Sequence Diversity of Pan Troglodytes Subspecies and the Impact of WFDC6 Selective Constraints in Reproductive Immunity
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing. -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
(P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds. -
Microarray Analysis of Novel Genes Involved in HSV- 2 Infection
Microarray analysis of novel genes involved in HSV- 2 infection Hao Zhang Nanjing University of Chinese Medicine Tao Liu ( [email protected] ) Nanjing University of Chinese Medicine https://orcid.org/0000-0002-7654-2995 Research Article Keywords: HSV-2 infection,Microarray analysis,Histospecic gene expression Posted Date: May 12th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-517057/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Background: Herpes simplex virus type 2 infects the body and becomes an incurable and recurring disease. The pathogenesis of HSV-2 infection is not completely clear. Methods: We analyze the GSE18527 dataset in the GEO database in this paper to obtain distinctively displayed genes(DDGs)in the total sequential RNA of the biopsies of normal and lesioned skin groups, healed skin and lesioned skin groups of genital herpes patients, respectively.The related data of 3 cases of normal skin group, 4 cases of lesioned group and 6 cases of healed group were analyzed.The histospecic gene analysis , functional enrichment and protein interaction network analysis of the differential genes were also performed, and the critical components were selected. Results: 40 up-regulated genes and 43 down-regulated genes were isolated by differential performance assay. Histospecic gene analysis of DDGs suggested that the most abundant system for gene expression was the skin, immune system and the nervous system.Through the construction of core gene combinations, protein interaction network analysis and selection of histospecic distribution genes, 17 associated genes were selected CXCL10,MX1,ISG15,IFIT1,IFIT3,IFIT2,OASL,ISG20,RSAD2,GBP1,IFI44L,DDX58,USP18,CXCL11,GBP5,GBP4 and CXCL9.The above genes are mainly located in the skin, immune system, nervous system and reproductive system. -
Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation. -
Topological Network Analysis of Differentially Expressed Genes In
CANCER GENOMICS & PROTEOMICS 12 : 153-166 (2015) Topological Network Analysis of Differentially Expressed Genes in Cancer Cells with Acquired Gefitinib Resistance YOUNG SEOK LEE 1, SUN GOO HWANG 2, JIN KI KIM 1, TAE HWAN PARK 3, YOUNG RAE KIM 1, HO SUNG MYEONG 1, KANG KWON 4, CHEOL SEONG JANG 2, YUN HEE NOH 1 and SUNG YOUNG KIM 1 1Department of Biochemistry, School of Medicine, Konkuk University, Seoul, Republic of Korea; 2Plant Genomics Laboratory, Department of Applied Plant Science, Kangwon National University, Chuncheon, Republic of Korea; 3Department of Plastic and Reconstructive Surgery, College of Medicine, Yonsei University, Seoul, Republic of Korea; 4School of Korean Medicine, Pusan National University, Yangsan, Republic of Korea Abstract. Background/Aim: Despite great effort to elucidate into the complex mechanism of AGR and to novel gene the process of acquired gefitinib resistance (AGR) in order to expression signatures useful for further clinical studies. develop successful chemotherapy, the precise mechanisms and genetic factors of such resistance have yet to be elucidated. Although chemotherapy is the most common treatment for Materials and Methods: We performed a cross-platform meta- various cancer types, the development of acquired resistance analysis of three publically available microarray datasets to anticancer drugs remains a serious problem, leading to a related to cancer with AGR. For the top 100 differentially majority of patients who initially responded to anticancer expressed genes (DEGs), we clustered functional modules of drugs suffering the recurrence or metastasis of their cancer (1- hub genes in a gene co-expression network and a protein- 3). Acquired drug resistance (ADR) is known to have a multi- protein interaction network. -
Distribution of Eppin in Mouse and Human Testis
MOLECULAR MEDICINE REPORTS 4: 71-75, 2011 Distribution of Eppin in mouse and human testis YAN LONG, AIHuA Gu, HuA YANG, GuIxIANG JI, xIuMEI HAN, LING SONG, SHOuLIN WANG and xINRu WANG Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical university, Nanjing 210029, P.R. China Received August 31, 2010; Accepted November 29, 2010 DOI: 10.3892/mmr.2010.403 Abstract. The human Eppin (hEppin) (SPINLW1; Epididymal Previous studies have shown that a number of the key protease inhibitor) gene was first described and sequenced in processes regulating the activity and fate of many proteins 2001, and later identified as an immunocontraceptive target involved in epididymis are strictly dependent on proteolytic for males in 2004. The expression and function of the mouse events. Therefore, proteases and protease inhibitors, which eppin (mEppin) gene was first described in 2003, and recent are implicated in tight junction/adherent junction (TJ/AJ) studies have shown that mEppin protein has a similar male assembly (3), are important regulators of Sertoli cell TJ contraceptive effect in mice. In this study, we designed a dynamics (4). probe to detect mEppin mRNA in frozen sections from the Human eppin (hEppin) is a member of a highly conserved testes of 60-day-old mice as well as in the GC-1, GC-2 and family of protease inhibitors that are expressed in the testis MLTC-1 cell lines, using a hyperbiotinylated oligonucleotide and epididymis, and was first identified and sequenced as a DNA probe. In addition to Sertoli cells, the expression of novel serine protease inhibitor in 2001. -
