lllllllllllllllllIllllllllllllllIlllllllllIllllIllllllllllllllllllIllllllll U USOO53 10667A Umted States Patent [19] [11] Patent Number: 5,310,667 Eichholtz et a1. [45] Date of Patent: May 10, 1994
[54] GLYPHOSATE-TOLERANT 5-ENOLPYRUVYL-3-PHOSPHOSHIKIMATE OTHER PUBLICATIONS SYNTHASES Botterman et a1. (Aug. 1988) Trends in Genetics 4:219-222. [75] Inventors: David A_ Eichholtz, St Louis; Dassarma et al. (1986) Science 232:1242-1244. Charles S_ Gasser; Ganesh M_ Oxtoby et al. (1989) Euphytiza 40:173-180. Kishore, both of Chesterfield, an of Sezel, Enzyme Kineties, Behavior and Analysis of Rapid Mo_ Equilibrium and Steady State Enzyme System, John Wiley and Sons, New York, 1975, p. 15. [73] Assignee: Monsanto Company, St. Louis, Mo. Primary Examiner—Che S. Chereskiin Attorney, Agent, or Firm-Dennis R. Hoemer, Jr.; [21] Appl. No.: 380,963 RiChard H- Shear [57] ABSTRACT [22] Filed: Jul- 17’ 1989 Glyphosate-tolerant 5-enolpyruvy1-3-phosphoshikimate (EPSP) synthases, DNA encoding glyphosate-tolerant [51] Int. Cl.5 ...... C12N 15/01; C12N 15/29; EPSP synthases, plant genes encoding the glyphosate C12N 15/32 tolerant enzymes, plant transformation vectors contain [52] US. Cl...... 435/ 172.3; 435/691; ing the genes, transformed plant cells and differentiated 800/205; 935/30; 935/35; 935/64; 536/236; transformed plants containing the plant genes are dis 536/23.7 closed. The glyphosate-tolerant EPSP synthases are [58] Field of Search ...... 435/68, 172.3, 69.1; prepared by substituting an alanine residue for a glycine 935/30, 35, 64, 67; 71/86, 113, 121; 530/370, residue in a ?rst conserved sequence found between 350; 800/205; 536/236, 23.7 positions 80 and 120, and either an aspartic acid residue ‘ or asparagine residue for a glycine residue in a second [56] References Cited conserved sequence found between positions 120 and 160 in the mature wild type EPSP synthase. U.S. PATENT DOCUMENTS 4,769,061 9/1988 Comai ...... 435/1723 4 Claims, 8 Drawing Sheets
US. Patent May 10, 1994 Sheet 3 of 8 5,310,667
N001 4132
Cm 3618 Hind3 4612
BamH1 4826 PEPSPS :3
EcoR1 5266 PMON 8135 N001 5353 5353 bp Consensus RBS Xba1 6 Bgl2 23 P-Mbo 16
0ri-327
BamH1 722
Figure 2 US. Patent - May 10, 1994 Sheet 4 of s . 5,310,667
4277 Bgl2 3966 EcoR1
prePEPSPS : 2
PMON ass 9888 bp
2306 EcoH1 2303 Xba1 2292 Bgl2
Figure 3
US. Patent May 10, 1994 Sheet 6 of 8 5,310,667
M@Eamon50EamazonE5 wwzmwmo:wzozmozotin8... ___n wnwmwhm _T._:.__==_85Nu2n!22 :0:.3 __I-—-~-___- _ __TugA8;A252.a;3: _=:5“,$52 \\\\\\§7/6 __55878.5:52;F8:33:2E n‘29:25+ US. Patent I May 10, 1994 Sheet 7 of 8 5,310,667
9645 Not1 RIGHT R N039 ‘ Nco1 2066 EcoH12071
‘3-358 PMON 987 11442 hp 8339 Cla1 ACC(3)-lll
8.165 EcoRV
preAEPSPS : 215
6624 Sma1 BamH1 4816 6617 BamH1 6061 EcoRV 8'92 4940 5942 Bg|2 EcoHV 5257 5939 Xba1 BamH1 5543
Figure 6 US. Patent May 10, 1994 Sheet 8 of 8 5,310,667
EcoRV 1418 PMON 8631 6366 bp Hind3 1620 ZmADH1S'lnt1 B192 1832
Xba1 2098 4121NO11 NCO1211-5 4117 Sma1 preZmEPSPS : 215 4110 BamH1 3847 EcoR1 Blg2 2331 3510 Nco1 BamH1 2379
Figure 7 5,310,667 1 2 which will maintain a high level of glyphosate tolerance GLYPHOSATE-TOLERANT while lowering the Km values for phosphoenolpyr S-ENOLPYRUVYL-3-PHOSPHOSHIKIMATE uvate. SYNTI-IASES All peptide structures represented in the present spec i?cation and claims are shown in conventional format BACKGROUND OF THE INVENTION wherein the amino group at the N-terminus appears to Recent advances in genetic engineering have pro the left and the carboxyl group at the C-terminus at the vided the requisite tools to transform plants to contain right. Likewise, amino acid nomenclature for the natu foreign genes. It is now possible to produce plants rally occurring amino acids found in protein is as fol which have unique characteristics of agronomic impor O lows: alanine (ala;A), asparagine (Asn;N), aspartic acid tance. Certainly, one such advantageous trait is herbi (Asp;D), arginine (Arg;R), cysteine (Cys;C), glutamic cide tolerance. Herbicide-tolerant crop plants could acid (Glu;E), glutamine (Gln;Q), glycine (Gly;G), histi reduce the need for tillage to control weeds, thereby dine (I'IiS;H), isoleucine (Ile;I), leucine (Leu;L), lysine effectively reducing costs to the farmer. (lys;K), methionine (Met;M), phenylalanine (Phe;F), One herbicide which is the subject of much investiga proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryp tion in this regard is N-phosphonomethylglycine. tophan (Trp;W), tyrosine (Tyr;Y) and valine (Val;V). For purposes of the present invention the term “mature EPSP synthase” relates to polypeptide without the N-terminal chloroplast transit peptide. It is now known 20 that the precusor form of the EPSP synthase in plants (with the transit peptide) is expressed and upon delivery to the chloroplast, the transit peptide is cleaved yielding This herbicide is a non-selective, broad spectrum, post the mature EPSP synthase. All numbering of amino emergence herbicide which is registered for use on acid positions are given with respect to the mature more than fifty crops. This molecule is an acid, which 25 EPSP synthase (without chloroplast transit peptide dissociates in aqueous solution to form phytotoxic an leader). ions. Several anionic forms are known. As used herein, FIG. 1 shows the amino acid sequence for EPSP the term “glyphosate” refers to the acid and its anions. synthase from various plant, and bacterial species. In Glyphosate inhibits the shikimic acid pathway which spection of the sequences and alignment to maximize provides a precursor for the synthesis of aromatic the similarity of sequence reveals regions of conserved amino acids. Speci?cally, glyphosate inhibits the con version of phosphoenolpyruvate and 3-phospho amino acid residues (indicated by the consensus se shikimic acid to S-enolpyruvyl-3-phosphoshikimic acid quence) in the regions where the alanine for glycine by inhibiting the enzyme 5-enolpyruvyl-3-phospho substitution and aspartic acid or asparagine for glycine shikimate synthase. 35 substitution are made. Indeed, all monofunctional EPSP It has been shown that glyphosate-tolerant plants can synthase enzymes reported in the literature and in the be produced by inserting into the genome of the plant present speci?cation reveal a glycine at the two posi the capacity to produce a higher level of EPSP syn tions in the conserved regions. Those familiar with the thase. literature will recognize that some organisms, such as The present invention provides a means of enhancing 40 yeast and molds (Aspergillus sp) have a multifunctional the effectiveness of glyphosate-tolerant plants by pro “arom complex” which includes an EPSP synthase ducing variant EPSP synthase enzymes which exhibit a component. The noted amino acids‘ are also conserved lower af?nity for glyphosate while maintaining cata and introduction of the described substitutions in the lytic activity. EPSP synthase component of the multifunctional 45 “arom complex” should also result in the glyphosate BRIEF DESCRIPTION OF THE DRAWINGS tolerant activity. FIG. lA-lB shows the amino acid sequences for Speci?cally, the glycine residue which is replaced by EPSP synthase enzymes from various plant, and bacte the alanine residue in the preparation of the glyphosate rial species. tolerant EPSP synthases of the present invention occurs FIG. 2 represents a map of plasmid pMON8l35. 