United States Patent (19) (11 Patent Number: 4,971,908 Kishore et al. 45 Date of Patent: Nov. 20, 1990

54 GLYPHOSATE-TOLERANT 56 References Cited 5-ENOLPYRUVYL-3-PHOSPHOSHKMATE U.S. PATENT DOCUMENTS SYNTHASE 4,769,061 9/1988 Comai ...... 71/86 (75. Inventors: Ganesh M. Kishore, Chesterfield; Primary Examiner-Robin Teskin Dilip M. Shah, Creve Coeur, both of Assistant Examiner-S. L. Nolan Mo. Attorney, Agent, or Firm-Dennis R. Hoerner, Jr.; 73 Assignee: Monsanto Company, St. Louis, Mo. Howard C. Stanley; Thomas P. McBride (21) Appl. No.: 179,245 57 ABSTRACT Glyphosate-tolerant 5-enolpyruvyl-3-phosphosikimate 22 Filed: Apr. 22, 1988 (EPSP) synthases, DNA encoding glyhphosate-tolerant EPSP synthases, plant genes encoding the glyphosate Related U.S. Application Data tolerant enzymes, plant transformation vectors contain ing the genes, transformed plant cells and differentiated 63 Continuation-in-part of Ser. No. 54,337, May 26, 1987, transformed plants containing the plant genes are dis abandoned. closed. The glyphosate-tolerant EPSP synthases are 51) Int. Cl...... C12N 15/00; C12N 9/10; prepared by substituting an alanine residue for a glycine CO7H 21/04 residue in a conserved sequence found between posi 52 U.S. C...... 435/172.1; 435/172.3; tions 80 and 120 in the mature wild-type EPSP syn 435/193; 536/27; 935/14 thase. 58) Field of Search...... 435/172.3, 193; 935/14, 935/67, 64 15 Claims, 14 Drawing Sheets

U.S. Patent Nov. 20, 1990 Sheet 3 of 14 4,971,908 1. 50 Yeast . . .TVYPFK DIPADQQKVV IPPGSKSSN RALITAATGE GQCKIKNLLH Aspergillus . PS. IEVHP GVAHSSNVIC APPGSKSISN RALVLAALGS GCRKNIH Petunia KPS. ...EV, QPIKEISGTV KLPGSKSSN RILLIAALSE GTTVVDNS Tomato KPH. . . EV, XPIKDISGTV KLPGSKSLSN RILLIAALSE GRTVVDNLLS Arabidopsis KAS. . . EV, QPIREISGLI KPGSKSLSN RILLIAALSE GTTVVDNLLN Glycine mac KPSTSPEV, EPIKDFSGTI TPGSKSISN RILLIAALSE GTTVVDNLLY Maize . . AGAEEIV. QPIKEISGTV KLPGSKSLSN RILLIAALSE GTTVVDNLLN E. coli MES...... LTL QPIARVDGTI NLPGSKWSN RAILLAAIAH GKTVLNLLD Salmonella MES...... I.T. QPIARVDGAI NLPGSKSVSN RAILLIAAT.AC GKTALTNLLD Consensus an a we w am no me a m rw me am a munit an rve a PGSK--SN R-L-LAAT-- G- - - - - NLL 51. 100 Yeast SDDTKHMLTA WHEL. . . . . KG ATISWEDNGE TVVVEGHGGS TLSACADPLY Aspergillus SDDTEVMLNA IERT.G. . . . A ATFSWEEEGE VVVNGKGG. NLQASSSPLY Petunia SDDIHYMLGA KLGLHVEE DSANQRAVVE GCGGFPVG KESKEEIQLF Tomato SDDIHYMGA KIGHVED DNENQRAIVE GCGGQFPVG. KKSEEEIQLF Arabidopsis SDDINYMDA LKRLGLNVET DSENNRAVWE GCGGIFPAS IDSKSDIELY Glycine max SEDIHYMGA RLGRVED DKTTKQAIVE GCGGLFP.S KESKDENLF Maize SEDVHYMGA RTGSVEA DKAAKRAVVV GCGGKFPW. . EDAKEEVQLF E. coli SDDVRHMNA LTALGVSYL SADRTRCEII. GNGG. . . . . P LHAEGALELF Salmonella SODVRHMNA SAGINY SADRTRCDIT LRAPGAELF Corisensus SDD- - -M-A ------n ------T 1.01 150 Yeast GNAGTASRF LSAAVNS TSSQKYIVLT APLVDSLRAN Aspergillus GNAGASRF ITVATLANS STVDSSVLT GDLVDALTAN Petunia LGNAGAMRP ILAAVVAGG . . NSRYVD SDLVDGLKOL Tomato LGNAGTAMRP AAVVAGG . . HSRYVD GDLVDGLKQL Arabidopsis LGNAGTAMRP LTAAVTAAGG . . NARYVD GDLVVGLKQL Glycine max IGNAGAMRP LTAAVVAAGG . . NASYVD GDIVAGLKQL. Maize GNAGAMRP TAAVTAAGG . . NATYVD GDLVVGLKQL E. coli GNAGAMRP LAAA. . LCLG S. N. DVL GHLVDALRLG Salmonella GNAGAMRP IAA. . . . ALC LGON.E.IVLT GEPAMLERP GHLVDSLROG Gonsensus LGNAGA-R------as a was emo is aV G- - -M--RPI 151 200 Yeast GTKEYNNE GSLPIKVYTD SVEKGGRIE AATVSSQYVS SIMCAPYAE Aspergillus WILPLNSKGR ASLPLKIAAS GGFAGGNINL AAKVSSQRVS SLIMCAPYAK Petunia GAEVDCFLGT KCPPVRIVSK GGLPGGKVKT, SGSISSQYLT ALLMAAPI.A. Tomato GAEVDCSGT NCPPVRIVSK GGLPGGKWKL SGSISSQYLT ALLMAAPLA. Arabidopsis GADVECTGT NCPPVRVNAN GGLPGGKVKL SGSISSQYLT ALTMSAPL.A. Glycine max GADVDCFG NCPPVRVNGK GGPGGKVK. SGSVSSQYLT ALLMAAPI.A. Maize GADVDCFG DCPPVRVNGI GGPGGKVK, SGSISSQYLS ALLMAAPLA. E. coli GAKITYLEQE NYPPLR. . LQ GGETGGNVIDV DGSVSSQFLT ALTMAPLAP Salmonelia GANIDYLEQE NYPPLR. R. GGETGGDTV DGSVSSQFTT A.MTAPI.A. Consensus ...... P------GG------SSQ- - - --LM-AP-A- 2011 250 Yeast EPVTALVGG KPISKLYWOM TKMMEKFG NVETSTTEPY TYYIPKGHYI Aspergillus EPVTLRVLGG KPISQPYIDM TAMMRSFG DVQKSTTEEH TYHIPQGRYV Petunia LGOVEEID KLISVPYVEM TLK LMERFGI SVEHSSSWOR FFVRGGQKYK Tomato LGOVEIEID KLISVPYVEM TLKMERFGV 'VEHSSGWDR FLVKGGQKYK Arabidopsis LGOVEIEIVD KISVPYVEM TLK LMERFGW SVEHSDSWDR FFVKGGQKYK Glycine max LGOVEEIVD KISVPYVEM TKLMERFGW SVEHSGNWDR FLVHGGOKYK Maize LGOVEIEID KSPYVEM TLRMERFGV KAEHSDSWDR FYIKGGOKYK E. coli E. DTVIRIKG DLVSKPYIDI TLNLMKTFGV EIE.NQHYQQ FVVKGGQSYQ Salmonella PKDTIIRVKG ELVSKPYD TNLMKTFG. VEIANHHYQQ FVVKGGQQYH Consensus - - -S--Y------M.--FG tims a w - - as a - Y. FIGURE 2(a) U.S. Patent Nov. 20, 1990 Sheet 4 of 14 4,971,908

251 3OO Yeast NPSEYVIESD ASSAYPLAF AMMTGVTV PNIGFESLQG DARFARDVLK Aspergillus NPAEYVIESD ASCAYPAV AAVTGTTCTV PNIGSASLOG DARFAVEVLR Petunia SPGKAFVEGD ASSASYFLAG AAVTGGTITV EGCGTNSLQG DVKFA.EVLE Totato SPGKAVEGD ASSASYFLAG AAVTGGTVTV EGCGTSSLQG DVKFA.EVLE Arabidopsis SPGNAYVEGD ASSACYFLAG AATGETVTV EGCGTTSLQG DVKFA.EVLE Brassica SPGNAFVEGD ASSASYLAG AATGGITV NGCGTSSLQG DVKFA.EVLE Maize SPKNAYVEGD ASSAYFLAG AAITGGTVTV EGCGTTSLQG DVKFA.EVLE E. coli SPGTYLVEGD ASSASYFAA AAIKGGTVKV TGIGRNSMOG DIRFA. DVLE Salmonella SPGRYLVEGD ASSASYFAA GAIKGGTVKV TGIGRKSMQG DIRFA. DVLE Consensus -P- - - - -E-D AS-A-Y-A- -A--G---V ---G--S-QG D--FA--VL 30 350 Yeast PMGCKITOTA TSTTVSGPPV GTKPKHVD MEPMTDAFLT ACVVAASHD Aspergillus PMGCTVEQTE TSTTWTGPSD GIL.RASKR GYGTNDRCVP RCFRTGSHRP Petunia KMGAEWTWTE NSWTVKGPPR SSSGR. KHLR ADVNMNKMP DVAMAVVA Tomato KMGAEWTWE NSWVKGPPR NSSG. MKHLR AIDVNMNKMP OWAMAVVA Arabidopsis KMGCKVSWTE NSWTVTGPPR DAFG. MRHR AIDVNMNKMP DVAMAVVA Brassica KMGAKVWSE NSWTVSGPPR DFSGR. KVR GIDVNMNKMP OVAMTAVVA Maize MMGAKVWE TSVTVTGPPR SHFGR. KHK AIDVNMNKMP DVAMAVVA DAAMTIATAA E. coli KMGATICW. . a us 0 s 4 GDOY ISCR. GEN AIDMDMNHP DAAMTLATA Salmonella MGATITW. . e o O GDDF IACTR. GELH AIDMDMNHIP Consensus -MG------G------35 400 Yeast SDPNSANTTT IEGIANQRVK ECNRIAMA ELAKFGVKTT ELPDGIQVHG Aspergillus MEKSQTTPPV SSGIANQRVK ECNRIKAMKD ELAKFGVICR EHDDG. . . . . Petunia YADGP IRDVASWRVK ETERMIAICT ERKGAVE EGPD...... Totato IFADGPT. . IRDVASWRVK ETERMAICT ERKLGAVV EGSD...... Arabidopsis FADGPT. . IRDVASWRVK ETERMAIC ERKLGAVE EGSD...... Brassica ANGP. . IRDVASWRVK ETERMIAICT ERKLGATVE EGPD...... Maize IFADGP. . ROWASWRVK ETERMVART ETKLGASVE EGPD...... E. coli LFAKGT. . LRNIYNWRVK EDRAMA ERKVGAEVE EGHD...... Salmonella FAKG. . LRNIYNWRVK EDREAMAT ERKVGAEVE EGHD ...... w Consensus am as a ma up RVK. E--R--A- - - E.-K-G- - - - E--D------401 450 Yeast NSIKDKVP SDSSGPWGVC TYDDHRVAMS FSILLAGMVNS QNERDEVANP Aspergillus LEIDGIDRS NLRQPVGGVP CYDDHRWAFS FSVL...... SLVTPQP Petunia YCIITPPEK. N. . . . VDID TYDOHRMAMA FS...... AACADVP Tomato YCIITPPEKL, N. . . . VTEID TYDDHRMAMA FS...... LAACADVP Arabidopsis YCVITPPKK. . . . VKAEID YDDHRMAMA FS...... LAACADVP Brassica YCVITPPEK, N. . . .WAD TYDDHRMAMA FS...... LAACGDVP Maize YCIITPPEKL N. . . .WAD TYODHRMAMA FS...... LAACAEVP E. coli YIRITPPEKE, N. . . . FAEIA TYNDHRMAMC FS...... VALSDP Salmonella YIRTPPAKL, . . . . OHADIG TYNDHRMAMC FS...... VASDTP Consensus ------Y-OHR-A- S------a m i u or a a P 451. 478 Yeast WRIERHCTG KTWPGWWOV, HSELGA. . Aspergillus IILEKECVG KWPGWWDT, RQLFKV. . Petunia WTINDPGCTR KTFPNYFDVI, QQYSKI. Tomato VTIKNPGCTR KTFPDYFEVI, QKYSKH . Arabidopsis ITINDSGCTR KTFPDYFQVL ERITKH. . Brassica WTIKDP. CTR KTFPDYFEVI, ERKH . Maize VIRDPGCTR KTFPDYFDVI STEVKN . E. coli WTLDPKCTA KTFPDYFEQL. ARISOAA* Salmonella WTILDPKCTA KTFPDYFEQI. ARMSPA Consensus ------C-- K-P----, FIGURE 2(b) U.S. Patent Nov. 20, 1990 Sheet 5 of 14 4,971,908

SYNTHETIC MULTI-LINKER U.S. Patent Nov. 20, 1990 Sheet 6 of 14 4,971,908

CaMV 35S PROMOTER

Filed EcoRI 1. o 60 GAATTAATTCCCGATCCTATCTGTCACTTCACAAAAGGACAGTAGAAAAGGAAGGTGGC

O A 120 ACTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACA

o 18O GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAA

o O 240 CCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAC TATA O . s 3OO AATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGA 5' mRNA d 332 GGACACGCTGAAATCACCAGTCTCTCTCTACA

SYNTHETIC MULTI-LINKER BglII ClaI SmaI KpnI Sall. EcoRI AGATCTATCGATTCCCGGGTACCTCGAGAATTCCC NOS 3.

