we use the term ªhydrophobic Summary regionº to designate a segment of the protein with the potential to span the membrane, as inferred by hydro- Mutant presenilins cause Alzheimer's disease. Pre- phobicity analysis, and ªtransmembrane domainº to senilins have multiple hydrophobic regions that could designate a hydrophobic region that our data suggest theoretically span a membrane, and a knowledge of actually spans a membrane. the membrane topology is crucial for deducing the mechanism of presenilin function. By analyzing the activity of b-galactosidase hybrid proteins expressed Strategy in C. elegans, we show that the C. elegans SEL-12 We constructed transgenes encoding hybrid SEL- presenilin has eight transmembrane domains and that 12::LacZ proteins, in which LacZ was placed after each there is a cleavage site after the sixth transmembrane of ten hydrophobic regions identified by hydrophobicity domain. We examine the presenilin sequence in view analysis (see Figure 1).
    [Show full text]
  • Detection of Pro Angiogenic and Inflammatory Biomarkers in Patients With
    www.nature.com/scientificreports OPEN Detection of pro angiogenic and infammatory biomarkers in patients with CKD Diana Jalal1,2,3*, Bridget Sanford4, Brandon Renner5, Patrick Ten Eyck6, Jennifer Laskowski5, James Cooper5, Mingyao Sun1, Yousef Zakharia7, Douglas Spitz7,9, Ayotunde Dokun8, Massimo Attanasio1, Kenneth Jones10 & Joshua M. Thurman5 Cardiovascular disease (CVD) is the most common cause of death in patients with native and post-transplant chronic kidney disease (CKD). To identify new biomarkers of vascular injury and infammation, we analyzed the proteome of plasma and circulating extracellular vesicles (EVs) in native and post-transplant CKD patients utilizing an aptamer-based assay. Proteins of angiogenesis were signifcantly higher in native and post-transplant CKD patients versus healthy controls. Ingenuity pathway analysis (IPA) indicated Ephrin receptor signaling, serine biosynthesis, and transforming growth factor-β as the top pathways activated in both CKD groups. Pro-infammatory proteins were signifcantly higher only in the EVs of native CKD patients. IPA indicated acute phase response signaling, insulin-like growth factor-1, tumor necrosis factor-α, and interleukin-6 pathway activation. These data indicate that pathways of angiogenesis and infammation are activated in CKD patients’ plasma and EVs, respectively. The pathways common in both native and post-transplant CKD may signal similar mechanisms of CVD. Approximately one in 10 individuals has chronic kidney disease (CKD) rendering CKD one of the most common diseases worldwide1. CKD is associated with a high burden of morbidity in the form of end stage kidney disease (ESKD) requiring dialysis or transplantation 2. Furthermore, patients with CKD are at signifcantly increased risk of death from cardiovascular disease (CVD)3,4.
    [Show full text]
  • Genetic, Cytogenetic and Physical Refinement of the Autosomal Recessive CMT Linked to 5Q31ð Q33: Exclusion of Candidate Genes I
    European Journal of Human Genetics (1999) 7, 849–859 © 1999 Stockton Press All rights reserved 1018–4813/99 $15.00 t http://www.stockton-press.co.uk/ejhg ARTICLE Genetic, cytogenetic and physical refinement of the autosomal recessive CMT linked to 5q31–q33: exclusion of candidate genes including EGR1 Ang`ele Guilbot1, Nicole Ravis´e1, Ahmed Bouhouche6, Philippe Coullin4, Nazha Birouk6, Thierry Maisonobe3, Thierry Kuntzer7, Christophe Vial8, Djamel Grid5, Alexis Brice1,2 and Eric LeGuern1,2 1INSERM U289, 2F´ed´eration de Neurologie and 3Laboratoire de Neuropathologie R Escourolle, Hˆopital de la Salpˆetri`ere, Paris 4Laboratoire de cytog´en´etique, Villejuif 5G´en´ethon, Evry, France 6Service de Neurologie, Hˆopital des Sp´ecialit´es, Rabat, Morocco 7Service de Neurologie, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland 8Service D’EMG et de pathologie neuromusculaire, Hˆopital neurologique Pierre Wertheimer, Lyon, France Charcot-Marie-Tooth disease is an heterogeneous group of inherited peripheral motor and sensory neuropathies with several modes of inheritance: autosomal dominant, X-linked and autosomal recessive. By homozygosity mapping, we have identified, in the 5q23–q33 region, a third locus responsible for an autosomal recessive form of demyelinating CMT. Haplotype reconstruction and determination of the minimal region of homozygosity restricted the candidate region to a 4 cM interval. A physical map of the candidate region was established by screening YACs for microsatellites used for genetic analysis. Combined genetic, cytogenetic and physical mapping restricted the locus to a less than 2 Mb interval on chromosome 5q32. Seventeen consanguineous families with demyelinating ARCMT of various origins were screened for linkage to 5q31–q33.
    [Show full text]