50 at position 96 in the EPSP synthase of Bordetella pertus FIG. 3 represents a map of plasmid pMON895. sis (Maskell et al., 1988); position 101 in the EPSP syn FIG. 4 represents a map of plasmid pMON915. thase of petunia; position 101 in the EPSP synthase of FIG. 5 represents a restriction map of the T-DNA of tomato; position 101 in the EPSP synthase of Arabidop pTiT37 plasmid of A. tumefaciens A208. sis thaliana; position 101 in the EPSP synthase of Bras FIG. 6 represents a map of intermediate plant trans 55 sica napus; position 104 in the EPSP synthase of Glycine formation vector pMON987. max; position 96 in the EPSP synthase of E. coli K-l2 FIG. 7 represents a map of plasmid pMON8631. (Duncan et al., 1984) and position 96 in the EPSP syn thase of Salmonella typhimurium (Stalker et al., 1985). STATEMENT OF THE INVENTION The glycine residue which is replaced by an amino acid The present invention provides novel EPSP synthase residue selected from the group consisting of aspartic enzymes which exhibit increased tolerance to glypho acid and asparagine in the preparation of the glypho sate herbicide while maintaining low Km values for sate-tolerant EPSP synthases of the present invention phosphoenolpyruvate. The subject enzymes of this in occurs at position 137 in the EPSP synthase of Borde vention have an alanine for glycine substitution and an teIla pertussis; position 144 in the EPSP synthase of aspartic acid for glycine substitution as described here 65 petunia; position 144 in the EPSP synthase of tomato; inafter. position 144 in the EPSP synthase of Arabidopsis In another aspect, the present invention provides a thaliana; position 144 in the EPSP synthase of Brassica method for the isolation of amino acid substitutions napus; at position 147 in the EPSP synthase of Glycine 5,310,667 3 4 max; position 137 in the EPSP synthase of E. coli K-12 further comprises a DNA sequence encoding a chloro and position 137 in the EPSP synthase of Salmonella plast transit peptide attached to the N-terminus of the ryphimurium. These examples demonstrate that the ala mature EPSP synthase coding sequence, said transit nine for glycine and aspartic acid for glycine replace peptide being adapted to facilitate the import of the ments can be introduced into the conserved regions of 5 EPSP synthase enzyme into the chloroplast of a plant these other wild-type EPSP synthase enzymes to yield cell. glyphosate-tolerant EPSP synthase enzymes. Therefore, in yet another aspect the present invention Hence, in one aspect the present invention provides also provides a plant transformation or expression vec glyphosate-tolerant EPSP synthase enzymes and a tor comprising a plant gene which encodes a glypho method for producing such enzymes which comprises sate-tolerant EPSP synthase enzyme having a ?rst se substituting an alanine residue for the second glycine quence: residue in a ?rst conserved region having the sequence:
15 located between positions 80 and 120 in the mature located between positions 80 and 120 in the mature EPSP synthase amino acid sequence and having a sec wild-type EPSP synthase amino acid sequence, and ond sequence: substituting an amino acid residue selected from the group consisting of aspartic acid and asparagine for the terminal glycine residue in a second region having the 20 sequence:
where x1, x2, x3, x4, x6, and x7 are any amino acid, and x5 is either arginine or lysine, said second sequence located between positions 120 and 160 in the mature where x1, x2, x3, x4, x6, and x7 are any amino acid and x5 25 EPSP synthase amino acid sequence. is either arginine (R) or lysine (K) and said second re According to still another aspect of the present inven gion is located between positions 120 and 160 in the tion, a process is provided that entails cultivating such a mature wild-type EPSP synthase amino acid sequence. plant and, in addition, propagating such plant using In most cases the ?rst conserved region will be located propagules such as explants, cuttings and seeds or cross 30 between positions 90 and 110 and the second conserved ing the plant with another to produce progeny that also region between positions 135 and 150 in the mature display resistance to glyphosate herbicide. EPSP synthase. The EPSP synthase sequences shown in FIG. 1 rep In one embodiment, glyphosate-tolerant EPSP syn thase coding sequences are useful in further enhancing resent a broad evolutionary range of source materials the ef?cacy of glyphosate-tolerant transgenic plants. 35 for EPSP synthases. These data demonstrate that EPSP Methods for transforming plants to exhibit glyphosate synthase from bacterial and plant material contain the tolerance are disclosed in European Patent Of?ce Publi aforementioned conserved regions. However, those cation No. 0218571 and commonly assigned U.S. patent skilled in the art will recognize that a particular EPSP application entitled “Glyphosate-Resistant Plants,” Ser. synthase may be produced by and isolated from another No. 879,814 ?led Jul. 7, 1986, the disclosures of which source material which may not have the exact sequence are speci?cally incorporated herein by reference. The of the conserved region. Indeed, it has been found that present invention can be utilized in this fashion by iso an alanine may be inserted for the ?rst glycine of the lating the plant or other EPSP synthase coding sequen conserved region of petunia EPSP synthase with no ces and introducing the necessary change in the DNA attendant changes in glyphosate sensitivity. sequence coding for EPSP synthase to result in the 45 While substituting either aspartic acid or asparagine aforementioned substitutions in the translated EPSP for the glycine residue in the aforedescribed second synthase enzyme. conserved region results in a glyphosate resistant EPSP In another aspect, the present invention provides a synthase, an aspartic acid substitution is most preferred. transformed plant cell and plant regenerated therefrom Those skilled in the art will recognize that substitutions which contain a plant gene encoding a glyphosate-toler 50 of other amino acid residues are likely to yield EPSP ant EPSP synthase enzyme having a ?rst sequence: synthase which are still glyphosate tolerant and possess a Km sufficient to maintain catalytic activity. Hence, other substitutions at this position should be considered within the spirit and scope of the present invention. located between positions 80 and 120 in the mature 55 The glyphosate-tolerant EPSP synthase plant gene EPSP synthase amino acid sequence and having a sec encodes a polypeptide which contains a chloroplast ond sequence: transit peptide (CTP), which enables the EPSP syn thase polypeptide to be transported into a chloroplast inside the plant cell. The EPSP synthase gene is tran scribed into mRNA in the nucleus and the mRNA is translated into a precursor polypeptide (CTP/mature where x1, x2, x3, x4, x6, and x7 are any amino acid, and EPSP synthase) in the cytoplasm. The precursor x5 is either arginine or lysine, said second sequence polypetide is transported (imported) into the chloro located between positions 120 and 160 in the mature plast at which time the CTP is cleaved to produce the EPSP synthase amino acid sequence. In most cases the 65 mature EPSP synthase enzyme. Suitable CTPs for use ?rst sequence will be located between positions 90 and in the present invention may be obtained from various 110 and the second sequence will be located between sources. Most preferably, the CTP is obtained from the 135 and 150 in the mature EPSP synthase. The gene endogenous EPSP synthase gene of the subject plant to 5,310,667 5 6 be transformed. Altemately, one may also use a CTP uM. Because of the elevated Km for PEP normal cata from an EPSP synthase gene of another plant. Al lytic activity will only be achieved at physiological though there is little homology between the CTP se concentrations of PEP by an elevated level of the vari quences of the EPSP synthase gene and the ssRU ant enzyme. If a variant of EPSP synthase could be BISCO gene (see e.g., Broglie, 1983), one may ?nd that identi?ed that had a high Kifor glyphosate and a lower non-homologous CTPs may function in particular em bodiments. Suitable CTP sequences for use in the pres Km for PEP than the current variant, it would enhance ent invention can be easily determined by assaying the the ability to achieve glyphosate tolerance in plant spe chloroplast uptake of an EPSP synthase polypeptide cies or plant tissues where it is difficult to engineer a comprising the CTP of interest as described hereinafter. O high level of gene expression. Selecting for new glypho It has been found that where a CTP is used other than sate-tolerant EPSP variants in bacteria would allow a the CTP of the EPSPS gene, one may need to include a much larger number of organisms to be screened in a small part of the N-terminus of the source protein from shorter amount of time than would be possible in selec which the CTP is derived to obtain efficient import of tions with higher organisms. The petunia EPSP syn the EPSP synthase into the chloroplasts. In most cases, thase cDNA clone