368 e 420 GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGG

O - a 48O TCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACAT 3' End mRNA O 54 O GTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT

s O e 600 TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGT HindIII TCATCTATGTTACTAGATCggggatcc.gtcgacctgcagocaagctt641 648

FIGURE 4 U.S. Patent Nov. 20, 1990 Sheet 7 of 14 4,971,908

ECOR SYNTHETIC MULTI-LINKER

RIGHT BORDER

FIGURE 5 U.S. Patent Nov. 20, 1990 Sheet 8 of 14 4,971,908 SYNTHETIC MULTI-LINKER

RIGHT BORDER

FIGURE 6

U.S. Patent Nov. 20, 1990 Sheet 11 of 14 4971,908

Pst Xma ECORV -des BglII NOS/NPTII/ SmaI NOS SpcR 35S RB T-DNA RIGHT BORDER AAC(3)-IV pMON825 NOS NOS ECORI PSt. RB RK2

Bg|II Klenow Filled

ECORI ECORI KenOW Pst multilinker filled pMON 841 HindIII PSt. (35s/AAC3-IV/NOS

ECORI ECORI BamHI PSt Xmni changed N Noss to HindIII by NOS 3' Ampf ECO RV dileti mutagenesis /AmpR AAC(3)-IV pMON843 99 VSO-pMON844 pMON849

AAC-3-IV by site directed mutagenesis ECORV BamHI

Xmn ECORI KlenOW filled Sindi y StuI (35S/AAC3-IV/NOS)

HindIII ECORI

HindIII (35S/AAC3-IV/NOS)

pMON505

ECORI RK2 Ori HindIII EcoRI

pMON845

NOS 3' OS RK2 Ori 7 SSN

SpcR 35S HindII pMON851 NOS BCI RK2 Ori FIGURE 9 RB YaNN U.S. Patent Nov. 20, 1990 Sheet 12 of 14 4,971,908 ECOR

NOS/NPTII/I N BOII LH A.SpcR s'35Y-9Y Aval 'Spc NOS 3 pMON120

NOS plMON530 BamHI

NOri RK2

RB T-DNA RIGHT Bg|II BORDER BamHI (NOS 3') (SpcR) BamHI (vectort + 35S ) ECORI Bg|II BamHI

Nos. Ampf AAC3-IV pMON849

35S M BamHI BamHI HindIII HindIII ECOR HindIII HindIII (35s/NOS 3') HindIII ECORI (Spc R) BCI (35s/AAC3-IV/NOS, RK2, pBR ori ECORI Right border)

HindIII NOS 3'

res pMON856

SpC AAC(3 RK2 35S Na Xbala Klenow ffilled

BC pMON851 Stu

s RK2 pMON857 FIGURE 10 U.S. Patent Nov. 20, 1990 Sheet 13 of 14 4,971,908

C C CS CUS St S. S. C. v . N He als5 N Ns

N N

Nmilmdo

3 3 3 S. S O U.S. Patent Nov. 20, 1990 Sheet 14 of 14 4,971,908 Glyphosate inhibition of Maize pre-EPSPS

