DOCSLIB.ORG

Blueprint Genetics Micromelic Dysplasia Panel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blueprint Genetics Micromelic Dysplasia Panel Micromelic Dysplasia Panel Test code: MA1901 Is a 27 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of acromesomelic dysplasia, cranioectodermal dysplasia, Robinow syndrome or Weill-Marchesani syndrome. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel. About Micromelic Dysplasia Acromesomelic dysplasia is an autosomal recessively inherited group of rare disorders characterized by severe dwarfism and limb abnormalities with normal facial appearance and intellect. Mutations in different genes cause three different types of acromesomelic dysplasia: Grebe, Hunter-Thomson and Maroteaux types. Robinow syndrome is characterized by limb shortening and abnormalities of the head, face and external genitalia. The clinical features are generally milder in the more common autosomal dominant form of Robinow syndrome than in the autosomal recessive form. In the presence of rib fusions, the recessive form of the syndrome should be considered. Cranioectodermal dysplasia is a rare developmental disorder characterized by congenital skeletal and ectodermal defects including dysmorphic features, nephronophthisis, hepatic fibrosis and ocular anomalies (mainly retinitis pigmentosa). Cranioectodermal dysplasia is a heterogenous disease belonging to the ciliopathies and is caused by mutations in the IFT122, IFT43, WDR19 and WDR35 genes. In most cases, the mode of inheritance is autosomal recessive. Weill-Marchesani syndrome is a rare condition characterized by short stature, brachydactyly, joint stiffness, and characteristic eye abnormalities including microspherophakia, ectopia of the lens, severe myopia, and glaucoma. Both autosomal recessive and autosomal dominant forms exist. Achondroplasia is characterized by rhizomelia, exaggerated lumbar lordosis, brachydactyly, and macrocephaly with frontal bossing and midface hypoplasia. The estimated incidence is at about 1/25,000 live births worldwide. Achondroplasia is due to mutations in the FGFR3 gene. Inheritance is autosomal dominant so genetic counseling is warranted. Achondroplasia has overlapping features with conditions such as multiple epiphyseal dysplasia tarda, achondrogenesis, osteopetrosis, and thanatophoric dysplasia. Availability 4 weeks Gene Set Description Genes in the Micromelic Dysplasia Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ADAMTS10 Weill-Marchesani syndrome AR 8 14 ADAMTSL2*,# Geleophysic dysplasia 3 AR 8 28 BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly AD/AR 12 23 C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) DVL1 Robinow syndrome AD 17 19 EXT1 Multiple cartilagenious exostoses 1 AD 97 523 FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, AD 1465 2679 Geleophysic dysplasia 3 https://blueprintgenetics.com/ FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon AD/AR 54 77 syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex AD/AR 23 53 brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia GNAS McCune-Albright syndrome, Progressive osseous heteroplasia, AD 64 274 Pseudohypoparathyroidism, Albright hereditary osteodystrophy IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin- AR 13 23 Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin- Sensenbrenner) type 2 IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating AR 38 63 thoracic dysplasia (ATD; Jeune) IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32 INPPL1 Opsismodysplasia AR 16 32 LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32 LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or AR 21 27 megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal AD/AR 32 75 chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular AD 75 183 adrenocortical disease, Carney complex ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40 SHOX* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short XL/PAR 25 431 stature SLC35D1 Schneckenbecken dysplasia AR 7 7 SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, AD 179 143 Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with AD 47 144 anonychia (Cooks syndrome) TRIP11* Achondrogenesis, type IA AR 11 17 TRPS1 Trichorhinophalangeal syndrome type 1, Trichorhinophalangeal AD 66 140 syndrome type 3 WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia AR 33 43 with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) https://blueprintgenetics.com/ WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, AR 28 31 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib- polydactyly syndrome type 5 WNT5A Robinow syndrome AD 7 11 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HGVS RefSeq RS-number HG19 BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2 FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4 FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4 FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4 FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4 FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4 FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4 FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4 FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4 FBN1 Chr15:48818478 c.863-26C>T NM_000138.4 GNAS Chr20:57478716 c.2242-11A>G NM_080425.2 IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3 IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192 PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4 PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4 PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4 https://blueprintgenetics.com/ PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4 PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801 SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685 SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3 SHOX ChrX:591198 c.-432-3C>A NM_000451.3 SHOX ChrX:591568 c.-65C>A NM_000451.3 SOX9 Chr17:70117348 c.-185G>A NM_000346.3 TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2 WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1 WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1 Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 (NM_014694:11-19), SHOX (NM_006883:6). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications
Load more

Recommended publications
  • The National Economic Burden of Rare Disease Study February 2021
    Acknowledgements This study was sponsored by the EveryLife Foundation for Rare Diseases and made possible through the collaborative efforts of the national rare disease community and key stakeholders. The EveryLife Foundation thanks all those who shared their expertise and insights to provide invaluable input to the study including: the Lewin Group, the EveryLife Community Congress membership, the Technical Advisory Group for this study, leadership from the National Center for Advancing Translational Sciences (NCATS) at the National Institutes of Health (NIH), the Undiagnosed Diseases Network (UDN), the Little Hercules Foundation, the Rare Disease Legislative Advocates (RDLA) Advisory Committee, SmithSolve, and our study funders. Most especially, we thank the members of our rare disease patient and caregiver community who participated in this effort and have helped to transform their lived experience into quantifiable data. LEWIN GROUP PROJECT STAFF Grace Yang, MPA, MA, Vice President Inna Cintina, PhD, Senior Consultant Matt Zhou, BS, Research Consultant Daniel Emont, MPH, Research Consultant Janice Lin, BS, Consultant Samuel Kallman, BA, BS, Research Consultant EVERYLIFE FOUNDATION PROJECT STAFF Annie Kennedy, BS, Chief of Policy and Advocacy Julia Jenkins, BA, Executive Director Jamie Sullivan, MPH, Director of Policy TECHNICAL ADVISORY GROUP Annie Kennedy, BS, Chief of Policy & Advocacy, EveryLife Foundation for Rare Diseases Anne Pariser, MD, Director, Office of Rare Diseases Research, National Center for Advancing Translational Sciences (NCATS), National Institutes of Health Elisabeth M. Oehrlein, PhD, MS, Senior Director, Research and Programs, National Health Council Christina Hartman, Senior Director of Advocacy, The Assistance Fund Kathleen Stratton, National Academies of Science, Engineering and Medicine (NASEM) Steve Silvestri, Director, Government Affairs, Neurocrine Biosciences Inc.
    [Show full text]
  • Increased Nuchal Translucency Precision Panel
    Increased Nuchal Translucency Precision Panel Overview Increased Nuchal Translucency (NT) is defined as an abnormal accumulation of fluid in the nuchal area, which is visualized as a thickened sonolucent area. It is a standardized measure obtained between 11 and 14 weeks of gestation to calculate the risk of a fetus being affected by a chromosomal aneuploidy. NT>3.5mm has been found to be associated with fetal chromosomal abnormalities and single-gene disorders as well as cardiac defects and other structural abnormalities in euploid and aneuploid fetuses. Proportionally as NT increases, even with a normal karyotype, there is a higher risk of adverse pregnancy outcomes such as miscarriage, intrauterine death, congenital heart defects and numerous other structural and genetic syndromes. There is not one single cause of increased NT, it is based on a complex and multifactorial process, linked to one or more embryonic processes. It has been shown that a persistently increased NT with a normal karyotype and aCGH has a 4-10% probability of being associated to Noonan Syndrome and/or other RASopathies using Whole Exome Sequencing (WES). However, the general tendency following detection of isolated enlarged NT in an euploid fetus is that most babies with normal detailed ultrasound examination and echocardiography will have uneventful outcomes. The Igenomix Increased Nuchal Translucency Precision Panel can be used to make a directed and accurate prenatal differential diagnosis of increased nuchal translucency in patients with or without a normal karyotype ultimately leading to a better management and prognosis of the associated comorbidities. It provides a comprehensive analysis of the genes involved in this disease using next-generation sequencing (NGS) to fully understand the spectrum of relevant genes involved.
