Univerzita Karlova v Praze Přírodovědecká fakulta Katedra zoologie
Molekulární fylogeografie lína obecného Tinca tinca (Linnaeus, 1758)
Zdeněk Lajbner
Disertační práce
Školitel: RNDr. Petr Kotlík, Ph.D. ÚŽFG AV ČR, v.v.i., Liběchov
Praha 2010 Prohlašuji, že jsem předloženou disertační práci vypracoval samostatně s použitím citované literatury. Dílčí publikace byly zkompletovány společně se jmenovanými spoluautory. Prohlašuji, že jsem nepředložil tuto práci ani žádnou její část k získání jiného nebo stejného akademického titulu.
V Praze, 21. prosince 2010 …………..…......
Zdeněk Lajbner
Poděkování
Na prvním místě děkuji RNDr. Petru Kotlíkovi, Ph.D., z Ústavu živočišné fyziologie a genetiky (ÚŽFG) AV ČR, v.v.i., za trpělivost, kterou se mnou měl již od dob mého magisterského studia a s níž se zhostil i vedení mé práce disertační. Rovněž mu děkuji za všestrannou podporu, jíž se mi z jeho strany dostávalo. Děkuji Prof. Ing. Petru Rábovi, DrSc. a všem kolegům z Laboratoře genetiky ryb ÚŽFG AV ČR, v.v.i., v Liběchově, za vytvoření příjemného pracovního prostředí, trvalý přísun inspirace a cenné rady. V neposlední řadě děkuji spoluautorům publikací i všem dalším lidem, kteří mi během tvorby disertační práce jakkoliv pomohli a to především při shromažďování vzorků línů z celého světa. Velmi rád za trpělivost, s níž tolerovala mé zaneprázdnění, děkuji i mé rodině.
Tato práce vznikla za finanční podpory Ministerstva školství mládeže a tělovýchovy České republiky - projekt číslo LC06073 a výzkumných záměrů přidělených Ústavu živočišné fyziologie a genetiky Akademie věd České republiky - projekt číslo AV0Z50450515, Přírodovědecké fakultě Univerzity Karlovy v Praze - projekt číslo 21620828, Fakultě rybářství a ochrany vod Jihočeské Univerzity v Českých Budějovicích - projekt číslo 6007665809 a Interní grantové agentury ÚŽFG AV ČR v.v.i. - projekty číslo 05/22 a 08/13. Summary
The tench Tinca tinca (Linnaeus, 1758) is a valued table fish native to Europe and Asia, but which is now widely distributed in many temperate freshwater regions of the world as the result of human-mediated translocations. Spatial genetic analysis applied to sequence data from four unlinked loci (three nuclear introns and mitochondrial DNA) defined two groups of populations that were little structured geographically but were significantly differentiated from each other, and it identified locations of major genetic breaks, which were concordant across genes and were driven by distributions of two major phylogroups. This pattern most reasonably reflects isolation in two principal glacial refugia and subsequent range expansions, with the Eastern and Western phylogroups remaining largely allopatric throughout the tench range. However, this phylogeographic variation was also present in European cultured breeds studied and some populations at the western edge of the native range contained the Eastern phylogroup. Thus, natural processes have played an important role in structuring tench populations, but human-aided dispersal have also contributed significantly, with the admixed genetic composition of cultured breeds most likely contributing to the introgression. We have then designed novel PCR-RFLP assays of two nuclear-encoded markers and one mitochondrial DNA (mtDNA) marker, which allow a rapid identification of the morphologically undistinguishable Western and Eastern phylogroup and also of three geographical mtDNA clades within the Eastern phylogroup. The method will enable researchers and also fishery practitioners to rapidly distinguish genetically divergent geographical populations of the tench and will be useful for monitoring the introduction and human-mediated spread of the phylogroups in wild populations, for characterization of cultured strains and in breeding experiments. The population genetic test based on analyses of variation at introns of nuclear genes, microsatellites, allozymes and mitochondrial DNA in populations from two postglacial lakes within the contact zone of both phylogroups did not detect robust linkage and Hardy-Weinberg disequilibria that would not be limited to individual loci and would be concordant between populations. This test, based on the expectation that in the presence of strong barriers to reproduction the hybrid populations would show genome-wide associations among alleles and genotypes, supports the hypothesis of free interbreeding between the two phylogroups of tench. Therefore, although the phylogroups may be considered as separate phylogenetic species, the present data suggest that they form a single species under the biological species concepts. Obsah
1. Úvod...... 6 1.1. Vývoj sladkovodní ichtyofauny...... 6 1.2. Hybridizace a její evoluční význam...... 9 1.3. Vliv člověka na genetickou strukturu populací...... 10 1.4. Lín obecný Tinca tinca (Linnaeus, 1758) jako modelový druh...... 13 1.5. Cíle práce...... 15 1.6. Seznam použité literatury:...... 16 2. Publikace...... 26 2.1. Human-aided dispersal has altered but not erased the phylogeography of the tench...... 26 2.2. PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca...... 60 2.3. Lack of reproductive isolation between the Western and Eastern phylogroups of the tench...... 65 3. Shrnutí výsledků a jejich význam...... 78 3.1 Seznam použité literatury:...... 80 1. Úvod
1.1. Vývoj sladkovodní ichtyofauny
Sladkovodní ichtyofauna, stejně jako veškerá biota, byla v průběhu čtvrtohor silně ovlivněna periodickými změnami klimatu způsobenými zejména Milankovičovými cykly (Dynesius a Jansson 2000). Takto jsou označovány změny oběžné dráhy Země a sklonu zemské osy, které ovlivňují množství slunečního záření dopadajícího na zemský povrch. S příchodem chladných období, kdy se zvětšovala plocha pokrytá kontinentálním ledovcem, populace teplomilných organismů ustupovaly ze severněji položených oblastí, vikariantně se štěpily a nakonec přežívaly pouze v oblastech, kde nalezly vhodné podmínky pro život, tzv. glaciálních refugiích (Hewitt 2004). V teplejších obdobích se tyto druhy opět rozšířily, při čemž docházelo ke kontaktu populací do té doby izolovaných v jednotlivých refugiích, které se tak mohly opět křížit (hybridizovat) (Hofreiter a kol. 2004). Analogicky reagovaly chladnomilné organismy na oteplení (Makhrov a Bolotov 2006; Stewart a kol. 2010). Dlouhodobé oddělení populací může vyvolat tzv. alopatrickou speciaci (Mayr 1963). V případě alopatrické speciace dochází ke vzniku reprodukčně izolačních mechanismů obvykle pomaleji, než v případě speciace sympatrické (např. McCune a Lovejoy 1998; Noor 1999; Turelli a kol. 2001; Matute 2010). Jsou-li proto odstraněny migrační bariéry, původně oddělené populace často hybridizují, což v případě absence silných reprodukčních bariér může vést ke genetické homogenizaci (Olden a kol. 2004). Hybridizace je u organismů s vnějším oplozením, jako jsou ryby, běžná a to i u druhů, které byly izolovány po stovky tisíc i několik milionů let (Hubbs 1955; Schwartz 1981; Lajbner a kol. 2009). Hybridizace a z ní plynoucí introgredované populace však mohou zůstat geograficky omezené na nově osídlený areál a s příchodem další klimatické změny vyhynout, aniž by geneticky ovlivnily populace refugiální a narušily tak jejich evoluční divergenci (Hofreiter a kol. 2004). Nejrůznější studie dokládají, že klimatické změny provázející konec posledního glaciálu byly (v geologickém měřítku) poměrně rychlé (Kasse a kol. 2005; Steffensen a kol. 2008). Tání ledovců způsobilo nejen zvednutí hladin oceánů a oddělení např. Britských ostrovů od pevniny, ale třeba i naplnění Baltského moře, či zvětšení a propojení Černého moře s Kaspickým a Středozemním (Chepalyga 2007). Počátek Holocénu tak možná zaznamenali i starověcí kronikáři jako onu „biblickou potopu“ (Ryan a kol. 1997). Slábnoucí tlak ledovců na zemské podloží rovněž spustil geologické procesy, v jejichž důsledku se některé oblasti nestejnoměrně zdvihaly, což v některých oblastech probíhá dodnes (Peltier 2004). Docházelo k výrazným změnám v říčních sítích, spojování a rozdělování povodí a ke vzniku jezer. Na rozdíl od dob ledových, které se mj. projevují aridizací klimatu, byla postglaciální Holarktická krajina náhle plná
6 kapalné vody a ryby i další sladkovodní organismy mohly do různé míry rozšiřovat své areály, přičemž svoji roli hrály výchozí „startovní pozice“ jednotlivých druhů (např. poloha glaciálních refugií), jejich ekologické nároky i disperzní schopnosti (Birks a Ammann 2000). Bănărescu (1991), především na základě chorologických a paleontologických dat, identifikoval hlavní glaciální refugia a kolonizační cesty, jimiž po oteplení sladkovodní ryby osídlily rozsáhlé oblasti Evropy. Nejvýznamnější glaciální refugia pro většinu druhů střední a západní Evropy se zřejmě nacházela v povodí Dunaje a případně dalších přítoků Černého a Kaspického moře (Durand a kol. 1999; Kotlík a Berrebi 2001; Kotlík a kol. 2004). Díky rutinní aplikaci molekulárních genetických markerů a v souvislosti s rozvojem populační genetiky, fylogenetiky a později pak především fylogeografie (Avise a kol. 1987, 2000) došlo k významnému nárůstu detailních znalostí o tom, jak se postglaciální evropská ichtyofauna formovala (Hewitt 2004). Fylogeografie se jako disciplina na pomezí fylogenetiky a biogeografie zabývá principy a procesy, které řídí geografickou distribuci genealogických linií mezi populacemi stejného nebo blízce příbuzných druhů (Avise 2000). Přestože fylogeografie metodicky také překlenula propast mezi molekulární fylogenetikou a populační genetikou a využívá proto metodických přístupů, které vznikly pro potřeby těchto dvou oborů, celá řada metod byla navržena specielně pro potřeby fylogeografie (viz. dále). Ačkoliv bylo v populační genetice v minulosti využíváno především variability v elektroforetické mobilitě proteinů (např. alozymů), která na tomto poli zaujímá významnou úlohu dodnes (Hamilton 2009), k bouřlivému rozvoji fylogeografie došlo až díky masovému rozšíření studia DNA a zejména vynálezu polymerázové řetězové reakce (PCR). Fylogeografie, podobně jako fylogenetika, zpočátku využívala především haploidní, mimojadernou (organelovou) DNA, v případě živočichů mitochondriální DNA (mtDNA) (Avise 1998). Jelikož se mtDNA dědí téměř výhradně po mateřské linii, zjišťujeme tímto způsobem především maternální historii (Avise 1998). V mtDNA obratlovců zpravidla nedochází k rekombinaci, je zde čtvrtinová efektivní velikost populace oproti jaderné části genomu (Birky a kol. 1989) a množství generací potřebných ke koalescenci je tedy relativně nižší (relativně bližší poslední společný předek) (Moore 1995). Dlouhodobou strukturaci populací lze tedy lépe odhalit pomocí jednopohlavně děděné mtDNA (ale např. i Y chromozomu) než studiem srovnatelně variabilního úseku rekombinující jaderné DNA (nDNA). Studie omezené na mtDNA však selhávají v případě hybridizace. Problémy při interpretaci dat získaných studiem jednopohlavně děděné DNA může sehrát i vyšší míra filopatrie (tj. věrnosti místu narození) jednoho z pohlaví a pod. (např. Bonfil a kol. 2005). Proto je důležité kombinovat výsledky získané analýzou mtDNA s vhodně zvolenými jadernými markery (Avise 2000).
