Acta Odontologica Scandinavica
ISSN: 0001-6357 (Print) 1502-3850 (Online) Journal homepage: http://www.tandfonline.com/loi/iode20
Restorative treatment strategies for patients with cleidocranial dysplasia
Huaiguang Chang, Jiahui Wei, Ying Wang, Jing Jia, Xuemei Gao, Xiaotong Li & Hailan Feng
To cite this article: Huaiguang Chang, Jiahui Wei, Ying Wang, Jing Jia, Xuemei Gao, Xiaotong Li & Hailan Feng (2015) Restorative treatment strategies for patients with cleidocranial dysplasia, Acta Odontologica Scandinavica, 73:6, 447-453
To link to this article: http://dx.doi.org/10.3109/00016357.2014.983541
Published online: 13 Feb 2015.
Submit your article to this journal
Article views: 83
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=iode20
Download by: [Peking University] Date: 13 November 2015, At: 00:22 Acta Odontologica Scandinavica. 2015; 73: 447–453
ORIGINAL ARTICLE
Restorative treatment strategies for patients with cleidocranial dysplasia
HUAIGUANG CHANG1, JIAHUI WEI1, YING WANG1, JING JIA1, XUEMEI GAO2, XIAOTONG LI2 & HAILAN FENG1
1Department of Prosthodontics, and 2Department of Orthodontics, Peking University School and Hospital of Stomatology, Beijing, China
Abstract Objective. To develop a suitable treatment strategy for patients with cleidocranial dysplasia (CCD) who miss the optimal early treatment stage. Materials and methods. This study enrolled 15 patients with CCD who had all missed the optimal treatment stage and were diagnosed with CCD through clinical examinations and genetic tests. Based on the chief complaints and requirements of the patients, three different therapeutic schedules were devised for these patients. Schedules I (periodontal and endodontic treatments) and II (periodontal, endodontic and prosthodontic treatments) were used for patients with low requirements, whereas Schedule III (multidisciplinary strategy, including periodontal, endodontic, surgical, orthodontic and prosthodontic treatments) was used for patients with high requirements. Results. Schedules I, II and III were used in five, seven and three patients, respectively. Schedule III treatments produced the best outcomes in terms of occlusion and esthetics. Conclusions. Schedule III based on a comprehensive multidisciplinary therapy is an ideal restorative therapeutic strategy and can achieve good outcomes for patients with CCD who missed the optimal treatment stage.
Key Words: cleidocranial dysplasia, multidisciplinary treatment, RUNX2, supernumerary teeth
Introduction CCD are clavicular dysplasia, delayed closure or non-closure of the fontanels and supernumerary teeth Cleidocranial dysplasia (CCD; OMIM# 119600) is a [3]. Among dental defects, supernumerary teeth, rare congenital disorder, which usually has an auto- retained deciduous teeth and delayed eruption of somal dominant mode of inheritance. The main permanent teeth are the three most common clinical causes of CCD are heterozygous mutations (e.g. findings of CCD [4]. Patients with these defects often gene insertions and deletions) in the RUNT-related present with masticatory hypofunction and poor transcription factor 2 (Cbfa1) gene, which is located esthetics caused by dentition defects or malocclusion. on chromosome 6p21 [1]. The clinical manifestations Generally, the management of CCD mainly Downloaded by [Peking University] at 00:22 13 November 2015 of CCD are mainly related to the bones and teeth. involves expectant treatment after symptoms appear. The bone-related manifestations of CCD include The more severe symptoms require repair surgery, clavicular aplasia, pseudarthrosis formation, drooping such as skull repair surgery, clavicle repair surgery and shoulders, hypermobility of the shoulders, delayed orthognathic surgery, but this article only focused on closure or non-closure of the fontanels, broadening the treatment of dental imperfections found in CCD, of the cranial sutures, distention of the cranial vault, which present with a very high incidence (93.5% of bell-shaped chest, distal phalanx dysplasia (resulting patients with CCD) [5]. According to the report by in brachydactyly), broadening of the pubic symphysis Jensen and Kreiborg [6], the optimal treatment period (causing pelvic dysplasia) and moderately short stat- for CCD patients is between 5–7 years of age, because ure. The main tooth-related findings are deformity, it should be possible to diagnose supernumerary dysplasia, delayed eruption of permanent teeth, incisors at this time point and supernumerary canines supernumerary teeth and impacted teeth [2]. Overall, and premolars a few years later; therefore, early inter- the three most common clinical manifestations of vention could be undertaken. If this treatment stage is
Correspondence: Hailan Feng, Department of Prosthodontics, Peking University School and Hospital of Stomatology, 22# Zhongguancun South Avenue, Beijing 100081, PR China. E-mail: [email protected]
(Received 17 February 2014; accepted 26 October 2014) ISSN 0001-6357 print/ISSN 1502-3850 online 2015 Informa Healthcare DOI: 10.3109/00016357.2014.983541 448 H. Chang et al.