Androgen Signaling in Sertoli Cells Lavinia Vija
Androgen Signaling in Sertoli Cells Lavinia Vija To cite this version: Lavinia Vija. Androgen Signaling in Sertoli Cells. Human health and pathology. Université Paris Sud - Paris XI, 2014. English. NNT : 2014PA11T031. tel-01079444 HAL Id: tel-01079444 https://tel.archives-ouvertes.fr/tel-01079444 Submitted on 2 Nov 2014 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE PARIS-SUD ÉCOLE DOCTORALE : Signalisation et Réseaux Intégratifs en Biologie Laboratoire Récepteurs Stéroïdiens, Physiopathologie Endocrinienne et Métabolique Reproduction et Développement THÈSE DE DOCTORAT Soutenue le 09/07/2014 par Lavinia Magdalena VIJA SIGNALISATION ANDROGÉNIQUE DANS LES CELLULES DE SERTOLI Directeur de thèse : Jacques YOUNG Professeur (Université Paris Sud) Composition du jury : Président du jury : Michael SCHUMACHER DR1 (Université Paris Sud) Rapporteurs : Serge LUMBROSO Professeur (Université Montpellier I) Mohamed BENAHMED DR1 (INSERM U1065, Université Nice)) Examinateurs : Nathalie CHABBERT-BUFFET Professeur (Université Pierre et Marie Curie) Gabriel -
Characterisation of Eppin Function: Expression and Activity in the Lung
ORIGINAL ARTICLE LUNG BIOLOGY Characterisation of eppin function: expression and activity in the lung Aaron Scott1,7, Arlene Glasgow1,7, Donna Small1, Simon Carlile1, Maelíosa McCrudden2, Denise McLean2, Ryan Brown1, Declan Doherty1, Fionnuala T. Lundy2, Umar I. Hamid2, Cecilia M. O’Kane2, Daniel F. McAuley2, Malcolm Brodlie3, Michael Tunney4, J. Stuart Elborn2, Chris R. Irwin5, David J. Timson 6, Clifford C. Taggart1 and Sinéad Weldon1 Affiliations: 1Airway Innate Immunity Research Group, Centre for Experimental Medicine, Wellcome-Wolfson Institute for Experimental Medicine, Queen’s University Belfast, Belfast, UK. 2Centre for Experimental Medicine, Wellcome-Wolfson Institute for Experimental Medicine, Queen’s University Belfast, Belfast, UK. 3Paediatric Respiratory Unit, Great North Children’s Hospital and Institute of Cellular Medicine, Newcastle University, Newcastle upon Tyne, UK. 4Halo, School of Pharmacy, Queen’s University Belfast, Belfast, UK. 5Centre for Dentistry, Queen’s University Belfast, Belfast, UK. 6School of Pharmacy and Biomolecular Sciences, University of Brighton, Brighton, UK. 7Joint first authors. Correspondence: Cliff Taggart, Airway Innate Immunity Research Group, Centre for Infection and Immunity, Wellcome-Wolfson Institute for Experimental Medicine, Queen’s University Belfast, Belfast, BT9 7BL, UK. E-mail: [email protected] @ERSpublications Eppin is a low-molecular-weight protein which is expressed in the human lung during inflammation http://ow.ly/WZuQ30aELEI Cite this article as: Scott A, Glasgow A, Small D, et al. Characterisation of eppin function: expression and activity in the lung. Eur Respir J 2017; 50: 1601937 [https://doi.org/10.1183/13993003.01937-2016]. ABSTRACT Eppin is a serine protease inhibitor expressed in male reproductive tissues. The aim of this study was to investigate the localisation and regulation of eppin expression in myeloid and epithelial cell lines, and explore its potential role as a multifunctional host defence protein. -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M. -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Downloaded from Here
bioRxiv preprint doi: https://doi.org/10.1101/017566; this version posted November 19, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Testing for ancient selection using cross-population allele 2 frequency differentiation 1;∗ 3 Fernando Racimo 4 1 Department of Integrative Biology, University of California, Berkeley, CA, USA 5 ∗ E-mail: [email protected] 6 1 Abstract 7 A powerful way to detect selection in a population is by modeling local allele frequency changes in a 8 particular region of the genome under scenarios of selection and neutrality, and finding which model is 9 most compatible with the data. Chen et al. [2010] developed a composite likelihood method called XP- 10 CLR that uses an outgroup population to detect departures from neutrality which could be compatible 11 with hard or soft sweeps, at linked sites near a beneficial allele. However, this method is most sensitive 12 to recent selection and may miss selective events that happened a long time ago. To overcome this, 13 we developed an extension of XP-CLR that jointly models the behavior of a selected allele in a three- 14 population tree. Our method - called 3P-CLR - outperforms XP-CLR when testing for selection that 15 occurred before two populations split from each other, and can distinguish between those events and 16 events that occurred specifically in each of the populations after the split.