7 Míra divergence mezi mitochondriálními liniemi byla zpočátku zjišťována pomocí restrikčních enzymů a tvorby restrikčních map (Brown a Vinograd 1974). Další, kvalitativní i kvantitativní skok přinesla možnost analýzy genetické variability na úrovni sekvencí DNA a její zpřístupnění široké vědecké veřejnosti, především díky poklesu ceny a dostupnosti formou servisní služby. Rostoucí obliba sekvenčních markerů se odrazila i ve vývoji nových metod zpracování dat. Získané fylogeografické vzory byly zpočátku popisovány hlavně graficky a interpretovány intuitivně (Avise 2000). Jedním z prvních pokusů o standardizaci fylogeografické analýzy byla takzvaná „Nested clade analysis“ (Templeton a kol. 1995). Tato metoda si rychle získala značnou oblibu, ale v současnosti je již vytlačena pokročilejšími statistickými přístupy (Knowles 2009) založenými především na hodnocení koalescenční (Kingman 1982) pravděpodobnosti alternativních fylogeografických modelů, často s využitím principů bayesiánské statistiky (např. Kuhner a kol. 1995; Wakeley a Hey 1997, Beerli a Felsenstein 1999; souhrn viz. Nielsen a Beaumont 2009). Alternativní přístup nabízí uplatnění teorie koalescence (Kingman 1982) při simulaci genových stromů uvnitř stromů populačních (Knowles a Maddison 2002), které umožňuje například program Mesquite (Maddison 2008). Zvláštní místo zaujímají metody prostorové analýzy genetických dat (Guillot a kol. 2009), jako je například SAMOVA (Dupanloup a kol. 2002), jejichž hlavní výhodou je, že odstraňují problém se zařazováním jedinců do diskrétních populací, čímž je zatížena řada jiných přístupů. Kromě sekvencí DNA se ve fylogeografii využívá opakování motivů tandemových repetic (mikrosatelity) a jednonukleotidových polymorfismů (SNPs) rozmístěných v různých oblastech jaderného genomu. Význam SNPs zřejmě nadále poroste v souvislosti s rostoucí dostupností genomických dat, produkovaných pomocí sekvenačních metod nové generace (Avise 2010, Emerson a kol. 2010).
8 1.2. Hybridizace a její evoluční význam
U ryb je hybridizace poměrně častým jevem, který má nezřídka za následek genovou introgresi mezi druhy nebo mezi geneticky odlišnými populacemi (Turner 1999). Vlivem introgrese cizích genů mohou populace ztratit důležité adaptace umožňující jim fungovat v prostředí, které obývají (Allendorf a kol. 2001). Hybridizace může také vést k outbrední depresi (např. narušením kompatibility mezi geny v různých populacích), snížení plodnosti (fertility) a životaschopnosti (viability) či k situaci, kdy početnější z hybridizujících taxonů (populací, druhů) geneticky „vstřebá“ ten vzácnější (přehled viz. Lajbner 2004; Lajbner a kol. 2009). V důsledku hybridizace může v určitých případech docházet také k polyploidizaci, vzácně i k různým odchylkám od sexuálního rozmnožování a vytváření složitých hybridních komplexů nebo dokonce ke vzniku asexuálně se množících klonálních linií. S nárůstem využití molekulárně genetických metod zjišťujeme, že navzdory dřívějším předpokladům je hybridizace u ryb velmi rozšířeným fenoménem s významným dopadem na jejich evoluci (Avise 1994; Haig 1998). V některých případech však může být metodologicky obtížné odlišit genovou introgresi od nekompletního oddělení genealogických linií (tzv. „incomplete lineage sorting“) a to především tehdy, je-li použito malé množství genetických markerů, navíc s neznámou specificitou vůči hybridizujícícím druhům (Avise a Robinson 2008). Nekompletní oddělení genealogických linií je situace, kdy v určitém genu mají oba druhy společné dvě nebo více alel aniž mezi nimi dochází k hybridizaci (alely tedy zdědily od společného předka; Degnan a Rosenberg 2009). I studium hybridizace prošlo v posledních desetiletích bouřlivým rozvojem. Morfologické znaky při její detekci často selhávají, což bylo zjištěno již díky prvním analýzám genetických, např. alozymových dat (Valenta a kol. 1979; Verspoor a Hammar 1991). Studium mtDNA potom přineslo možnost určit převládající směr hybridizace (např. kombinace samec jednoho druhu a samice druhého druhu; Lajbner a kol. 2009), zatímco studium sekvencí DNA umožnilo lépe detekovat například historickou hybridizaci, která může stát za vznikem některých recentních taxonů (Dowling a Secor 1997). Detailní studium hybridizace spadá především do pole působnosti populační genetiky a využívá tedy především statistických metod vyvíjených pro tuto vědeckou disciplínu. V současnosti je však již k dispozici velké množství pokročilých statistických metod vyvinutých specielně k testování konkrétních hypotéz spojených s hybridizací, mezi nimiž zaujímá významné postavení bayesiánská metoda v programu NewHybrid (Anderson a Thompson 2002). K odhalení nových případů hybridizace však často dochází v pracích fylogeografických a fylogenetických (např. Tsigenopoulos a kol. 2002; Marková a kol. 2010).
9 1.3. Vliv člověka na genetickou strukturu populací
V období od konce 18. století někdy označovaném termínem antropocén (Crutzen 2002), kdy se lidské aktivity stávají celosvětově jedním z hlavních faktorů ovlivňujících životní prostředí, se vliv člověka na rozšíření organismů neustále stupňuje, což podnítilo vlnu zájmu ohledně evolučních a ekonomických souvislostí (např. Guisan a Thuiller 2005; Halpern a kol. 2008). Lidská činnost ovlivňuje biologickou evoluci celou řadou způsobů (Palumbi 2001). V některých případech může vést až k lokálnímu či dokonce globálnímu vymírání druhů (Martin 1966; Brooks a kol. 2002; Courchamp a kol. 2006; Gillespie a kol. 2008), avšak v jiných případech může naopak umožnit rozšíření druhů do nových oblastí, což ovšem také často způsobuje nechtěné změny biodiverzity (Elton 1958; Carlton a Geller 1993; Mooney a Clealand 2001; Rahel 2002; Clavero a García- Berthou 2005). Vodní ekosystémy jsou lidskou činností ovlivněny zvlášť významně a sladkovodní biotopy jsou těmi nejohroženějšími vůbec (Jenkins 2003; Xenopoulos a kol. 2005). Přesto ochrana vodní biologické diverzity za tou suchozemskou značně zaostává (Brooks a kol. 2006; Nei a kol. 2009). Vlivu člověka nezůstává ušetřena ani genetická variabilita a strukturace populací ryb, které člověk ovlivňuje jak přímo (manipulací s rybami) tak i nepřímo (ovlivňováním jejich životního prostředí). Za přímé vlivy lze považovat praktiky rybářského hospodaření ve volných vodách. Rybáři se při lovu specializují na určité druhy ryb a jejich velikostní skupiny. Bylo prokázáno, že takováto záměrná selekce u nejčastěji lovených populací mořských ryb může způsobit zmenšení průměrné velikosti jejich těla při dosažení pohlavní zralosti (např. Hutchings a Reynolds 2004; Swain a kol. 2007; Miethe a kol. 2010), což může následně zvyšovat i jejich přirozenou mortalitu (Swain 2010). Ve sladkých volných vodách dochází vlivem rybolovu, nechtěných úniků ryb z akvakultury jakožto i záměrného vysazování ryb do volných vod k výrazným změnám populací i v druhovém složení rybích společenstev (Kottelat a Freyhof 2007). Podpůrným vysazováním je suplován úbytek početnosti populací některých druhů ryb. Vysazované násady jsou obvykle produkty umělého výtěru a odchovu, kdy dochází k významnému zásahu do genofondu populace, neboť dojde k velmi úspěšnému rozmnožení několika málo vybraných jedinců (Fraser 2008). Ryby často mívají velmi vysokou plodnost, kterou představují až miliony jiker (Peňáz 1995). Přežití raných vývojových stadií ryb, která se vyznačují nejvyšší mortalitou, je mnohonásobně vyšší v líhních, než volných vodách (Ferguson 2007). Vliv umělého výtěru na genetickou variabilitu zdrojové populace je tak značný a v některých ohledech dokonce srovnatelný s tzv. „průchodem hrdlem lahve“ (Hansen a kol. 2000).
10 Přesto je podpora přirozené reprodukce rybami, jejichž rodiče však musejí pocházet z téže oblasti, zřejmě tím nejvhodnějším způsobem, kterým lze suplovat snižování početnosti populací ryb, které jsou pod silným rybářským tlakem. Volbou vhodné metodiky tak lze riziko dalšího poklesu genetické variability divokých populací snížit (Ferguson 2007; McClure a kol. 2008; Ballou a kol. 2010). Skutečnost, že jsou násadové ryby často transportovány a vysazovány v oblastech značně vzdálených od míst jejich původu, však vede k hybridizaci a genetické homogenizaci volně žijících populací a ke smývání přirozeného fylogeografického vzoru (Olden 2004; Taylor 2004; Sanz a kol. 2006; Ferguson a kol. 2007; Mabuchi a kol. 2008; Randi 2008; Muhlfeld a kol. 2009). Ještě výraznější dopad na původní populace může mít vypouštění kulturních a domestikovaných linií téhož druhu z akvakultury. Chovné linie jsou obvykle předmětem plemenitby a často jsou šlechtěny na konkrétní užitkové vlastnosti. Díky neuvážené podpoře přirozené reprodukce tak divoké populace mohou ztratit své lokální adaptace, přizpůsobivost a plasticitu, což vede ke snižování jejich reprodukční zdatnosti – fitness (např. Allendorf a kol. 2001; Araki a kol. 2008; Hutchings a Fraser 2008; Fraser a kol. 2010; Marie a kol. 2010). Zvláštním případem je vysazování druhů mimo oblast jejich přirozeného výskytu. Přestože jsou dnes již dobře známa mnohá rizika, která s sebou introdukce exotických druhů přináší (např. Pimentel a kol. 2000, 2005), v případě ryb k ní často stále dochází záměrně a to především u hospodářsky významných druhů (Lintermans 2004). Detailní znalost introdukovaných populací je nutným předpokladem pro schopnost věrohodně odhadnout možný dopad na místní ekosystémy i míru nebezpečí pro autochtonní organismy plynoucí z pravděpodobnosti naturalizace exotických druhů. Nepřímých antropogenních vlivů na genetickou strukturu populací ryb je mnoho a mnoho jich zřejmě ani dosud nebylo rozpoznáno. Ve své disertační práci tyto vliv těchto jevů nestuduji a tak se k nim vyjádřím jen velmi stručně. Často se jedná o další vlivy, které smývají habitatovou segregaci druhů a indukují hybridizaci. Významný vliv na genetickou strukturu populací ryb proto mají vodní díla (Poff a kol. 2007). Patří mezi ně jak propojování původně oddělených povodí kanály, tak fragmentace přehradami nebo jezy. Díky změnám charakteru vod jak na makrohabitatové tak mikrohabitatové úrovni může docházet k prostorovému i časovému překryvu výtěru různých druhů ryb (např. Balon 1992). Výrazná změna charakteru substrátu, hloubky, proudění a teploty může vést nejen k výrazným změnám ve druhovém složení obsádky (De Leeuw a kol. 2007; Schmutz a kol. 2007), ale i k tvrdé selekci určitých fenotypů, či kolapsu reprodukčně izolačních mechanizmů a masové mezidruhové hybridizaci (např. Balon 1992). Dalším příkladem může být hybridizace cejna obecného s ploticí obecnou (Abramis brama x Rutilus rutilus) na mnoha lokalitách po celé Evropě (Hayden a kol. 2010). Kromě vodních staveb
11 člověk svou činností indukuje změny obsahu rozptýlených částic a rozpuštěných látek ve vodě. Tyto faktory mohou mít podstatný vliv např. na inkubaci jiker, parazitaci ryb aj. (Lafferty 2008; Roni a kol. 2010). Znečištění vod neurohumorálně aktivními látkami může u některých druhů indukovat hermafroditismus nebo zvrat pohlaví (Jobling a Tyler 2003). To vše může vést nejen k nabourávání reprodukčně izolačních mechanismů, ale i k významným změnám v genetické struktuře populací a složení ichtyofauny volných vod vůbec. V člověkem narušených ekosystémech potom mohou mít tendenci dominovat nepůvodní (invazní) druhy (Litchman 2010).