missed, the gradual formation of tooth roots along auxillary genetic testing [11]. This study was approved with delayed absorption of the roots of deciduous by the ethics committee of Peking University. teeth will eventually cause delayed eruption or impac- tion of permanent teeth, thus increasing both the Physical and radiographic examinations difficulty in treatment and the patient’s suffering. In our study, we have referred to treatment during the CCD was diagnosed on the basis of typical clinical optimal treatment period as ‘timely treatment’ and manifestations in combination with X-ray findings later treatment as ‘restorative treatment’. Several mul- [11]. Oral examination was conducted to record char- tidisciplinary treatment strategies have been proposed acteristics such as tooth eruption and retention, enamel [7] for timely treatment, such as the Toronto–Mel- development state and periodontal and occlusal con- bourne approach, the Belfast–Hamburg approach, the ditions. Photographs of the intra-oral view, both shoul- Jersusalem approach and the Bronx approach [8-10]. derjoints,headandfacewereobtainedinallpatients.In However, most CCD patients seek clinical treatment addition, the following X-ray films were acquired to only after the optimal treatment period; yet no suit- assess bone development: dental panoramic radio- able treatment strategy has been devised for these graph, lateral view of the head, chest radiograph, patients, and only individual case reports are available extremities radiograph and pelvic radiograph. [2,5]. A comprehensive therapeutic strategy that restores RUNX2 gene detection masticatory function and esthetics in CCD patients who present after the optimal treatment period must After the patients provided informed consent, they be formulated through the long-term observation of were tested for the RUNX2 gene [12]. Aliquots of CCD patients. In this study, we assessed 15 CCD peripheral blood (2 ml) were collected in anticoagu- patients who were presented after the optimal treat- lant (EDTA) tubes and used to extract genomic ment period and were treated between 2005–2013. DNA; 1 ml of the extract was subjected to 1.0% Here, we summarize and analyze their treatment out- agarose gel electrophoresis. Eight pairs of primers comes and attempt to use this data to devise a suitable (Table I) were used for the polymerase chain reaction clinical treatment strategy for patients undergoing (PCR) amplification of eight exons in the RUNX2 restorative treatment. gene. The PCR products were detected and separated on agarose gel electrophoresis, and the target band was recycled for sequencing. Materials and methods
Patient selection Treatment strategies
In this study, we retrospectively reviewed the medical Three different treatment strategies based on the chief data of 15 patients with CCD who underwent restor- complaints and requirements of the patients were ative treatment at our hospital between 2005–2013. used for dental therapy (Table II). Schedule I or II They included six patients from two families and was applied in patients who had fewer dentition nine patients with sporadic cases of CCD. All study imperfections and/or low requirements and only patients were Han nationality. All patients presented needed periodontal or endodontic treatment, along with different degrees of deciduous tooth retention and with prosthodontic treatment when necessary. Downloaded by [Peking University] at 00:22 13 November 2015 permanent tooth impaction, along with ocular hyper- Patients with greater requirements were treated using telorism, skull and clavicular aplasia and other symp- a multidisciplinary treatment strategy (Schedule III) toms. All patients were clinically diagnosed with CCD that included periodontal, endodontic, surgical, according to typical clinical manifestations and orthodontic and prosthodontic treatments.