    [Show full text]
  • Spinal Deformity Study Group
    Spinal Deformity Study Group Editors in Chief Radiographic Michael F. O’Brien, MD Timothy R. Kuklo, MD Kathy M. Blanke, RN Measurement Lawrence G. Lenke, MD Manual B T2 T5 T2–T12 CSVL T5–T12 +X° -X +X° C7PL T12 L2 A S1 ©2008 Medtronic Sofamor Danek USA, Inc. – 0 + Radiographic Measurement Manual Editors in Chief Michael F. O’Brien, MD Timothy R. Kuklo, MD Kathy M. Blanke, RN Lawrence G. Lenke, MD Section Editors Keith H. Bridwell, MD Kathy M. Blanke, RN Christopher L. Hamill, MD William C. Horton, MD Timothy R. Kuklo, MD Hubert B. Labelle, MD Lawrence G. Lenke, MD Michael F. O’Brien, MD David W. Polly Jr, MD B. Stephens Richards III, MD Pierre Roussouly, MD James O. Sanders, MD ©2008 Medtronic Sofamor Danek USA, Inc. Acknowledgements Radiographic Measurement Manual The radiographic measurement manual has been developed to present standardized techniques for radiographic measurement. In addition, this manual will serve as a complimentary guide for the Spinal Deformity Study Group’s radiographic measurement software. Special thanks to the following members of the Spinal Deformity Study Group in the development of this manual. Sigurd Berven, MD Hubert B. Labelle, MD Randal Betz, MD Lawrence G. Lenke, MD Fabien D. Bitan, MD Thomas G. Lowe, MD John T. Braun, MD John P. Lubicky, MD Keith H. Bridwell, MD Steven M. Mardjetko, MD Courtney W. Brown, MD Richard E. McCarthy, MD Daniel H. Chopin, MD Andrew A. Merola, MD Edgar G. Dawson, MD Michael Neuwirth, MD Christopher DeWald, MD Peter O. Newton, MD Mohammad Diab, MD Michael F.
    [Show full text]
  • A Novel Locus for Brachydactyly Type A1 on Chromosome 5P13.3-P13.2 C M Armour, M E Mccready, a Baig,Agwhunter, D E Bulman
    186 LETTERS TO JMG J Med Genet: first published as 10.1136/jmg.39.3.189 on 1 March 2002. Downloaded from A novel locus for brachydactyly type A1 on chromosome 5p13.3-p13.2 C M Armour, M E McCready, A Baig,AGWHunter, D E Bulman ............................................................................................................................. J Med Genet 2002;39:186–189 he brachydactylies are a group of inherited disorders METHODS characterised by shortened or malformed digits that are The linkage study comprised 34 members including 20 Tthought to be the result of abnormal growth of the affected subjects and was conducted after approval by the phalanges and/or metacarpals. First classified by Bell into Children’s Hospital of Eastern Ontario Ethics Review Com- types A, B, C, D, and E, they were reclassified by Temtamy and mittee. McKusick1 and Fitch.2 Brachydactyly type A1 (BDA1, MIM Peripheral blood samples were taken with informed 112500) is characterised by shortened or absent middle consent from all participating family members, and a stand- phalanges. Often the second and fifth digits, as well as the first ard protocol was used to isolate DNA. A genome wide scan proximal phalanx, are the most severely affected. In addition, was initiated using 36 primer sets from the MAPPAIRS™ all of the small tubular bones tend to be reduced in size and microsatellite markers (Research Genetics, Huntsville, Ala- the metacarpals may be shortened, particularly the fifth bama), encompassing markers from 16 chromosomes. metacarpal. Radial/ulnar clinodactyly, as well as malformed or Particular emphasis was placed on markers from chromo- 11 absent epiphyses, have also been reported.12 Complex some 5 and 17, based on the report by Fukushima et al syndromes have been described in which BDA1 is one of a describing a translocation between 5q11.2 and 17q23 in a girl number of manifestations.3 with Klippel-Feil anomaly and BDA1.