can be expressed in E. coli to pro one would preferably isolate the EPSPS gene from the duce a fully functional EPSP synthase enzyme when plant to be transformed and introduce the substitutions the cDNA clone is properly tailored for expression in of the present invention into a cDNA construct made E. 0011'. So, to hasten the isolation of variants a system from the endogenous EPSPS mRNA of the subject for the expression and selection of variant forms of plant. Suitable plants for the practice of the present 20 petunia EPSP synthase was developed in the common invention include, but are not limited to, soybean, cot laboratory organism E. coli. ton, alfalfa, oil seed rape, ?ax, tomato, sugar beet, sun ?ower, potato, tobacco, maize, wheat, rice and lettuce. Promoters which are known or found to cause tran General Features of Selection Scheme for Identifying scription of the EPSP synthase gene in plant cells can be 25 Glyphosate Resistant Variants with Low Km Values for PEP used in the present invention. Such promoters may be Component Features obtained from plants, plant pathogenic bacteria or plant E. 0011' Host aroA~ strain or prototrophic viruses and include, but are not necessarily limited to, strain with endogenous EPSPS the 35S and 19S promoters of cauli?ower mosaic virus activity inhibited with low and promoters isolated from plant genes such as EPSP levels of glyphosate (empirically synthase, ssRUBISCO genes and promoters obtained deten-nined for each host). from T-DNA genes of Agrobacrerium tumefaciens such Expression Plasmid Self replicating plasmid with as nopaline and mannopine synthases. The particular a weak bacterial promoter fused promoter selected should be capable of causing suffr to a plant EPSPS gene, which is not able to complement the cient expression to result in the production of an effec E. colt‘ aroA mutation and support tive amount of glyphosate-tolerant EPSP synthase pol cell growth on minimal medium ypeptide to render the plant cells and plants regenerated when expressed at a weak level. therefrom substantially resistant to glyphosate. Those The promoter should be weak skilled in the art will recognize that the amount of gly enough so that a fusion with phosate-tolerant EPSP synthase polypeptide needed to a wild type EPSPS gene would be inhibited at a concentration induce tolerance may vary with the type of plant. of glyphosate similar to that The promoters used for expressing the EPSP syn needed to inhibit the endogenous thase gene of this invention may be further modi?ed if bacterial EPSPS. desired to alter their expression characteristics. For Mutagens Should create point mutations, example, the CaMV35S promoter may be ligated to the 45 either single or multiple, portion of the ssRUBISCO gene which represses the transitions or transversions, but expression of ssRUBISCO in the absence of light, to not insertions, deletions or frameshifts. Spontaneous muta create a promoter which is active in leaves but not in tions could also be selected, roots. The resulting chimeric promoter may be used as but would probably be less described herein. As used herein, the phrase efficient. "CaMV35S” promoter includes variations of Selection Medium Minimal bacterial growth medium CaMV35S promoter, e.g. promoters derived by means containing essential salts and of ligation with operator regions, random or controlled minerals and sugars without mutagenesis, addition or duplication of enhancer se aromatic amino acids. Anti biotics may be added which quences, etc. 55 correspond to the drug resistance Variant EPSP synthases which contain only the gly marker genes on the expression cine to alanine change at position 101 as described plasmid to select only for above are highly resistant to glyphosate. However, this bacterial cells containing the resistance is accompanied by an increase in the binding expression plasmid. For aroA constant (K,,,) for phosphoenolpyruvate (PEP), one of hosts, glyphosate is not required the two natural substrates for the enzyme. The binding to select for variants with low Km values for PEP, which are able constant for the other substrate, shikimate-3-phosphate to complement the E. coli aroA (S3P), is not affected. For example; the wild type petu mutation when expressed at a nia EPSP synthase has a'binding constant (K,~) for the weak level. For prototrophic competitive inhibitor glyphosate of 0.4 “M and a Km 65 E 0011' strains, add glyphosate for PEP of 5.2 ttM, while the variant form with the to inhibit the endogenous EPSPS alanine for glycine substitution at position 101 has a K, activity. for glyphosate of 2000 uM and a Km for PEP of 198 5,310,667 7 8 contains the ATG translational initiation signal of the Exemplary Heterologous Bacterial coding sequence. Expression/ Selection System To construct pMONéOOl, pMON25 was digested A) Construction of pMON342 and pMON9566 ex with BamHI and mixed with a synthetic DNA fragment pression vectors for wild type and variant petunia containing a partial phage lambda pL sequence (Adams EPSP synthase (glycine (101) to alanine) in E. coli. and Galluppi, 1986) containing BamHI sticky ends: Plasmid pMON342 carries the “mature” wild-type petunia EPSP synthase coding sequence (without chlo 5'-GATCCTATCTCTGGCGGTGTT GACATAAATACCACTGGCGGTGATACT roplast transit peptide) expressed from tandem copies of GAGCACATCG-Ii' the bacteriophage lambda pL promoter (double pL). 10 This plasmid was derived from pMON953l and 3'-GATAGAGACCGCCACAACTGTATT pMON9556, petunia EPSP cDNA clones, as described TATGGTGACCGCCACTATGACTCGT below (the isolation of pMON953l and pMON9556 is GTAGCCTAG-S' described hereinafter). A unique Ncol site and ATG translational initiation The resulting plasmid pMON6001 carries two copies of signal were introduced at the amino terminus of the the synthetic phage lambda pL promoter fragments as wild-type petunia EPSP synthase cDNA coding se direct repeats in the BamHI site of pMONZS in the quence for the mature protein. Simultaneously, the correct orientation to promote transcription of the E. chloroplast transit peptide coding sequence was re coli EPSP synthase coding sequence. moved by subjecting M8017 (the Ml3mp9 clone of the 20 Plasmid pMON6001 was cleaved with N001 and 300 bp EcoRI cDNA fragment of pMON9531) to site EcoRI and the 3 kb fragment isolated from an agarose directed mutagenesis using the procedure of Zoller and gel. This fragment was mixed with the small 100 bp Smith (1983) and the following mutagenesis primer: NcoI-EcoRI fragment puri?ed from M8019. Following ligation and transformation a clone was identi?ed that 5'-ATCTCAGAAGGCTCCATGGTGCT 25 contained the small 100 bp NcoI-EcoRI fragment cor GTAGCCA-3' responding to the 5' end of the “mature” EPSP synthase of petunia. This construct was designated pMON9544. A variant phage clone was isolated that contained an Plasmid pMON9544 was digested with EcoRI and NcoI site. The presence of the above-described muta treated with alkaline phosphatase. The EcoRI fragment tion was con?rmed by sequence analysis. This Ml3mp9 of pMON9544 was mixed with pMON9556 DNA that clone .was designated M8019. had been cleaved with EcoRI to release a 1.4 kb frag Plasmid pMON600l is a derivative of pBR327 (So ment encoding the 3’ portion of the petunia EPSP syn beron et a1., 1980) carrying the E. coli K12 EPSP syn thase coding sequence. Following ligation and transfor thase coding sequence expressed from two tandem cop mation, a clone was identi?ed that could complement ies of a synthetic bacteriophage lambda pL promoter. 