Table I. Sequences of the primers used for the eight exons of the RUNX2 gene. Exon Forward primer sequence (3 C!5 C) Reverse primer sequence (3 C!5 C) Annealing temperature ( C)
0 ATGGTTAATCTCCGCAGGTCA GCTATTTGGAAAAGCTAGCAG 58 1 CCAAAGACTCCGGCAAAGAT AAGGCAGGAGGAGGTCTTGGAG 56.5 2 TGGCATCACAACCCATACAC GTCTACATTTCATCAAAGGAGC 59 3 AATTTAGAAGAAGGAGTCCTG AAATATATGCAGATAGCAAAG 59 4 ATTCCTTGGCTTAAACTCCCAG GCCAGCTTCACAGCTCCAGG 56 5 AACGCTTTGTGCTATTTAAGGCC CCAGTTGTCATTCCCTTGCCC 61 6 CTCTGGGAAATACTAATGAGGGA AGTGCCATGATGTGCATTTGTAAT 61 7 GGCTTGCTGTTCCTTTATGG GGCTGCAAGATCATGACTGA 60 Restorative treatment strategies for CCD 449
Table II. Chief complaints and requirements of CCD patients and the corresponding therapeutic schedules. Chief complaints and requirements of patients Therapeutic schedules
Schedule I Only endodontic or periodontal symptoms, Periodontal and endodontic treatments few requirements Schedule II Failed eruption of permanent teeth, Periodontal, endodontic and prosthodontic treatments dentition defect Schedule III Many esthetic requirements, desire for Comprehensive treatment, including periodontal, endodontic, greater utilization of permanent teeth surgical, orthodontic and prosthodontic treatments
Results Genetic diagnosis
Clinical diagnosis Mutations were detected in the eight exons of the RUNX2 gene in 13 patients; no RUNX2 mutations Clinical and radiographic examinations revealed the were found in patients 07 and 08. Seven mutations typical clinical manifestations of CCD [11], such as were present in the RUNT domain, which was more incomplete closure of the fontanels, clavicular aplasia, than the number of mutations found in the Q/A deciduous tooth retention, supernumerary teeth, domain and PST domain. Thus, 13 patients were impacted teeth and distal phalanx dysplasia (Figure 1). genetically diagnosed with CCD. The most common clinical manifestations included improper development of the clavicles and fontanels, with or without supernumerary teeth (Table III). Therapeutic strategies and outcomes There were seven female and eight male patients. Three treatment strategies based on the chief com- Twelve patients were adults at the time of presenta- plaints and requirements of the patients were used. tion. The other three, patients 01, 04 and 09, were Schedule I was used for five patients, Schedule II for minors, but had missed the optimal treatment stage. seven patients and Schedule III for three patients. In As mentioned earlier, six patients (01–04, 10 and 11) all 15 patients, the therapeutic outcomes were were from two families, while the other nine patients assessed on the basis of three aspects: periodontal had sporadic cases of CCD. Fourteen patients had status, occlusion and esthetics (Table IV). The clin- delayed closure of the fontanelles and one patient did ical manifestations and therapeutic strategy in patient not have delayed closure of the fontanelle. All 15, who received Schedule III (multidisciplinary) 15 patients had clavicular aplasia. Twelve patients treatment, is briefly described below. had supernumerary teeth, including two patients with a history of tooth extraction, while three patients . Patient 15: This patient presented with poor oral had no supernumerary teeth. Most patients were not hygiene, three impacted teeth (23, 33 and 34), four tall (<165 cm), with the exception of one male patient supernumerary teeth located (a) on the labial side who measured 171 cm. of 11 and the root of 12, (b) near the middle of the palatal side of 24 and on the palatal side (c)
Downloaded by [Peking University] at 00:22 13 November 2015 between 25 and 26 and (d) between the roots of 33 and 34, skewing of the center-line of the max- AB C D illary teeth 2 mm to the left with a normal center- line of the mandibular teeth, ocular hypertelorism, bridge collapse, flat cranial vault, hypoplastic mid- face, other usual features of the CCD facies, tall and narrow palate vaults, short stature and other EFG symptoms (Figure 2). This patient underwent periodontal, endodontic, surgical, orthodontic and prosthodontic treatments in five departments from 1996–2013 (17 years). The main treatment procedures are shown in Table V. Figure 1. Typical clinical manifestations of CCD: (A) Radiograph showing non-closure of the fontanels, with clearly visible sutural bones. (B) Chest radiograph showing consecutive interruptions in Discussion the distal right clavicle, left clavicular aplasia. (C) Hypermobility of both shoulders due to clavicular aplasia. (D) Photograph showing As Schedule I did not include surgical and orthodon- deciduous and supernumerary teeth. (E) Dental panoramic radiograph showing deciduous, supernumerary and impacted teeth. tic treatments, the following problems were not (F and G) Distal phalanx dysplasia. resolved in patients treated with this strategy: irregular 450 H. Chang et al.