12 1.4. Lín obecný Tinca tinca (Linnaeus, 1758) jako modelový druh
Lín obecný je domestikovaným (Bilio 2007) cyprinoidem, jehož fylogeografická historie dosud byla navzdory širokému areálu rozšíření a významu v evropské akvakultuře (Šusta 1884; Steffens 1995) prakticky neznámá. Nejstarší písemný záznam o rybě, zvané „tinca“ vytvořil nejpravděpodobněji Decimius Magnus Ausonius roku 370 n. l. v poemu o řece Mosella protékající současnou severní Francií (bývalou Galií) a slovo „tinca“ je pravděpodobně Galského původu (Giovio 1524). V Čechách je lín chován v rybnících jako doplňková ryba spolu s kaprem minimálně od počátku 18. století (Šusta 1884). Tento systém jeho produkce existuje v mnoha oblastech dodnes (Steffens 1995). Přestože je lín obecný i nyní hospodářsky významnou a komerčně zajímavou rybou, která zažívá intenzivní domestikaci (Hulata 1995; Gela a kol. 1998), ve velké části původního areálu, který pravděpodobně sahá od Velké Británie přes Kaspické úmoří po jezero Bajkal (Brylińska a kol. 1999a), se stále ještě rozmnožuje přirozeně. Hlavním cílem mé disertační práce bylo zjistit, do jaké míry je současná fylogeografická struktura přírodních populací ovlivněna transferem ryb v důsledku rybářského hospodaření a do jaké míry odráží přirozené demografické a biogeografické změny, ke kterým docházelo v souvislosti s vývojem klimatu v průběhu čtvrtohor (Hewitt 2004). Z pohledu zoologické systematiky je lín obecný jediným žijícím druhem rodu Tinca Cuvier, 1816. Již Kryžanovskij (1947) jej oddělil do zvláštní podčeledi Tincinae, což však mnozí systematici později zpochybňovali (viz. Howes 1991). V rámci nadčeledi Cyprinoidea, což je velmi druhově bohatá skupina recentních sladkovodních ryb (Chen a Mayden 2009), je jeho postavení stále nejasné (Briolay a kol. 1998) a příliš světla do rekonstrukce jeho genealogie nevnesly ani recentní molekulárně-fylogenetické studie. Na základě výsledků studie založené na kombinaci dat získaných sekvenací mitochondriální kontrolní oblasti, cytochromu b a 16S rDNA byl Gillesem a kol. (2001) zařazen do blízkosti nejstarobylejších podčeledí Rasborinae a Cyprininae, jako sesterská skupina všech ostatních druhů čeledi Cyprinidae. V současnosti jsou tyto skupiny považovány za samostatné čeledi a lín byl oddělen do monotypické čeledi Tincidae, které se zdají být fylogeneticky nejbližší čeledi Acheilognathidae a Tanichthyidae (Chen a Mayden 2009). Paleontologicky je rod Tinca doložen od středního miocénu z Německa (Gaudant 1980, Böhme 2002). Obrhelová a Obrhel (1987) uvádějí výskyt tohoto rodu na území bývalé ČSSR (Fiľakovo, SK) až z pliocénu. Známo je celkem asi devět fosilních druhů rodu Tinca (Černý 1995). Ve fosilním záznamu na území ČR uvádí Obrhelová (1977) zástupce blízce příbuzných rodů (Protothymallus – oligocén; Palaeotinca – spodní až střední miocén). Nejstarší zmiňovaná fosilie druhu Tinca tinca pochází ze svrchního pliocénu Itálie (Pieragnoli 1931 citován Brylińskou a kol.
13 1999b), avšak tento nález dle některých autorů vyžaduje verifikaci (Brylińska a kol. 1999b). Běžně se však lín obecný vyskytuje od pleistocénu v Holandsku, Německu, Polsku, Rakousku a Maďarsku (Gaudant 1979; Böhme a Ilg 2010) a Británii (Lister a kol. 1990), v povodí Kaspického a Černého moře (Lebeděv 1960) a na západní Sibiři (Shtylko 1934 citován Brylińskou a kol. 1999a). Glaciály pravděpodobně přežíval v několika jižně položených refugiích a během interglaciálů, stejně tak jako v postglaciálu, opakovaně rekolonizoval vodnatými toky za ustupujícím ledovcem preglaciální areál (Thienemann 1950). Skandinávský poloostrov pravděpodobně osídlil během sladkovodní fáze vývoje Baltského moře (Thienemann 1925, 1950), zvané Ancylové jezero 1(De Geer 1890) před ~10,700-8,500 lety (Björck 2008). Lína obecného lze v současnosti nalézt na všech kontinentech kromě Antarktidy, za což vděčí rozsáhlým introdukcím (Welcomme 1988; Brylińska a kol.1999b). Problém v rekonstrukci přirozeného areálu rozšíření představují především nezaznamenané introdukce prováděné na jeho hranicích, které jsou velmi těžko odlišitelné od spontánního šíření podmíněného např. efektem „river capture“2. První záznamy o introdukcích línů v rámci Evropy pocházejí z počátku 18.století (Kennedy & Fitzmaurice 1970). Je však velmi pravděpodobné, že k nim docházelo již dříve. Molekulárními markery, jimiž byl lín dosud studován na populační úrovni, jsou alozymy (Šlechtová a kol. 1995; Kohlmann a Kersten 1998), mikrosatelity (Kohlmann a Kersten 2006; Kohlmann a kol. 2010) a restrikčními enzymy štěpené úseky mtDNA (Lo Presti a kol. 2009). Tyto studie jsou však pouze lokálního charakteru a nepřinášejí komplexní vhled do fylogeografické historie druhu. Některá zjištění byla navíc shledána obtížně interpretovatelnými, s největší pravděpodobností z důvodu absence širšího fylogeografického kontextu (viz. např. Kohlmann a kol. 2010).
1 Jako Ancylové jezero byla tato etapa vývoje Baltského moře nazvána díky sladkovodnímu mlži kamomilu říčnímu (Ancylus fluviatilis), který se tam v této etapě hojně vyskytoval. 2 Proces, kdy v důsledku eroze, či zablokování původního koryta, řeka nebo její část změní směr svého toku tak, že následně teče do jiného povodí. Všechny organismy obývající tuto část řeky změní svou příslušnost k novému povodí společně s ní. K tomuto geologickému jevu zcela jistě docházelo ve zvýšené míře v postglaciálních obdobích, kdy masy vody z tajících horských ledovců způsobovaly zvýšenou erozi, vytváření příledovcových jezer, dočasných toků a nových říčních spojení, čímž umožnily migraci chladnomilné sladkovodní fauny do nových oblastí a genetický tok mezi dočasně izolovanými populacemi (Arkhipov a kol. 1995).
14 1.5. Cíle práce
Cílem mojí disertační práce bylo provést fylogeografickou studii lína v rámci celého jeho areálu rozšíření s použitím různých molekulárních markerů, identifikovat zodpovědné evoluční procesy a rekonstruovat historické události, které měly na fylogeografii lína rozhodující vliv. Dále bylo mým cílem z těchto dat určit vliv rybářského hospodaření na fylogeografii lína a získat podklady pro informovaný management lína ve volných vodách i v akvakultuře. Z praktického hlediska bylo užitečné navrhnout metodiku pro identifikaci geneticky a fylogeograficky odlišných populaci, která umožní další zpřesňování našich znalostí o evoluční historii lína včetně vlivu člověka. Moje disertační práce je proto tvořena třemi ucelenými studiemi, které však na sebe vzájemně úzce navazují. Všechny tři studie jsem zveřejnil v impaktovaných vědeckých časopisech.
Článek 1. Lajbner Z., Linhart O., Kotlík P. (in press) Human-aided dispersal has altered but not erased the phylogeography of the tench. Evol. Appl. (doi:10.1111/j.1752-4571.2010.00174.x).
Touto publikací, která je publikována v časopise Evolutionary Applications, představuji výsledky fylogeografické studie lína v celém areálu jeho rozšíření založené na sekvencích DNA jednoho mitochondriálního a třech jaderných genů. Kromě přirozeného areálu hodnotím i fylogeografii známých introdukcí a také řady chovných linií.
Článek 2. Lajbner Z., Kotlík P. (Early View; 20 SEP 2010) PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca. Mol. Ecol. Resour. (doi: 10.1111/j.1755-0998.2010.02914.x).
Článek zveřejněný v časopise Molecular Ecology Resources popisuje nové RFLP markery, které jsem vyvinul pro rychlou identifikaci fylogeograficky odlišných populací lína a shrnuje možnosti jejich využití při charakterizaci populací lína v chovech i ve volných vodách.
Článek 3. Lajbner Z., Kohlmann K., Linhart O., Kotlík P. (2010) Lack of reproductive isolation between the Western and Eastern phylogroups of the tench. Rev. Fish Biol. Fisher. 20, 289-300. (doi: 10.1007/s11160-009-9137-y).
S využitím alozymových, mikrosatelitových a nově vyvinutých RFLP markerů v této práci zveřejněné v časopise Reviews in Fish Biology and Fisheries testuji existenci reprodukčně- izolačních mechanizmů v oblasti postglaciálního kontaktu a hybridizace dvou geneticky odlišných populací lína.
15 1.6. Seznam použité literatury:
Allendorf FW, Leary RF, Spruell P, Wenburg JK (2001) The problems with hybrids: setting conservation guidelines. Trends in Ecology and Evolution 16:613-622. Anderson EC, Thompson EA (2002) A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160:1217-1299. Araki H, Berejikian BA, Ford MJ, Blouin MS (2008) Fitness of hatchery-reared salmonids in the wild. Evolutionary Applications 1:342-355. Arkhipov SA, Ehlers J, Johnson RG, Wright HE Jr (1995) Glacial drainages towards the Mediterranean during middle and late Pleistocene. Boreas 24:196-206. Avise JC (1994) Molecular markers, natural history and evolution. Chapman and Hall, New York. Avise JC (1998) The history and preview of phylogeography: a personal reflection. Molecular Ecology 7:371-379. Avise JC (2000) Phylogeography: The history and formation of species. Harvard University Press, Cambridge. Avise JC (2010) Perspective: conservation genetics enters the genomics era. Conservation Genetics 11:665-669. Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC (1987) Intraspecific phylogeography - the mitochondrial-DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics 18:489-522. Avise JC, Robinson TJ (2008) Hemiplasy: a new term in the lexicon of phylogenetics. Systematic Biology 57:503-507. Balon EK (1992) How dams on the River Danube might have caused hybridisation and influenced the appearance of new cyprinid taxon. Environmental Biology of Fishes 33:167-180. Ballou JD, Lees C, Faust LJ, Long S, Lynch C, Bingaman-Lackey L, Foose TJ (2010) Demographic and genetic management of captive populations. In: Kleiman D (ed) Wild mammals in captivity. University of Chicago Press, Chicago, 219-252. Bănărescu PM (1991) Zoogeography of fresh waters, 2: Distribution and dispersal of fresh water animals in North America and Eurasia. AULA-Verlag, Wiesbaden. Beerli P, Felsenstein J (1999) Maximum-likelihood estimation of migration rates and effective population numbers in two populations using a coalescent approach. Genetics 152:763-773. Bilio M (2007) Controlled reproduction and domestication in aquaculture - the current state of the art, Part I. Aquaculture Europe 32/1:5-14.
16 Birky CW Jr, Fuerst P, Maruyama T (1989) Organelle gene diversity under migration, mutation and drift: equilibrium expectations, approach to equilibrium, effects of heteroplasmic cells, and comparisons to nuclear genes. Genetics 121:613-627. Björck S (2008) The late Quaternary development of the Baltic Sea basin. In: The BACC author Team (eds) Assessment of climate change for the Baltic Sea Basin. Springer-Verlag, Berlin, 398-407. Bonfil R, Meyer M, Scholl M, Johnson R, O'Brien S, Oosthuizen H, Swanson S, Kotze D, Paterson M (2005) Transoceanic migration, spatial dynamics, and population linkages of white sharks. Science 310:100-103. Böhme M (2002) Freshwater fishes from the Pannonian of the Vienna Basin with special reference to the locality Sandberg near Götzendorf, Lower Austria. Courier Forschungsinstitut Senckenberg 237:151-173. Böhme M, Ilg A (2010) Database of fossil fishes, amphibians, reptiles (fosFARbase). www.wahre-staerke.com Briolay J, Galtier N, Brito RM, Bouvet Y (1998) Molecular phylogeny of Cyprinidae inferred from cytochrome b DNA sequences. Molecular Phylogenetics and Evolution 9:100-108. Brooks TM, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Rylands AB, Konstant WR, Flick P, Pilgrim J, Oldfield S, Magin G, Hilton-Taylor C (2002) Habitat loss and extinction in the hotspots of biodiversity. Conservation Biology 16:909-923. Brylińska M, Bryliński E, Bănărescu PM (1999a) Tinca Cuvier, 1817. In: Bănărescu PM (ed) The Freshwater Fishes of Europe, 5/I: Cyprinidae 2/I. AULA-Verlag,Wiesbaden, 225-229. Brylińska M, Bryliński E, Bnińska M (1999b) Tinca tinca (Linnaeus, 1758). In: Bănărescu PM (ed) The Freshwater Fishes of Europe, 5/I: Cyprinidae 2/I. AULA-Verlag, Wiesbaden, 229-302. Carlton JT, Geller JB (1993) Ecological roulette: the global transport of nonindigenous marine organisms. Science 261:78-82. Clavero M, Garcia-Berthou E (2005) Invasive species are a leading cause of animal extinctions. Trends in Ecology and Evolution 20:110. Courchamp F, Angulo E, Rivalan P, Hall RJ, Signoret L, Bull L, Meinard Y (2006) Rarity value and species extinction: the anthropogenic Allee effect. Public Library of Science Biology 4:2405-2410. Crutzen PJ (2002) Geology of mankind - The Anthropocene. Nature 415:23. Černý K (1995) Rod Tinca Cuvier, 1817 - Lín, Lieň. In: Baruš V, Oliva O (eds) Fauna ČR a SR / Mihulovci a ryby 2. Academia, Praha, 80.