120

-O- G-A Mutant 100 -H Wild Type

8 O

6 O

4 O

20

1 10 100 1000 Glp mM

FIGURE 12 4,971,908 1. 2 FIG. 7 shows a diagrammatic representation of the GLYPHOSATE-TOLERANT pistil and anther cDNA clones of tomato EPSP syn 5-ENOLPYRUVYL-3-PHOSPHOSHKMATE thase. SYNTHASE FIG. 8 shows a diagrammatic comparison of the genomic clones of EPSP synthase of petunia and arabi This application is a continuation-in-part of co-pend dopsis. ing application Ser. No. 054,337, filed May 26, 1987, FIG. 9 shows the steps employed in the preparation now abandoned. of plasmid pMON851. FIG. 10 shows the steps employed in the preparation BACKGROUND OF THE INVENTION 10 of plasmid pMON857. Recent advances in genetic engineering have pro FIG. 11 shows representative inhibition data for gly vided the requisite tools to transform plants to contain phosate-tolerant EPSP synthase versus wild-type EPSP foreign genes. It is now possible to produce plants synthases. which have unique characteristics of agronomic impor FIG. 12 illustrates the glyphosate tolerance of the tance. Certainly, one such advantageous trait is herbi 15 mutant maize EPSP synthase of the present invention cide tolerance. Herbicide-tolerant plants could reduce versus the wild-type maize EPSP synthase. the need for tillage to control weeds thereby effectively STATEMENT OF THE INVENTION reducing costs to the farmer. The present invention provides novel EPSP synthase One herbicide which is the subject of much investiga 20 enzymes which exhibit increased tolerance to glypho tion in this regard is N-phosphonomethylglycine. sate herbicide. The subject enzymes of this invention have an alanine for glycine substitution as described hereinafter. The present invention was enabled in part by the Ho-c-CH-N-CH--oh 25 discovery of an E. coli bacteria carrying an altered OH EPSP synthase gene. This organism was obtained in the following manner. This herbicide is a non-selective, broad spectrum, post Cells of E. coli ATCC 11303 were transferred to emergence herbicide which is registered for use in more medium A and incubated at 37 C. than fifty crops. This molecule is an acid, which dissoci 30 ates in aqueous solution to form phytotoxic anions. Several anionic forms are known. As used herein, the MEDUMA name "glyphosate' refers to the acid and its anions. 10X MOPS medium 50 Glyphosate inhibits the shikimic acid pathway which 50% glucose solution (50 g/100 ml) 2 35 100 mM aminomethyl phosphonate 10 provides a precursor for the synthesis of aromatic (sodium salt) amino acids. Specifically, glyphosate curbs the conver Thiamine (5 mg/ml) pH 7.4 l sion of phosphoenolpyruvate and 3-phosphoshikimic 100 mM glyphosate (sodium salt) 10 Deionized water to 500 acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhib 1OX MOPS medium: iting the enzyme 5-enolpyruvyl-3phosphoshikimate Per 500 m synthase. 1 MMOPS (209.3 g/1, pH 74) 200 It has been shown that glyphosate tolerant plants can 1 M Tricine (89.6 g/1, pH 7.4) 20 be produced by inserting into the genome of the plant 0.01 M FeSO4.7H2O (278.01 mg/100 ml) 1.9M NHCl (50.18 g/500 ml) 2 the capacity to produce a higher level of EPSP syn 0.276 M K2SO4 (4.81 g/100 ml) thase. 0.5 mM CaCl2.2H2O (7.35 mg/100 ml) - The present invention provides a means of enhancing 45 0.528 M MgCl2 (10.73 g/100 ml) the effectiveness of glyphosate-tolerant plants by pro 5 M NaCl (292.2 g/1) 5 0.5% L-Methionine (500 mg/100 ml) ducing mutant EPSP synthase enzymes which exhibit a micronutrients lower affinity for glyphosate while maintaining cata micronutrients in 25 ml H2O lytic activity. 50 ZnSO4 (2.88 mg/ml) 25 ul MnCl2 (1.58 mg/ml) 250 ul BRIEF DESCRIPTION OF THE DRAWINGS CuSO4 (1.6 mg/ml) 25 ul CoCl2 (7.14 mg/ml) 25 ul FIGS. 1A and 1B show the amino acid sequences for H3BO3 (2.47 mg/ml) 250 pil the EPSP synthase enzymes from E. coli 11303 and E. NH4Mo7024 (3.71 mg/ml) 25 ul coli 11303 SM-1. 55 MOPS - 3-N-morpholino-propane-sulfonic acid FIGS. 2A and 2B show the amino acid sequences for EPSP synthase enzymes from various plant, bacteria After a week, a culture was obtained which could and fungal species. grow rapidly in the presence of high concentrations of FIG. 3 shows a plasmid map for co-integrating plant glyphosate in the growth medium (10 mM or higher). transformation vector pMON316. Analysis of the EPSPsynthase activity in the extracts of FIG. 4 shows the sequence for the CaMV35S pro this culture and comparison of its glyphosate sensitivity moter, synthetic multi-linker and NOS3' transcription with that of wild-type E. coli ATCC 11303 revealed terminator/polyadenylation signal used in the vectors that the mutant organism had an altered EPSP synthase. described herein. The glyphosate sensitivity of EPSP synthase of mutant FIG. 5 shows a plasmid map for binary plant transfor 65 cells was significantly different from that of wild-type mation vector pMON505. cells. This mutant bacterium was designated E. coli. FIG. 6 shows a plasmid map for binary plant transfor 11303 SM-1. The AroA gene encoding EPSP synthase mation vector pMON530. from this mutant bacterium was isolated as follows. 4,971,908 3 4. The DNA from this bacterium was isolated by the substituting an alanine residue for the second glycine method of Marmur (1961). Southern hybridization residue in the highly conserved region having the se using E. coli K-12 aroA gene (Rogers et al., 1983) as the quence: probe established that the aroA gene in the mutant bacterium was on a 3.5 Kb BglII-HindIII fragment. 5 This fragment was cloned into the vector pKC7 (Rao, R. N. & Rogers, 1979) and the resulting plasmid was located between positions 80 and 120 in the mature used for transformation of E. coli. Transformed colonies wild-type EPSP synthase amino acid sequence. In most were screened for their ability to grow in the presence cases the above sequence will be located between posi of glyphosate (Medium A) and were shown to contain 10 tions 90 and 110 in the mature EPSP synthase. the 3.5 Kb BglII-HindIII insert by hybridization with In one embodiment, glyphosate-tolerant EPSP syn the E. coli K-12 aroA gene. This clone was designated thase coding sequences are useful in further enhancing pMON9538. the efficacy of glyphosate-tolerant transgenic plants. The nucleotide sequence for the mutant E. coli EPSP Methods for transforming plants to exhibit glyphosate synthase aroA gene was determined by the method of 15 tolerance are disclosed in European Patent Office Publi Sanger (1977) and the corresponding amino acid se cation No. 0218571 and commonly assigned U.S. patent quence for the encoded EPSP synthase deduced there application entitled "Glyphosate-Resistant Plants,” Ser. from. No. 879,814 filed July 7, 1986, now allowed, not as yet All peptide structure represented in the present speci patented the disclosures of which are specifically incor fication and claims are shown in conventional format 20 porated herein by reference. The present invention can wherein the amino group at the N-terminus appears to be utilized in this fashion by isolating the plant or other the left and the carboxyl group at the C-terminus at the EPSP synthase coding sequences and introducing the right. Likewise, amino acid nomenclature for the natu necessary change in the DNA sequence coding for rally occurring amino acids found in protein is as fol EPSP synthase to result in the aforementioned alanine lows: alanine (ala;A), asparagine (Asn;N), aspartic acid 25 for glycine substitution in the translated EPSP synthase (Asp;D), arginine (Arg;R), cysteine (Cys;C), glutamic enzyme. acid (Glu;E), glutamine (Gln;Q), glycine (Gly;G), histi In another aspect, the present invention provides a dine (His;H), isoleucine (Ile:I), leucine (Leu;L), lysine transformed plant cell and plant regenerated therefrom (lys;K), methionine (Met;M), phenylalanine (Phe;F), which contain a plant gene encoding a glyphosate-toler proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryp-30 ant EPSP synthase enzyme having the sequence: tophan (Trp;W), tyrosine (Tyr;Y) and valine (Val;V). Amino acid and nucleotide sequences for the above described mutant and the wild-type EPSP synthase enzymes of E. coli are shown in FIG. 1. The mutant E. located between positions 80 and 120 in the mature coli EPSP synthase sequence has an alanine for glycine 35 EPSP synthase amino acid sequence. In most cases the substitution at position 96. above sequence will be located between positions 90 FIG. 2 shows the amino acid sequence for EPSP and 110 in the mature EPSPsynthase. The gene further synthase from various plant, bacteria and fungal species. comprises a DNA sequence encoding a chloroplast Inspection of the sequences and alignment to maximize transit peptide attached to the N-terminus of the mature the similarity of sequence reveals a region of highly 40 EPSP synthase coding sequence, said transit peptide conserved amino acid residues (indicated by the box) in adapted to facilitate the import of the EPSP synthase the region of the E. coli EPSP synthase mutant where enzyme into the chloroplast of a plant cell. the alanine for glycine substitution occurred. Indeed, all Therefore, in yet another aspect the present invention EPSP synthase enzymes reported in the literature and also provides a plant transformation or expression vec in the present specification reveal a glycine at this posi 45 tor comprising a plant gene which encodes a glypho tion in this highly conserved region. sate-tolerant EPSP synthase enzyme having the se Specifically, the glycine residue which is substituted quence: with the alanine residue in the preparation of the gly phosate-tolerant EPSP synthases of the present inven tion occurs at position 97 in the EPSP synthase of Asper 50 gillus nidulans (Charles et al., 1986); position 101 in the located between positions 80 and 120 in the mature EPSP synthase of petunia; position 101 in the EPSP EPSP synthase amino acid sequence. synthase of tomato; position 101 in the EPSP synthase According to still another aspect of the present inven of Arabidopsis thaliana; position 104 in the EPSP syn tion, a process is provided that entails cultivating such a thase of Glycine max; position 96 in the EPSP synthase 55 plant and, in addition, propagating such plant using of E. coli K-12 (Duncan et al., 1984) and position 96 in propagules such as explants, cuttings and seeds or cross the EPSP synthase of Salmonella typhimurium (Stalker ing the plant with another to produce progeny that also et al., 1985). display resistance to glyphosate herbicide. It has been found that the alanine for glycine substitu The EPSP synthase sequences shown in FIG. 2 rep tion can be introduced into this highly conserved region 60 resent a broad evolutionary range of source materials of other wild-type EPSP synthase enzymes to yield for EPSP synthases. These data demonstrate that EPSP glyphosate-tolerant EPSP synthase enzymes. FIG. 11 synthase polypeptides from bacterial, fungal and plant shows representative inhibition data for glyphosate-tol material contain the aforementioned conserved region erant EPSP synthases of the present invention versus (-L-G-N-A-G-T-A). However, those skilled in the art wild-type EPSP synthases. 65 will recognize that a particular EPSP synthase may be Hence, in one aspect the present invention provides produced by and isolated from another source material glyphosate-tolerant EPSP synthase enzymes and a which may not have the exact sequence of the con method for producing such enzymes which comprises served region. Indeed, it has been found that an alanine 4,971,908 5 6 may be inserted for the first glycine of the conserved The mutant EPSP synthase polypeptides of the pres region of petunia EPSP synthase with no attendant ent invention may be prepared by either polypeptide changes in glyphosate sensitivity. synthesis or isolation and mutagenesis of a EPSP syn Hence, for purposes of the present invention glypho thase gene to produce the above described glyphosate sate-tolerant EPSP synthase polypeptides produced by 5 tolerant molecule. Since it is foreseen that the greatest substituting an alanine for the second glycine in a se utility of the present invention is in the preparation of quence homologous to the sequence (-L-G-N-A-G-T- glyphosate-tolerant plants, nucleotide sequences (either A-) located between positions 80 and 120 is considered cDNA or genomic) encoding the glyphosate-tolerant an equivalent of the present discovery and therefore EPSP synthase can be easily prepared in the following within the scope of the invention. O tale. The glyphosate-tolerant EPSP synthase plant gene encodes a polypeptide which contains a chloroplast cDNA Coding Sequences transit peptide (CTP), which enables the EPSP syn Total RNA is isolated from the source material thase polypeptide (or an active portion thereof) to be which includes, but is not necessarily limited to, bac transported into a chloroplast inside the plant cell. The 15 teria, fungi and plant tissue. PolyA-mRNA is selected EPSP synthase gene is transcribed into mRNA in the by oligodT cellulose chromatography. A cDNA library nucleus and the mRNA is translated into a precursor is then prepared using the polyA-mRNA. The cDNA polypeptide (CTP/mature EPSP synthase) in the cyto library is then screened using a previously cloned EPSP plasm. The precursor polypeptide (or a portion thereof) synthase sequence or a suitable oligonucleotide probe. is transported into the chloroplast. 20 Suitable oligonucleotide probes include probes based on Suitable CTP's for use in the present invention may the conserved region having the amino acid sequence be obtained from various sources. Most preferably, the (L-G-N-A-G-T-A) or probes based on the amino acid CTP is obtained from the endogenous EPSP synthase sequence of other portions of the EPSP synthase mole gene of the subject plant to be transformed. Alternately, cule. The cDNA fragments selected by hybridization one may also use a CTP from an EPSP synthase gene of 25 are then sequenced to confirm that the fragment en another plant. Although there is little homology be codes the EPSP synthase and to determine the DNA tween the CTP sequences of the EPSP synthase gene sequence encoding and adjacent to the conserved amino and the ssRUBISCO gene (see e.g., Broglie, 1983), one acid sequence described above. may find that non-homologous CTPs may function in The EPSP synthase clone is then altered by oligonu particular embodiments. Suitable CTP sequences for 30 cleotide mutagenesis to insert the DNA substitution use in the present invention can be easily determined by necessary to result in the alanine for glycine substitution assaying the chloroplast uptake of an EPSP synthase in the conserved amino acid sequence (L-G-N-A-G-T- polypeptide comprising the CTP of interest as de A). The above procedure produces a cDNA sequence scribed in Example 18 hereinafter. which encodes the glyphosate-tolerant EPSP synthase Suitable plants for the practice of the present inven 35 of the present invention based on the wildtype EPSP tion include, but are not limited to, soybean, cotton, synthase of the selected source material. This structural alfalfa, oil seed rape, flax, tomato, sugar beet, sunflower, coding sequence can be inserted into functional chime potato, tobacco, maize, wheat, rice and lettuce. ric gene constructs and inserted into suitable plant trans Promoters which are known or found to cause tran formation vectors to be used in preparing transformed scription of the EPSPsynthase gene in plant cells can be plant cells and regenerated plants using the methodol used in the present invention. Such promoters may be ogy described herein. obtained from plants or viruses and include, but are not necessarily limited to, the 35S and 19S promoters of Genomic EPSP Synthase Clone cauliflower mosaic virus and promoters isolated from Generally it is preferred that the plant tissue from the plant genes such as EPSP synthase, ssRUBISCO genes 45 plant species to be transformed also serve as the source and promoters obtained from T-DNA genes of Agrobac material for the DNA coding sequence for the glypho terium tunefaciens such as nopaline and mannopine sate-tolerant EPSP synthase of the present invention. In synthases. The particular promoter selected should be this way, one would easily obtain the chloroplast transit capable of causing sufficient expression to result in the peptide coding sequence from the plant species to be production of an effective amount of EPSP synthase 50 transformed. In some cases, it may be beneficial to uti polypeptide to render the plant cells and plants regener lize a genomic clone from the plant species which com ated therefrom substantially resistant to glyphosate. prises the introns normally found in the endogenous Those skilled in the art will recognize that the amount EPSP synthase gene. The general method described of EPSP synthase polypeptide needed to induce toler above is also applicable with the exception that the ance may vary with the type of plant. 