Table III. Clinical manifestations of the 15 patients with CCD.
Delayed fontanel Clavicular Supernumerary No. Sex Age (years) Type of CCD closure aplasia teeth Height (cm)
01# Female 16 Familial Y Y 9 150 02# Female 39 Familial N Y 1* 148 03# Female 34 Familial Y Y 4 146 04# Male 09 Familial Y Y 0 122 05# Female 42 Sporadic Y Y 4 160 06# Female 28 Sporadic Y Y 4 152 07# Female 28 Sporadic Y Y 0 155 08# Female 19 Sporadic Y Y 0 146 09# Male 15 Sporadic Y Y 6 171 10# Male 24 Familial Y Y 2* 158 11# Male 24 Familial Y Y 3 160 12# Male 26 Sporadic Y Y 2 162 13# Male 41 Sporadic Y Y 9 165 14# Male 29 Sporadic Y Y 2 160 15# Male 46 Sporadic Y Y 2 164
Y, present; N, not present. *, history of tooth extraction.
dentition, crowded dentition, and double dentition Since most CCD patients present after the optimal caused by supernumerary teeth. These problems treatment stage, exploring strategies for delayed treat- resulted in repeated occurrences of gingivitis, peri- ment is of practical importance. In a review of the odontitis, and dental caries. In addition, without literature on CCD treatment, we found that almost denture and prosthodontic treatment, occlusion every author had proposed a treatment strategy that and esthetics did not improve. In contrast, in patients was based solely on the professional field of the author who were treated using Schedule II, which included [2,5,15]. As orthodontic treatment is increasingly prosthodontic treatment, the occlusion and esthetics becoming a key aspect of CCD treatment, almost improved slightly, but malocclusion probably led to all recent strategies described in the literature com- repeated episodes of periodontal disease and dental prise multidisciplinary treatments, regardless of the caries, especially when associated with poor oral professional field of the authors [15]. We, therefore, hygiene [13,14]. Schedule III was an oral multidis- formulated a strategy for the restorative treatment of ciplinary therapeutic strategy incorporating periodon- CCD on the basis of previous treatment schemes tal and endodontic treatment as its foundation. [8-10] and our clinical experience (Table VI).
Downloaded by [Peking University] at 00:22 13 November 2015 Furthermore, surgical and orthodontic treatments The key point in the application of our treatment were used to improve malocclusion and, therefore, strategy is determining which patients required treat- improve masticatory function and esthetics. In addi- ment. Although it is not difficult to select the appro- tion, prosthodontic treatment or implant therapy was priate treatment strategy in patients who are very undertaken for functional and esthetic improvements. young or very old, a judgment standard is necessary Therefore, Schedule III or similar interdisciplinary for patients in between these two groups. In general, treatments should be adopted whenever possible. the restorative treatment strategy should be adopted
Table IV. Evaluation of the effectiveness of the three therapeutic schedules. Quantity Therapeutic outcomes of patients
Schedule I 5 Repeated recurrences of periodontitis and dental caries; malocclusion, only slight increase in masticatory efficiency; no esthetic improvement Schedule II 7 Repeated recurrences of periodontitis and dental caries; improvement of occlusal relationships; slight esthetic improvement Schedule III 3 Reduced recurrence of periodontitis and dental caries; good occlusal relationships; improved masticatory efficiency; improved esthetics Restorative treatment strategies for CCD 451