35 an E. coli aroA mutation and carried the 1.4 kb fragment Plasmid pMON600l was constructed in the following of pMON9556 to give an intact mature coding sequence manner. First, pMON4 (Rogers et al., 1983) was di for petunia EPSP synthase. This plasmid was desig gested with ClaI and the 2.5 kb fragment was inserted nated pMON342. into a pBR327 plasmid vector that had also been The EcoRI site at the 3’ end of the EPSP synthase in cleaved with ClaI. The resulting plasmid, pMON8, pMON342 was replaced with a ClaI site to facilitate contains the EPSP synthase coding sequence reading in construction. This was accomplished by partial diges the same direction as the beta-lactamase gene of tion with EcoRI followed by digestion with mungbean pBR327. nuclease to make the ends blunt. ClaI linkers (5’-CATC To construct pMON25, a derivative of pMON8 with GATG-3', New England Biolabs) were added to the unique restriction endonuclease sites located adjacent to 45 blunt ends by ligation with T4 DNA ligase. The mixture the E. coli EPSP synthase coding sequence, the follow was digested with ClaI to produce sticky ends, and the ing steps were taken. A deletion derivative of pMON4 5 kb EcoRI partial digest was isolated from an agarose was made by cleavage with BstEII and religation. The gel and ligated with T4 DNA ligase. This plasmid was resultant plasmid pMON7 lacks the 2 kb BstEII frag designated‘pMON9563. ment of pMON4. Next, a 150 bp Hinfl to NdeI fragment 50 A 29-nucleotide mutagenic deoxyoligonucleotide which encodes the 5' end of the EPSP synthase open having the following sequence: reading frame was isolated after digestion of pMON7 with Ndel and Hinfl and electroelution following elec 5'-GCCGCATTGCTGTAGCTGCAI I I trophoretic separation on an acrylamide gel. This piece CCAAGG-3' was added to the puri?ed 4.5 kb BamHI-Ndel fragment 55 of pMON8 which contains the 3' portion of the EPSP was synthesized for introducing the alanine for glycine synthase coding sequence and a synthetic linker with substitution at position 101 using an automated DNA the sequence: synthesizer (Applied Biosystems, Inc.). The deox yoligonucleotide was puri?ed by preparative polyacryl 5'-GATCCAGATCTGTTGTAAGGAGT amide gel electrophoresis. ' CTAGACCATGG-3’ The 660 bp EcoRI-HindIII fragment of pMON9563 3'-GTCTAGACAACATTCCTCAGATCTG was subcloned into a EcoRI-Hindlll digested GTACC'I'I'A-S’ M13mpl0 bacteriophage vector (New England Bi olabs). The single-stranded template DNA was pre The resulting plasmid pMON25 contains the E. coli 65 pared from the subclone as described in the M13 clon EPSP synthase coding sequence preceded by unique ing and sequencing handbook by Amersham, Inc. (Ar BamHI and BglII sites, a synthetic ribosome binding lington Heights, 111.) and oligonucleotide mutagenesis site, and unique XbaI and Ncol sites, the latter of which reactions were performed as described by Zoller and 5,310,667 9 10 Smith (1983) using the oligonucleotide described above. Baml-ll, HindIIl, Clal and Noel. Those restriction en This plasmid was designated M9551: The 660 bp zymes were chosen because they out within, or ?ank the EcoRI-HindIII fragment of M9551 was inserted into petunia EPSPS coding sequence and would be used for pMON9563 between the EcoRI and HindIII sites, re mobilizing mutagenized fragments. Therefore, ideal placing the corresponding wild type fragment. This promoter fragments would not contain restriction sites plasmid was designated pMON9566. for any of those enzymes. There were 8 Mbol fragments The double pL promoter used to express the petunia with varying degrees of promoter activity which lacked EPSP synthase in pMON342 and pMON9566 leads to a restriction sites for the enzymes listed above. Two of very high level of expression of the enzyme. The en them, pMON8l05 and pMON8l43, were selected for zyme is present at such high concentration that bacteria further characterization. Both plasmids complemented harboring either of these plasmids are tolerant to very the aroA defect and supported the growth of SR481 on high levels of glyphosate (>50 uM) in growth media, minimal medium containing up to 1 mM (pMON8l05) even though the enzyme produced by pMON342 is the and 20 mM (pMON8l43) glyphosate. wild type form. In order to produce a plasmid that C) Testing the Expression Vectors. would allow for selection of glyphosate tolerant forms The heterologous expression system was tested with of the enzyme it was necessary to replace the high ex a known variant to see if glyphosate resistant variants of pressing lambda phage pL promoter with a much petunia EPSPS could be selected. The glyphosate resis weaker promoter sequence. A plasmid for identifying tant mutation, glycine (101) to alanine, was introduced such a promoter was constructed as follows: into the petunia EPSPS coding sequence of both pMON9544, the precursor to pMON342, was digested 20 pMON8l05 and pMON8l43 expression vectors to gen with BamHI to 'remove the pL promoters, and was erate pMON8l35 and pMON8152, respectively. That recircularized by ligation resulting in pMON362. The was achieved by replacing the 660 bp EcoRI-HindIII EcoRI fragment of pMON9556 containing the 3' region from both vectors with the 660 bp EcoRI-Hin~ cDNA portion of the petunia EPSPS cDNA was then dIII region from pMON9566 which contained the gly inserted into the EcoRI site of this plasmid reconstitut ing the entire coding sequence. The resulting plasmid, cine (101) to alanine mutation. Both pMON8l35 and pMON364 is identical to pMON342 except that there is pMON8l52 were used to transform SR481. The no promoter 5’ of the EPSP synthase coding sequence. pMON8l52 construct was able to complement the aroA To facilitate future cloning steps, the EcoRI/PstI defect in SR481 and vsupport cell growth on minimal fragment of pMON364 from which the promoter ele medium containing up to 50 mM glyphosate. ments.had been deleted was ligated to the EcoRI/PstI The weakly expressing pMON8l35 (FIG. 2) con fragment of pMON9563 containing most of the EPSP struct containing the variant enzyme sequence was not synthase cDNA creating pMON9564. This plasmid is able to complement the aroA defect in SR481 and did identical to pMON364 except that it has a unique Clal not support cell growth on minimal medium. A culture site at the 3'-end of the EPSP synthase cDNA and a 35 of SR481 cells carrying the pMON8l35 plasmid was unique EcoRI site within the EPSP synthase coding assayed to demonstrate that the petunia EPSP synthase sequence. Transformation of an aroA E. coli, such as enzyme was expressed. Plasmid pMON8l35 has a spe SR481 (Bachman et a1., 1980; Padgette et al., 1987) ci?c activity of 41 nmol/min/mg protein and failed to complement the mutation, thus demonstrating pMON8l05 has a speci?c activity of 28 nmol/min/mg the effective deletion of the promoter region and the protein. So, the pMON8l35 construct was expressed in inability of this plasmid to produce EPSP synthase in E. E. coli with a specific activity similar to its parental coli. An empirical screening approach was used to iso construct pMON8l05. It was then hypothesized that late promoters with an appropriate low level expression the elevated Km for PEP of the variant enzyme (198 uM in E. coli as follows. versus 5.2 uM for the wild type) resulted in a relatively B) Generation of a series of promoter constructs. 45 inefficient EPSP synthase enzyme that was unable to Chromosomal DNA isolated from the E. coli strain complement the aroA mutation when the enzyme was SRZO (GM42 hfr, his-, dam3-) was digested completely produced at this low level. This result demonstrated the with Mbol. The MboI fragments were cloned into the importance of the Km for PEP and the ability of a vari BglII site of plasmid pMON9564. The BglII site is in a ant petunia EPSPS enzyme to complement aroA when multilinker located upstream of the promoterless petu 50 weakly expressed in E. coli. If a variant enzyme has a nia EPSPS coding sequence which had been tailored high Km for PEP, then a greater level of expression is for expression in E. coli The ligation mixture was used required to complement aroA. The weakly expressing to transform E. coli strain SR481, the aroA- variant vector, pMON8l05, therefore, provides a novel, pow lacking endogenous EPSPS activity. Forty-one colo erful selection tool for identifying petunia EPSPS vari nies were obtained which contained Mbol fragments 55 ants which have relatively low Km values for PEP. In with sufficient promoter activity to express the Petunia combination with glyphosate selection, variants which EPSPS cDNA, complementing the aroA defect in combine signi?cant glyphosate tolerance with low Km SR481 and supporting cell growth on minimal medium. values for PEP can be obtained. This implies that not The 41 colonies were streaked individually onto MOPS only can new variants of the wild type enzyme be ob minimal medium containing glyphosate at l, 5, l0, l5 tained from this system, but it can also be used to select and 20 pM concentrations. The amount of cell growth for second site mutations in the glycine (101) to alanine on increasing concentrations of glyphosate was used as variant coding sequence that lower the Km for PEP a measure of the relative promoter strength of each while maintaining glyphosate tolerance. This unexpect Mbol fragment expressing the petunia EPSPS coding edly powerful selection system constitutes one part of sequence. To further characterize each of the MboI 65 the present invention. Those skilled in the art will rec promoter fragments, plasmid miniprep DNA was pre ognize that one can use other strains of aroA bacteria, pared by the alkaline lysis method from each of the 41 other methods of insertion, other sources of random colonies and was digested individually with EcoRI, DNA fragments and coding sequences from organisms 5,310,667 11 . 