55 The promoters used in the EPSP synthase gene of probes are used to screen a genomic DNA library con this invention may be further modified if desired to alter structed from the selected plant tissue. Detailed exam their expression characteristics. For example, the ples better elucidating this preparation of cDNA and CaMV35S promoter may be ligated to the portion of genomic DNA glyphosate-tolerant EPSP synthase con the ssRUBISCO gene which represses the expression of 60 structs of the present invention are provided below. ssRUBISCO in the absence of light, to create a pro PREPARATION OF EPSP SYNTHASE PLANT moter which is active in leaves but not in roots. The TRANSFORMATION VECTORS resulting chimeric promoter may be used as described herein. As used herein, the phrase "CaMV35S' pro I. EPSP Synthase of Petunia moter includes variations of CaMV35S promoter, e.g. 65 A. Creation of MP4-G Cell Line promoters derived by means of ligation with operator The starting cell line, designated as the MP4 line, was regions, random or controlled mutagenesis, addition or derived from a Mitchell diploid petunia (see e.g., Ausu duplication of enhancer sequences, etc. bel 1980). The MP4 cells were suspended in Murashige 4,971,908 7 8 and Skoog (MS) culture media, (GIBCO, Grand Island, TABLE 1 N.Y.) All transfers involved dispensing 10 ml of suspen PETUNIA EPSP SYNTHASE SEQUENCES sion cultures into 50 ml of fresh media. Cultivation 8 9 10 11 12 13 periods until the next transfer ranged from 10 to 14 5 Amino Gn Pro Ile Lys Glu Ile days, and were based on visual indications that the Acid: culture was approaching saturation. nRNA 5'-CAP CCN AUU GAP CAP AUU strand: Approximately 10 ml of saturated suspension culture C C (containing about 5X106 cells) were transferred into 50 A A ml of MS media containing 0.5 mM glyphosate. The Comple- 3'-GTQ GGN TAA TTQ CTQ TAA 10 mentary sodium salt of glyphosate was used throughout the DNA G experiments described herein. The large majority of strand: cells were unable to reproduce in the presence of the U U Synthetic glyphosate. The cells which survived (estimated to be DNA less than 1% of the starting population) were cultured in 15 Probes: 0.5 mM glyphosate and transferred to fresh media con EPSP1: 3'-GTQ GGP TAP TTQ CTQ TA taining glyphosate every 10 to 14 days. EPSP2: 3'-GTQ GGQ TAP TTQ CTQ TA EPSP3: 3'-GTQ GGN TAT TTQ CTQ TA After two transfers, the surviving cells were trans Exact 5'-CAA CCC AUU AAA GAG AUU ferred into fresh media containing 1.0 mM glyphosate. mRNA After two transfers at 1.0 mM, the surviving cells were 20 Sequence: transferred sequentially into 2.5 mM glyphosate, 5.0 mM glyphosate, and 10 mM glyphosate. C. Synthasis of Probes The MP4-G cells prepared as described-above were Using the genetic code, the amino acid sequence substantially shown by a Southern blot assay (Southern, 25 indicated in Table 1 was used to determine the possible 1975) to have about 15-20 copies of the EPSP synthase DNA codons which are capable of coding for each gene, due to a genetic process called "gene amplifica indicated amino acid. Using this information, three dif tion' (see e.g. Schimke 1982). Although spontaneous ferent probe mixtures were created and designated as mutations might have occurred during the replication EPSP-1, EPSP-2, and EPSP-3, as shown in Table 1. In of any cell, there is no indication that any mutation or 30 this table, A, T, U, C, and G represent the nucleotide other modification of the EPSP synthase gene occurred bases: adenine, thymine, uracil, cytosine and guanine. during the gene amplification process. The only known The letters P, Q, and N are variables; N represents any difference between the MP4 and the MP4-G cells is that of the bases; P represents purines (A or G); Q represents the MP4-G cells contain multiple copies of an EPSP pyrimidines (U, T, or C). synthase gene and possibly other genes located near it 35 All oligonucleotides were synthesized by the method of Adams 1983. Whenever an indeterminate nucleotide on the chromosomes of the cells. position (P, Q or N) was reached, a mixture of appropri B. Purification and Sequencing of EPSP Synthase ate nucleotides was added to the reaction mixture. Enzymes Probes were labeled 20 pmol at a time shortly before use Petunia cells from the MP4-G cell line were har with 100 uCi y-32P-ATP (Amersham) and 10 units vested by vacuum filtration, frozen under liquid N2, and polynucleotide kinase in 50 mM Tris-HCl, pH 7.5; 10 ground to a powder in a Waring blender. The powder mM MgCl2, 5 mM DTT, 0.1 mM EDTA, and 0.1 mM was suspended in 0.2 M Tris-HCl, pH 7.8, containing 1 spermidine. After incubation for 1 hr. at 37 C., the mM EDTA and 7.5% w/v polyvinyl-polypyrrolidone. probes were repurified on either a 20% acrylamide, 8 M The suspension was centrifuged at about 45 urea gel or by passage over a 5 ml column of Sephadex 20,000Xgravity for 10 min to remove cell debris. Nu G25 in 0.1 M NaCl, 10 mM Tris-HCl, pH 7.5, 1 mM cleic acids were precipitated from the supernatant by EDTA. addition of 0.1 volume of 1.4% protamine sulfate and D. Preparation of mRNA and Preliminary Testing of discarded. Probes The crude protein suspension was purified by five SO (a) Poly-A mRNA sequential steps (see Mousdale 1984 and Steinrucken Total RNA was isolated from the MP4 (glyphosate 1985) which involved: (1) ammonium sulfate precipita sensitive) and MP4-G (glyphosate resistant) cell lines as tion; (2) diethylaminoethyl cellulose ion exchange chro described by Goldberg 1981. Total RNA was further matography; (3) hydroxyapatite chromatography; (4) sedimented through a CsCl cushion as described by hydrophobic chromatography on a phenylagarose gel; 55 Depicker 1982. Poly-A mRNA was selected by oligodT cellulose chromatography. The yield of poly-A RNA and (5) sizing on a Sephacryl S-200 gel. was 1.1 micrograms (ug) per gram of MP4 cells and 2.5 The purified EPSP synthase polypeptide was de pug/gm of MP4-G cells. graded into a series of individual amino acids by Edman (b) Gel Processing of RNA degradation by a Model 470A Protein Sequencer (Ap Tenug of poly-ARNA from the MP4 or MP4-G cell plied Biosystems Inc., Foster City, CA), using the meth lines were precipitated with ethanol and resuspended in ods described in Hunkapiller 1983a. Each amino acid 1XMOPS buffer (20 mMMOPS, pH 7.0, 5 mM sodium derivative was analyzed by reverse phase high perfor acetate and 1 mM EDTA, ph 8.0) containing 50% form mance liquid chromatography, as described by Hun amide and 2.2M formaldehyde. RNA was denatured by kapiller 1983b, using a cyanopropyl column with over 65 heating at 65 C. for 10 min. One-fifth volume of a 22,000 theoretical plates (IBM Instruments, Walling loading buffer containing 50% glycerol, 1 mM EDTA, ford CT). A partial amino acid sequence for petunia 0.4% bromophenol blue and 0.4% xylene cyanol was EPSP synthase is shown in Table 1. then added. RNA was fractionated on a 1.3% agarose 4,971,908 9 10 gel containing 1.1 M formaldehyde until bromophenol and all radioactive compounds were from Amersham, blue was near the bottom. Hae|II-digested dX174 Arlington, Hits., IL. DNA, labelled with 32P, was run as a size standard. The The Agt10 vector (ATCC No. 40179) and associated DNA markers indicated approximate sizes for the RNA E. coli cell lines were supplied by Thanh Huynh and bands. Ronald Davis at Stanford University Medical School (c) Transfer of RNA to Nitrocellulose (see Huynh 1985). This vector has three important char RNA was transferred to nitrocellulose (#BA85, acteristics: (1) it has a unique EcoRI insertion site, Schleicher & Schuell, Keene, NH) by blotting the gels which avoids the need to remove a center portion of overnight using 20X SSC (1X SSC is 0.15 M. NaCl, DNA from the phage DNA before inserting new DNA; 0.015 M sodium citrate, pH 7.0) as the transfer buffer. O (2) DNA ranging in size from zero to about 8,000 bases After transfer, filters were air-dried and baked in a vac can be cloned using this vector; and, (3) a library can be uum oven for 2-3 hrs at 80 C. processed using E. coli MA150 cells (ATCC No. 53104) (d) Preliminary Hybridization with Radioactive to remove clones which do not have DNA inserts. Probes (b) cDNA First Strand Synthesis Filters were prehybridized in 6XSSC, 10XDen 15 Poly-A mRNA was prepared as described in section hardt's solution (1XDenhardt's solution is 0.02% ficoll, D.(a) above, and resuspended in 50 mM Tris (pH 8.5), 0.02% polyvinylpyrrollidone, 0.02% bovine serum albu 10 mM MgCl2, 4 mM DTT, 40 mM KC1,500 uM of min), 0.5% NP-40, and 200 ug/ml E. coli transfer RNA d(AGCT)TP, 10 g/ml dT12-18 primer, and 27.5 at 50 C. for 4 hrs. Hybridization was carried out in the units/ml RNAsin. In a 120 pull reaction volume, 70 units 20 reverse transcriptase were added per 5 ug of poly-A fresh solution containing 2x10 cpm/ml of either RNA. One reaction tube contained y-32P-dCTP (5 EPSP-1 or EPSP-2 probe for 48 hrs at 32° C. The uCi/120 ul reaction) to allow monitoring of cDNA size EPSP-3 probe was not tested since it contained a codon and yield and to provide a first strand label to monitor (ATA) that is rarely found in the petunia genome. Hy later reactions. In order to disrupt mRNA secondary bridization temperature (32 C.) used in each case was 25 structure, mRNA in H2O was incubated at 70 C. for 3 10 C. below the dissociation temperature (Td) calcu min and the tube was chilled on ice. Reverse transcrip lated for the oligonucleotide with the lowest GC con tase was added and the cDNA synthesis was carried out tent in a mixture. The Td of the probe was approxi at 42 C. for 60 min. The reaction was terminated by the mated by the formulate 2 C.X (A-T)--4 addition of EDTA to 50 mM. cDNA yield was moni C.X(G--C). 30 tored by TCA precipitations of samples removed at the (e) Filter Washing start of the reaction and after 60 min. Following cDNA The filters were washed twice for 15-20 min at room synthesis, the cDNA existed as a cDNA-RNA hybrid. temperature in 6XSSC and then for 5 min at 37°C. with The cDNA-RNA hybrid was denatured by heating the gentle shaking. Filters were then wrapped in plastic film mixture in a boiling water bath for 1.5 min, and cooled and autoradiographed for 12-14 hrs at -70 C. with 35 on ice. two intensifying screens. The filters were then washed (c) Second Strand DNA Synthesis again for 5 min with gentle shaking at a temperature of Single-stranded cDNA was allowed to self-prime for 42 C. The filters were autoradiographed again for second strand synthesis. Both Klenow polymerase and 12-14 hrs. The autoradiographs indicated that the probe reverse transcriptase were used to convertss cDNA to EPSP-1 hybridized to an RNA of approximately 1.9 kb 40 ds cDNA. Klenow polymerase is employed first since in the lane containing the poly-A RNA from the its 3’-5’ exonuclease repair function is believed to be MP4-G cell line. No hybridization to this RNA was able to digest non-flush DNA ends generated by self detected in the lane containing the poly-A RNA from priming and can then extend these flush ends with its the MP4 cell line. This result was attributed to overpro polymerase activity. Reverse transcriptase is used in duction of EPSP synthase mRNA by the MP4-G cell 45 addition to Klenow polymerase, because reverse tran line. The probe EPSP-2, which differs from EPSP-1 by scriptase is believed to be less likely to stop prematurely a single nucleotide, showed barely detectable hybridiza once it has bound to a template strand. The Klenow tion to the 1.9 kb mRNA of the MP4-G cell line but polymerase reaction was in a final 100 ul volume ex hybridized strongly to a 1.0 kb mRNA from both cell cluding enzyme. The reaction mix included 50 mM lines. However, the 1.0 kb DNA was not sufficient to 50 HEPES, pH 6.9, 10 mMMgCl2, 50 mMKC1,500 uMof encode a polypeptide of 50,000 daltons, and it is be each dNTP and cDNA. To begin the reaction, 20 to 40 lieved that one of the sequences in the EPSP-2 probe units of Klenow polymerase (usually less than 5 ul ) hybridized to an entirely different sequence in the li were added and the tubes incubated at 15 C. for 5 hrs. brary. These results suggested that degenerate probe The reaction was terminated by the addition of EDTA mixture EPSP-1 contained the correct sequence for 55 to 50 mM. The mix was extracted with phenol and the EPSP synthase. This mixture was used in all subsequent nucleic acids were precipitated, centrifuged and dried. degenerate probe hybridization experiments. The reverse transcriptase reaction to further extend E. Preparation of Agt 10 cDNA library the anti-complementary DNA strand was performed as (a) Materials Used described for the reaction to originally synthesize AMV reverse transcriptase was purchased from cDNA, except dT10-18 primer and RNAsin were absent, Seikagaku America, Inc., St. Petersburg, FL; the large and 32 units of reverse transcriptase were used in a 120 fragment of DNA polymerase I (Klenow polymerase) ul reaction. The reaction was terminated by the addi was from New England Nuclear, Boston, MA; S1 nu tion of EDTA to 50 mM. The mixture was extracted clease and tRNA were from Sigma; AcA 34 column with an equal volume of phenol and the nucleic acid bed resin was from LKB, Gaithersburg, MD; EcoRI, 65 was precipitated, centrifuged and dried. EcoRI methylase and EcoRI linkers were from New (d) S1 Nuclease Treatment England Biolabs, Beverly MA; RNAsin (ribonuclease 200 ul of 2XS1 buffer (1XS1 buffer is 30 mM sodium inhibitor) was from Promega Biotech, Madison, Wisc. acetate, pH 44, 250 mMNaCl, 1 mM ZnCl2), 175ul of 4,971,908 11 12 H2O and 525 units of S1 nuclease were added to the Tris, pH 7.5, 10 mM MgSO4, 200 mM NaCl were tubes containing 125 pull of the second strand synthesis added. T4 DNA ligase was heat inactivated by incuba reaction product. The tubes were incubated at 37 C. tion at 70° C. for 10 min. Forty units of EcoRI were for 30 min and the reaction was terminated by addition added and the incubation was carried out at 37 C. for of EDTA to 50 mM. The mixture was extracted with an 3 hr. The reaction was terminated by addition of EDTA equal volume of phenol/chloroform (1:1). The aqueous to 50 mM. The sample was clarified by centrifugation phase was extracted with ethyl ether to remove residual and applied to an AcA 34 column. phenol. The DNA was precipitated with ethanol and air (i) AcA 34 Column Chromatography dried. Free linkers (those not ligated to ds cDNA) were (e) EcoRI Methylation Reaction 10 removed from ds cDNA with attached linkers, to pre Since the ds cDNAs were copied from a large variety vent them from interfering with the insertion of the of mRNAs, many of the ds cDNAs probably contained desired ds cDNAs into the cloning vectors. AcA 34 internal EcoRI restriction sites. It was desired to pro resin (a mixture of acrylamide and agarose beads, nor tect such cleavage sites from EcoRI cleavage, to enable mally used for sizing) preswollen in 2 mM citrate buffer the use of blunt-ended EcoRI linkers which were subse 15 and 0.04% sodium azide in water, was added to the 1 ml quently cleaved with EcoRI to create cohesive over mark of a 1 ml plastic syringe plugged with glass wool. hangs at the termini. The column was equilibrated with 10 mM Tris-HCl pH In an effort to prevent the undesired cleavage of 7.5, 1 mM EDTA, 400 mM. NaCl. The ds cDNA mix internal EcoRI sites, the ds cDNA was methylated tures with ligated linkers and free linkers (~45ul) was using EcoRI methylase. DNA pellets were dissolved in 20 brought to 400 mM. NaCl. 1 ul of 0.5% bromophenol 40 ul of 50 mM Tris pH 7.5, 1 mM EDTA, 5 mMDTT. blue dye (BPB) was added, and the sample was applied Four ul of 100 uM S-adenosyl-L-methionine and 1 ul to the column which was run in equilibration buffer at (80 units) of EcoRI methylase were added. Tubes were room temperature. Ten 200 ul fractions were collected. incubated at 37 C. for 15 min and then at 70 C. for 10 The BPB dye normally eluted from the column in the minutes to inactivate the methylase. 25 sixth tube or later. Tubes 1 and 2 were combined and It was subsequently discovered that the methylation used as the source of ds cDNA for cloning. reaction described below was unsuccessful in prevent (j) Assembly of Agt10 clones ing EcoRI cleavage at an internal site within the EPSP The ds cDNA was mixed with 1 tug of EcoRI-cut synthase coding region, apparently because of inactive Agt10 DNA, precipitated with ethanol, and centrifuged. methylase reagent. The cleavage of the internal EcoRI 30 After washing the pellet once with 70% ethanol, the site required additional steps to isolate a full-length DNA pellet was air dried and resuspended in 4.5 ul of cDNA, as described below. To avoid those additional 10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 50 mM. NaCl. steps, the methylation reagents and reaction conditions To anneal and ligate the cDNA inserts to the left and should be used simultaneously on the cDNA and on right arms of the Agt10 DNA, the mixture was heated at control fragments of DNA, and protection of the con 35 70' C. for 3 min, then at 50 C. for 15 min. The mixture trol fragments should be confirmed by EcoRI digestion was chilled on ice and 0.5 pull each of 10 mM ATP, 0.1 before digestion is performed on the cDNA. MDTT, and sufficient T4DNA ligase to ensure at least (f) DNA Polymerase I Fill-In Reaction 90% completion were added. The reaction was incu To the tube containing 45 ul of cDNA (prepared as bated at 14 C. overnight, which allowed the insertion described above) were added 5 ul of 0.1 M MgCl2, 5 ul 40 of the ds cDNA into the EcoRI site of the Ngt10 DNA. of 0.2 mM d(ACGT)TP and 10 units of DNA polymer The resulting DNA was packaged into phage particles ase I. The tube was incubated at room temperature for vitro using the method described by Soherer 1981. 10 min. The reaction was terminated by the addition of (k) Removal of Phages Without Inserts EDTA to 25 mM. One microgram of uncut ygt10 DNA Insertion of a cDNA into the EcoRI site of Agt10 was added as a carrier and the mix was extracted with 45 results in inactivation of the C1 gene. Agt10 phages with phenol/chloroform (1:1). The nucleic acid in the mix inactivated C1 genes (i.e., with inserts) replicate nor was precipitated with ethanol, centrifuged and dried. mally in E. coli MA150 cells. By contrast, Agti0 phages (g) Ligation of EcoRI. Linkers to Methylated ds without inserts are unable to replicate in the MA150 cDNA strain of E. coli. This provides a method of removing Approximately 400 pmoles of EcoRI linkers (5'- 50 Agtl0 clones which do not have inserts. CGGAATTCCG-3) were dissolved in 9 ul of 20 mM The phages in the library were first replicated in E. Tris, pH 8.0, 10 mMMgCl2, 10 mMDTT containing 50 coli C600 (MR) cells which modified the Agt10 uCi of y-32P-ATP (5000 Ci/mmole) and 2 units of T4 DNA to protect it from the E. coli MA150 restriction polynucleotide kinase. The oligonucleotides were incu system. A relatively small number of E. coli C600 cells bated at 37 C. for 30 minutes to allow them to anneal to 55 were infected and then plated with a 20 fold excess of each other, creating double-stranded, blunt-ended link MA150 (MR) cells. The primary infection thus oc ers. 2 units of T4 polynucleotide kinase and 1 pull of 10 curred in the M-R cells where all the phages will mM ATP were added and incubated at 37 C. for an grow, but successive rounds of replication occurred in additional 30 min. The linkers were stored at -20° C. the MA150 cells which prevented the replication of The methylated DNA pellet was resuspended in tubes phages without inserts. The amplified phage library was containing 400 pmoles of the kinased linkers. Ligation collected from the plates, and after removal of agar and of the EcoRI linkers to the methylated DNA was car other contaminants by centrifugation, the recombinant ried out by adding 1 ul of T4 ligase and incubating the phages were ready to use in screening experiments. reaction mixture at 12-14 C. for 2 days. F. Screening of cDNA Library; Selection of (g) Digestion with EcoRI to Create Cohesive Ter 65 pMON9531 Approximately 600 phages (each plate) were spread To 11 ul of the reaction production from Section on 10 cm x 10 cm square plates of solid NZY agar 1.E.