AB C steps listed in Table VI. In the first step, it is essential that the diagnosis be made by a multidisciplinary team from the relevant departments after a comprehensive assessment of the deciduous, permanent and super- numerary teeth. Not all deciduous or supernumerary teeth need to be removed. Well-developed supernu- merary and even deciduous teeth that are present at DE ideal locations and will not affect subsequent treat- ment can be retained. However, some permanent teeth which are dysplastic or ectopic need be removed, as they may cause difficulty in subsequent treatment. On the basis of this comprehensive eval- uation, a multidisciplinary treatment plan should be formulated. The third step requires co-operation between surgeons and orthodontic specialists and Figure 2. Patient 15 had CCD with four supernumerary teeth involves tooth extraction followed by orthodontics (three in the maxilla in the area of the premolars and one in the mandible in the area of the premolars) and three impacted teeth or alternates between tooth extraction and orthodon- (one in the maxilla in the area of the premolars and two in the tics, depending on the treatment plan devised in the mandible in the area of the premolars): (A) Photograph of the first step. A decision tree is shown in Figure 3. Early patient showing ocular hypertelorism. (B) Photograph of erupted diagnosis and treatment should be advocated for supernumerary teeth in the maxilla. (C) Photograph of the man- CCD patients. Supernumerary teeth should be dible. (D) Skull radiograph showing deformity of the skull, hypo- plastic midface and supernumerary teeth. (E) Dental panoramic removed before the root develops completely, so as radiograph, confirming the diagnosis. to facilitate the eruption of permanent teeth in the correct positions. Failure to do so will result in long- in patients who are older than 7 years. However, the term dental health issues for the patients. Unfortu- exact cut-off should be based on the dental develop- nately, there exist some difficulties in the early diag- ment of the patient. When the length of the roots of nosis of CCD. First, the majority of patients have only the normal permanent teeth has reached about one- mild systemic symptoms and, by the time they present third of its final length, the overlying supernumerary with dental or esthetic problems, they tend to have teeth should be removed, together with overlying missed the optimal treatment stage. In fact, many bone and primary teeth. In regions where no super- patients present for the first time after they have numerary teeth are formed, tooth eruption may be had their pubertal ‘growth spurt’. This is because improved by removal of the primary teeth and surgical easily identifiable symptoms appear only during ado- exposure of the underlying permanent teeth [6]. lescence [16-19]. Second, about a third of patients During treatment, attention must be paid to the have sporadic CCD, i.e. their parents do not have first step and the third step, according to the treatment CCD and the clinical manifestations in these patients
Table V. Therapeutic procedures in patient 15.
Time (year) Multidisciplinary therapy, including periodontal, endodontic, surgical, orthodontic and prosthodontic treatments Downloaded by [Peking University] at 00:22 13 November 2015 1996 Supragingival scaling; filling after root canal therapy at 15 1998 Subgingival scaling; 24, 25 filling 2003 Subgingival scaling; 12, 14 filling, 24, 25 root canal therapy; removal of 14, 15 as well as the supernumerary teeth at the labial side of 12 and lingual side of 24, 25 2004 Subgingival scaling; 31, 16, 17, 33, 42 root canal therapy; removal of 28; removable partial denture in maxilla 2005 Supragingival scaling; gingival excision and boning at 33; orthodontic traction of 33 2006 46, 36–38, 46, 47; 25–27, 15–17 scaling and root planing; 16 filling; 24, 25, 15 cutting crown; orthodontic traction of 34; over-denture in maxilla 2007 Supragingival scaling; maintenance of mandibular teeth 2008 Supragingival scaling; maintenance of maxillary teeth; over-denture in maxilla 2009 Supragingival scaling; 22, 12, 13, 38 filling; 11 laminate veneer 2010 Supragingival scaling; 12–17 scaling and root planning 2011 Supragingival scaling; 36, 38 filling; 37 root canal therapy 2012 Supragingival scaling; 26, 36, 37, 46, 47, 16 scaling and root planing 2013 Supragingival scaling; 37, 38 filling 452 H. Chang et al.