12 other than petunia while not departing from the spirit EMS mutagenized pMON8l35 plasmid DNA was and scope of the invention. transformed into JMlOl and glyphosate resistant vari D) In vivo Mutagenesis of pMON8l35 with Ethyl ants were selected on MOPS minimal medium contain Methane Sulfonate. ing 5 mM glyphosate. The following mutagenesis procedure serves as an The glyphosate resistant colonies contained example of the application of this selection system for pMON8l35 plasmids with a variety of mutations, in obtaining such second site variants of the glycine (101) cluding promoter mutations, copy number mutations to alanine variant of the petunia enzyme. Ethyl methane and glyphosate resistant mutations in the petunia EPSP sulfonate (EMS) is a chemical mutagen commonly used synthase coding sequence. Mutations that increased in bacterial genetics, but it requires growing the bacte plasmid copy number or increased the strength of the rial cultures in minimal medium. Since pMON8l35 does promoter that was used to drive the EPSP synthase not complement aroA in SR481, a prototrophic strain of gene would increase the amount of EPSP synthase E. coli had to be employed. enzyme in the bacteria and would confer an aroA posi pMON8l35 was transformed into the E. coli strain tive glyphosate tolerant phenotype to the cells. To elim JM109. A 3 ml culture was grown to saturation over inate mutations in the non-coding regions of the EMS night at 37° C. in 2XYT media containing 50 ug/ml mutagenized pMON8135 plasmid, the glyphosate resis carbenicillin. A 0.5 ml aliquot of the saturated culture tant colonies were pooled together into 2XYT liquid was diluted 40 fold into 20 ml 2XYT medium in a side media containing 50 ug/ml carbenicillin and grown arm ?ask. The diluted culture was shaken continuously overnight at 37° C. with agitation to aerate the cells. in a water bath at 37° C. and the growth was monitored 20 The cells were then pelleted from the saturated cultures using a Klett-Summerson photoelectric colorimeter by centrifugation and the plasmid DNA was extracted until a Klett value of 145 was reached. The culture was using the alkaline lysis procedure. The plasmid DNA then mixed with an equal volume (20 ml) of an EMS was then digested completely with EcoRI and ClaI stock solution which contained 0.8 ml EMS (Sigma enzymes and the 1.6kb petunia EPSPS coding sequence Chemical, St. Louis, Mo.) and 19.2 ml 1X MOPS mini 25 region was then puri?ed out of a 0.8% SeaPlaque (FMC mal medium. After being shaken for 2 hours at 37° C., Corporation) low gelling temperature agarose gel. The the 40 ml culture was diluted 10 fold with 1X MOPS 1.6kb EcoRl-Clal fragment was used to replace the media to a ?nal volume of 400 ml. The diluted culture analogous fragment containing the wild-type coding was then shaken for 3 hours at 37° C. The cells were sequence in the non-mutagenized pMON8lO5 expres pelleted in a 500 ml plastic centrifuge bottle using a sion vector by ligating it to the 3.83 kb EcoRI-Clal Beckman JAlO rotor for 10 min at 7000 rpm and at 5° C. vector fragment of this plasmid which had been isolated The cells were then resuspended and washed in 100 ml as above. The ligation mixture was then used to trans of lX MOPS media and then pelleted as above. The form JMlOl cells, which were plated onto MOPS mini bacterial cell pellet was resuspended in 200 'ml of 2XYT mal medium containing 5 mM glyphosate to select for growth medium and shaken in a 1 liter ?ask for 90 min glyphosate resistant mutations in the petunia EPSP utes at 37° C. The cells were then pelleted again as synthase coding sequence region. above and were frozen at —20° C. The pellet was The glyphosate resistant colonies obtained from the thawed and the mutagenized pMON8l35 plasmid DNA transformations of the sub-cloned coding region were was then extracted following a standard alkaline lysis further characterized by measuring the rate of growth procedure. of each variant in liquid culture in varying concentra E) Screening for Glyphosate Resistant Coding Se tions of glyphosate. This growth curve analysis func quence Variants. tioned as a tertiary screen and was performed in the A multi-step screening procedure was used to iden following way: tify glyphosate resistant variants of petunia EPSPS. The Glyphosate resistant colonies were picked off the ?rst screening step involved the transformation of E. 45 selection plates and inoculated individually into precul coli with the EMS mutagenized pMON8l35 plasmid tures containing 1 ml of MOPS medium and 50 ug/ml DNA and selecting for glyphosate resistant colonies on carbenicillin. The precultures were then grown to satu minimal medium containing glyphosate. The SR48l ration by shaking the cultures overnight at 37° C. The aroA E. coli strain had a very low transformation fre next morningthe density of each culture was deter quency, yielding at best 104 transformants per p.g of mined by withdrawing a 100 pl aliquot from each and plasmid DNA. To overcome that problem, the E. coli diluting it 10 fold with the addition of 900 pl MOPS strain JMlOl was used because transformation efficien medium, then reading the optical density at a wave cies of up to 108 transformants per ug of plasmid DNA length of 660 nm in a spectrophotometer. The saturated could be routinely obtained. However, JMlOl con precultures were then diluted to 1% by adding 50 u] tained a fully functional aroA gene and was able to 55 from each saturated preculture to 5 ml of MOPS media grow on MOPS minimal medium. By plating JMlOl on containing 0, 5 or 10 mM glyphosate. The diluted pre minimal medium plates containing increasing concen cultures were grown in glass culture tubes ?tted with trations of glyphosate, it was determined that 2 mM stainless steel closures, rotating on a wheel at 37° C. The glyphosate would inhibit the endogenous EPSP syn glass culture tubes were designed for direct reading in a thase enzyme activity and growth of JMlOl on minimal Klett-Summerson photoelectric colorimeter, which media. Since the weakly expressing wild type petunia was used to monitor the growth of the bacterial cultures EPSP synthase cDNA construct (pMON8105) could at approximately 3 hour intervals. not support the growth of the aroA-E. coli strain, One culture, #215, was identi?ed which grew faster SR481, on 1 mM glyphosate and the corresponding than all of the other glyphosate resistant cultures and glycine 101 to alanine construct (pMONS l 35) could not control cultures in MOPS medium containing 10 mM complement the bacterial aroA, then a prototrophic glyphosate. It was the only culture that had grown to strain of E. 0011' can be used for the selections if the saturation within 11 hours of growth in this concentra glyphosate concentrations are greater than 2 mM. The tion of glyphosate. The control cultures were 5,310,667 13 14 pMON8l43 and pMON8l52 (both described above) in stant except in the presence of varying concentrations the JMlOl E. coli host. of glyphosate (0,100,200,400 uM). Initial rate data was F) Characterization of the Glyphosate Resistant Cod plotted as l/[PEP] versus UV and the slopes of the ing Sequence Variants. resulting lines were replotted versus [glyphosate]. The balance of the #215 preculture (~750 pl) was The assay results showed that the bacterial cells con used to inoculate 2 ml of MOPS medium containing 50 taining the pMON8l86 