(g) above, 10 ml of a solution containing 50 mM (Maniatis 1982) with 0.7% agarose. A translucent lawn 4,971,908 13 14 of E. coli MA150 cells were growing on the plates. chloroform extraction was repeated. Sodium acetate Areas where the phages infected and killed the E. coli was added to the aqueous phase to a final concentration cells were indicated by clear areas called “plaques', of 0.15 M and the DNA was precipitated with ethanol. which were visible against the lawn of bacteria after an The DNA was collected by centrifugation, dissolved in overnight incubation of the plates at 37 C. Six plates 5 1XTE (10mM Tris-HCl, pH 8.0, 1 mM EDTA) and were prepared in this manner. The plaques were pressed banded in a CsCl-ethidium bromide gradient. The DNA against pre-cut nitrocellulose filters for about 30 min. was collected by puncturing the side of the tube with a This formed a symmetrical replica of the plaques. To 16 gauge needle. The ethidium bromide was extracted affix the phage DNA, the filters were treated with 0.5 with CsCl-saturated isopropanol, and the DNA was M. NaOH and 2.5 M NaCl for 5 min. The filters were 10 dialyzed extensively against 1 XTE. Approximately 400 then treated sequentially with 1.0 M Tris-HCl, pH 7.5 ug of DNA was isolated from 12 g of cells. and 0.5 M Tris-HCl, pH 7.5 containing 2.5 M NaCl to MP4-G chromosomal DNA (10 ug) was digested to neutralize the NaOH. They were then soaked in chloro completion with 30 units of BamHI in a buffer contain form to remove bacterial debris. They were then air ing 10 mM Tris, pH 7.8, 1 mM DTT, 10mMMgCl2, 50 dried and baked under a vacuum at 80 C. for 2 hours, 15 mMNaCl for 2 hours at 37 C. The DNA was extracted and allowed to cool to room temperature. The filters with phenol followed by extraction with chloroform were then hybridized with 32P-labelled EPSP-1 probe and precipitated with ethanol. The DNA fragments (2x 106 cpm/filter) as described in Section 1.D(e) were suspended in 1XTE at a concentration of 0.5 above. After 48 hr of hybridization, the filters were ug/ul. washed in 6x SSC at room temperature twice for 20 min 20 (b) Cloning of MP4-G Chromosomal DNA Frag and then at 37 C. for 5 min. These washes removed ments in AMG 14 non-specifically bound probe molecules, while probe DNA from phage AMG14 (obtained from Dr. May molecules with the exact corresponding sequence nard Olson of the Washington University School of (which was unknown at the time) remained bound to Medicine, St. Louis, MO) was prepared by the method the phage DNA on the filter. The filters were analyzed 25 described in Maniatis 1982. 150 g of DNA was di by autoradiography after the final wash. After the first gested to completion with BamHI in a buffer containing screening step, seven positively hybridizing signals ap 10mM Tris-HCl, pH 7.8, 1 mM DTT, 10 mMMgCl2, 50 peared as black spots on the autoradiograms. These mM NaCl. The completion of the digest was checked plaques were removed from the plates and replated on by electrophoresis through 0.5% agarose gel. The the fresh plates at a density of 100-200 plagues/plate. 30 phage DNA was then extracted twice with phenol These plates were screened using the procedure de chloroform-isoamyl alcohol (25:24:1) and precipitated scribed above. Four positively hybridizing phages were with ethanol. The DNA was resuspended in 1XTE at a selected. DNA was isolated from each of these four concentration of 150 pg/ml. MgClz was added to 10 clones and digested with EcoRI to determine the sizes mM and incubated at 42 C. for 1 hr to allow the cohe of the cDNA inserts. The clone containing the largest 35 sive ends of ADNA to reanneal. Annealing was checked cDNA insert, approximately 330 bp, was selected, and by agarose gel electrophoresis. designated AE3. The cDNA insert from AE3 was in After annealing, DNA was layered over a 38 ml serted into plasmid plJC9 (Vieira 1981), and the result (10-40%, w/v) sucrose gradient in a Beckman SW27 ing plasmid was designated pMON9531. ultracentrifuge tube. The gradient solutions were pre To provide confirmation that the pMON9531 clone 40 pared in a buffer containing 1 MNaCl, 20 mM Tris-HCl contained the desired EPSP synthase sequence, the (pH 8.0), 5 mM EDTA. 75 ug of DNA was loaded onto insert was removed from the pMON9531 clone by di each gradient. The samples were centrifuged at 26,000 gestion with EcoRI. This DNA fragment was then rpm for 24 hours at 15° C. in a Beckman SW 27 rotor. sequenced by the chemical degradation method of Fractions (0.5 ml) were collected from the top of the Maxam (1977). The amino acid sequence deduced from 45 centrifuge tube and analyzed for the presence of DNA the nucleotide sequence corresponded to the EPSP by gel electrophoresis. The fractions containing the synthase partial amino acid sequence shown in Table 1. annealed left and right arms of ADNA were pooled G. Creation of AF7 Genomic DNA Clone together, dialyzed against TE and ethanolprecipitated. In order to obtain the entire EPSP synthase gene, The precipitate was washed with 70% ethanol and chromosomal DNA from the MP4-G cells line was 50 dried. The DNA was dissolved in TE at a concentration digested with BamHI and cloned into a phage vector to of 500 pg/ml. create a library, which was screened using the partial The purified arms of the vector DNA and the BamHI EPSP synthase sequence from pMON9531 as a probe. fragments of MP4-G DNA were mixed at a molar ratio (a) Preparation of MP4-G Chromosomal DNA Frag of 4:1 and 2:1 and ligated using T4 DNA ligase in a ments 55 ligase buffer containing 66 mM Tris-HCl, pH 7.5,5 mM MP4-G cells were frozen and pulverized in a mortar MgCl2, 5 mM DTT and 1 mM ATP. Ligation was with crushed glass in the presence of liquid nitrogen. carried out overnight at 15 C. Ligation was checked by The powdered cells were mixed with 8 ml/g of cold agarose gel eletrophoresis. Ligated phage DNA carry lysis buffer containing 8.0M urea, 0.35M NaCl, 0.05M ing inserts of MP4-G DNA were packaged into phage Tris-HCl (pH 7.5), 0.02M EDTA, 2% sarkosyl and 5% 60 capsids in vitro using commercially available packaging phenol. The mixture was stirred with a glass rod to extracts (Promega Biotech, Madison, WI). The pack break up large clumps. An equal volume of a 3:1 mix aged phage were plated in 10 cm x 10 cm square plates ture of phenol and chloroform containing 5% isoamyl of NZY agar in 0.7% agarose at a density of approxi alcohol was added. Sodium dodecyl sulfate (SDS) was mately 6000 plaques per plate using E. coli C600 cells. added to a final concentration of 0.5%. The mixture was 65 After overnight incubation at 37 C., the plaques had swirled on a rotating platform for 10-15 minutes at formed, and the plates were removed from the incuba room temperature. The phases were separated by cen tor and chilled at 4 C. for at least an hour. The agar trifugation at 6,000Xg for 15 minutes. The phenol/- plates were pressed against nitrocellulose filters for 30 4,971,908 15 16 minutes to transfer phages to the filters, and the phage cleaved with BamHI, treated with Klenow fragment of DNA was affixed to the filters as described previously. DNA polymerase I and then cleaved with EcoRI. The Each filter was hybridized for 40 hours at 42° C. with promoter fragment was then excised from pBR322 with approximately 1.0x 106 cpm/filter of the 330 bp cDNA BamHI and EcoRI, treated with Klenow polymerase insert isolated from the pMON9531 clone, which had and inserted into the SmaI site of M13mp8 so that the been nick-translated, using the procedure described in EcoRI site of the mp3 multi-linker was at the 5' end of Maniatis (1982). The specific activity of the probe was the promoter fragment. The nucleotide numbers refer 2-3X 108 cpm/ug of DNA. Hybridization was carried to the sequence of CM1841 (Gardner et al., 1981). Site out in a solution containing 50% formamide, 5x SSC, 5x directed mutagenesis was then used to introduce a G at Denhardt's solution, 200 g/ml tRNA and 0.1% SDS. 10 nucleotide 7464 to create a BglII site. The CaMV35S Filters were washed in 1XSSC, 0.2% SDS at 50 C. and promoter fragment was then excised from the M13 as a autoradiographed. Several positive signals were ob 330 bp EcoRI-BglI fragment which contains the served, and matched with plaques on the corresponding CaMV35S promoter, transcription initiation site and 30 plate. The selected plaques were lifts, suspended in SM nucleotides of the 5' non-translated leader but does not buffer, and plated with NZY agar. The replica plate 15 contain any of the CaMV translational initiators nor the screening process was repeated at lower densities until CaMV35S transcript polyadenylation signal that is lo all the plaques on the plates showed positive signals. cated 180 nucleotides downstream from the start of One isolate was selected for further analysis and was transcription (Covey et al., 1981; Guilley et al., 1982). designated as the AF7 phage clone. The CaMV35S promoter fragment was joined to a H. Preparation of pMON9543 and pMON9556 20 synthetic multi-linker and the NOS 3' non-translated The DNA from AF7 was digested (separately) with region and inserted into pMON200 (Fraley et al., 1985; BamHI, Bgll, EcoRI, and HindIII. The DNA was Rogers et al., 1986) to give pMON316, see FIG. 3. hybridized with a nick-translated EPSP synthase se Plasmid pMON316 contains unique cleavage sites for quence from pMON9531 in a Southern blot procedure. BglII, Clai, KpnI, XhoI and EcoRI located between This indicated that the complementary sequence from 25 AF7 was on a 4.8 kb BglII fragment. This fragment was the 5' leader and the NOS polyadenylation signals. inserted into plasmid puC9 (Vieira 1982), replicated, Plasmid pMON316 retains all of the properties of nick-translated, and used to probe the petunia cDNA pMON200. The complete sequence of the CaMV35S library, using hybridization conditions as described in promoter, multi-linker and NOS 3' segment is given in Section 1.(G), using 106 cpm per filter. A cDNA clone 30 FIG. 4. This sequence begins with the Xmn site cre with a sequence that bound to the AF7 sequence was ated by Klenow polymerase treatment to remove the identified, and designated as pMON9543. EcoRI site located at the 5' end of the CaMV35S pro DNA sequence analysis (Maxam 1977) indicated that moter segment. pMON9543 did not contain the stop codon or the 3' Plasmid pMON530 (see FIG. 6) is a derivative of non-translated region of the EPSP synthase gene. 35 pMON505 prepared by transferring the 2.3 kb StuI Therefore, the EPSP synthase sequence was removed HindIII fragment of pMON316 into pMON526. Plas from pMON9543, nick-translated, and used as a probe mid pMON526 is a simple derivative of pMON505 in to screen the cDNA library again. A clone which hy which the SmaI site is removed by digestion with Xmal, bridized with the EPSP synthase sequence was identi treatment with Klenow polymerase and ligation. Plas fied and designated as pMON9556. DNA sequence mid pMON530 retains all the properties of pMON505 analysis indicated that the insert in this clone contained and the CaMV35S-NOS expression cassette and now the entire 3' region of the EPSP synthase gene, includ contains a unique cleavage site for SmaI between the ing a polyadenylated tail. The 5' EcoRI end of this promoter and polyadenylation signal. insert matched the 3' EcoRI end of the EPSP synthase Binary vector pMON505 is a derivative of pMON200 insert in pMON9531. An entire EPSP synthase coding 45 in which the Ti plasmid homology region, L1H, has sequence was created by ligating the EPSP synthase been replaced with a 3.8 kb HindIII to Small segment of inserts from pMON9531 and pMON9556. the mini RK2 plasmid, pTJS75 (Schmidhauser & Helin I. Preparation of pMON546 Vector with CaMV35 ski, 1985). This segment contains the RK2 origin of S/EPSP Synthase Gene replication, oriV, and the origin of transfer, oriT, for The EPSP synthase insert in pMON9531 was modi 50 conjugation into using the tri-parental mating proce fied by site-directed mutagenesis (Zoller et al., 1983) dure (Horsch Klee, 1986). using an M13 vector (Messing 1981 and 1982) to create Referring to FIG. 5, plasmid pMON505 retains all a BglI site in the 5' non-translated region of the EPSP the important features of pMON200 including the syn synthase gene. The modified EPSP synthase sequence thetic multi-linker for insertion of desired DNA frag was isolated by EcoRI and BglII digestion, and inserted 55 ments, the chimeric NOS-NPTII'NOS gene for kana into vector, pMON530, a binary vector for Agrobac mycin resistance determinant for selection of E. coli and terium-based plant transformation to obtain pMON536. A. tumefaciens, an intact nopaline synthase gene for The 1.62 kb EcoRI-EcoRI fragment from pMON9556 facile scoring of transformants and inheritance in prog was then inserted into pMON536 to obtain pMON546. eny and a pBR322 origin of replication for ease in mak Since pMON530 already contained a 35S promoter ing large amounts of the vector in E. coli. Plasmid from a cauliflower mosaic virus (CaMV) next to the pMON505 contains a single T-DNA border derived BglII site, this created a chimeric CaMV35S/EPSP from the right end of the pTiT37 nopaline-type T synthase gene in pMON546. DNA. Southern analyses have shown that plasmid pMON530, a derivative of pMON505 carrying the pMON505 and any DNA that it carries are integrated 35S-NOS cassette, was prepared in the following man 65 into the plant genome, that is, the entire plasmid is the ner: The CaMV35S promoter was isolated from the T-DNA that is inserted into the plant genome. One end pOS-1 clone of CM4-184 as an AluI (n 7143)-EcoRI" (n of the integrated DNA is located between the right 7517) fragment which was inserted first into pBR322 border sequence and the nopaline synthase gene and the 4,971,908 17 18 other end is between the border sequence and the CaMV 35S promoter fused to the wild-type-petunia pBR322 sequences. EPSP synthase gene. Plasmid pMON546 contained (1) the CaMV35 Four individual representative transgenic seedlings S/EPSP synthase gene; (2) a selectable marker gene for were selected, grown and tested in the testing proce kanamycin resistance (Kan.); (3) a nopaline synthase 5 dure described below, along with four individual non (NOS) gene as a scorable marker; and (4) a right transformed (wild-type) petunia seedlings. T-DNA border, which effectively caused the entire The plants were grown in a growth medium in a plasmid to be treated as a "transfer DNA” (T-DNA) growth chamber at 26 C. with 12 hours of light per region by A. tunefaciens cells. day. The plants were fertilized weekly with a soluble This plasmid was inserted into A. tumefaciens cells O fertilizer and watered as needed. The plants were which contained a helper plasmid, pGV3111-SE. The sprayed at a uniform and reproducible delivery rate of helper plasmid encodes certain enzymes which are nec herbicide by use of an automated track sprayer. The essary to cause DNA from pMON546 to be inserted glyphosate solution used was measured as pounds of into plant cell chromosomes. It also contains a kanamy glyphosate acid equivalents per acre, mixed as the gly cin resistance gene which functions in bacteria. 