17 De Geer G (1890) Om Skandinaviens nivåförändringar under quartärtiden. Geologiska Föreningens i Stockholm Förhandlingar 12:61-110. De Leeuw JJ, Buijse AD, Haidvogl G, Lapinska M, Noble R, Repecka R, Virbickas T, Wiśniewolski W, Wolter C (2007) Challenges in developing fish-based ecological assessment methods for large floodplain rivers. Fisheries Management and Ecology 14:483-494. Degnan JH, Rosenberg NA (2009) Gene tree discordance, phylogenetic inference, and the multispecies coalescent. Trends in Ecology and Evolution 24:332-340. Dowling TE, Secor CL (1997) The role of hybridization and introgression in thediversification of animals. Annual Reviews in Ecology and Systematics 28:593-619. Dupanloup I, Schneider S, Excoffier L (2002) A simulation annealing approach to define the genetic structure of populations. Molecular Ecology 11:2571-2581. Durand JD, Persat H, Bouvet Y (1999) Phylogeography and postglacial dispersion of the chub (Leuciscus cephalus) in Europe. Molecular Ecology 8:989-997. Dynesius M, Jansson R (2000) Evolutionary consequences of changes in species’ geographical distributions driven by Milankovitch climate oscillations. Proceedings of the National Academy of Sciences USA 97:9115-9120. Elton CS (1958) The Ecology of Invasion by Animals and Plants. Chapman and Hall, London. Emerson KJ, Merz CR, Catchen JM, Hohenlohe PA, Cresko WA, Bradshaw WE, Holzapfel CM (2010) Resolving postglacial phylogeography using high-throughput sequencing. Proceedings of the National Academy of Sciences USA 107:16196-16200. Excoffier L (2004) Patterns of DNA sequence diversity and genetic structure after a range expansion: lessons from the infinite-island model. Molecular Ecology 13:853-864. Ferguson A, Fleming I, Hindar K, Skaala Ø, McGinnity P, Cross TF, Prodöhl P (2007) Farm escapes. In: Verspoor E, Stradmeyer L, Nielsen J (eds) The Atlantic Salmon: Genetics, Conservation and Management. Blackwell, Oxford, 357-398. Fraser DJ (2008) How well can captive breeding programs conserve biodiversity? Evolutionary Applications 1:535-586. Fraser DJ, Houde ALS, Debes PV, O’Reilly P, Eddington JD, Hutchings JA (2010) Consequences of farmed-wild hybridization across divergent wild populations and multiple traits in salmon. Ecological Applications 20:935-953. Fu YX (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147:915-925. Gaudant J (1979) L' ichthyofaune tiglienne de Tegelen (Pays-Bas), signification paléoécologique et paléoclimatique. Scripta Geologica 50:1-16.
18 Gaudant J (1980) Mise au point sur l'ichthyofaune d'Ohningen. (Baden, Allemagne). - Comptes Rendus de l'AcadEmie des Sciences, Paris (D) 291:1033-1036. Gela D, Linhart O, Flajšhans M, Duda P (1998) A live gene bank of tench, Tinca tinca (L.) strains in the Czech Republic. Polish Archives of Hydrobiology 45:311-314. Giovio P (1524) De Romanis piscibus libellus. F. Minitius Caluus, Rome. Gilles A, Lecointre G, Miquelis A, Loerstcher M, Chappaz R, Brun G (2001) Partial combination applied to phylogeny of European cyprinids using the mitochondrial control region. Molecular Phylogenetics and Evolution 19:22-33. Gillespie R (2008) Updating Martin's global extinction model. Quaternary Science Reviews 27:2522-2529. Guillot G, Leblois R, Coulon A, Frantz AC (2009) Statistical methods in spatial genetics. Molecular Ecology 18:4734-4756. Guisan A, Thuiller W (2005) Predicting species distribution: offering more than simple habitat models. Ecology Letters 8:993-1009. Haig SM (1998) Molecular contributions to conservation. Ecology 79:413-425. Halpern BS, Walbridge S, Selkoe KA, Kappel CV, Micheli F, D’Agrosa C, Bruno JF, Casey KS, Ebert C, Fox HE, Fujita R, Heinemann D, Lenihan HS, Madin EMP, Perry MT, Selig ER, Spalding M, Steneck R, Watson R (2008) A global map of human impact on marine ecosystems. Science 319:948-952. Hamilton M (2009) Population genetics. Wiley-Blackwell, New York. Hansen MM, Nielsen EE, Ruzzante DE, Bouza C, Mensberg K-LD (2000) Genetic monitoring of supportive breeding in brown trout (Salmo trutta L.), using microsatellite DNA markers. Canadian Journal of Fisheries and Aquatic Sciences 57:2130-2139. Hayden B, Pulcini D, Kelly-Quinn M, O'Grady M, Caffrey J, McGrath A, Mariani S (2010) Hybridisation between two cyprinid fishes in a novel habitat: genetics, morphology and life- history traits. BMC Evolutionary Biology 10:169. Hewitt GM (2004) Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transasctions of the Royal Society London B 359:183-195. Hofreiter M, Serre D, Rohland N, Rabeder G, Nagel D, Conard N, Münzel S, Pääbo S (2004) Lack of phylogeography in European mammals before the last glaciation. Proceedings of the National Academy of Sciences USA 101:12963-12968. Howes GJ (1991) Systematics and biogeography: an overview. In: Winfield IJ, Nelson JS (eds) Cyprinid Fishes, Systematics, biology and exploitation. Chapmann and Hall, London, 1-33. Hubbs CL (1955) Hybridization between fish species in nature. Systematic Zoology 4:1-20.
19 Hulata G (1995) A review of genetic improvement of the common carp (Cyprinus carpio L.) and other cyprinids by crossbreeding, hybridization and selection. Aquaculture 129:142-155. Hutchings JA, Reynolds JD (2004) Marine fish population collapses: consequences for recovery and extinction risk. BioScience 54:297-309. Hutchings JA, Fraser DJ (2008) The nature of fisheries-and farming-induced evolution. Molecular Ecology 17:294-313. Chen WJ, Mayden RL (2009) Molecular systematics of the Cyprinoidea (Teleostei: Cypriniformes), the world’s largest clade of freshwater fishes: Further evidence from six nuclear genes. Molecular Phylogenetics and Evolution 52:544-549. Chepalyga AL (2007) The late glacial great flood in the Ponto-Caspian basin. In: Yanko-Hombach V, Gilbert AS, Panin N, Dolukhanov PM (eds) The Black Sea lood question: changes in coastline, climate and human settlement. Springer, Dordrecht, 119-148. Jenkins M (2003) Prospects for biodiversity. Science 302:1175-1177. Jobling S, Tyler CR (2003) Endocrine disruption, parasites and pollutants in wild freshwater fish. Parasitology 126:S103-S108. Kasse C, Hoek WZ, Bohncke SJP, Konert M, Weijers JWH, Cassee ML, Van der Zee RM (2005) Late Glacial fluvial response of the Niers-Rhine (western Germany) to climate and vegetation change. Journal of Quaternary Science 20:377-394. Kennedy M, Fitzmaurice P (1970) The biology of the tench Tinca tinca (L.) in Irish waters. Proceedings of the Royal Irish Academy 69B:31-82. Kingman JFC (1982) The coalescent. Stochastic Processes Applications 13:235-248. Knowles LL (2009) Statistical phylogeography. Annual Review of Ecology, Evolution, and Systematics 40:593-612. Knowles LL, Maddison WP. 2002. Statistical phylogeography. Molecular Ecology 11:2623-2635. Kohlmann K, Kersten P (1998) Enzyme variability in a wild population of tench (Tinca tinca). Polish Archives of Hydrobiology 45:303-310. Kohlmann K, Kersten P (2006) Microsatellite loci in tench: isolation and variability in a test population. Aquaculture International 14:3-7. Kohlmann K, Kersten P, Panicz P, Memiş D, Flajšhans M (2010) Genetic variability and differentiation of wild and cultured tench populations inferred from microsatellite loci. Reviews in Fish Biology and Fisheries 20:279-288. Kotlík P, Berrebi P (2001) Phylogeography of the barbel (Barbus barbus) assessed by mitochondrial DNA variation. Molecular Ecology 10:2177-2185. Kotlík P, Bogutskaya NG, Ekmekçi FG (2004) Circum Black Sea phylogeography of Barbus freshwater fishes: divergence in the Pontic glacial refugium. Molecular Ecology 13:87-95.
20 Kottelat M, Freyhof J (2007) Handbook of European freshwater fishes. Kottelat, Cornol and Freyhof, Berlin. Kryžanovskij SG (1947) Sistema semejstva karpovych ryb. Zoologičeskij Žurnal 25:53-64 (Rusky). Kuhner MK, Yamato J, Felsenstein J (1995) Estimating effective population size and mutation rate from sequence data using Metropolis-Hastings sampling. Genetics 140:1421-1430. Lafferty KD (2008) Ecosystem consequences of fish parasites. Journal of Fish Biology 73:2083-2093. Lajbner Z (2004) Využití cytonukleárních genetických markerů při studiu mezidruhového křížení parem (rod Barbus) v přírodní populaci. Diplomová práce. Univerzita Karlova, Přírodovědecká fakulta, Praha. Lajbner Z, Šlechtová V, Šlechta V, Švátora M, Berrebi P, Kotlík P (2009) Rare and asymmetrical hybridization of the endemic Barbus carpathicus with its widespread congener B. barbus. Journal of Fish Biology 74:418-436. Lebedev VD (1960) Quaternary freshwater fish fauna of European part of USSR. Izdatelstvo Moskovskovo universiteta, Leningrad (Rusky). Lintermans M (2004) Human assisted dispersal of alien freshwater fish in Australia. New Zealand Journal of Marine and Freshwater Research 38:481-501. Lister AM, McGlade JM, Stuart AJ (1990) The early Middle Pleistocene vertebrate fauna from Little Oakley, Essex. Philosophical Transactions of the Royal Society of London, series B 328:359-385. Litchman E (2010) Invisible invaders: non-pathogenic invasive microbes in aquatic and terrestrial ecosystems. Ecology Letters 13:1560-1572. Lo Presti R, Gasco L, Lisa C, Zoccarato I, Di Stasio L (2009) PCR-RFLP analysis of mitochondrial DNA in tench (Tinca tinca L.). Journal of Fish Biology 76:401-407. Mabuchi K, Senou H, Nishida M (2008) Mitochondrial DNA analysis reveals cryptic large-scale invasion of non-native genotypes of common carp (Cyprinus carpio) in Japan. Molecular Ecology 17:796-809. Maddison WP (2008) Coalescence package for Mesquite. Version 2.5. http://mesquiteproject.org Makhrov AA, Bolotov IN (2006) Dispersal routes and species identification of freshwater animals in northern Europe: a review of molecular evidence. Russian Journal of Genetics 42:1101- 1115.