plasmid had an EPSP synthase pg/ml carbenicillin and was shaken overnight at 37° C. activity of 28nmoles of EPSP forrned/min/mg of pro to reach saturation. Plasmid DNA was isolated from an tein. The enzyme was highly resistant to glyphosate as aliquot of the saturated culture using an alkaline lysis' indicated by a Kifor glyphosate of 348 pM. The Km for procedure. The plasmid was designated pMON8l86. PEP was determined to be 40 uM. The petunia EPSPS An aliquot of the pMON8l86 plasmid was used to trans glycine (101) to alanine variant has a Kifor glyphosate form the E. coli host SR48l (described above) and rese of 2000 p.M and a Km for PEP of 200 pM. The Ki/Km lected on MOPS medium containing 10 mM glyphosate ratio for the pMON8l86 encoded glyphosate resistant and 50 pg/ml carbenicillin. A single glyphosate resis variant enzyme is 7.7, which is similar to that of the tant colony of pMON8l86 was picked off the selection progenitor glycine (101) to alanine variant whose ratio plate and used to inoculate 3 ml of 2XYT bacterial is 10.0. However, the pMON8l86 enzyme has a Km for medium containing 50 rig/ml carbenicillin. The culture PEP that is more than four fold lower than the glycine was then aerated on rotating wheel at 37° C. until satu (101) to alanine variant. The lowering of the Km for rated, then it was used to inoculate a larger 500 ml PEP makes the pMON8l86 variant enzyme more ef? culture. The large culture was grown to saturation by cient kinetically, as demonstrated by its ability to sup shaking it overnight at 37° C. in a water bath. The bac port the growth of E. coli in MOPS medium containing terial cells were lysed and the extracts were assayed for high concentrations of glyphosate. This demonstrated EPSPS activity. that our selection system allowed for the induction and Speci?cally, the bacterial cell paste was washed identi?cation of mutations of the petunia EPSPS gly twice with 0.9% saline, suspended in buffer (100 mM 25 cine (101) to alanine variant enzyme which would main Tris-HCl, 5 mM benzamidine HCl) and passed twice tain the glyphosate resistant properties of the original through the French Pressure Cell at 1000 psi. The cell variant, but lower the Km for PEP. The pMON8l86 extract was separated from the cells by centrifuging at results also demonstrated that the improvements in the 15,000 x gravity for 10 mins. at 5° C. It was desalted Km for PEP could be selected in the heterologous bac using Sephadex G-50 (Pharmacia, Piscataway, NJ). 30 terial expression system described above. A variant The desalted extract was assayed for EPSP synthase petunia EPSP synthase containing the glycine (101) to activity as follows: alanine substitution and the glycine (144) to asparagine To an assay mix (40 pl) containing shikimate-3-phos substitution exhibited a Km for PEP of 91 p.M and a K; phate (2 mM), l‘lC-phosphoenolpyruvate ‘(1 mM, 1.2 for glyphosate of 960 uM (Ki/Km: 10.5). mCi/mmol), ammonium molybdate (0.1 mM), potas 35 G) Identi?cation of the pMON8l86 Mutation. sium ?uoride (5 mM) in 50 mM HEPES-KOH, pH 7, To identify the EMS induced mutation responsible was added the extract and incubated at 25° C.- for 2 for the improved glyphosate resistant properties of the mins. The reaction was quenched by the addition of 50 pMON8l86 variant enzyme, it was first localized within pl of 50 pl of 90% ethanol/0.1M acetic acid, pH 4.5. 70 the coding sequence region. This was achieved by sub ul of the reaction mixture was loaded on a SynchroPak 40 cloning the 5' and 3’ h'alves individually into a bacterial AXl00 HPLC column (0.4X25 cm) and the column overexpression vector and determining the kinetic was eluted with 0.5M potassium phosphate, pH 5.5 at 1 properties of each subclone as follows: The 660 bp ml/min. The radioactivity of the eluent was monitored EcoRI-HindIII fragment from the petunia EPSPS cod using a Radiomatic Flo-One Beta Instrument. (Radi ing sequence in pMON9767 was replaced with the anal omatics, Fla). The EPSP synthase activity was deter 45 ogous EcoRI-HindIII fragment from pMON8l86. Plas mined by measurement of the conversion of l‘iC-PEP to mid pMON9767 is a derivative of pMON9566 (de l“'C-EPSP synthase, both of which are resolved under scribed above) in which an Xbal site had been created at the above conditions of chromatography. The protein the 3' end of the petunia EPSPS glycine (101) to alanine content of the extract was determined by the method of variant coding sequence by HindIII-Clal fragment of Bradford (Biorad Labs, Calif). The speci?c activity of 50 the petunia EPSPS coding sequence region from the extract is expressed as nanomoles of EPSP synthase pMON9767 was replaced with the analogous HindIII formed/min/mg protein. ClaI fragment from pMON8l86. The constructs were Kinetic constants (appKm PEP and appKi glypho then transformed into SR48l and plated on MOPS me sate) were determined for EPSP synthase as described dium containing 50 pg/ml carbenicillin. Large scale below. Substrate kinetic parameters were determined at 55 cultures (50 ml 2XYT containing 50 ug/ml carbenicil pH 7.0 in 50 mM HEPES (N-[2-hydroxyethyl1pipera lin) of each subclone were prepared from single colo zine-N'-[2-ethanesulfonic acid]) buffer in the presence nies picked off the selection plates. The cultures were of 2 mM S3P and varying amounts of l‘*C-PEP (1O grown to saturation by shaking them overnight in a 37° pM-400 uM), for 2.0 minutes at 25° C. Reactions were C. waterbath. The cells were pelleted and lysed. The quenched with 100 mM Na Acetate in ethanol, pH 4.5, bacterial extracts were assayed as described above and centrifuged and analyzed for product EPSP formation the approximate Kiand Km values were determined for by HPLC with ?ow radioactivity detection. HPLC each pMON8l86 subclone. The kinetic values for the conditions were 0.35 MKPi, pH 6.5, on a Synchropak EcoRI-HindIII region subclone were similar to those of AXlOO column at 1.0 ml/min. The resulting rates were the intact pMON8l86, while those of the HindIIl-ClaI plotted by hyperbolic plot, Lineweaver-Burk plot and 65 subclone were similar to those of pMON8l35. Thus, the Eadie-Hofstee plot and an average Km for PEP value EMS induced, second site mutation responsible for the obtained. The appKi for glyphosate versus PEP was excellent kinetic properties of pMON8l86 was located determined as described for the substrate kinetic con on the 660 bp EcoRI-HindlII fragment. That subclone 5,310,667 15 16 - of the EcoRl-HindIII region was designated The pMON895 plasmid contains next the 3.14 K pMON8191. DNA segment that encodes a chimeric gene for expres The 660 bp EcoRI-HindIII fragment of pMON8186 sion of the petunia S-enolpyruvylshikimate-3-phosphate was sequenced to determine the exact nucleotide synthase. The chimeric gene consists of the 0.66 Kb change and the corresponding amino acid change re CaMV 35S promoter enhanced as described by Kay et sponsible for the new kinetic properties of the al. (1987) (P-e35S), followed by the 2 Kb coding se pMON8l86 encoded variant enzyme. The 660 bp quence for the petunia EPSPS with the glycine (101) to EcoRI-HindIII fragment from pMON8186 was inserted alanine substitution (prePEPSPS:2), and the 0.48 Kb 3’ into EcoRI-HindIII cut Ml3mp18 and M13mp19 bacte nontranslated region of the soybean alpha’ subunit of riophage vector DNAs and were designated M8059 and 0 the beta-conglycinin gene (78 3’) (Schuler et a1. 