Table VI. Restorative treatment strategies for patients with CCD. Step 1 Comprehensive assessment of all teeth; formulation of a treatment plan in consultation with other relevant departments Step 2 Periodontal and endodontic treatment; oral health education Step 3 Tooth extraction, orthodontic treatment according to the treatment plan Step 4 Prosthodontic treatment or implantation therapy for further functional and esthetic improvement
Dental caries Endodontic treatments
Multidisciplinary diagnostic Periodontitis Periodontal according to: To keep treatments 1. Integrity of teeth 2. Positive of teeth Malocclusion Orthodontic 3. Development stage of root treatments All teeth 4. Impact on the follow-up treatment of patients Impacted teeth
To remove Surgical Prosthodontic treatments treatments
Figure 3. The decision tree. Interdisciplinary doctors comprehensively evaluated all of the teeth of patients with CCD. The integrity and position of teeth, developmental stage of the root and impact on the follow-up treatment were taken in account as reference points to decide which teeth were kept and which were removed. A treatment plan was finally formulated. If teeth that were kept had dental caries, periodontitis or malocclusion, then they underwent endodontic treatments, periodontal treatments or orthodontic treatments, respectively. If teeth that were kept were impacted, a full thickness mucoperiosteal buccal flap was raised, and the crowns of impacted teeth were exposed after the removal of bone covering the unerupted teeth. Orthodontic traction was then initiated with a light orthodontic force. After endodontic treatments and/or periodontal treatments, if necessary, orthodontic treatments and/or prosthodontic treatments were offered. On the other hand, if teeth had been removed according to the plan, orthodontic treatments and/or prosthodontic treatments could be used as follow-up treatments. Solid lines represent necessary treatment processes, while dotted lines represent the non-necessary treatment processes.
may be very mild and difficult to identify [11,12]. intra-oral inspection, panoramic radiographs and a Third, the clinical findings of CCD are diverse and thorough family history should be taken to avoid need to be differentiated from those of other diseases, misdiagnosis [21]. In addition, in CCD patients making diagnosis based solely on clinical manifesta- with typical manifestations, the first impression of tions very difficult. Fourth, not every CCD patient CCD can be obtained by observing the characteristic presents with all the symptoms of CCD and some facies. All of these can facilitate early diagnosis and patients have atypical symptoms, which makes the help establish a good foundation for subsequent early Downloaded by [Peking University] at 00:22 13 November 2015 clinical diagnosis of CCD relatively difficult. Finally, intervention. although molecular biological detection of RUNX2 The treatment of the 15 patients in this study was mutations is accurate, only 70% patients were found prolonged (lasting for even 17 years in patient 15) and to have point mutations, 13% had large/contiguous required co-operation between doctors from five deletions, and the other 17% of patients had unknown departments, which fully illustrates the severe burden mutations [20]. Thus, although the clinical character- of restorative treatment. Therefore, early diagnosis istics of CCD are present since birth, the final diag- and timely treatment are crucial in CCD. In addition, nosis occurs much later, as in the case of the clinicians should improve the strategies for restorative 15 patients in this study. treatment in order to improve the therapeutic out- As increasing numbers of cases of CCD are comes and reduce the burden borne by the patients. reported, early diagnosis is becoming possible in Besides a multidisciplinary therapeutic approach, patients with the typical clinical manifestations of these patients also require a variety of diagnostic CCD. If clavicular aplasia, non-closure of the fonta- and treatment techniques such as cone-beam com- nels and supernumerary embedded teeth are found, puted tomography [22], autogenous tooth transplan- the clinical diagnosis of CCD is straightforward, but tation and implant anchorage [23]. Early gene therapy requires a full understanding of this hereditary disease to correct the mutation in the RUNX2 gene may be on the part of the clinician. If many retained decid- the best solution, but the required technology needs uous teeth and supernumerary teeth are found on to be greatly improved before it can be used clinically. Restorative treatment strategies for CCD 453