    [Show full text]
  • Lordosis, Kyphosis, and Scoliosis
    SPINAL CURVATURES: LORDOSIS, KYPHOSIS, AND SCOLIOSIS The human spine normally curves to aid in stability or balance and to assist in absorbing shock during movement. These gentle curves can be seen from the side or lateral view of the spine. When viewed from the back, the spine should run straight down the middle of the back. When there are abnormalities or changes in the natural spinal curvature, these abnormalities are named with the following conditions and include the following symptoms. LORDOSIS Some lordosis is normal in the lower portion or, lumbar section, of the human spine. A decreased or exaggerated amount of lordosis that is causing spinal instability is a condition that may affect some patients. Symptoms of Lordosis include: ● Appearance of sway back where the lower back region has a pronounced curve and looks hollow with a pronounced buttock area ● Difficulty with movement in certain directions ● Low back pain KYPHOSIS This condition is diagnosed when the patient has a rounded upper back and the spine is bent over or curved more than 50 degrees. Symptoms of Kyphosis include: ● Curved or hunched upper back ● Patient’s head that leans forward ● May have upper back pain ● Experiences upper back discomfort after movement or exercise SCOLIOSIS The most common of the three curvatures. This condition is diagnosed when the spine looks like a “s” or “c” from the back. The spine is not straight up and down but has a curve or two running side-to-side. Sagittal Balance Definition • Sagittal= front-to-back direction (sagittal plane) • Imbalance= Lack of harmony or balance Etiology ​ • Excessive lordosis (backwards lean) or kyphosis (forward lean) • Traumatic injury • Previous spinal fusion that disrupted sagittal balance Effects • Low back pain • Difficulty walking • Inability to look straight ahead when upright The most ergonomic and natural posture is to maintain neutral balance, with the head positioned over the shoulders and pelvis.
    [Show full text]
  • Marble Bone Disease: a Rare Bone Disorder
    Open Access Case Report DOI: 10.7759/cureus.339 Marble Bone Disease: A Rare Bone Disorder Eswaran Arumugam 1 , Maheswari Harinathbabu 2 , Ranjani Thillaigovindan 1 , Geetha Prabhu 1 1. Prosthodontics, Thai Moogambigai Dental College and Hospital 2. Oral Medicine and Radiology, Siva Multi Speciality Dental Clinic Corresponding author: Eswaran Arumugam, [email protected] Abstract Osteopetrosis, or marble bone disease, is a rare skeletal disorder due to a defective function of the osteoclasts. This defect renders bones more susceptible to osteomyelitis due to decreased vascularity. This disorder is inherited as autosomal dominant and autosomal recessive. Healthcare professionals should urge these patients to maintain their oral health as well as general health, as this condition makes these patients more susceptible to frequent infections and fractures. This case report emphasizes the signs and symptoms of marble bone disease and presents clinical and radiographic findings. Categories: Physical Medicine & Rehabilitation, Miscellaneous Keywords: osteopetrosis, marble bone disease, autosomal recessive, dense sclerotic bone Introduction Osteopetrosis (literally "stone bone," also known as marble bone disease or Albers-Schonberg disease) is an extremely rare inherited disorder where the bones harden and become denser. The disorder can cause osteosclerosis. The estimated prevalence of osteopetrosis is 1 in 100,000 to 500,000. It presents in two major clinical forms-a benign autosomal dominant form and a malignant autosomal recessive form. The autosomal dominant adult (benign) form is associated with few, if any, symptoms, and the autosomal recessive infantile (malignant) form is typically fatal during infancy or early childhood if untreated [1]. A rarer autosomal recessive (intermediate) form presents during childhood with some signs and symptoms of malignant osteopetrosis.
    [Show full text]
  • The Genetic Basis for Skeletal Diseases
    insight review articles The genetic basis for skeletal diseases Elazar Zelzer & Bjorn R. Olsen Harvard Medical School, Department of Cell Biology, 240 Longwood Avenue, Boston, Massachusetts 02115, USA (e-mail: [email protected]) We walk, run, work and play, paying little attention to our bones, their joints and their muscle connections, because the system works. Evolution has refined robust genetic mechanisms for skeletal development and growth that are able to direct the formation of a complex, yet wonderfully adaptable organ system. How is it done? Recent studies of rare genetic diseases have identified many of the critical transcription factors and signalling pathways specifying the normal development of bones, confirming the wisdom of William Harvey when he said: “nature is nowhere accustomed more openly to display her secret mysteries than in cases where she shows traces of her workings apart from the beaten path”. enetic studies of diseases that affect skeletal differentiation to cartilage cells (chondrocytes) or bone cells development and growth are providing (osteoblasts) within the condensations. Subsequent growth invaluable insights into the roles not only of during the organogenesis phase generates cartilage models individual genes, but also of entire (anlagen) of future bones (as in limb bones) or membranous developmental pathways. Different mutations bones (as in the cranial vault) (Fig. 1). The cartilage anlagen Gin the same gene may result in a range of abnormalities, are replaced by bone and marrow in a process called endo- and disease ‘families’ are frequently caused by mutations in chondral ossification. Finally, a process of growth and components of the same pathway.