15 phosate isopropylamine salt, with an ionic surfactant. A culture of A. tumefaciens containing pMON546 and Four individual wild-type (non-transformed) petunia pGV3111-SE was deposited with the American Type plants were selected for use as control plants. Four Culture Collection (ATCC) and was assigned ATCC individual transformed plants containing the pMON546 accession number 53213. If desired, either one of these vector were selected by kanamycin resistance as de plasmids may be isolated from this culture of cells using 20 scribed in Horsch et al (1985). standard methodology. For example, these cells may be The control plants and the transformed plants were cultured with E. coli cells which contain a mobilization sprayed with the isopropylamine salt of glyphosate at plasmid, such as prK2013 (Ditta 1980). Cells which the application level listed in Table 2 below; the experi become Spc/Str, Kans will contain pMON546, while mental results obtained are also summarized in Table 2. cells which become Kan, Spc/Strs will contain 25 pGV3111-SE. TABLE 2 GLYPHOSATE-TOLERANT PETUNA PLANTS Plant Response to Glyphosate Spraying Leaf disks with diameters of 6 mm ( inch) were Plant Type Glyphosate Dose" Visual Appearance taken from surface-sterilized petunia leaves. They were 30 Control completely dead, cultivated on MS104 agar medium for 2 days to pro plants showed very rapid chlorosis and mote partial cell wall formation at the wound surfaces. bleaching, wilted They were then submerged in a culture of A. tumefaci and died ens cells containing both pMON546 and GV3111-SE Chimeric EPSP 0.8 if/acre growing well, which had been grown overnight in Luria broth at 28 35 synthase slight chlorosis in new leaves which C., and shaken gently. The cells were removed from the are growing with bacterial suspension, blotted dry, and incubated upside normal morphology, down on filter paper placed over "nurse' cultures of plants appear tobacco cells, as described in Horsch (1980). After 2 or healthy and 3 days, the disks were transferred to petri dishes con 40 started to flower taining MS media with 500 g/ml carbenicillin and 0. "Acid Equivalent 0.1, 0.25, or 0.5 mM glyphosate (sodium salt), with no wild-type plant or transformed with control vector (pMON505) nurse cultures. Control tissue was created using A. tumefaciens cells As indicated in Table 2, the control plants were killed containing the helper plasmid pCV3111-SE and a dif 45 when sprayed with 0.8 pounds/acre of glyphosate. In ferent plant transformation vector, pMON505, which contrast, the petunia plants which were transformed contained a T-DNA region with a NOS/NPTII/NOS were healthy and viable after spraying with 0.8 pound kanamycin resistance gene and a NOS selectable s/acre. The transformed plants are more resistant to marker gene identical to pMON546, but without the glyphosate exposure than the non-transformed control CaMV35S/EPSP synthase gene. 50 plants. Within 10 days after transfer to the media containing Glyphosate-Tolerant Petunia EPSP Synthase glyphosate, actively growing callus tissue appeared on A plant transformation vector carrying a glyphosate the periphery of all disks on the control plate containing tolerant petunia EPSP synthase mutant was prepared in no glyphosate. On media containing 0.1 mM glypho the following manner. sate, there was little detectable difference between the 55 Plasmid pMON342 carries the “mature' wildtype control disks and the transformed tissue. At 0.25 mM petunia EPSP synthase coding sequence (without chlo glyphosate, there was very little growth of callus from roplast transmit peptide) expressed from the double control disks, while substantial growth of transformed phage lambda pl. promoter. This plasmid is derived tissue occurred. At 0.5 mM glyphosate, there was no from pMON9544 and pMON9556. callus growth from the control disks, while a significant In order to introduce a unique Nco site and ATG number of calligrew from the transformed disks. This translational initiation signal in the wildtype petunia confirms that the CaMV35S/EPSP synthase gene con EPSP synthase cDNA just outside the coding sequence ferred glyphosate resistance upon the transformed cells. for the mature protein and at the same time remove the Transformed petunia plants were produced by regen chloroplast transit peptide coding sequence, M8017 (the eration from the above-described transformed leaf disks 65 M13mp9 clone of the 300 bp EcoRI cDNA fragment) by the procedure described in Horsch et al (1985). The was subjected to site directed mutagenesis using the transformed plants obtained contained the pMON546 procedure of Zoller and Smith (1983) and the following vector, described hereinabove, which contains the mutagenesis primer: 4,971,908 19 20 had been cleaved with EcoRI to release a 1.4 kb frag S-ATCTCAGAAGGCTCCATGGTGCT ment encoding the 3' portion of the petunia EPSP syn GTAGCCA-3' thase coding sequence. Following ligation and transfor mation, a clone was identified that could complement A mutant phage clone was isolated that contained a 5 an E. coli aroA mutation and carried the 1.4 kb fragment Nicol site. The presence of the above-described muta of pMON9556. This plasmid was designated pMON342. tion was confirmed by sequence analysis. This M13mp9 The EcoRI site at the 3' end of the EPSP synthase in clone was designated M8019. pMON342 was replaced with a Clal site to facilitate Plasmid pMON6001 is a derivative of pBR327 (So construction. This was accomplished by partial diges beron et al., 1980) carrying the E. coli K12 EPSP syn 10 tion with EcoRI followed by digestion with mungbean thase coding sequence expressed from two tandem cop nuclease to make the ends blunt. Cla linkers (5'-CATC ies of a synthetic phage lambda pl. promoter. Plasmid GATG-3', New England Biolabs) were added to the pMON6001 was constructed in the following manner. bluntends by ligation with T4DNA ligase. The mixture First, pMON4 (Rogers et al., 1983) was digested with was digested with ClaI to produce sticky ends, and the Clal and the 2.5 kb fragment was inserted into a pBR327 15 5 kb EcoRI partial digest was isolated from an agarose that has also been cleaved with Cla. The resulting gel and ligated with T4 DNA ligase. This plasmid was plasmid, pMON8, contains the EPSP synthase coding designated pMON9563. sequence reading in the same direction as the beta-lacta A 29-nucleotide mutagenic deoxyoligonucleotide mase gene of pBR327. having the following sequence: To construct pMON25, a derivative of pMON8 with 20 unique restriction endonuclease sites located adjacent to 5'-GCCGCATTGCTGTAGCTGCATT the E. coli EPSP synthase coding sequence, the follow CCAAGG-3' ing steps were taken. A deletion derivative of pMON4 was made by cleavage with BstEII and religation. The was synthesized for introducing the alanine for glycine resultant plasmid pMON7 lacks the 2 kb BstEII frag substitution at position 101 using an automated DNA ment of pMON4. Next, a 150 bp HinfI to NdeIfragment 25 synthesizer (Applied Biosystems, Inc.). The deox which encodes the 5' end of the EPSP synthase open yoligonucleotide was purified by preparative polyacryl reading frame was isolated after digestion of pMON7 amide gel electrophoresis. with Nde and HinfI and electroelution following elec The 770 bp EcoRI-HindIII fragment of pMON9563 trophoretic separation on an acrylamide gel. This piece was subcloned into a EcoRI-HindIII digested was added to the purified 4.5 kb BamHI-Nde fragment 30 M13mp10 bacteriophage vector (New England Bi of pMON8 which contains the 3' portion of the EPSP olabs). The single-stranded template DNA was pre synthase coding sequence and a synthetic linker with pared from the subclone as described in the M13 clon the sequence: ing and sequencing handbook by Amersham, Inc. (Ar lington Heights, IL.). 35 Oligonucleotide mutagenesis reactions were per 5'-GATCCAGATCTGTTGTAAGGAGTCTAGACCATGG-3' formed as described by Zoller and Smith (1983). Single 3'-GTCTAGACAACATTCCTCAGATCTGGTACCTTA-5' stranded M13mpl0 template DNA (0.5 picamoles, The resulting plasmid pMON25 contains the EPSP pmole) containing the 770 bp EcoRI-HindIII fragment synthase coding sequence preceded by unique BamHI 40 of the pMON9563 clone was mixed with 20 pmole of and Bgll sites, a synthetic ribosome binding site, and the above-described 29-mer deoxyoligonucleotide and 1 unique Xbal and Nco sites the latter of which contains ul of 10xbuffer DTT, pH 7.5) in a total volume of 10 the ATG translational initiator signal of the coding ul. This mixture was heated at 70° C. for 5 minutes, sequence. placed at room temperature (23 C.) for 20 minutes and To construct pMON6001, pMON25 was digested 45 then placed on ice for 20 minutes. During the annealing with BamHI and mixed with a synthetic DNA fragment reaction, the enzyme/nucleotide solution was prepared containing a partial phage lambda p sequence (Adams by addition of the following components: 1 ul of and Galluppi, 1986) containing BamHI sticky ends: 10xbuffer B (0.2M Tris-HCl, 0.1M MgCl2, 0.1M DTT, 5'-GATCCTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCG-3' 3'-GATAGAGACCGCCACAACTGTATTTATGGTGACCGCCACTATGACTCGTGTAGCCTAG-5 The resulting plasmid pMON6001 carries two copies of pH 7.5), 1 ul each of 10 mM dNTPs, 1 pil of 10 mM the synthetic phage lambda pl. promoter fragments as rATP, 3 units of T4 DNA ligase, 2 units of the large direct repeats in the site of pMON25 in the correct 55 fragment of DNA polymerase I and H2O to a total orientation to promote transcription of the EPSP syn volume of 10 Jul. This solution was kept on ice until thase coding sequence. used. Plasmid pMON6001 was cleaved with Nico and After 20 minutes incubation on ice, 10 ul of the en EcoRI and the 3 kb fragment isolated from an agarose zyme/nucleotide solution was added to the annealed gel. This fragment was mixed with the small 100 bp 60 DNA, mixed and maintained at 15° C. overnight. Three Nco-EcoRI fragment purified from M8019. Following units of T4 DNA ligase were added again to ensure ligation and transformation a clone was identified that completion of the extension reaction to yield closed contained the small 100 bp NcoI-EcoRI fragment cor circular DNA molecules. This construct was desig responding to the 5' end of the "mature' EPSP synthase nated M9551. The 770 bp EcoRI-HindIII fragment of of petunia. This construct was designated pMON9544. 65 M9551 was inserted into pMON9563 between the Plasmid pMON9544 was digested with EcoRI and EcoRI and HindIII sites, replacing the corresponding treated with alkaline phosphatase. The EcoRI fragment wildtype fragment. This plasmid was designated of pMON9544 was mixed with pMON9556 DNA that pMON9566. 4,971,908 21 22 Plasmid pMON530 DNA was digested with BglII -continued and Clai, to which was added the 330 bp BglII-EcoRI EPSP synthase 3' fragment from pMON536 and puri Vol. Substance Final ConcAmount fied 1.4 kb EcoRI-Cla. EPSPsynthase 5' fragment from buffer 10 ul 5 mM dNTP 500 uM each pMON9566 and then treated with T4DNA ligase. Fol 5 A.C.G.T. lowing transformation a plasmid was isolated that car 10 ul 100 pg/ml oligo d(pT) 1 pig ried the intact mutant EPSP synthase coding sequence 2 ul RNAsin (30 U/ul) 60 U3 of petunia (with the coding sequence for the chloroplast 2 ul RNA ~ 1.5 pig transmit peptide) adjacent to the CaMV35S promoter. 3 ul. Reverse Transcriptase 40 units 10 2 ul 32P-dATP 200 Ci/mMole This plasmid was designated pMON567. Plasmid Sigma Chemical, St. Louis, MO. pMON567 was inserted into A. tumefaciens cells that collaborative Research, Lexington, MA. contained helper plasmid pGV3111-SE. Promega Biotech, Madison, WI. Life Sciences, St. Petersburg, FL. A culture of A. tumefaciens cells containing Amersham, Arlington Heights, IL. pMON567/pGV3111-SE was contacted with leaf disks The reaction mixture was incubated at 42 C. for 60 min. The reaction mixture was taken from tobacco plants (Nicotiana tobacam CV 15 frozen on dry ice and stored at -20." C. H425) as described by Horsch (1985). The Agrobacte rium cells inserted the mutant EPSP synthase gene into The quantity of cDNA synthesized was determined the chromosomes of the plant cells. Plant cells resistant to be ~1.31 pug by precipitation of a portion of the to kanamycin were selected and regenerated into differ reaction with trichloroacetic acid and scintillation entiated plants by the procedure of Horsch (1985). 20 counting. Progeny of these plants were propagated and grown Purification of First Strand to a rosette diameter of about 10 cm corresponding to a Biogel P60 (100-200 mesh, Bio Rad, Richmond, CA), plant age of about four weeks. The plants were sprayed pre-swollen in 10 mM Tris-HC1/1 mM EDTA, pH 8.0, with glyphosate at levels corresponding to 2.0 and 3.6 (TE) was used to pour a column in a siliconed pasteur pounds acid equiv./acre. The effect of glyphosate on 25 pipet plugged with siliconized glass wool (bed volu the transformed plants was scored at 7 and 14 days. The me=1 ml). The column was washed with several vol effect was translated to a numerical scale of 0-10 in umes of 1 mM Tris pH 7.6/ 0.01 mM EDTA. The col which 0 represents total kill and 10 is the normal, un umn was calibrated by running 90 pil of this same solu sprayed plant. The data below demonstrates that to tion plus 10 ul of column marker buffer (see below) bacco plants transformed with the glyphosate-tolerant 30 over the column. The void volume was determined by EPSP synthase gene of petunia exhibit substantial toler the fraction containing the blue dye. More buffer was added to the column to elute the red dye. ance even to these high levels of glyphosate. The values The first strand reaction was extracted twice with an represent the best transformant for both wild-type equal volume of phenol. 0.5 ul 2% bromophenol blue EPSP synthase and glyphosate-tolerant EPSP synthase 3 5 was added to the cDNA and it was loaded on the col genes. umn, and the void volume was collected. TABLE 3 Column Marker Buffer: Relative Effect of Glyphosatel 5% Blue Dextrans (2 M dalton, Sigma) pounds/Acre 0.05% Phenol Red (or Bromophenol blue at 0.1%) 0.4 2.0 3.6 40 dissolved in 20 mM Tris pH 7–8/ 1 mM EDT Day GT2 WT3 GT WT GT WT Second Strand Synthesis and Methylation 7 8.0 6.0 8.0 5.0 5.0 5.0 The first strand was dried to ca. 10 pull in a Savant 14 8.0 7.0 8.3 1.8 7.4 1.7 speed vacuum. 28 9.0 9.0 7.0 0.8 7.0 0.8 0 represents total kill and 10 represents no effect. 45 glyphosate-tolerant petunia EPSP synthase. Vol. Substance First Conc./Amount wild-type EPSP synthase. 3.8 ul cDNA -500 mg of first strand 10 ul 10X Sec. Strand Buffer 1X II. EPSP SYNTHASE OF TOMATO 0.8 ul 5 nM dNTP 40 LM each 50 81.5 ul Water to 100 ul final Complementary DNA (cDNA) libraries were pre volume pared from poly-A plus RNA isolated from mature 2 ul DNA Pol I (NEB) 20 U tomato pistils or anthers by a modification of the meth 0.4 ul E. coli DNA ligase 2U ods of Huynh et al. (1985) and Gubler et al. (1983) as (NEB) follows: 0.5 RNA 1 U 55 ul ase H First Strand Synthesis (BRL) Quantities given below are those used to prepare the 3 ul 32PdCTP 30 uCi mature pistill cDNA library, the anther cDNA library l ul BSA (1:10 dil of BRL) 50 g/ml was prepared in a similar manner. NEB = New England Biolabs, Beverly, MA 10 pil of 400 ug/ml Actinomycin D (Sigma Chemical) BRL = Bethesda Research Labs, Gaithersberg, MD in 50% ethanol was dried down in each reaction tube in a Savant speed vacuum. The following reagents were The reaction was incubated at 14 C. for 60 min. then at added to this tube (the reagents were added in the order room temperature for 60 min. given): The following was added: 0.5ul 5mM dNTP 65 1 ul T4 DNA polymerase (NEB) Vol. Substance Final ConcAmount The reaction was incubated for 30 min. at room temper 62 ul Autoclaved water to final 100 ul ature. 10 ul 10X first strand see below The following were added: 4,971,908 23 24 The reaction was heated to 68 C. for 10 min. to inactivate ligase. 1.2 ul mM S-adenosyl 12 u.M L-methionine (Sigma) The following reagent was added: 1.0 ul EcoRI Methylase (NEB) 20 U 2 ul EcoRI (40 units, NEB) 2.4 pul 0.5 M EDTA 12 mM The reaction wa incubated at 37 C. for 2.5 hr. The reaction was heated to 68 C. for 10 min. to inactivate EcoRI. 5 ul was removed from the reaction and added to 260 Size Cut cDNA and Separate From Linkers ng wild type lambda DNA (NEB) as control for meth 5 pull of loading buffer was added to the digested ylation. O cDNA/EcoRI linker reaction. The sample was electro The reactions were incubated at 37 C. for 45 min. phoresed on a 0.8% Sea Plaque agarose (FMC Corp., Both the main and test reactions were heated to 68 Rockland, MD)/TEA (40 mM Tris-Acetate pH 8.2/1.6 C. for 10 min. to inactivate enzymes. mM EDTA) minigel containing 0.3 g/ml ethidium Measurements of trichloroacetic acid insoluble bromide. The gel was run at 4 V/cm until the bromo counts indicated that ~500 ng of ds cDNA (double 15 phenol blue dye had migrated 4 cm. Lambda DNA stranded cDNA) was produced in the reaction. digested with HindIII and EcoRI was used as a size marker. The markers were visualized by UV fluores cence, and a fragment of gel containing cDNA ranging 10X Second Strand Buffer: in size from ~ 600 bp to greater than 10 kb was re 200 mM Tris-HCl pH 7.4-7.5 1 M stock 50 mM MgCl2 1 M stock 20 moved. 1.0 M KC 4M stock Loading Buffer: 100 mM Ammonium sulfate 1 M stock 250 mM EDTA pH 7 1.5 mM Beta-NAD 150 mM stock 0.2% Bromophenol blue 50% Glycerol Assay for Completeness of Methylation 25 Purification, Ligation and Packaging The following was added to the heat treated test The volume of the gel slice was determined to be methylation: ~500 ul by weighing and assuming a density of 1.0 2 ul 100 mM Tris-HCl pH 7.6/100 mM MgCl2/1.0 M g/ml. 140 pil of 20 mM Tris-HCl (pH 7.5)/200 mM NaCl NaCl/1.0 mM EDTA, and 20 ul of 5 M NaCl were 12 Jul water 30 added to the gel fragment. The mixture was heated to 1 pul EcoRI (20 units BRL) 68 C. for 15 min. and extracted twice with 500 ul of 0.5ul puC19 (0.5 pig, NEB) phenol. The DNA was purified from contaminants by The reaction was incubated for 1 hr. at 37 C. chromatography on an EluTip D column (Schleicher & The products were run on an agarose minigel with Schuell, Keen, NH) according to the manufacturers 35 instructions. The final volume was 450 ul. The amount undigested puC19, and lambda digested with EcoRI of radioactivity in the sample was determined by scintil and HindIII as size markers. The pljC19 in the reaction lation counting of an aliquot, and it was determined that digested to completion indicating that the EcoRI was 70 ng of cDNA was contained in the eluted volume. working efficiently, the lambda DNA was completely 2 ul (2 ug) lambda gt 10 arms (Vector Cloning Sys undigested showing that it had been protected by the 40 tems, San Diego, CA) were added to the cDNA fol methylation reaction. This shows that the methylase lowed by the addition of 2 volumes of cold ethanol. The was effective in blocking the EcoRI sites in the cDNA sample was chilled to -80 C. for 15 min. and the pre from digestion. cipitate was pelleted in a microfuge for 15 min. The tube ds cDNA Clean Up was drained and rinsed with 200 ul of -20° C. 70% The second strand reaction mixture was extracted 45 ethanol with caution so as not to disturb the pellet. The twice with an equal volume of phenol, run over a P-60 pellet was air dried for 30 min. column as described above and the void volume was The following was added: collected and lyophilized in a Savant speed vacuum. 