Acknowledgments [10] Berg RW, Kurtz KS, Watanabe I, Lambrakos A. Interim prosthetic phase of multidisciplinary management of cleido- We thank the patients and their families for their co- cranial dysplasia: "the Bronx Approach". J Prosthodont 2011; – operation and enthusiastic support. 20:S20 5. [11] Mundlos S. Cleidocranial dysplasia: clinical and molecular genetics. J Med Genet 1999;36:177–82. Declaration of interest: The authors report no [12] Xuan D, Li S, Zhang X, Hu F, Lin L, Wang C, et al. conflicts of interest. The authors alone are responsible Mutations in the RUNX2 gene in Chinese patients with – for the content and writing of the paper. cleidocranial dysplasia. Ann Clin Lab Sci 2008;38:15 24. [13] Helm S, Petersen PE. Causal relation between malocclusion and periodontal health. Acta Odontol Scand 1989;47:223–8. [14] Stahl F, Grabowski R. Malocclusion and caries prevalence: is References there a connection in the primary and mixed dentitions? Clin Oral Investig 2004;8:86–90. [1] McGuire TP, Gomes PP, Lam DK, Sandor GK. Cranioplasty [15] Olszewska A. Dental treatment strategies in a 40-year-old for midline metopic suture defects in adults with cleidocranial patient with cleidocranial dysplasia. J Appl Genet 2006;47: dysplasia. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 199–201. 2007;103:175–9. [16] Jarvis JL, Keats TE. Cleidocranial dysostosis. A review of [2] Farronato G, Maspero C, Farronato D, Gioventu S. Ortho- 40 new cases. Am J Roentgenol Radium Ther Nucl Med dontic treatment in a patient with cleidocranial dysostosis. 1974;121:5–16. Angle Orthodontist 2009;79:178–85. [17] Jensen BL, Kreiborg S. Development of the dentition in [3] Tokuc G, Boran P, Boran BO. Cleidocranial dysplasia in a cleidocranial dysplasia. J Oral Pathol Med 1990;19:89–93. mother and her daughter within the scope of neurosurgery. [18] Kreiborg S, Jensen BL, Bjork A, Skieller V. Abnormalities of Report of two cases. J Neurosurg 2006;104:290–2. the cranial base in cleidocranial dysostosis. Am J Orthod 1981; [4] Daskalogiannakis J, Piedade L, Lindholm TC, Sandor GK, 79:549–57. Carmichael RP. Cleidocranial dysplasia: 2 generations of [19] Jarvinen S. Cephalometric findings in three cases of cleido- management. J Can Dent Assoc 2006;72:337–42. cranial dysostosis. Am J Orthod 1981;79:184–91. [5] Suba Z, Balaton G, Gyulai-Gaal S, Balaton P, Barabas J, [20] Lee MT, Tsai AC, Chou CH, Sun FM, Huang LC, Yen P, et Tarjan I. Cleidocranial dysplasia: diagnostic criteria and com- al. Intragenic microdeletion of RUNX2 is a novel mechanism bined treatment. J Craniofac Surg 2005;16:1122–6. for cleidocranial dysplasia. Genomic Med 2008;2:45–9. [6] Jensen BL, Kreiborg S. Dental treatment strategies in cleido- [21] Quack I, Vonderstrass B, Stock M, Aylsworth AS, Becker A, cranial dysplasia. Br Dent J 1992;172:243–7. Brueton L, et al. Mutation analysis of core binding factor [7] Angle AD, Rebellato J. Dental team management for a patient A1 in patients with cleidocranial dysplasia. Am J Hum Genet with cleidocranial dysostosis. Am J Orthod Dentofacial 1999;65:1268–78. Orthop 2005;128:110–17. [22] Dalessandri D, Laffranchi L, Tonni I, Zotti F, Piancino MG, [8] Becker A, Shteyer A, Bimstein E, Lustmann J. Cleidocranial Paganelli C, et al. Advantages of cone beam computed tomog- dysplasia: Part 2–Treatment protocol for the orthodontic and raphy (CBCT) in the orthodontic treatment planning of surgical modality. Am J Orthod Dentofacial Orthop 1997;111: cleidocranial dysplasia patients: a case report. Head Face 173–83. Med 2011;7:6. [9] Becker A, Lustmann J, Shteyer A. Cleidocranial dysplasia: [23] Kuroda S, Yanagita T, Kyung HM, Takano-Yamamoto T. Part 1–General principles of the orthodontic and surgical Titanium screw anchorage for traction of many impacted teeth treatment modality. Am J Orthod Dentofacial Orthop 1997; in a patient with cleidocranial dysplasia. Am J Orthod Den- 111:28–33. tofacial Orthop 2007;131:666–9. Downloaded by [Peking University] at 00:22 13 November 2015