21 Marková S, Šanda R, Crivelli A, Shumka S,Wilson IF, Vukić J, Berrebi P, Kotlík P (2010) Nuclear and mitochondrial DNA sequence data reveal the evolutionary history of Barbus (Cyprinidae) in the ancient lake systems of the Balkans. Molecular Phylogenetics and Evolution 55:488-500. Marie AD, Bernatchez L, Garant D (2010) Loss of genetic integrity correlates with stocking intensity in brook charr (Salvelinus fontinalis). Molecular Ecology 19:2025-2037. Martin PS (1966) Africa and Pleistocene overkill. Nature 212:339-342. Matute DR (2010) Reinforcement of gametic isolation in Drosophila. Public Library of Science Biology 8:e1000341. Mayr E (1963) Animal species and evolution. Harvard University Press, Cambridge. McClure M, Utter F, Baldwin C, Carmichael R, Hassemer P, Howell P, Spruell P, Cooney TD, Schaller HA, Petrosky CE (2008) Evolutionary effects of alternative artificial propagation programs: implications for the viability of endangered anadromous salmonids. Evolutionary Applications 1:356-375. McCune AR, Lovejoy NJ (1998) The relative rate of sympatric and allopatric speciation in fishes: tests using DNA sequence divergence between sister species and among clades. In: Howard DJ, Berlocher SH (eds) Endless forms: species and speciation. Oxford University Press, New York, 172-185. Miethe T, Dytham C, Dieckmann U, Pitchford JW (2010) Marine reserves and the evolutionary effects of fishing on size at maturation. ICES Journal of Marine Science 67:412-425. Mooney HA, Cleland EE (2001) The evolutionary impact of invasive species. Proceedings of the National Academy of Sciences USA 98:5446-5451. Moore WS (1995) Inferring phylogenies from mtDNA variation: mitochondrial-gene trees versus nuclear-gene trees. Evolution 49:718-726. Muhlfeld CC, Kalinowski ST, McMahon TE, Taper ML, Painter S, Leary RF, Allendorf FW (2009) Hybridization rapidly reduces fitness of a native trout in the wild. Biology Letters 5:328-331. Nei JL, Roux DJ, Abell R, Ashton PJ, Cowling RM, Higgins JV, Thieme M, Viers JH (2009) Progress and challenges in freshwater conservation planning. Aquatic Conservation: Marine and Freshwater Ecosystems 19:474-485. Nielsen R, Beaumont MA (2009) Statistical inferences in phylogeography. Molecular Ecology 18:1034-1047. Noor MAF (1999) Reinforcement and other consequences of sympatry. Heredity 83:503–508. Obrhelová N (1977) Süßwasser-Ichthyofauna im Tertiär der ČSSR. Časopis pro mineralogii a geologii 24/2:135-146.
22 Obrhelová N, Obrhel J (1987) Paläoichthyologie und Paläoökologie des kontinentalen Tertiärs und Quartärs der ČSSR. Zeitschrift für geologische Wissenschaften 15/6:709-731. Olden JD, Poff NL, Douglas MR, Douglas ME, Fausch KD (2004) Ecological and evolutionary consequences of biotic homogenization. Trends in Ecology and Evolution 19:18-24. Palumbi S (2001) Evolution - humans as the world’s greatest evolutionary force. Science 293:1786-1790. Peltier WR (2004) Global glacial isostasy and the surface of the Ice-age Earth: The ICE-5G (VM2) model and GRACE. Annual Review of Earth and Planetary Science 32:111-149. Peňáz M (1995) Rozmnožování. In: Fauna ČR a SR / Mihulovci a ryby 1 (eds Baruš V, Oliva O), 231-246, Academia, Praha. Pimentel D, Lach L, Zuniga R, Morrison D (2000) Environmental and economic costs of nonindigenous species in the United States. BioScience 50:53-65. Pimentel D, Zuniga R, Morrison D (2005) Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics 52:273-288. Poff NL, Olden JD, Merritt DM, Pepin DM (2007) Homogenization of regional river dynamics by dams and global biodiversity implications. Proceedings of the National Academy of Sciences USA 104:5732-5737. Rahel FJ (2002) Homogenization of freshwater faunas. Annual Reviews in Ecology and Systematics 33:291-315. Rogers AR, Harpending H (1992) Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9:552-569. Roni P, Pess G, Morley S (2010) Monitoring salmon stream restoration: Guidelines based on experience in the American Pacific Northwest. In: Kemp P (ed) Salmonid fisheries: Freshwater habitat management. John Wiley and Sons, Singapore, 119-143. Ryan WBF, Pitman III WC, Major CO, Shimkus K, Moskalenko V, Jones GA, Dimitrov P, Gorür N, Sakinç M, Yüce H (1997) An abrupt drowning of the Black Sea shelf. Marine Geology 138:119-126. Sanz N, Cortey M, Pla C, García-Marín JL (2006) Hatchery introgression blurs ancient hybridization between brown trout (Salmo trutta) lineages as indicated by complementary allozymes and mtDNA markers. Biological Conservation 130:278-289. Schmutz S, Cowx IG, Haidvogl G, Pont D (2007) Fish-based methods for assessing European running waters: a synthesis. Fisheries Management and Ecology 14:369-380.
23 Schwartz FJ (1981) World literature to fish hybrids with an analysis by family, species and hybrid. NOAA Technical Report NMFS SSRF-750, Suppl.1. U.S. Department of Commerce, National Oceanic and Atmospheric Administration, National Marine Fisheries Service, Seattle. Steffens W (1995) The tench (Tinca tinca L.), a neglected pond fish species. Polish Archives of Hydrobiology 42:161-180. Steffensen JP, Andersen KK, Bigler M, Clausen HB, Dahl-Jensen D, Fischer H, Goto-Azuma K, Hansson M, Johnsen SJ, Jouzel J, Masson-Delmotte V, Popp T, Rasmussen SO, Röthlisberger R, Ruth U, Stauffer B, Siggaard-Andersen ML, Sveinbjörnsdottir AE, Svensson A, White JWC (2008) High-resolution Greenland ice core data show abrupt climate change happens in few years. Science 321:680-684. Swain DP, Sinclair AF, Hanson JM (2007) Evolutionary response to size-selective mortality in an exploited fish population. Proceedings of the Royal Society B: Biological Sciences 274:1015-1022. Swain DP (2010) Life-history evolution and elevated natural mortality in a population of Atlantic cod (Gadus morhua). Evolutionary Applications (in press). doi:10.1111/j.1752-4571.2010.00128.x Stewart JR, Lister AM, Barnes I, Dalén L (2010) Refugia revisited: individualistic responses of species in space and time. Proceedings of the Royal Society B 277:661-671. Šlechtová V, Šlechta V, Valenta M (1995) Genetic protein variability in tench (Tinca tinca L.) stocks in Czech republic. Polish Archives of Hydrobiology 42:133-140. Šusta J (1884/1997): Výživa kapra a jeho družiny rybničné. Carpio, Třeboň. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595. Taylor EB (2004) Evolution in mixed company: evolutionary inferences from studies of natural hybridization in Salmonidae. In: Hendry AP, Stearns S (eds) Evolution illuminated. Salmon and their relatives. Oxford University Press, Oxford, 232-263. Templeton AR, Routman E, Phillips CA (1995) Separating population structure from population history-a cladistic analysis of the geographical distribution of mitochondrial DNA haplotypes in the tiger salamander, Ambystoma tigrinum. Genetics 140:767-782. Thienemann A (1925) Die Süßwasserfische Deutschlands. Eine tiergeografische Skizze. In: Demoll R, Maier HN (eds) Handbuch der Binnenfischerei Mitteleuropas. Verlag Schweizerbarthsche, Stuttgart, Band 3:1-32. Thienemann A (1950) Verbreitungsgeschichte der Süsswassertierwelt Europas. Die Binnengewässer, 18. E. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart.
24 Tsigenopoulos C, Kotlík P, Berrebi P (2002) Biogeography and pattern of gene flow among Barbus species (Teleostei: Cyprinidae) inhabiting the Italian Peninsula and neighbouring Adriatic drainages as revealed by allozyme and mitochondrial sequence data. Biological Journal of the Linnean Society 75:83-99. Turelli M, Barton NH, Coyne JA (2001) Theory and speciation. Trends in Ecology and Evolution 16:330-343. Turner GF (1999) What is a fish species? Reviews in Fish Biology and Fisheries 9:281-297. Valenta M, Ráb P, Stratil A, Kálal L, Oliva O (1979) Karyotypes, heterogeneity, and polymorphism of proteins in the tetraploid species Barbus meridionalis and its hybrids with Barbus barbus. In: Pavlitchenko VP (ed) Proceedings of the XVIth International Conference on Animal Blood Groups and Biochemical Polymorphism 4. The National Committee of the USSR, Leningrad 204-214. Verspoor E, Hammar J (1991) Introgressive hybridization in fishes: The biochemical evidence. Journal of Fish Biology (Suppl. A) 39:309-334. Wakeley J, Hey J (1997) Estimating ancestral population parameters. Genetics 145:847-855. Welcomme RL (1988) International introductions of inland aquatic species. FAO Fisheries Technical Paper 294. Food and Agriculture Organization of the United Nations, Rome. Xenopoulos MA, Lodge DM, Alcamow J, Märker M, Schulze K, Van Vuuren DP (2005) Scenarios of freshwater fish extinctions from climate change and water withdrawal. Global Change Biology 11:1557-1564.
25 2. Publikace
2.1. Human-aided dispersal has altered but not erased the phylogeography of the tench.
Lajbner Zdeněk, Linhart Otomar, Kotlík Petr (v tisku)
Evolutionary Applications. (doi:10.1111/j.1752-4571.2010.00174.x)
26 Human-aided dispersal has altered but not erased the phylogeography of the tench
Zdeněk Lajbner 1,2 , Otomar Linhart 3 and Petr Kotlík 1
1 Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Liběchov, Czech Republic 2 Department of Zoology, Faculty of Science, Charles University, Prague, Czech Republic 3 University of South Bohemia, České Budějovice, Faculty of Fisheries and Protection of Waters, Research Institute of Fish Culture and Hydrobiology at Vodňany, Czech Republic.
Correspondence: Zdeněk Lajbner, Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburská 89, 277 21 Liběchov, Czech Republic. e-mail: [email protected], phone: +420 315 639 516, fax: +420 315 639 510.
Abstract Human-aided dispersal can result in phylogeographical patterns that do not reflect natural historical processes, particularly in species prone to intentional translocations by humans. Here we use a multiple-gene sequencing approach to assess the effects of human-aided dispersal on phylogeography of the tench Tinca tinca, a widespread Eurasian freshwater fish with a long history in aquaculture. Spatial genetic analysis applied to sequence data from four unlinked loci and 67 geographic localities (38–382 gene copies per locus) defined two groups of populations that were little structured geographically but were significantly differentiated from each other, and it identified locations of major genetic breaks, which were concordant across genes and were driven by distributions of two phylogroups. This pattern most reasonably reflects isolation in two major glacial refugia and subsequent range expansions, with the Eastern and Western phylogroups remaining largely allopatric throughout the tench range. However, this phylogeographic variation was also present in all 17 cultured breeds studied and some populations at the western edge of the native range contained the Eastern phylogroup. Thus, natural processes have played an important role in structuring tench populations, but human-aided dispersal have also contributed significantly, with the admixed genetic composition of cultured breeds most likely contributing to the introgression.
Keywords Intron; mtDNA; secondary contact; species range; stocking; Tinca tinca
27 Introduction Determining the effects of human-aided dispersal and how it overlays with natural distributional changes is essential for the effective protection of species throughout their native ranges. Translocations that occur within the limits of the natural distribution of a species do not extend its range but instead superimpose new genetic signatures on the natural diversity patterns if they involve genetically divergent populations or domestic breeds (Taylor 2004; Ferguson et al. 2007; Stone et al. 2007; Mabuchi et al. 2008; Randi 2008; Muhlfeld et al. 2009). The impacts of such translocations are therefore more difficult to detect. Molecular phylogeography offers here a powerful tool, which can also be used to resolve the ‘cryptogenic’ nature of species whose status in a given area may be either native or introduced but where clear evidence for either origin is absent (Carlton 1996). The international trade and human-aided transport provides an effective dispersal mechanism in many aquatic organisms, and freshwater fishes in particular. Up until now, phylogeographic studies of European freshwater fishes were largely focused on species that were not targets of aquaculture (e.g. Durand et al. 1999; Kotlík and Berrebi 2001; Šlechtová et al. 2004; Bohlen et al. 2007; Šedivá et al. 2008). Few economically important species have been studied phylogeographically across their ranges, but even in those cases the focus has been primarily on putative native populations, assuming (or hoping for) negligible phylogeographic contribution of human-aided dispersal (see Nesbø et al. 1999; Triantafyllidis et al. 2002; Van Houdt et al. 2005). As the result, phylogeographic information is still lacking for many common fishes, despite their role in freshwater communities and economic importance. One such domesticated fish (Bilio 2007) with poorly known genetic structure (Kohlmann et al. 2010; Lo Presti et al. 2010) despite the ancient history in the European aquaculture and cuisine (Giovio 1524; Lebedev 1960; Steffens 1995; García-Berthou et al. 2007) is the tench Tinca tinca (Linnaeus, 1758). The tench is widely distributed between the British Isles and Iberian Peninsula in the west to central Siberia in the east (Fig. 1), but because it has been in cultivation in Europe for a long time (Šusta 1884; Steffens 1995), its exact native range is difficult to discern: in some areas (e.g. Spain: García-Berthou et al. 2007; Italy: Gherardi et al. 2008; Turchini and De Silva 2008), it may be either native or introduced but clear evidence for either origin is absent (i.e. it is cryptogenic there). There are records of tench introduction outside its native range from as early as the 18th century (e.g. to Ireland: Kennedy and Fitzmaurice 1970), and since then, introduced populations have been established on all continents except Antarctica (Welcomme 1988; Brylińska et al. 1999). In some countries it is even considered as an invasive, potentially harmful species due concerns over competition with native fish (e.g. Rowe 2004; Stokes et al. 2004; Hesthagen and Sandlund 2007; Rowe et al. 2008; De Vaney et al. 2009).