    [Show full text]
  • Supporting Information
    Supporting Information Torkamani et al. 10.1073/pnas.0802403105 Materials and Methods kinase sequences used to generate conserved motifs, as in Kannan Kinase Identifiers. Kinase protein and DNA reference sequences et al. (3), the Gibbs motif sampling method identifies characteristic were obtained from Kinbase. These reference sequences were motifs for each individual subdomain of the kinase catalytic core, used as the basis to assign various gene identifiers (including which are then used to generate high confidence motif-based Ensembl gene IDs, HGNC gene symbols, and Entrez gene IDs) Markov chain Monte Carlo multiple alignments based upon these to every known human protein kinase. Ultimately, only eukary- motifs (4). These subdomains compromise the core structural otic protein kinases, that is, all human protein kinases except components of the protein kinase catalytic core. Intervening re- those belonging to the atypical protein kinase family, were gions between these subdomains were not aligned. considered in this study. The various gene identifiers were assigned as follows: Ensembl Mapping to Multiple Alignments and Generation of Logo Figures. A Gene ID’s were determined for each protein kinase by BLAST- nonredundant set of SNPs was generated to be mapped to the ing the reference Kinbase protein sequence against the Ensembl alignment computationally. That is, if multiple disease or com- ࿝ database (www.ensembl.org/Homo sapiens/blastview). The En- mon SNPs have been observed at a particular position within a sembl Gene ID of the top hit was assigned to the protein kinase. particular protein kinase, it is only considered once in our The Ensembl Gene ID was then used as a query in Biomart analysis.
    [Show full text]
  • Repercussions of Inborn Errors of Immunity on Growth☆ Jornal De Pediatria, Vol
    Jornal de Pediatria ISSN: 0021-7557 ISSN: 1678-4782 Sociedade Brasileira de Pediatria Goudouris, Ekaterini Simões; Segundo, Gesmar Rodrigues Silva; Poli, Cecilia Repercussions of inborn errors of immunity on growth☆ Jornal de Pediatria, vol. 95, no. 1, Suppl., 2019, pp. S49-S58 Sociedade Brasileira de Pediatria DOI: https://doi.org/10.1016/j.jped.2018.11.006 Available in: https://www.redalyc.org/articulo.oa?id=399759353007 How to cite Complete issue Scientific Information System Redalyc More information about this article Network of Scientific Journals from Latin America and the Caribbean, Spain and Journal's webpage in redalyc.org Portugal Project academic non-profit, developed under the open access initiative J Pediatr (Rio J). 2019;95(S1):S49---S58 www.jped.com.br REVIEW ARTICLE ଝ Repercussions of inborn errors of immunity on growth a,b,∗ c,d e Ekaterini Simões Goudouris , Gesmar Rodrigues Silva Segundo , Cecilia Poli a Universidade Federal do Rio de Janeiro (UFRJ), Faculdade de Medicina, Departamento de Pediatria, Rio de Janeiro, RJ, Brazil b Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Puericultura e Pediatria Martagão Gesteira (IPPMG), Curso de Especializac¸ão em Alergia e Imunologia Clínica, Rio de Janeiro, RJ, Brazil c Universidade Federal de Uberlândia (UFU), Faculdade de Medicina, Departamento de Pediatria, Uberlândia, MG, Brazil d Universidade Federal de Uberlândia (UFU), Hospital das Clínicas, Programa de Residência Médica em Alergia e Imunologia Pediátrica, Uberlândia, MG, Brazil e Universidad del Desarrollo,
    [Show full text]
  • Skeletal Dysplasias
    Skeletal Dysplasias North Carolina Ultrasound Society Keisha L.B. Reddick, MD Wilmington Maternal Fetal Medicine Development of the Skeleton • 6 weeks – vertebrae • 7 weeks – skull • 8 wk – clavicle and mandible – Hyaline cartilage • Ossification – 7-12 wk – diaphysis appears – 12-16 wk metacarpals and metatarsals – 20+ wk pubis, calus, calcaneus • Visualization of epiphyseal ossification centers Epidemiology • Overall 9.1 per 1000 • Lethal 1.1 per 10,000 – Thanatophoric 1/40,000 – Osteogenesis Imperfecta 0.18 /10,000 – Campomelic 0.1 /0,000 – Achondrogenesis 0.1 /10,000 • Non-lethal – Achondroplasia 15 in 10,000 Most Common Skeletal Dysplasia • Thantophoric dysplasia 29% • Achondroplasia 15% • Osteogenesis imperfecta 14% • Achondrogenesis 9% • Campomelic dysplasia 2% Definition/Terms • Rhizomelia – proximal segment • Mezomelia –intermediate segment • Acromelia – distal segment • Micromelia – all segments • Campomelia – bowing of long bones • Preaxial – radial/thumb or tibial side • Postaxial – ulnar/little finger or fibular Long Bone Segments Counseling • Serial ultrasound • Genetic counseling • Genetic testing – Amniocentesis • Postnatal – Delivery center – Radiographs Assessment • Which segment is affected • Assessment of distal extremities • Any curvatures, fracture or clubbing noted • Are metaphyseal changes present • Hypoplastic or absent bones • Assessment of the spinal canal • Assessment of thorax. Skeletal Dysplasia Lethal Non-lethal • Thanatophoric • Achondroplasia • OI type II • OI type I, III, IV • Achondrogenesis • Hypochondroplasia