1982). M8058, respectively. Following transformations into Plasmid pMON9l5 (FIG. 4) was constructed from JMlOl, single plaques were picked and single strand three DNA fragments: template DNA was prepared from each (protocol from l. The 7.91 Kb BglII to Xbal fragment from Amersham, M13 cloning and sequencing handbook). pMON895 containing the P-e35S promoter, the The template DNAs were sequenced by the method of Spc/Str gene, P-35/KAN/NOS 3', ori-V, ori-PBR, and Sanger using the reagents and protocol from a commer the right border. cially available DNA sequencing kit from United States 2. The 1.27 Kb Xbal to EcoRI fragment from Biochemical Corporation. The presence of the glycine pMON8191 containing the petunia EPSP synthase gene (101) to alanine substitution was con?rmed in the DNA with the glycine (101) to alanine and glycine (144) to sequence. In addition, there was a single guanine to aspartic acid substitutions. adenine transition at the second nucleotide position of 3. The 0.31 Kb EcoRI to BglII fragment from the GGT codon for glycine (144) in the mature petunia pMON895, which contains the petunia EPSP synthase EPSP synthase, resulting in a glycine to aspartate amino chloroplast transit peptide. acid substitution at the 144 position. The guanine to The pMON9l5 plasmid was introduced into the ACO Agrobacterium strain. The strain carries the dis adenine transition is consistent with the type of muta tion known to be induced by EMS. Thus, the improved armed pTiT37-CO nopaline type plasmid. Referring to , FIG. 5, a restriction map is provided of the T-DNA kinetic properties of the pMON8l86 encoded glypho region of the A208 Agrohacterium tumefaciens strain sate resistant petunia EPSPS variant enzyme are due to pTiT37 plasmid, which was disarmed to create the a combination of two substitutions: one resulting in the ACO strain. The hatched boxes show the segments of glycine (101) to alanine change, the other resulting in a the Ti plasmid DNA which were used to provide ho glycine (144) to aspartic acid amino acid change. mology for recombination and replacement of the T The petunia EPSP synthase coding sequence contain DNA. The T-DNA segment was replaced by the Tn60l ing the glycine (101) to alanine and glycine (144) to bacterial kanamycin resistance gene (KnR) segment aspartic acid substitutions was engineered for appropri 35 joined to the oriV and pBR322 segment homologous to ate expression in plant cells. Construction of the inter the vectors described above. The recombination be mediate plant transformation vector and Agrobacterium tween the disarmed pTiT37-CO and pMON9l5 plasmid tumefaciens-based transformations of plant cells is de takes place through the pBR322 oriV area of homology, scribed below. resulting in the hybrid T-DNA which contains the en Construction of pMON91 5 tire pMON9l5 DNA. On cultivation of the Agrobacte rium with plant cells, the hybrid T-DNA segment be The plant transformation vector pMON9l5 was de tween the left and right borders is transferred to the rived from the pMON895 vector. The pMON895 plas cells and integrated into the genomic DNA. mid (FIG. 3) is made up of the following segments of The variant EPSP synthase polypeptides of the pres DNA. The ?rst segment is a 0.93 Kb AvaI to engi ent invention may be prepared by either polypeptide neered EcoRV fragment isolated from transposon Tn7 synthesis or isolation and mutagenesis of a EPSP syn that encodes bacterial spectinomycin/streptomicin re thase gene to produce the above described glyphosate sistance (Spc/Str), which is a determinant for selection tolerant molecule. Since it is foreseen that the greatest in E. coli and Agrobacterium tumefaciens. This is joined utility of the present invention is in the preparation of to the 1.61 Kb segment of DNA encoding a chimeric glyphosate-tolerant plants, nucleotide sequences (either kanamycin resistance gene which permits selection of cDNA or genomic) encoding the glyphosate-tolerant transformed plant cells. The chimeric gene (P EPSP synthase can be easily prepared in the following 35S/KAN/NOS 3’) consists of the cauli?ower mosaic manner. virus (CaMV) 35S promoter, the neomycin phospho transf :rase type II (KAN) gene, and the 3’-nontran cDNA Coding Sequences slated and ?anking regions of the nopaline synthase Total RNA is isolated from the source material gene (NOS 3’). The next segment is the 0.75 Kb ori-V which includes, but is not necessarily limited to, fungi containing the origin of replication from the RK2 plas and plant tissue. PolyA-mRNA is selected by oligodT mid. It is joined to the 3.1 Kb SalI to Pvul segment of cellulose chromatography. A cDNA library is then pBR322 (ori-322) which provides the origin of replica‘ 60 prepared using the polyA-mRNA. The cDNA library is tion for maintenance in E. coli and the bom site for the then screened using a previously cloned EPSP synthase conjugational transfer into the Agrobacterium Iumefaci sequence or a suitable oligonucleotide probe. Suitable ens cells. The ori-V and ori-322 segments also provide oligonucleotide probes include probes based on the homology for the recombination of the vector into the conserved region having the amino acid sequence disarmed pTiT37-CO plasmid to form a hybrid T-DNA 65 (L—G——N—A—G—T-—A) or probes based on the as described below. The next segment is the 0.36 Kb amino acid sequence of other portions of the EPSP Pvul to BclI from pTiT37 that carries the nopaline-type synthase molecule. The cDNA fragments selected by T-DNA right border. hybridization are then sequenced to con?rm that the 5,310,667 17 18 fragment encodes the EPSP synthase and to determine After two transfers, the surviving cells were trans the DNA sequence encoding and adjacent to the con ferred into fresh media containing 1.0 mM glyphosate. served amino acid sequence described above. After two transfers at 1.0 mM, the surviving cells were The EPSP synthase clone is then altered by oligonu transferred sequentially into 2.5 mM glyphosate, 5.0 cleotide mutagenesis to insert the DNA substitution mM glyphosate, and 10 mM glyphosate. necessary to result in the alanine for glycine substitution The MP4-G cells prepared as described above were in the ?rst conserved amino acid sequence and an aspar subsequently shown by a Southern blot analysis (South tic acid for glycine substitution in a second conserved ern, 1975) to have about 15—20 copies of the EPSP amino acid sequence as previously described. The synthase gene, due to a genetic process called “gene above procedure produces a cDNA sequence which amplification” (see e.g. Schimke 1982). Although spon encodes the glyphosate-tolerant EPSP synthase of the taneous mutations might have occurred during the rep present invention based on the wild-type EPSP syn lication of any cell, there is no indication that any muta thase of the selected source material. This structural tion or other modi?cation of the EPSP synthase gene coding sequence can be inserted into functional chime occurred during the gene ampli?cation process. The ric gene constructs and inserted into suitable plant trans only known difference between the MP4 and the formation vectors to be used in preparing transformed MP4-G cells is that the MP4-G cells contain multiple plant cells and regenerated plants using the methodol copies of an EPSP synthase gene and possibly other ogy described herein. genes located near it on the chromosomes of the cells. B. Puri?cation and Sequencing of EPSP Synthase Genomic EPSP Synthase Clone 20 Enzymes Generally it is preferred that the plant tissue from the Petunia cells from the MP4-G cell line were har plant species to be transformed also serve as the source vested by vacuum ?ltration, frozen under liquid N2, and material for the DNA coding sequence for the glypho ground to a powder in a Waring blender. The powder sate-tolerant EPSP synthase of the present invention. In was suspended in 0.2M Tris-HCl, pH 7.8 containing 1 this way, one would easily obtain the chloroplast transit 25 mM EDTA and 7.5% w/v polyvinylpolypyrrolidone. peptide coding sequence from the plant species to be The suspension was centrifuged at about transformed. In some cases, it may be bene?cial to ‘uti 20,000Xgravity for 10 min to remove cell debris. Nu lize a genomic clone from the plant species which com cleic acids were precipitated from the supernatant by prises the introns normally found in the endogenous addition of 0.1 volume of 1.4% protamine sulfate and EPSP synthase gene. The general method described discarded. above is also applicable with the exception that the The crude protein suspension was puri?ed by ?ve probes are used to screen a genomic DNA library con sequential steps (see Mousdale 1984 and Steinrucken structed from the selected plant tissue. Detailed exam 1985) which involved: (1) ammonium sulfate precipita ples better elucidating this preparation of cDNA and tion; (2) diethylaminoethyl cellulose ion exchange chro genomic DNA glyphosate-tolerant EPSP synthase con 35 matography; (3) hydroxyapatite chromatography; (4) structs of the present invention are provided