7.2 ul Water The cDNA was dissolved in 3 Jul 1 mM Tris-HCl pH 1 Jul 10 X Ligation buffer 7.5/0.01 mM EDTA. 50 1 ul ATP Ligation of Linkers to cDNA 0.8 ul T4 DNA ligase The following was mixed in a microfuge tube: The reaction was incubated for 20 hrs at 14 C. 3ulds cDNA (500 ng) 10 x Ligation Buffer 2.5ul Phosphorylated EcoRI linkers (NEB, 250 ng) 200 mM Tris-HCl pH 7.6 1 ul 10X Ligation buffer 55 100 mM MgCl2 1 u1 10 mM ATP 50 mM Dithiothreitol (DTT) 1.5 ul water (for final vol of 10 ul) One fourth (2.5ul) of the ligation reaction was pack 1 ul T4 DNA Ligase (~400 units NEB) aged in vitro into phage using Gigapack packaging The reaction was incubated at 14 C. for 12 hr. extracts (Stratagene Cloning Systems, San Diego, CA) 10X Ligation Buffer according to the manufacturers instructions. Subse 300 mM Tris-HCl pH 7.6 quent plating of the phage showed that this reaction 100 mM MgCl2 contained 106 recombinant plaque forming units (PFU). 50 mM DTT Packaging of the entire ligation mix would therefore Removal of Linkers produce 4x106 PFU. The remainder of the ligation mix The following reagents were added: was stored at -20' C. for future use. 2 ul 100 mM Tris-HCl pH 7.6/100 mM MgCl2/1.0M Plaque lifts from the two libraries were screened with NaCl a 32P-labeled fragment from pMON6145 containing the 6 ul water complete coding sequence of petunia EPSP synthase. 4,971,908 25 26 pMON6145 is a derivative of plasmid pCEM2 wild-type EPSP synthase coding sequence in phage (Promega Biotech, Madison, WI) described in the M9568 was mutagenized with the oligonucleotide above-referenced and incorporated application S.N. 879,814, which carries a full-length cDNA clone of 5'-GCCGCATTGCTGTAGCTGCATTT petunia EPSP synthase. Two hybridizing plaque were 5 CCAAGG-3' isolated from each library. Maps of the inserts of these phages are shown in FIG. 7. The large EcoRI frag by the method of Zoller and Smith (1983) as described ments of the two pistill clones (P1 and P2) were sub previously. The phage was then mutagenized with the cloned into pljC19 (New England Biolabs), and the oligonucleotide small EcoRI fragments were cloned into puC119 form 10 ing plasmids 9591, 9589, 9595 and 9596, respectively. 5'-AGCACAATCTCATGGGGTT pUC119 is constructed by isolating the 476 bp Hgi CCATGGTCTGCAGTAGCC-3' AI/Drafragment of bacteriophage M13 and making the to introduce an Nico site and translational initiation ends of the fragment blunt with T4 DNA polymerase codon as previously described. The resulting construct (New England Biolabs). This fragment is then inserted 15 into puC19 (Yanisch-Perron et al., 1985) that has been was designated M9580. The EcoRI/BamHIfragment of digested with Nde I and filled in with Klenow DNA M9580 which contains the region which had been mut polymerase (New England Biolabs). The resulting plas agenized was inserted into pMON9718 which had been mid (pUC119) can be used to produce single stranded digested with EcoRI and BamHI. This plasmid was DNA if cells harboring the plasmid are infected with a 20 designated pMON9728. For expression in E. coli the defective phage such as R408 (Stratagene Cloning Sys NcoI/HindIII fragment of pMON9728 was inserted tems). into NcoI/HindIII digested pMON5521 (described In order to introduce an Nicosite and an ATG trans above) producing a plasmid which was designated lational initiation codon at the site predicted to be the pMON9729. Hence, plasmids pMON9719 and start of the mature enzyme for in vitro expression in E. 25 pMON9729 are similar plasmids in which the wild-type coli, the 1.6 kb EcoRI/HindIII fragment of pMON9591 EPSP synthase and glyphosate-tolerant EPSP synthase was cloned into EcoRI./HindIII digested M13mp18 (gly(101)-ala) of tomato are under the control of the (New England Biolabs) producing a phage designated recA promoter of E. coli. E. coli SR481 cells harboring M9568. This clone was mutagenized with the oligonu pMON9719 or pMON9729 were grown under condi cleotide: tions which induce the expression of the RecA pro 30 moter. The cells were lysed and the extracts were as 5'-AGCACAATCTCATGGGGTT sayed for EPSP synthase activity. CCATGGTCTGCAGTAGCC-3' Specifically, the bacterial cell paste was washed as previously described. Sequencing confirmed the suc twice with 0.9% saline, suspended in buffer (100 mM cess of the mutagenesis and the resulting phage was 35 Tris-HCl, 5 mM dithiothreitol, 1 mM EDTA, 10% designated M9575. The 1.6 kb EcoRI./HindIII fragment glycerol and 1 mM benzamidine HCl) passed twice of this phage was inserted into EcoRI./HindIII digested through the French Pressure Cell at 1000 psi. The cell pMON6140. This plasmid was designated pMON9717. extract was separated from the cells by centrifuging at Plasmid pMON6140 is a derivative of pCEM1 15,000Xgravity for 10 mins. at 5° C. It was desalted (Promega Biotech, Madison, WI) which carries the using Sephadex G-50 (Pharmacia, Piscataway, New same full-length cDNA clone of petunia EPSPsynthase Jersey). The desalted extract was assayed for EPSP as described above for pMON6145. synthase activity as follows: In vitro transcription and translation of pMON9717 To an assay mix (40 ul) containing shikimate-3-phos failed to produce an active enzyme. Subsequent se phate (2 mM), phosphate, pH 5.5 at 1 designated pMON9718. In vitro analysis of pMON9718 ml/min. The radioactivity of the eluent was monitored showed it coded for active tomato EPSP synthase. using a Radiomatic Flo-One Beta Instrument. (Radi A vector for high level expression in E. coli was con 55 omatics, Florida). The EPSP synthase activity was structed to further characterize the tomato EPSP syn determined by measurement of the conversion of C thase. The Nco/HindIII fragment of pMON9718 con PEP to 14C-EPSP synthase, both of which are resolved taining the coding sequence for tomato EPSP synthase under the above conditions of chromatography. The was inserted into NcoI/HindIII digested pMON5521. protein content of the extract was determined by the This placed the tomato EPSPsynthase coding sequence method of Bradford (Biorad Labs, California). The under the control of the E. coli RecA promoter (Horiiet specific activity of the extract is expressed as nanomoles al., 1980; Sancar et al., 1980). This plasmid was desig of EPSP synthase formed/min/mg protein. nated pMON9719. Plasmid pMON9719 was able to Assay results show that cells containing pMON9719 complement the EPSP synthase deficiency of an E. coli had an EPSP synthase activity of about 1600 nanomoles aroA mutant (SR481) demonstrating the synthesis of 65 of EPSP synthase formed/minute/mg protein. How active EPSP synthase. ever, this enzyme was quite sensitive to glyphosate as To introduce the alanine for glycine substitution at indicated by an Iso of 12M glyphosate. Although cells position 101 of the mature tomato EPSP synthase, the containing pMON9729 (gly(101)-ala) had a EPSP syn 4,971,908 27 28 thase activity of 390 nanomoles/minute/mg protein, 700 bp BamHI fragment was used as a hybridization this enzyme was highly glyphosate-tolerant as indicated probe against the phage and Arabidopsis genomic DNA by an Iso value of 32 mM glyphosate. to identify restriction fragments suitable for the cloning A plant transformation vector capable of producing of the entire EPSP synthase gene. Two hybridizing the glyphosate resistant form of tomato EPSP synthase BglII fragments of 6.0 kb and 3.2 kb were identified in in transgenic plants is constructed as follows: the E1 phage clone. These fragments were separately A Bgll site is engineered upstream of the ATG trans subcloned into pMON550 to provide DNA for further lation initiation codon of tomato pre-EPSP synthase by experiments and designated pMON582 and pMON583, performing site directed mutagenesis on pMON9596. respectively. Two additional subclones were made from The mutagenesis is performed by the method of Kunkel O clones pMON582 and pMON583. Plasmid pMON584 is (1985) using the oligodeoxynucleotide: the 1.8 kb EcoRI to BamHI fragment containing the 5'-end of the Arabidopsis EPSP synthase gene in S-GCCATTTCTTGTGAAAAAGATCTTT pUC118 which is prepared from puC18 in a manner CAGTTTC-3' analogous to the preparation of puC119 from puC19. The alanine for glycine substitution is engineered into 15 Plasmid pMON589 is the 2.8 kb BamHI to BglII frag the coding sequence for M9568 by site directed muta ment containing the 3'-end of the Arabodopsis EPSP genesis exactly as described above. The 700 bp EcoRI/- synthase gene in puC119. Sequence determination from BamHI fragment of the resulting phage is then trans the BamHI site of pMON584, and from the BamHI site ferred into EcoRI/BamHI digested pMON9718 replac of pMON589 completed the sequence of the coding ing the corresponding wild-type fragment. 20 regions of the gene, see FIG. 8. The 70 bp BglII/EcoRI fragment of the altered The coding sequence was altered so that the ex pMON9596 is then combined with the 1.6 kb EcoRI/- pressed Arabidopsis EPSP synthase would include the HindIII fragment of the M9718 derivative into BglII/- alanine for glycine substitution at position 101 of the HindIII digested pMON550.pMON550 is a derivative mature enzyme. Plasmid pMON578 was mutagenized of puC19 (Yanisch-Perron et al., 1985) produced by 25 with the oligonucleotide: inserting the synthetic DNA fragment: 5'-CTTTACCTCGGTAATGCAGCTACAG 5'-AGCTTTCTAGAAGATCTCCATGGAGGCCTGGTAC-3' CAATGCG-3' 3'-AAGATCTTCTAGAGGTACCTCCGGAC-5 by the method of Kunkel (1985). A portion of the result into puC19 digested with HindIII and Kipn I. This 30 ing plasmid, pMON594, was sequenced to verify the reconstitutes a complete tomato EPSP synthase precur mutation. sor gene which includes the alanine for glycine substitu A Clasite is required just upstream of the transla tion. tional initiation site for insertion of the Arabidopsis For insertion into a plant transformation vector a EPSP synthase gene into plant transformation/expres convenient site is engineered at the 3'-end of the coding 35 sion vectors. A 370 bp SnaBI/BamHI fragment of sequence by digestion with HindIII, making the ends pMON584 including the translational initiation site and blunt and inserting a Clal linker (New England Bi 65bp of 5'-untranslated region was cloned into EcoRV olabs). The 1.7 kb BglII/Clal fragment of this plasmid is /BamHI digested Bluescript KS (Stratagene Cloning then inserted into BglII/Cla digested plant transforma Systems, San Diego, CA) forming pMON9734. This tion vector such as pMON316. The resulting plasmid 40 fragment can now be removed from pMON9734 with has the tomato EPSP synthase precursor coding se Clai and BamHI. quence with the alanine for glycine substitution at posi The entire Arabidopsis gene was reconstructed for tion 101 of the mature EPSP synthase sequence under plant transformation experiments as follows: the 3.0 kb control of the CaMV35S promoter. Transformation of BamHI to BglII fragment containing the 3' half of the plants, such as tomato, with this vector leads to the 45 gene was excised from pMON583 and inserted into the production of a high level of the glyphosate-tolerant unique BamHI site of pMON9734. This plasmid enzyme, resulting in glyphosate tolerant plants. pMON588, has a unique BamHI site in the middle of the III. EPSP SYNTHASE OF ARABIDOPSIS gene. The 800 bp BamHI fragment from pMON594 was then inserted into the unique BamHI site of pMON588. An Arabidopsis thaliana genomic bank was prepared 50 This resulting plasmid, pMON598, contains the entire by cloning size fractionated (15-20 kb) Mbo partially digested DNA into BamHI and EcoRI digested lambda EPSP synthase gene with the alanine for glycine substi EMBL3 (Strategene Cloning Systems, San Diego, CA). tution at position 101 of the mature protein. The entire Approximately 10,000 plaques of phage from this li gene was excised from pMON598 as a 3.5 kb ClaI to brary were screened with 32P labeled petunia EPSP 55 EcoRI fragment and cloned into ClaI/EcoRI cut synthase probe (pMON9566 described hereinbefore). A pMON857. This new plasmid, pMON600, contains the strongly hybridizing plaque, designated E1, was puri entire Arabidopsis gene under the transcriptional con fied. Southern blots of the EPSP synthase probe to the trol of the CaMV35S promoter and includes the 3' end phage DNA identified two fragments which hybridized of the nopaline synthase gene. The plasmid was then very strongly. The first fragment was a 1.0 kb HindIII introduced into Agrobacterium A208ASE containing fragment and the other was a 700 bp BamHI fragment. the disarmed Tiplasmid pTiT37SE. These fragments were subcloned into plasmid puC119 Plasmid pMON857 was prepared as follows. The and designated pMON574 and pMON578. DNA coding sequence for a type IV gentamicin-3- The DNA sequences for the two inserts were then Nacetyltransferase (AAC(3)-IV) enzyme was excised determined by the method of Sanger (1977). The se 65 from plasmid pLG62 (Gritz and Davies, 1984). The quence data indicated that the phage did contain the DNA sequence of this AAC(3)-IV enzyme has been EPSP synthase gene of Arabidopsis by its strong ho reported in the literature (Brau et al., 1984). Plasmid mology to the petunia EPSP synthase sequence. The pMON825 which comprises the DNA containing the 4,971,908 29 30 open reading frame (ORF) of the AAC(3)-IV enzyme smaller 1900 bp EcoRI/HindIII fragment of pMON849 was prepared in the following manner. carrying the same chimeric gene. This plasmid was A 143 base pair (bp) Taq fragment spanning the designated pMON851. Fragments were used from three amino terminal portion of the ORF of the AAC(3)-IV plasmids to construct a multipurpose cloning vector gene was excised from p G62 and cloned into the AccI 5 employing the CaMV35S/AAC(3)-IV/NOS gene as a site of plasmid puC8 (Vieira et al., 1982) creating selectable marker and containing a CaMV35S/NOS3' pMON823. Next, a 1316 bp SacI-PstI fragment from cassette. Referring to FIG. 10, the CaMV35S/NOS3' pLG62 containing the remainder of the ORF was cassette was prepared from pMON849 and pMON530. cloned into pMON823 previously cut with Sacl and Specifically, pMON849 was cut with BamHI removing Pst endonucleases. This plasmid was designated 10 the AAC(3)-IV/NOS sequence while leaving the pMON824. Plasmid pMON824 contains the recon CaMV35S sequence. The 294 bp BglII/BamHI frag structed coding sequence of the type IV gentamicin-3- ment from pMON530 containing the multilinker and N-acetyltransferase with an EcoRI site immediately NOS3' was ligated into the BamHI cut pMON849 pro upstream of the start of the ORF. A 1300 bp EcoRI ducing pMON853. fragment containing the entire ORF was then excised 15 The TnT. Spc/Str resistance gene was obtained from from pMON824 and cloned into the EcoR site of pMON120. The 1600 bp EcoRI/AraI fragment of pMON530. This plasmid was designated pMON825. pMON120 containing the Spc/Str gene was cloned into Plasmid pMON825 contains the entire AAC(3)-IV EcoRI and Xmal cut plJC9 producing plasmid ORF immediately upstream of the NOS 3' transcrip pMON854. tional terminator/polyadenylation signal. 20 Referring to FIG. 9, plasmid pMON825 was cut with Plasmid pMON856 was prepared by ligation of the endonucleases SmaI and BglII. The overhangs resulting following three fragments: from the BglII cut were filled by treatment with Kle Fragment #1: The 7770 bp EcoRI to BclI fragment now polymerase and the four nucleotide triphosphates. from pMON851 containing the CaMV35S/AAC(3)- The flush ends were ligated by treatment with DNA 25 IV/NOS selectable marker gene, RK2 replicon, ligase and the resulting plasmid designated pMON840. pBR322 origin of replication, and the right border Plasmid pMON840 was cut with endonuclease EcoRI. sequence from plasmid pTiT37 of Agrobacterium tu The overhangs were filled by treatment with Klenow mefaciens. polymerase and the four nucleotide triphosphates. The Fragment #2: The 630 bp HindIII to BamHI fragment flush ends were ligated by treatment with DNA ligase 30 from pMON853 containing the CaMV35S/NOS3' and the resulting plasmid designated pMON841. The cassette and the multilinker. above procedure removed the BglI, SmaI and EcoRI Fragment #3: The 1630 bp HindIII to BamHI fragment restriction sites from the chimeric CaMV35S/AAC(3)- from pMON854 containing the Spc/Str resistance IV/NOS gene. gene. Other restriction sites were Femoved by site directed 35 Extraneous sequence and restriction sites between the mutagenesis in the following manner. The 2170 bp PstI selectable marker gene and the Spc/Str gene were re fragment of pMON841 was introduced into PstI cut moved from pMON856 in the following manner. Plas pUC119 producing a construct designated pMON843. mid pMON856 was cut with StuI and Xbal. The Xbal The EcoRV site in the CaMV35S promoter sequence site was filled by treatment with Klenow polymerase was deleted by site directed mutagenesis (Zoller, 1983) 40 and the four nucleotide triphosphates. Subsequent liga using the oligonucleotide: tion produced plasmid pMON857 which is a useful plant transformation vector containing the CaMV35 5'-TTACGTCAGTGGAAGTATCACAT S/AAC(3)-IV/NOS selectable marker gene. CAATCCA-3' The Agrobacterium harboring the pMON600 plasmid 45 was used to transform explants of Brassica napus. Three producing plasmid pMON844. Sequencing confirmed gentamicin resistant calli were obtained. All three of that pMON844 contained the above-described EcoRV these calli were found to be capable of growth on 0.5 deletion. mM glyphosate, a concentration which kills wild type The NOS/NPTII/NOS gene in pMON505 was re callus. Proteins were extracted from samples of the calli moved by cleavage of pMON505 with Stul and Hin 50 and were assayed for EPSP synthase activity. All three dIII. It was replaced with the 2220 bp EcoRI (Klenow of the calli contained EPSP synthase activity that was filled) HindIII fragment from pMON844 containing the resistant to 0.5 mM glyphosate. CaMV35S/AAC(3)-IV/NOS gene. This plasmid was These results demonstrate that the calli transformed designated pMON845. It was subsequently determined with pMON600 contain a glyphosate resistant form of by sequence analysis that the CaMV35S/AAC(3)- 55 EPSP synthase. The EPSP synthase in the extracts was IV/NOS chimeric gene which is in pMON845 con further characterized by titrating the resistance to gly tained extraneous sequence upstream from the start of phosate. The Iso of the enzyme was found to be 7.5 mM, the CaMV35S promoter sequence carried from the this is several orders of magnitude higher than has