28 Distribution of genetic diversity of freshwater fishes is largely controlled by the island-like nature of their habitats (Bernatchez and Wilson 1998), and the present-day phylogeographic patterns of temperate species have been shaped primarily by isolation in multiple glacial refugia during the last glacial maximum (18 000-23 000 years ago), followed by range expansion and drainage isolation. Many widely distributed temperate freshwater fish species therefore show deep phylogeographic subdivisions (e.g. Durand et al. 1999; Bernatchez 2001; Kotlík and Berrebi 2001; Van Houdt et al. 2005; Kotlík et al. 2008; Hänfling et al. 2009). However, some species display only a limited or shallow phylogeographic structure, which is usually interpreted as the result of a recent dispersion from only one glacial refugium (Triantafyllidis et al. 2002; Bohlen et al. 2007). Alternatively, it can point to strong effects of human-aided translocations (Hänfling et al. 2009). The present study uses a multiple-gene sequencing approach (Brito and Edwards 2008) and barrier-detection statistics to test if the range-wide genetic variation of the tench shows a significant phylogeographic structure that can be explained by natural processes during the last glacial-interglacial cycle. Tench occupy all major freshwater regions in Europe, so that it should be possible to identify the contribution of different refugia (Fig. 1) to its present-day distribution. However, if human-aided dispersal significantly altered recent evolutionary history of the tench, the haplotypes could have been re-distributed among populations, wiping out any natural phylogeographic structure (Sanz et al. 2006). Captive breeding can produce admixed gene pools, increasing the homogenizing effect of human-aided dispersal. To assess this effect of hatchery practices, in addition to putative native populations we also sampled various cultured strains and known introduced populations outside the native range.
Figure 1 Putative native (olive) and part of non-native (violet) distribution range of the tench. Large areas where the origin is considered ambiguous are highlighted by orange. Locations of major freshwater glacial refugia in Europe, Western/ Atlantic (R1), Danubian (R2) and Ponto-Caspian (R3), are indicated. Sampling countries are labelled (codes: B, Belgium; BG, Bulgaria; BIH, Bosnia and Herzegovina; CH, Switzerland; CZ, Czech Republic; D, Germany; EST, Estonia; GB, Great Britain; H, Hungary; I, Italy; P, Portugal; RO, Romania; S, Sweden; SK, Slovakia). References to the map: Urchinov 1995; Brylińska et al. 1999; Mitrofanov and Petr 1999; Savvaitova and Petr 1999; Economidis et al. 2000; Wang et al. 2004; Innal and Erk’akan 2006; Hestagen and Sandlund 2007; Popov 2009; Mamilov et al. 2010.
29 Materials and methods Sampling Sampled populations were chosen to cover the majority of the natural range of the tench in Europe and Asia. Fin tissue samples were stored in 95% ethanol. A total of 225 individuals were collected from 76 populations and included 25 hatchery stocks and several known introductions (Fig. 2; Appendix A). A single specimen (MNHN 0000–1357) from the collection of the Museum National d'Histoire Naturelle in Paris, France, was sampled. We also analysed 16 Czech and foreign cultured tench breeds maintained in the live gene bank of the Research Institute of Fish Culture and Hydrobiology in Vodňany, Czech Republic (Gela et al. 1998; Flajšhans et al. 1999; Gela et al. 2006), and an Italian regional breed, the Golden hump tench of Poirino highland (Gasco et al. 2010).
Data collection Introns of three nuclear genes and a complete sequence of one mitochondrial gene (Table 1) were analysed by polymerase chain reaction (PCR) amplification from genomic DNA and direct sequencing. Total genomic DNA was extracted with QIAGEN DNeasy® Tissue Kit. The PCR conditions followed standard methods (Tsigenopoulos and Berrebi 2000; Machordom and Doadrio 2001). The resulting PCR products were purified using the Millipore Montage PCR centrifugal filter devices and were directly sequenced with the ABI PRISM BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and purified using DyeEx Spin Kit (Qiagen). The extension products were run on ABI 3730 or 3730xl automated sequencers. Sequences were assembled using SEQMAN II (DnaStar Inc.) with the default options. All sequence traces were inspected visually to check the accuracy of the heterozygous base calls (Hare and Palumbi 1999). Nucleotide sequences of each unique haplotypes were deposited in the GenBank database under the accession nos HM167935-HM167965. A part of nuclear DNA containing the second intron of the actin gene (Act) was amplified and sequenced using primers Act-2-R and Act-2-F described by Atarhouch et al. (2003). The intron of the gene coding for the ATP synthase beta subunit (ATPase) was amplified and sequenced using the primers described by Jarman et al. (2002). The first intron of the gene coding for the S7 ribosomal protein (RpS7) was amplified and sequenced using the primers S7RPEX1F and S7RPEX2R (Chow and Hazama 1998). Haplotypes were inferred from diploid sequence traces (Clark 1990; Won and Hey 2005) and verified by the use of fastPHASE (Scheet and Stephens 2006). The entire mitochondrial cytochrome b gene (Cytb) was amplified with the primers GluF and ThrR described by Machordom and Doadrio (2001) and sequenced with newly designed forward (5′ - AAACAACCCAACAGGACT - 3′) and reverse sequencing primers (5′ - CAAATAGGAAATATCATTCTG - 3′).
30
Figure 2 Geographical distribution of major clades and SAMOVA groups. Clade W is shown in red and clade E in blue for ATPase (a), Act (b) and RpS7 (c). For Cytb (d), clade W is in red, clade EA in blue, clade EC in green and clade EI in yellow. The same colours are used for the SAMOVA groups (e). Boxed data points to the right and left of the maps in (b) through (e) represent identities for two sites in North America and in China and New Zealand, respectively [see (a)]. For exact haplotype distribution and frequencies see Appendix A.
31 Data analyses Sequence analysis For each locus, we estimated the haplotype and nucleotide diversities and their variances (Nei 1987). To explore whether intragenic recombination may have affected the patterns of variation at Act, ATPase and RpS7, we used the four-gamete test (Hudson and Kaplan 1985). McDonald- Kreitman (1991) test was performed for Cytb to test for deviation from neutrality using an outgroup species and comparing different tench clades against each other. Tinca tinca is the only species in the family Tincidae, so that a sharpbelly species, Hemiculter leucisculus, from a related family Cultridae (Chen and Mayden 2009) has been used as the outgroup (GenBank Accession no. AF095608). All the calculations were performed using DNASP, version 4.50.3 (Rozas et al. 2003).
Phylogenetic and network analyses Rooted phylogenies were reconstructed by the maximum-likelihood criterion (ML) using PhyML version 3.0.1 (Guindon and Gascuel 2003). We used Akaike information criterion and jModelTest version 0.1 (Posada 2008) to identify the HKY+G model as the most suitable model of DNA substitution for the Cytb data and the TrN model for the RpS7 data. Sharpbelly RpS7 sequence was not available, so that a sequence (AY325789) of the rosy bitterling, Rhodeus ocellatus, from another related family Acheilognathidae was used to root the RpS7 tree. The robustness of the trees was assessed by the approximate likelihood ratio test (Anisimova and Gascuel 2006) and by bootstrap resampling (1000 replicates; Felsenstein 1985) using PhyML. A haplotype network was constructed for each gene by the statistical parsimony (Templeton et al. 1992) as implemented in TCS version 1.21 (Clement et al. 2000).
Inference of demographic history To examine past population dynamics we calculated two commonly used summary statistics D (Tajima 1989) and Fs (Fu 1997) with DnaSP and ARLEQUIN version 3.11 (Excoffier et al. 2005). Their significance was tested by generating random samples under constant population size using a coalescent simulation conditioned on the number of polymorphic sites (Ramírez-Soriano et al. 2008). For neutral markers, significant negative values can be expected in cases of population expansion (Tajima 1989; Fu 1997). As another way of assessing signatures of refugial expansion, we considered the distribution of the number of pairwise nucleotide differences (mismatch distribution) by contrasting observed distributions with those expected from models of population size change. We tested whether the data fitted the sudden demographic expansion model (Rogers and Harpending 1992)
32 or the instantaneous range expansion model (Excoffier 2004), using ARLEQUIN. The models were fitted to the data by a generalized non-linear least-square approach, which allowed the estimation of the parameter τ = t/2μ, the expansion time scaled by the mutation rate (Schneider and Excoffier 1999). A parametric bootstrapping approach (Schneider and Excoffier 1999) was used to obtain the probability that the observed data conform to the model using the sum of square deviations (SSD) between the observed and expected mismatch distribution as a test statistic. We considered a wide range of estimated Cytb mutation rates for fishes of about 0.005–0.125 substitutions per site per Myr, published by Dowling et al. (2002) and Burridge et al. (2008), respectively.
Spatial genetic analysis Two complementary barrier-detection methods were applied to identify any discontinuities in the geographic distribution of genetic variation (Guillot et al. 2009). The geographical component of the phylogeographic pattern was first assessed by the spatial analysis of molecular variance using SAMOVA version 1.0 (Dupanloup et al. 2002). The advantage of SAMOVA is that it removes bias in population designation because it does not make a priori group distinction for genetic analyses. It employs a simulated annealing procedure using geographical locations of the sampling sites to cluster the sites into a user-defined number of groups (K), so that the proportion of total genetic variance between groups (FCT) is maximized and the proportion of variation among sites within groups (FSC) minimized. Major barriers to the distribution of genetic variation were then estimated by the Monmonier’s (1973) maximum difference algorithm implemented in BARRIER version 2.2 (Manni et al. 2004), based on a matrix of the pairwise net genetic distances among sampling sites generated from DNA sequences using ARLEQUIN. The algorithm was applied to a network connecting the geographical coordinates of the sampling locations computed using Delaunay triangulation (Manni et al. 2004). Analyses were performed separately for each locus but on the same geographical network and the results were then combined to identify barriers supported by multiple loci; the locus ATPase was excluded due to its limited geographical coverage.
33 Coalescent simulation We conducted a series of simulation experiments to evaluate if a natural population that was founded by unrelated clades at the end of the Younger Dryas, and has been isolated from other populations since then, may still carry haplotypes from different clades. This situation would correspond, for example, to tench populations inhabiting lakes in deglaciated areas of northern Europe (see Lajbner et al. 2010). In each experiment, we simulated 10 000 coalescent trees using Mesquite version 2.5 (Maddison 2008; Maddison and Maddison 2008) to estimate the distribution of the time to the most recent common ancestor (TMRCA) in such a population, and we counted the trees deeper than 3000 generations, approximately corresponding to the end of the Younger Dryas c. 11,500 years ago (Muscheler et al. 2008) and the generation time of four years (Monich
1953; Pekař 1965). We parameterized the simulations by female effective population size (Nef) values corresponding to known population densities of tench (c. 100–500 individuals per hectare; Lusk et al. 1998) and a lake area between 10 and 400 hectares, and assuming an equal sex ratio
(Monich 1953) and the ratio of the effective population size to the adult census size, Ne/N, of 0.3 (Turner et al. 2006). We focused on the female component of population, which is represented in our data by mtDNA variation, because of its relatively shallower coalescence-time depth and therefore shorter expected TMRCA compared with autosomal loci. For values of Nef yielding the number of deep trees that was less than 5% of all the trees simulated assuming that Nef, we considered it unlikely that a population with that effective number of females would still contain haplotypes from different clades unless the haplotypes were recently redistributed among populations through human-mediated movement. On the other hand, a high number of deep trees (i.e. more than 95%) would indicate that there is no need to invoke recent gene flow as the likely explanation for the coexistence of divergent clades in such population, which could be the result of natural post-glacial contact. Although these simulation experiments make simplifying assumptions that may not be realistic, they generate ideal benchmarks for interpreting the observed data.