    [Show full text]
  • Inherited Renal Tubulopathies—Challenges and Controversies
    G C A T T A C G G C A T genes Review Inherited Renal Tubulopathies—Challenges and Controversies Daniela Iancu 1,* and Emma Ashton 2 1 UCL-Centre for Nephrology, Royal Free Campus, University College London, Rowland Hill Street, London NW3 2PF, UK 2 Rare & Inherited Disease Laboratory, London North Genomic Laboratory Hub, Great Ormond Street Hospital for Children National Health Service Foundation Trust, Levels 4-6 Barclay House 37, Queen Square, London WC1N 3BH, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-2381204172; Fax: +44-020-74726476 Received: 11 February 2020; Accepted: 29 February 2020; Published: 5 March 2020 Abstract: Electrolyte homeostasis is maintained by the kidney through a complex transport function mostly performed by specialized proteins distributed along the renal tubules. Pathogenic variants in the genes encoding these proteins impair this function and have consequences on the whole organism. Establishing a genetic diagnosis in patients with renal tubular dysfunction is a challenging task given the genetic and phenotypic heterogeneity, functional characteristics of the genes involved and the number of yet unknown causes. Part of these difficulties can be overcome by gathering large patient cohorts and applying high-throughput sequencing techniques combined with experimental work to prove functional impact. This approach has led to the identification of a number of genes but also generated controversies about proper interpretation of variants. In this article, we will highlight these challenges and controversies. Keywords: inherited tubulopathies; next generation sequencing; genetic heterogeneity; variant classification. 1. Introduction Mutations in genes that encode transporter proteins in the renal tubule alter kidney capacity to maintain homeostasis and cause diseases recognized under the generic name of inherited tubulopathies.
    [Show full text]
  • The Genetic Heterogeneity of Brachydactyly Type A1: Identifying the Molecular Pathways
    The genetic heterogeneity of brachydactyly type A1: Identifying the molecular pathways Lemuel Jean Racacho Thesis submitted to the Faculty of Graduate Studies and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Biochemistry Specialization in Human and Molecular Genetics Department of Biochemistry, Microbiology and Immunology Faculty of Medicine University of Ottawa © Lemuel Jean Racacho, Ottawa, Canada, 2015 Abstract Brachydactyly type A1 (BDA1) is a rare autosomal dominant trait characterized by the shortening of the middle phalanges of digits 2-5 and of the proximal phalange of digit 1 in both hands and feet. Many of the brachymesophalangies including BDA1 have been associated with genetic perturbations along the BMP-SMAD signaling pathway. The goal of this thesis is to identify the molecular pathways that are associated with the BDA1 phenotype through the genetic assessment of BDA1-affected families. We identified four missense mutations that are clustered with other reported BDA1 mutations in the central region of the N-terminal signaling peptide of IHH. We also identified a missense mutation in GDF5 cosegregating with a semi-dominant form of BDA1. In two families we reported two novel BDA1-associated sequence variants in BMPR1B, the gene which codes for the receptor of GDF5. In 2002, we reported a BDA1 trait linked to chromosome 5p13.3 in a Canadian kindred (BDA1B; MIM %607004) but we did not discover a BDA1-causal variant in any of the protein coding genes within the 2.8 Mb critical region. To provide a higher sensitivity of detection, we performed a targeted enrichment of the BDA1B locus followed by high-throughput sequencing.
    [Show full text]