been NOS promoter of pMON825. The Xmal site at the start found for any wild type plant EPSPsynthase. Given the of the CaMV35S promoter of pMON844 was changed 60 differences in the conditions of the assays (plant extracts to a HindIII by site directed mutagenesis using the which still contain the endogenous (wild-type) EPSP oligonucleotide: synthase versus extracts from overproducing E. coli) '-TGTAGGATCGGGAAGCTTCCCCGGAT this Iso does not differ significantly from the values CATG-3' found for the petunia and tomato enzymes carrying the 65 same alanine for glycine substitution (16 and 32 mM producing plasmid pMON849. The EcoRI./HindIII respectively). fragment of pMON845 (containing the CaMV35 Plants transformed with plasmid pMON600 are pro S/AAC(3)-IV/NOS gene) was replaced with the duced by transforming stem explants and culturing 4,971,908 31 32 under selective conditions which favor shoot formation (Promega, Madison, WI) according to the manufactur over callus formation. The resulting plants will contain ers instructions. Hybridizing plaques were isolated, the glyphosate-tolerant form of EPSP synthase and will replated, and nitrocellulose lifts from the plates were exhibit elevated tolerance to glyphosate herbicide. screened with the same probe. Plaques representing single clones which hybridized strongly to the tomato IV. EPSP SYNTHASE OF Glycinemax probe were isolated, propagated and used to prepare The cDNA for EPSP synthase of Glycine max was DNA. Clone lambda-zld was found to contain a 1.8 kb isolated from a library constructed from RNA isolated EcoRI insert. The insert of this phage was subcloned from Glycine max root tips. The library was constructed into the EcoRI site of Bluescript KS--(Strategene, San using the commercially available Amersham cDNA 10 Diego, CA) to form pMON9935. The complete se synthesis kit (Amersham Corp., Arlington Hits., IL), quence of this cDNA clone was determined and is and lambda gt10 from Vector Cloning Systems (San shown in FIG. 2. To facilitate future constructions an Diego, CA). The library was screened with an insert Xba I site was engineered immediately upstream of the from pMON578 which contains part of the EPSP syn first ATG initiation codon of this clone by oligonucleo thase gene and hybridizing plaques were isolated and 15 their inserts subcloned into Bluescript plasmids (Vector tide mediated mutagenesis by the method of Kunkel Cloning Systems, San Diego, CA), and single stranded using the oligonucleotide: phage. The sequence of a portion of one of the cDNA 5'-TACCAACCATCGGCGTCTAGAGG clones (pMON9752, containing a 1600 bp cDNA) was CAATGGCGGC-3' determined. Referring to FIG. 2, the protein deduced 20 from the nucleotide sequence has strong homology to producing plasmid pMON9950. pMON9950 was di the petunia sequence in the region corresponding to the gested with Xba I and religated to eliminate the 126 bp mature protein. Notably, amino acids 94-107 of the Xba I fragment at the 5' end of the cDNA forming petunia enzyme are identical to amino acids 97-110 of pMON9951. To produce a coding sequence for a gly the mature Glycine max enzyme (a three amino acid 25 phosate tolerant form of maize EPSP synthase insertion in the Glycine max relative to the petunia near pMON9951 was mutated by the method of Kunkel the amino terminus is responsible for the difference in using the oligonucleotide: numbering, see FIG. 2). The Glycine max enzyme was altered to change the 5'-CTTCTGGGGAATGCTGCTACT glycine at position 104 (which corresponds to Gly 101 30 GCAATGCGGC-3' in petunia) to an alanine by site directed mutagenesis using the oligonucleotide: resulting in pMON9960. This mutagensis will change a GGA codon to a GCT codon, changing the second 5'-AAAGGACGCATTGCACTGGCAGCATT. glycine residue in the conserved sequence -L-G-N-A- CCAA-3' G-T-A- to an alanine in the resulting protein. The gly 35 cine residue is amino acid 163 of the predicted maize according to the method of Kunkel (1985). preFPSP synthase. This would correspond to amino Initial cDNA clones isolated did not contain the com plete sequence of the amino terminal chloroplast transit acid 95-105 of the mature protein depending on the peptide of Glycine max EPSP synthase. The remaining precise transit peptidase cleavage site which has not sequence is isolated by screening the cDNA library been determined. until a clone containing this region is obtained or by To demonstrate that this alteration produced a gly isolating a clone from a library of Glycine max genomic phosate tolerant form of maize EPSP synthase, protein DNA by hybridization with a Glycine max cDNA was produced from pMON9951 and pMON9960 by in clone. For expression ia plants a BglII or other conve vitro transcription with T7 RNA polymerase, followed nient site is engineered just upstream of the normal 45 by in vitro translation as follows: Plasmid DNA translational initiation codon as was done in the petunia (pMON9951 and pMON9960) containing the full and tomato sequences. This region is then combined length EPSP synthase cDNA was linearized with with the cDNA that had been mutagenized to contain EcoRI. The linearized plasmid DNA was transcribed in the alanine for glycine substitution at a common Hin vitro with T7 polymerase essentially as described by dIII site. The altered gene is then inserted into a plant 50 Krieg et al., 1984. The standard reaction buffer con transformation vector such as pMON530 which places tained 40 mM Tris-HCl (pH 7.9), 6 mM MgCl2, 10 mM the coding sequence under the control of the CaMV35S dithiothreitol, 2 mM spermidine, 80URNAsin ribuonu promoter. The resulting vector is used to produce trans clease inhibitor, 0.5 mM each of ATP, GTP, CTP and genic plants which exhibit enhanced tolerance to gly UTP, in a final reaction volume of 100 ul. The final phosate herbicide. 55 RNA pellet was resuspended in 20 ul of sterile water Preparation of a Glyphosate Tolerant Maize EPSP and stored at -80 C. A standard translation reaction Synthase Gene, and Glyphosate Tolerant Maize Cells contained 100 ui of nuclease-treated rabbit reticulocyte Construction of a glyphosate tolerant maize gene lysate, 5.7 ui of a 19-amino acid mixture (minus methio Maize seeds were imbibed for 12 hr in water, the nine at 1 mM each, 5.7 ul of RNA (total RNA tran embryos including the scutella were dissected from the scripts derived from 0.63 ug of plasmid DNA), 16 ul seeds and RNA was purified from this material by the RNAsin (20U/ul) ribonuclease inhibitor, and 58.3 ul of method of Rochester et al. (1986). PolyA-mRNA was S) methionine (14-15 mci/ml). The in vitro transla isolated from the RNA by chromatography on oligo dT tion products were stored frozen at -80 C. cellulose, and was used to construct a cDNA library as The products of the in vitro translation were then described previously. The library was screened with a 65 assayed for EPSP synthase activity as described herein. 32-P labelled RNA probe synthesized in vitro from Referring to FIG. 12, the product of pMON9951 pMON9717 which had been linearized with HindIII. showed easily detectable EPSP synthase activity in the The probe was synthesized with T7 RNA polymerase absence of glyphosate. When the assay was repeated in 4,971,908 33 34 the presence of 1.0 mM glyphosate no activity was rose. After 2 weeks in the dark at 26 C., medium with detected. In contrast the mutant pre-enzyme product of out mannitol and containing kanamycin is added to give pMON9960 showed a high level of tolerance to glypho a final concentration of 100 mg/1 kanamycin. After an sate, being only slightly inhibited at 1 mM glyphosate, additional 2 weeks, microcalli are removed from the was 25% inhibited at 10 mM glyphosate and still show liquid and placed on a membrane filter disk above aga ing detectable activity at 100 mM glyphosate. rose-solidified medium containing 100 mg/1 kanamy For expression in maize cells the coding sequence of cin. Kanamycin resistant calli composed of transformed the glyphosate tolerant mutant form of maize pre-EPSP maize cells appear after 1-2 weeks. synthase is excised from pMON9960 and inserted be Glyphosate tolerant maize cells tween a promoter known to function in maize cells such 10 As described by Fromm et al. (1986), transformed as the CaMV35S promoter, and the poly A addition site maize cells can be selected by growth in kanamycin of the nopaline synthase gene. In addition an intron such containing medium following electroporation with as the first intron of the maize ADH1 gene may be DNA vectors containing chimeric kanamycin resis included in the 5'-untranslated region of the expression tance genes composed of the CaMV35S promoter, the unit which may enhance expression of the chimeric 15 NPTII coding region and the NOS 3' end. These cells gene (Callis, et al. 1987). would also be producing the glyphosate tolerant form This expression unit is then inserted into a vector of EPSP synthase, and would tolerate elevated levels of which includes the neomycin phosphotransferase gene glyphosate. under control of the CaMV35S promoter, or a similar Alternative methods for the introduction of the plas vector with a marker gene that can allow for selection 20 mids into maize, or other monocot cells would include, of transformed maize cells. This vector, or a similar but are not limited to, the high-velocity microprojectile vector using any other glyphosate resistant coding se method of Klein et al. (1987) or the injection method of quence constructed as described in the claims and exam de la Pena et al. (1987). ples of this application is then introduced into maize The embodiments described above are provided to cells as described in the following example. 25 better elucidate the practice of the present invention. It Preparation of Maize Protoplasts should be understood that these embodiments are pro Protoplasts are prepared from a Black Mexican vided for illustrative purposes only, and are not in Sweet (BMS) maize suspension line, BMSI (ATCC tended to limit the scope of the invention. 54022) as described by Fromm et al. (1985 and 1986). REFERENCES BMSI suspension cells are grown in BMS medium 30 which contains MS salts, 20 g/1 sucrose, 2 mg/l (2,4- Adams, S.P. and Galluppi, G. R. (1986) Medicinal Re dichlorophenoxy) acetic acid, 200 mg/1 inositol, 130 search Reviews 6:135-170. mg/1 asparagine, 1.3 mg/1 niacin, 0.25 mg/1 thiamine, Adams, S.P., et al., (1983) J. Anner. Chem. Soc. 05:661. 0.25 mg/1 pyridoxine, 0.25 mg/l calcium pantothenate, Ausubel, F., et al., (1980) Plant Mol. Bio, Newsletter pH 5.8, 40 ml cultures in 125 erlenmeyer flasks are 35 1:26-32. shaken at 150 rpm at 26° C. The culture is diluted with Brau, et al., Mol. Gen. Genet, 193:179-187 (1984). an equal volume of fresh medium every 3 days. Proto Broglie, R. et al., (1983) Bio/Technology 1:55-61. plasts are isolated from actively growing cells 1 to 2 Callis, J., Fromm, M. and Walbot, V. (1987) Genes and days after adding fresh medium. For protoplast isola Develop. 1:1183-1200. tion cells are pelleted at 200Xg in a swinging bucket 40 Charles, G. Keyte, J. W., Brammer, W. J., Smith, M. table top centrifuge. The supernatant is saved as condi and Hawkins, A. R. (1986) Nucleic Acids Res. tioned medium for culturing the protoplasts. Six ml of 14:22O1-2213. packed cells are resuspended in 40ml of 0.2 M man Covey, S., Lomonosoff, G. and Hill, R., (1981) Nucleic nitol/50 mM CaC12/10 mM sodium acetate which Acids Res. 9:6735. contains 1% cellulase, 0.5% hemicellulase and 0.02% 45 de la Pena, A., Lorz, H. and Schell, J. (1987) Nature pectinase. After incubation for 2 hours at 26 C., proto 325:274-276. plasts are separated by filtration through a 60 um nylon DePicker A., et al., (1982) J. Mol. Appl. Gen. 1:561. mesh screen, centrifuged at 200Xg, and washed once in Ditta, G., et al., (1980) Pro. Natl. Acad. Sci. USA the same solution without enzymes. 77:7347. Transformation of Maize Protoplasts Using an Elec 50 Duncan, K., Lewendon, A. and Coggins, J. R. (1984) troporation Technique FEBS Lett. 170:59-63. Protoplasts are prepared for electroporation by wash Fraley, R., Rogers, S., Eichholtz, D., Flick, J., Fink, C., ing in a solution containing 2 mM potassium phosphate Hoffman, N. and Sanders, P., (1985) Bio/Technology pH 7.1, 4 mM calcium chloride, 140 mM sodium chlo 3:629. ride and 0.2M mannitol. After washing, the protoplasts 55 Fromm, M., Taylor, L. P. and Walbot, V. (1985) Proc. are resuspended in the same solution at a concentration Nat Acad. Sci., USA 82:5824-5828. of 4 X 10E6 protoplasts per ml. One-half ml of the Fromm, M., Taylor, L. P. and Walbot, V. (1986) Nature protoplast containing solution is mixed with 0.5 ml of 319:791-793. the same solution containing 50 micrograms of super Gardner, R., Howarth, A., Hahn, P., Brown-Luedi, M., coiled plasmid vector DNA and placed in a 1 ml elec 60 Shepherd, R. and Messing, J., (1981) Nucleic Acids troporation cuvette. Electroporation is carried out as Res. 9:2871. described by Fromm et al. (1986). As described, an Gritz and Davies, Gene 25:179-188 (1984). electrical pulse is delivered from a 122 or 245 micro Guilley, H., Dudley, R., Jonard, G., Ballax, E. and Rich Farad capacitor charged to 200 V. After 10 minutes at ards, K. (1982) Cell 30:763. 4 C. and 10 min at room temperature protoplasts are 65 Goldberg, R. B., et al., (1981) Devel. Bio. 83:201-217. diluted with 8 ml of medium containing MS salts 0.3 M Gubler, U., and Hoffman, B. H. (1983) Gene 25:263-269. mannitol, 2% sucrose, 2 mg/1 2,4-D, 20% conditioned Horsch, R. and Klee, H., (1986) Proc. Natl. Acad. Sci. BMS medium (see above) and 0.1% low melting aga USA vol. 83, 4428-4432. 4,971,908 35 Horsch, R. B., and Jones, G. E. (1980) In Vitro 16:103-108. Horii, T., et al. (1980) P.N.A.S. USA 77:313. Hunkapiller, M. W., et al. (1983b) Methods Enzymol. located between positions 80 and 120 in a mature EPSP 91:486-493. 5 synthase sequence. Huynh, T.V. Young, R.A. and Davis, R.W. (1985) 2. A method of claim 1 in which the glyphosate-toler DNA Cloning Techniques: A Practical Approach, D. ant EPSP synthase gene is produced from a plant EPSP Glover ed., IRL Press, Oxford. synthase gene. Klein, T.M., Wolf, E.D., Wu, R. and Sanford, J.C. 3. A method of claim 1 in which the glyphosate-toler (1987) Nature 327:70-73. 10 ant EPSP synthase gene is produced from a bacterial Krieg, P.A. and Melton, D.A. (1984) Nucleic Acids Res. EPSP synthase gene. 12:7057-707O. 4. A method of claim 1 in which the glyphosate-toler Kunkel (1985) P.N.A.S. USA 82:488-492. ant EPSP synthase gene is produced from a fungal gene Lemke, G. and Axel, R. (1985) Cell 40:501-508. encoding EPSP synthase. Maniatis, T., et al. (1982) Molecular Cloning. A Labora 15 5. A glyphosate-tolerant 5-enolpyruvyl-3-phospho tory Manual, Cold Spring Harbor Labs., NY. shikimate (EPSP) synthase enzyme which contains the Marmur, J. (1961) J. Mol. Biol. 3:208-210. amino acid sequence: Maxam, A.M. and Gilbert, W., (1977) P.N.A.S. USA 74:560-564. Messing, J. et al. (1981) Nucleic Res, 9:309-321. 20 between positions 80 and 120 in the mature EPSP syn Mousdale, D.M. and Doggins, J.R. (1984) Planta thase sequence. 160:78-83. 6. The glyphosate-tolerant EPSP synthase enzyme of Okayama, H. and Berg, P. (1982) Mol. Cell. Biol. 2:161. claim 5 as shown in FIGS. 1(a) and 1(b). Rao, R.N. and Rogers, S.G. (1979) Gene pp. 7:79-82. 7. A glyphosate-tolerant EPSP synthase gene pro Rochester, D.E., Winter, J.A. and Shah, D.M. (1986) 25 duced by the method of claim 1 wherein the wild-type EMBO.J. 5:452-458. EPSP synthase coding sequence is selected from the Rogers, S., Horsch, R. and Fraley, R., (1986) Methods in group of EPSP synthases consisting of Aspergillus nidu Enzymology Vol. 118 (H. Weissbach and A. Weiss lans, petunia, tomato, maize, Arabidopsis thaliana, Gly bach, eds.) p.627, Academic Press, New York. cine max, E. coli K-12 and Salmonella typhimurium as Rogers, S.G., et al. (1983) Appl. Envir. Microbio. shown in FIG. 2. 46:37-43. 8. A glyphosate-tolerant EPSP synthase gene of Sancar, A., et al. (1980) P.N.A.S. USA 77:2611. claim 7 wherein the wild-type EPSP synthase coding Sanger, et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463. sequence is selected from Aspergillus nidulans. Scherer, et al. (1981) Developmental Bio. 86:438-447. 9. A glyphosate-tolerant EPSP synthase gene of Schimke, R.T. ed., (1982) Gene Amplification, Cold 35 claim 7 wherein the wild-type EPSP synthase coding Spring Harbor Labs. sequence is selected from petunia. Schmidhauser, T. and Helinski, D. (1985).J. Bacteriology 10. A glyphosate-tolerant EPSP synthase gene of 164:446. claim 7 wherein the wild-type EPSP synthase coding Soberson, et al. (1980), Gene 9:287-305. sequence is selected from tomato. Southern, E.M. (1975) J. Mol. Biol. 98:503-517. 40 11. A glyphosate-tolerant EPSP synthase gene of Stalker, D. M., Hiatt, W. R. and Comai, L. (1985) J. Biol claim 7 wherein the wild-type EPSP synthase coding Chen. 260:4724-4728. sequence is selected from maize. Steinrucken, H. and Amrhein, N. (1980) Biochem. & 12. A glyphosate-tolerant EPSP synthase gene of Biophys. Res. Comm.94:1207-1212. claim 7 wherein the wild-type EPSP synthase coding Vieira, J. et al., (1982) Gene 19:259-268. 45 sequence is selected from Arabidopsis thaliana, Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) 13. A glyphosate-tolerant EPSP synthase gene of Gene 33:03-119. claim 7 wherein the wild-type EPSP synthase coding Zoller, M.M. et al. (1983) Methods Enzymol. 100:468. sequence is selected from Glycine max. We claim: 14. A glyphosate-tolerant EPSP synthase gene of 1. A method for producing a gene encoding a glypho 50 claim 7 wherein the wild-type EPSP synthase coding sate-tolerant 5-enolpyruvyl-3-phosphoshikimate sequence is selected from E. coli K-12. (EPSP) synthase enzyme which comprises altering a 15. A glyphosate-tolerant EPSP synthase gene of gene encoding EPSP synthase to cause the substitution claim 7 wherein the wild-type EPSP synthase coding of an alanine residue for the second glycine residue in 55 sequence is selected from Salmonella typhimurium. the amino acid sequence: k :

65