34 Results
Sequence variation
The levels of polymorphism among sequences obtained for each of the four genes (38–430 gene copies per gene) are summarized in Table 1. There were five short (<5 bp) insertion/deletion (indel) polymorphisms segregating at the RpS7 locus (Table 1) that were not associated with simple sequence repeats and could be unambiguously aligned. Of these, a two-base deletion was inferred to have occurred along the branch leading to clade W (see below) and a single-base deletion along the branch leading to clade E. Data sets from neither Act, ATPase nor RpS7 showed evidence of homoplasy and they all passed the four-gamete test, indicating that recombination has not affected the patterns of variation at the nuclear genes in our study. The McDonald- Kreitman test provided no evidence of selection on the coding sequence of the Cytb gene (P>0.05).
Genealogical and geographical relationships
The phylogenetic and network analyses split the range-wide data set for the mitochondrial Cytb into two distinct phylogroups (clades W and E) separated with 1.6 % of genetic distance (Fig. 3e,f), translating to a divergence time of about 64x103 –1600x103 years ago. The Western phylogroup was found in Europe between the British Isles and Poland whereas the Eastern phylogroup was present from Europe throughout Asia to China, with a broad zone of overlap with the Western phylogroup in Europe (Fig. 2d). While clade W showed very little internal structure, clade E was partitioned into three subclades (Fig. 3e,f). The majority of haplotypes were in the clade EA, while the other two clades had very restricted distributions: the EC haplotypes in the Anzalee lagoon of the Caspian Sea in Iran, and the EI haplotype in the Iskar River of the Danube River drainage in Bulgaria (Fig. 2d). We constructed a phylogenetic network for each nuclear DNA locus and a phylogenetic tree of the RpS7 haplotypes (Fig. 3a–d). The most salient feature of the inferred genealogies is the complete lineage sorting of nuclear genes between the two phylogroups in that all genes are distinguished into two clades W and E and the divergence between the phylogroups based on sequences of the nuclear Act, ATPase and RpS7 genes is geographically concordant with mitochondrial Cytb sequences (Fig. 2a–d). Nuclear DNA loci and mtDNA thus display striking similarities, showing a strong genealogical concordance across the distribution range of the tench. Changes in mtDNA and the three nuclear loci are concordant also across the contact zone between the two phylogroups, with only finer-scale differences being evident in phylogroup frequencies among sites (Fig. 2a–d).
35 The introduced populations in Turkey and China carried at all loci only clade E haplotypes, as did the overseas introduction to the state of Washington. However, the non-native populations in Bosnia and Herzegovina, in New Zealand and in Quebec carried at one or more loci haplotypes from both clade W and clade E (Fig. 2a–d). The phylogeographical variation observed among the tench populations was present also in the cultured breeds, with the exception of Cytb clades EC and EI that had very restricted geographical distributions. Each one of the 16 cultured breeds in the Vodňany live gene bank as well as the Italian regional breed carried haplotypes from both clades W and E at one or more loci, including the seven regional Czech breeds, three European breeds (German, Romanian and Hungarian), three experimental breeds and three ornamental breeds (Appendix A).
Figure 3 Haplotype relationships. Clade E is shown in blue and clade W in red for ATPase (a), Act (b) and RpS7 (c, d). For Cytb (e, f), clade W is in red, clade EA in blue, clade EC in green and clade EI in yellow. The networks were constructed under the 95 % maximum parsimony criterion and the size of the circles is proportional to the haplotype frequency; small empty circles represent unobserved haplotypes. The maximum-likelihood phylograms are shown with bootstrap (from 1000 replicates)/ aLRT support for major partitions in the RpS7 (d) and Cytb (f) phylogenies, with branch lengths proportional to the scale bar with the unit being a mean number of nucleotide changes per site.
36 Table 1 Summary of polymorphism for each gene and the results of demographic analyses
Gene Phylogeo- N Number of Polymorphic Indels Haplotype Nucleotide Tajima's D Fu's Fs P(SSDD/R) graphical haplotypes sites diversity ± diversity ± unit SD SD (x 100) Cyt b Clade E 140 12 33 0 0.228±0.048 0.181±0.058 -1.940**/**/** -1.455 0.217/0.383 (1141bp) Clade EA 130 8 7 0 0.105±0.037 0.009±0.003 -2.065***/***/*** -13.791***/***/*** 0.286/0.312 Clade EI 5 1 0 0 0 0 - - - Clade EC 5 3 3 0 0.700±0.218 0.105±0.043 -1.048 -0.186 0.882/0.896 Clade W 70 5 4 0 0.308±0.070 0.029±0.007 -1.278*/-/- -2.988*/-/* 0.366/0.092 Total 210 17 44 0 0.581±0.029 0.687±0.038 0.092 4.994 0.000/0.230 RpS7 Clade E 210 3 0 2 0.019±0.013 0.002±0.002 -1.279-/*/* -5.178-/*/*** 0.109/0.082 (868bp) Clade W 172 5 4 1 0.666±0.018 0.116±0.007 0.266 0.891 0.053/0.005 Total 382 8 15 5 0.637±0.020 0.883±0.013 3.669+++/+/+++ 18.222++/+++/+ 0.113/0.274 Act Clade E 237 2 1 0 0.008±0.008 0.003±0.003 -0.934 -2.952-/-/** 0.033/0.996 (289bp) Clade W 193 2 1 0 0.010±0.010 0.004±0.004 -0.956 -2.776-/-/* 0.050/0.991 Total 430 4 6 0 0.501±0.006 0.860±0.009 3.240++/++/++ 8.886+/++/+ 0.000/0.008 ATPase Clade E 26 1 0 0 0 0 - - - (100bp) Clade W 12 1 0 0 0 0 - - - Total 38 2 1 0 0.444±0.058 0.444±0.058 1.253 1.538 0.095/0.015
The size of DNA fragments is given below the gene names in base pairs. The superscripts indicate probability levels that values in the neutral population can be equal or lower than observed: *) P<0.05; **) P<0.01; ***) P<0.001; equal or higher than observed: +) P<0.05; ++) P<0.01 and ‘-’ means non significant result given by coalescent simulations based on number of segregating sites/the average number of nucleotide differences estimated by DNASP, version 4.50.3 (Rozas et al. 2003)/result given by ARLEQUIN version 3.11 (Excoffier et al. 2005) respectively. The value P(SSD) shows the probability of observing a less good fit between the model and observed distribution by chance under the demographic/spatial expansion scenario. 37 Population demographic history The D and Fs statistics were negative for the major Cytb clades W and E as well as for clades EA and EC, reflecting the excess of rare mutations compared to the expectation under constant population size, and for clades W, E and EA this difference was significant (Table 1). A similar pattern was observed at the Act and RpS7 genes, with a number of D and Fs values being large and negative, and with significant results for both Act clades and the RpS7 clade E (Table 1). For all four genes and clades W and E as well as for Cytb clades EA and EC there was also a good fit (P (simulated SSD ≥ observed SSD) > 0.1) between the observed and the expected mismatch distribution from at least one expansion model (Table 1). The τ values obtained for Cytb clades W (0.373) and EA (3.000) translate into an expansion time of about 1308–31 134 years ago and 10 517–262 927 years ago, respectively.
Spatial genetic structure The SAMOVA analyses identified a significant two-group spatial structure for each locus (Fig. 2e), with approximately 65% to 100% of the genetic variation proportioned between the two groups
(Cytb: FCT, 0.687, P<0.05; FSC, 0.606, P<0.001; nuclear DNA loci: FCT, 0.667–1.000, P<0.001; FSC, 0.000–0.080, P<0.001). Assuming a four-group scenario for Cytb placed the Anzalee population (clade EC) and the Iskar population (clade EI) in their own separate groups (Fig. 2e), yielding higher FCT (0.791, P<0.001) and lower FSC values (-0.095, P<0.001) than those observed for this gene in the two-group scenario. Interestingly, one SAMOVA group was defined in the way that its distribution was clearly partitioned into distinct sets of sites which belonged to that same group but which were not geographically adjacent (i.e. the British, one Swedish and the Spanish and Portuguese sites were placed in the same group with sites from eastern Europe and Asia; Fig. 2e). The BARRIER analysis overlaying five major barriers for each locus identified several discontinuities with a support from multiple loci (Fig. 4). The longest break divided the tench distribution into a western part and an eastern part and was fully supported by two loci and partially by all three loci (Fig. 4), depending on the local patterning of clades in the contact zone between the Western and Eastern phylogroups (Fig. 2b–d). Another barrier separated the Spanish and Portuguese sites from the rest of the sites with a complete support of all loci. The third barrier separated the British sites from the other sites with a support of two loci, and the fourth barrier separated the Swedish site Lake Öre sjö from the other sites in Sweden and around the Baltic Sea, with a complete support from two loci and a partial support of all loci (Fig. 4). Additional three short breaks supported by two loci were identified in central Europe (Fig. 4), following the transitions between phylogroups in that region (see Fig. 2e).
38 TMRCA distribution
The simulations of the TMRCA assuming Nef of 730 produced fewer than 5% of coalescent trees that were deeper than 3000 generations. We therefore consider it unlikely that an isolated population with this effective number of females or smaller that was founded by unrelated mtDNA clades at the end of the Younger Dryas (assuming the generation time of four years) would still contain haplotypes from different clades, unless the haplotypes were recently redistributed among populations by human-mediated movement. However, for any Nef larger than that, there was greater than 5% chance that the TMRCA predated the origin of the population, and for Nef larger than 4000, more than 95% of all coalescent trees were deeper than 3000 generations. The effective number of females of 4000 would translate to an adult census size of c. 25 000 individuals assuming an equal sex ratio and the ratio Ne/N of 0.3, which would correspond to a lake area of c. 250 hectares, assuming the population density of 100 individuals per hectare.
Figure 4 European phylogeographic breaks identified in tench data by BARRIER using the Monmonier’s algorithm. Thin lines, Delaunay triangulations; thick lines, barriers supported by at least two loci. The thickness of the different barriers and their segments is proportional to the number of loci that supported them (two or three).
39 Discussion
Pleistocene phylogeographical subdivision
The statistical method in SAMOVA detected a significant phylogeographical pattern driven by the spatial orientation of the Western and Eastern phylogroups, with high congruence between mtDNA and nuclear DNA loci (Fig. 2e). The barrier detection method in BARRIER revealed a well-supported genetic break crossing central Europe in a north-south direction (Fig. 4), paralleling the transition between the phylogroups (Fig. 2a–d). These results together provide evidence of a strong geographical component to the present phylogeographical pattern in the tench that is highly concordant among unlinked loci. The distribution of highly divergent, reciprocally monophyletic phylogroups is strongly reminiscent of phylogeographic discontinuities modulated by refugial isolation (Taberlet et al. 1998; Hewitt 2000). It seems thus likely that, after the last glacial maximum, the Western phylogroup originated from the western European refugium, whereas the Eastern phylogroup originated from an eastern European or western Asian refugium. This conclusion is in accordance with previous phylogeographic studies indicating putative freshwater refugia in drainages of the Atlantic tributaries and of Rhone River (Durand et al. 1999; Nesbø et al. 1999; Kotlík and Berrebi 2001) and in the Black and Caspian Sea basins (Bănărescu 1991; Kotlík and Berrebi 2001; Kotlík et al. 2004, 2008). The importance of the Ponto-Caspian refugium is supported by the findings of tench fossils from glacial deposits in the Black Sea basin (Lebedev 1960). It is interesting that a distinct Cytb clade EC occurred in the southern Caspian Sea and only there, although the widespread clade EA occurred in the northern Caspian Sea, and all tench from both sites carried the same nuclear DNA haplotypes (Fig. 2a–d). Furthermore, clade EI occurred only at one site in the Iskar River basin in the lower Danube River drainage, where again only widespread nuclear DNA haplotypes were present (Fig. 2a–d). This shows hitherto undescribed complexities in the distribution of refugia within the Ponto-Caspian region and the Danube River, and lineage sorting and/or gene flow between them. The signatures of population expansion in both phylogroups are consistent with a history of post-glacial dispersion from formerly isolated refugia. The estimates of times from population expansion are approximately consistent with an expansion following the last glacial maximum. If, on the other hand, the significant tests reflected recent introductions, the time estimates should indicate much more recent expansion. The higher age of the expansion of the Eastern phylogroup than of the Western phylogroup is congruent with phylogeographical evidence from other fishes that the geographic range occupied by the Eastern phylogroup was much less directly affected by recent glacial advances than the western European drainages (Bernatchez 2001).