below. hydrophobic chromatography on a phenylagarose gel; and (5) sizing on a Sephacryl 8-200 gel. PREPARATION OF EPSP SYNTHASE PLANT The puri?ed EPSP synthase polypeptide was de TRANSFORMATION VECTORS graded into a series of individual amino acids by Edman I. cDNA ENCODING THE EPSP SYNTHASE 40 degradation by a Model 470A Protein Sequencer (Ap OF PETUNIA plied Biosystems Inc., Foster City, Calif), using the Described below is the methodology employed to methods described in Hunkapiller 1983a. Each amino prepare the cDNA clone of petunia EPSP synthase acid derivative was analyzed by reverse phase high which was used in the mutagenesis procedure described performance liquid chromatography, as described by above. Clones of wild-type EPSP synthases from other 45 Hunkapiller 1983b, using a cyanopropyl column with plant sources can be obtained in a similar manner and over 22,000 theoretical plates (IBM Instruments, Wal the above described mutations introduced by site di lingford Conn). A partial amino acid sequence for petu rected mutagenesis. nia EPSP synthase is shown in Table 1. A. Creation of MP4-G Cell Line TABLE 1 The starting cell line, designated as the MP4 line, was derived from a Mitchell diploid petunia (see e.g., Ausu Petunia EPSP Synthase Sguences bel 1980). The MP4 cells were suspended in Murashige 8 9 10 ll l2 l3 and Skoog (MS) culture media, (GIBCO, Grand Island, Amino Gln Pro lle Lys Glu lle Acid: NY.) All transfers involved dispensing 10 ml of suspen mRNA 5’-CAP CCN AUU GAP CAP AUU sion cultures into 50 ml of fresh media. Cultivation strand: ‘ C C periods until the next transfer ranged from 10 to 14 A A days, and were based on visual indications that the Comple- 3’-GTQ GGN TAA TI‘Q CT Q TAA mentary G G culture was approaching saturation. DNA U U Approximately 10 ml of saturated suspension culture strand: (containing about 5 X 106 cells) were transferred into 50 60 Synthetic ml of MS media containing 0.5 mM glyphosate. The DNA sodium salt of glyphosate was used throughout the 2mg; EPSPI: 3‘-GTQ GGP TAP 'I’I‘Q CTQ TA experiments described herein. The large majority of EPSPZ: 3'~GTQ GGQ TAP TI‘Q CTQ TA cells were unable to reproduce in the presence of the EPSP3: 3'-GTQ GGN TAT 'I'TQ CTQ TA glyphosate. The cells which survived (estimated to be 65 Exact 5’-CAA CCC AUU AAA GAG AUU less than 1% of the starting population) were cultured in mRNA Sequence: 0.5 mM glyphosate and transferred to fresh media con taining glyphosate every 10 to 14 days. 5,310,667 19 20 C. Synthesis of Probes (ATA) that is rarely found in the petunia genome. Hy Using the genetic code, the amino acid sequence bridization temperature (32° C.) used in each case was indicated in Table l was used to determine the possible 10° C. below the dissociation temperature (Td) calcu DNA codons which are capable of coding for each lated for the oligonucleotide with the lowest GC con indicated amino acid. Using this information, three dif tent in a mixture. The Td of the probe was approxi ferent probe mixtures were created and designated as mated by the formula 2° C.><(A+T)+4° C.><(G+C). EPSP-1, EPSP-2, and EPSP-3, as shown in Table 1. In (e) Filter Washing this table, A, T, U, C, and G represent the nucleotide The ?lters were washed twice for 15-20 min at room bases: adenine, thymine, uracil, cytosine and guanine. temperature in 6X SSC and then for 5 min at 37“ C. with The letters P, Q, and N are variables; N represents any gentle shaking. Filters were then wrapped in plastic ?lm of the bases; P represents purines (A or G); Q represents and autoradiographed for 12-14 hrs at —70° C. with pyrimidines (U, T, or C). two intensifying screens. The ?lters were then washed All oligonucleotides were synthesized by the method again for 5 min with gentle shaking at a temperature of of Adams 1983. Whenever an indeterminate nucleotide 42° C. The ?lters were autoradiographed again for position (P, Q or N) was reached, a mixture of appropri 12-14 hrs. The autoradiographs indicated that the probe ate nucleotides was added to the reaction mixture. EPSP-1 hybridized to an RNA of approximately 1.9 kb Probes were labeled 20 pmol at a time shortly before use in the lane containing the poly-A RNA from the with 100 pCi 'y-[32PI-ATP (Amersham) and 10 units MP4-G cell line. No hybridization to this RNA was polynucleotide kinase in 50 mM Tris-HCl, pH 7.5; 10 detected in the lane containing the poly-A RNA from mM MgClg, 5 mM DTT, 0.1 mM EDTA, and 0.1 mM 20 the MP4 cell line. This result was attributed to overpro spermidine. After incubation for 1 hr. at 37° C., the duction of EPSP synthase mRNA by the MP4-G cell probes were repuri?ed on either a 20% acrylamide, 8M line. The probe EPSP-2, which differs from EPSP-l by urea gel or by passage over a 5 ml column of Sephadex a single nucleotide, showed barely detectable hybridiza G25 in 0.1M NaCl, 10 mM Tris-HCI, pH 7.5, 1 mM tion to the 1.9 kb mRNA of the MP4-G cell line but EDTA. 25 hybridized strongly to a 1.0 kb mRNA from both cell D. Preparation of mRNA and Preliminary Testing of lines. However, the 1.0 kb DNA was not sufficient to Probes encode a polypeptide of 50,000 daltons, and it is be (a) Poly-A mRNA lieved that one of the sequences in the EPSP-2 probe Total RNA was isolated from the MP4 (glyphosate hybridized to an entirely different sequence in the li sensitive) and MP4-G (glyphosate resistant) cell lines as 30 brary. These results suggested that degenerate probe described by Goldberg 1981. Total RNA was further mixture EPSP-1 contained the correct sequence for sedimented through a CsCl cushion as described by EPSP synthase. This mixture was used in all subsequent Depicker 1982. Poly-A mRNA was selected by oligo degenerate probe hybridization experiments. dT cellulose chromatography. The yield of poly-A B. Preparation of Agt 10 cDNA library RNA was 1.1 micrograms (pg) per gram of MP4 cells 35 (a) Materials Used and 2.5 pg/ gm of MP4-G cells. AMV reverse transcriptase was purchased from (b) Gel Processing of RNA Seikagaku America, Inc., St. Petersburg, Fla; the large Ten pg of poly-A RNA from the MP4 or MP4-G cell fragment of DNA polymerase I (Klenow polymerase) lines were precipitated with ethanol and resuspended in was from New England Nuclear, Boston, MA; S1 nu lXMOPS buffer (20 mM MOPS, pH 7.0, 5 mM sodium clease and tRNA were from Sigma; AcA 34 column acetate and 1 mM EDTA, pH 8.0) containing 50% bed resin was from LKB, Gaithersburg, Md.; EcoRI, formamide and 2.2M formaldehyde. RNA was dena EcoRI methylase and EcoRI linkers were from New tured by heating at 65° C. for 10 min. One-?fth volume England Biolabs, Beverly MA; RNAsin (ribonuclease of a loading buffer containing 50% glycerol, 1 mM inhibitor) was from Promega Biotech, Madison, Wis. EDTA, 0.4% bromophenol blue and 0.4% xylene cya 45 and all radioactive compounds were from Amersham, nol was then added. RNA was fractionated on a 1.3% Arlington, Hts., Ill. agarose gel containing 1.1M formaldehyde until bromo The kgtlO vector (ATCC No. 40179) and associated phenol blue was near the bottom. HaeIIl-digested E. coli cell lines were supplied by Thanh Huynh and ¢X174 DNA, labelled with 32F, was run as a size stan Ronald Davis at Stanford University Medical School dard. The DNA markers indicated approximate sizes 50 (see Huynh 1985). This vector has three important char for the RNA bands. acteristics: (1) it has a unique EcoRI insertion site, (0) Transfer of RNA to Nitrocellulose which avoids the need to remove a center portion of RNA was transferred to nitrocellulose (#BA85, DNA from the phage DNA before inserting new DNA; Schleicher & Schuell, Keene, NH.) by blotting the gels (2) DNA ranging in size from zero to about 8,000 bases overnight using 20X SSC (1X SSC is 0.15M NaCl, can be cloned using this vector; and, (3) a library can be 0.015M sodium citrate, pH 7.0) as the transfer buffer. processed using E. coli MA150 cells (ATCC No. 53104) After transfer, ?lters were air-dried and baked in a vac to remove clones which do not have DNA inserts. uum oven for 2-3 hrs at 80° C. (b) cDNA First Strand Synthesis (d) Preliminary Hybridization with Radioactive Poly-A mRNA was prepared as described in section Probes D.(a) above, and resuspended in 50 mM Tris (pH 8.5), Filters were prehybridized in 6>