40 Fourteen sites in central and northern Europe were assigned to one SAMOVA group by some loci and to the other SAMOVA group by the other loci (Fig. 2e), and admixed sites carrying haplotypes of both phylogroups were observed over a large area between, roughly, Belgium and Estonia (Fig. 2a–d). Changes in mtDNA and the three nuclear loci are concordant across the contact zone, supporting that this is not a matter of primary contact and selection on some of the markers but rather of a secondary contact of populations from different refugia. But can this introgression be caused entirely by human-aided dispersal? Our TMRCA simulations indicated that there is no need to invoke recent gene flow as a likely explanation for the presence of both phylogroups even in relatively small populations. Furthermore, the location of the tench contact zone matches phylogeographical subdivisions in other species where expanding populations from different refugia meet in the same area (e.g. Taberlet et al. 1998; Hewitt 2000). We therefore consider it unlikely that the overlap between the phylogroups at the sites in central Europe has been entirely caused by human transport and release. Rather, it most likely represents a region of natural post-glacial contact between lineages from the eastern and western refugia.
Evidence for human-aided dispersal
On the other hand, the contact zone is very broad and spans across several watershed divides, and there is fairly high amount of introgression in western Europe (Fig. 2b–d). The SAMOVA analysis even placed sites from three western European regions that contained particularly high proportions of the Eastern phylogroup into the same group with the sites from eastern Europe and Asia (Fig. 2e). These sites were located on Iberian Peninsula, in Britain and in Sweden, and they were separated from the other western sites with a BARRIER support of several loci (Fig. 4). All tench from the three sites in Spain and Portugal contained exclusively the Eastern phylogroup, which strongly speaks in favour of the hypothesis that tench are not a native species on the Iberian Peninsula (García-Berthou et al. 2007; Ribeiro et al. 2009), and points to the eastern Europe or Asia as their likely source. This demonstrates the ability of detailed phylogeographic studies such as ours to resolve the status of cryptogenic species where other evidence for either native or introduced origin is absent (Carlton 1996). The lack of phylogeographic resolution means, however, that we cannot confirm or reject the native status of the populations in Italy (Gherardi et al. 2007; Turchini and De Silva 2008). The absence of strong genetic separation from more northern sites (Fig. 2e and 4) suggests that tench colonization of Italy is most likely of post- glacial origin.
41 Another site in western Europe that only contained Eastern alleles is Lake Öre sjö in southern Sweden. It may suggest that this population escaped admixture, but it may also be that the sample of only one fish (four loci) was not enough to detect the Western phylogroup if it was present in low frequency. The British sites were separated from the other western sites by BARRIER, but they carried a mixture of the Eastern and Western phylogroups, which was reflected by their SAMOVA assignment to both groups, depending on the locus (Fig. 2e). This is probably a result of human introduction of the Eastern phylogroup to the British Isles as this phylogroup occurs in much lower frequency in western Europe. It could also be a natural colonization by both phylogroups but it would require almost complete replacement of the Eastern phylogroup in western Europe (see Searle et al. 2009).
Cultured breeds and introgression
The above evidence strongly suggests that human-aided dispersal has altered the phylogeographic structure of the tench. This implies either that tench from geographically remote populations were used for stocking, or that local source breeds carried the opposite phylogroup. Interestingly, we found that although the cultured breeds originating from different parts of Europe differed in the frequencies of the Western and Eastern phylogroups (Appendix A), all of them carried haplotypes of both phylogroups. Therefore, supplemental stocking with these or genetically related breeds would increase the probability of introgression between the phylogroups. Our recent study looked for evidence of a reproductive isolation in a post-glacial lake inhabited by both phylogroups but we found no results that would point towards barriers to their interbreeding (Lajbner et al. 2010). Furthermore, at many sites within the contact zone we observed individuals of apparently hybrid ancestry (see Fig. 2b–d). The putative hybrids were heterozygous for alternate phylogroups, or were homozygous but for different phylogroups at different loci and/or carried mtDNA of the opposite phylogroup (data not shown). Finally, that both phylogroups characterized all of the examined breeds supports that populations of mixed origin can persist without strong negative fitness consequences at least under cultured conditions. Therefore, the admixed genetic composition of the cultured breeds most likely contributed to the introgression between the phylogroups in natural habitats.
42 Phylogeography of known introductions
There is no record as to the geographical origin of tench in the Neretva River in Bosnia and Herzegovina, which is in the eastern Adriatic Sea basin where tench do not naturally occur (Glamuzina 2006). The presence of both phylogroups in the Neretva population shows that it is may have descended either from introductions from the adjacent Danube River drainage where both phylogroups occur (Fig. 2), or from genetically admixed hatchery stocks. In Turkey, tench are probably native to some river drainages within the Black Sea basin (Brylińska et al. 1999) but it have been introduced to water systems of central and western Turkey (Korkmaz and Zencir 2005; Innal and Erk’akan 2006). The six putative non-native populations in Turkey (Appendix A) contained exclusively haplotypes of the Eastern phylogroup (Fig. 2b–d), which made them indistinguishable from the other sites in the eastern part of the range (Fig. 2e and 4). This points to a local source of this introduction or to a distant source but within the range of the Eastern phylogroup. The introduced population in China also carried only the Eastern phylogroup (Fig. 2a–d). Tench were introduced in large parts of China during the 20th century (Walker and Yang 1999; Huang et al. 2001), most probably from the Itrysh River drainage in northern China where tench naturally occur (Fig. 1). Interestingly, European cultured breeds originating from the live gene bank in Vodňany were recently imported to China to serve as a source for stocking into open waters throughout China (Wang et al. 2004). If those breeds carry both phylogroups, as did all breeds in that gene bank that we examined, this practice is likely to induce introgression of the European genes into the native populations of the tench in Asia. The first introduction of tench from Europe to the United States occurred in 1877 (Baird 1879). By 1896, their descendants had been distributed to at least 36 states, and subsequent introductions to North America followed, including to Canada in 1986 (Quebec: Dumont et al. 2002). Both these introductions used tench from Germany (Baughman 1947; Fuller et al. 1999; Nico and Fuller 2010). Consistent with this, the population from Quebec contained both phylogroups and was placed in the same SAMOVA group with German and other western European sites (Fig. 2e). However, the Silver Lake population in the state of Washington contained only the Eastern phylogroup and it was grouped with the Eastern sites by SAMOVA (Fig. 2e). This suggests that this population originated from yet another introduction to the United States that occurred in the state of Washington in 1909 (Wydoski and Whitney 2003), and which would have involved an unknown but most likely an eastern European or Asian source.
43 New Zealand tench were introduced several times in 19th century from Tasmania (Allport 1866; Abbott 1868; Arthur 1881; Thomson 1922; Hicks 2003), to where they had been successfully introduced from England in 1858 (Allport 1866, 1868). The North Island population contained both phylogroups (Fig. 2a–d) and it was placed in one SAMOVA group by one locus and to the other SAMOVA group by other loci (Fig. 2e). We were unable to acquire samples from Tasmania but these results suggest that England already had the Eastern phylogroup in 19th century, placing an upper limit on the time of its introduction to the British Isles.
Conclusions The difficulty of disentangling the confounding effects of secondary dispersal from the impact of natural historical processes presents a persistent challenge for studies on the historical biogeography, particularly of species prone to intentional translocation by humans. Our study highlights that for such species it may be useful to consider the effects of anthropogenic factors as juxtaposed on the natural phylogeographic structure rather than viewing these as mutually exclusive causes of the observed genetic and distribution patterns. We showed that natural historical processes have played an important role in genetically structuring the tench populations and that their signatures can still be detected across multiple genes. On the other hand, we demonstrated that human-aided dispersal significantly contributed to the recent evolutionary history of the tench and that the admixed genetic composition of cultured breeds most likely enhances introgression between genetically differentiated populations. It appears likely that if the current practices in open-water fisheries management continue, the human-aided migration will eventually erase the natural phylogeographic pattern for large parts of the tench range. It is also possible that, by increasing their adaptive variation, the hybridization would enhance the invasive potential of the admixed populations outside the native range, including into novel niches not occupied in the native range (Lucek et al. 2010). Within the native range, phylogroups descended from different refugia would likely show physiological adaptations to different selective environments. Stocking with individuals of the opposite phylogroup or the mixed ancestry may disrupt such adaptations, which can lead to reduction in fitness of wild populations (see Araki et al. 2008; Hutchings and Fraser 2008; Fraser et al. 2010; Marie et al. 2010; for numerous examples from salmonids). Such impacts might substantially reduce the evolutionary potential of wild populations and affect their chance of persistence (Stockwell et al. 2003; Frankham 2005).
44 Acknowledgements
We thank all the colleagues who assisted with sample collections, especially Adámek Z., Akbarzadeh A., Alavi M.S.H., Apostolou A., Bohlen J., Bolding B., Buras P., Cook I., Černý J., Dahlberg M., De Gelas K., Desloges C., Desloges S., Doadrio I., Dumont P., Dzuba B., Ekmekçi F.G., Flajšhans M., Gaffaroğlu M., Gallardo J.M., Gante H.F., Gasco L., Gomulka P., Gualtieri M., Henshaw A., Hertig A., Hicks B.J., Hubenova T., Kamler E., Kohlmann K., Korte E., Korwin- Kossakowski M., Koščo J., Lopatin O., Mamilov N., Memiş D., Navodaru I., Nico L.G., Paaver T., Pekárik L., Persat H., Petr T., Piačková V., Polli B., Rossi S., Sudakova N., Sychrová O., Švátora M., Vandeputte M., Vassilev M., and Wang J. We thank Choleva L. for his assistance with nuclear markers selection and Marková S., Pelikánová Š., Šedivá A., Bohlen-Šlechtová V., Janko K., Ráb P., and many others for their advice. The work was supported by the Ministry of Education, Youth and Sports of the Czech Republic (LC06073, MSM6007665809), by the Academy of Sciences of the Czech Republic (IRP IAPG AV0Z50450515 and IGA UZFG/05/22), and by the Czech Science Foundation (206/09/1154).
45 Literature cited Abbott, F. 1868. Tench fish supplied from the Royal Society’s gardens during the year 1868. Monthly Notices of Papers and Proceedings of the Royal Society of Tasmania for 1868. Page 83. Allport, M. 1866. Report on the present state of the fry of the salmon and salmon trout at the Plenty; and of the taking of the first spawn from the brown trout. Monthly Notices of Papers and Proceedings of the Royal Society of Tasmania for 1866. Pages 61–64. Allport, M. 1868. Remark's on Mr Krefft's Notes on the fauna of Tasmania. Monthly Notices of Papers and Proceedings of the Royal Society of Tasmania for 1868. Pages 33–36. Anisimova, M., and O. Gascuel. 2006. Approximate Likelihood-Ratio Test for Branches: A Fast, Accurate, and Powerful Alternative. Systematic Biology 55:539–552. Atarhouch, T., M. Rami, G. Cattaneo-Berrebi, C. Ibanez, S. Augros, E. Boissin, A. Dakkak, and P. Berrebi. 2003. Primers for EPIC amplification of intron sequences for fish and other vertebrate population genetic studies. BioTechniques 35:676–678,680,682. Araki, H., B. A. Berejikian, M. J. Ford, M. S. Blouin. 2008. Fitness of hatchery-reared salmonids in the wild. Evolutionary Applications 1:342–355. Arthur, W. 1881. History of fish culture in New Zealand. Transactions and Proceedings of the Royal Society of New Zealand 14:180–210. Baird, S. F. 1879. United States Commission of Fish and Fisheries, Part V., Report of the Commissioner for 1877. U.S. Government Printing Office, Washington, D.C. Bănărescu, P. 1991. Zoogeography of fresh waters 2: Distribution and dispersal of fresh water animals in North America and Eurasia.AULA-Verlag, Wiesbaden. Baughman, J. L. 1947. The tench in America. Journal of Wildlife Management 11:197–204. Bernatchez, L. 2001. The evolutionary history of brown trout (Salmo trutta L.) inferred from phylogeographic, nested clade, and mismatch analyses of mitochondrial DNA variation. Evolution 55:351–379. Bernatchez, L., and C. Wilson. 1998. Comparative phylogeography of nearctic and palearctic fishes. Molecular Ecology 7:431–452. Bilio, M. 2007. Controlled reproduction and domestication in aquaculture – the current state of the art, Part I. Aquaculture Europe 32 (1):5–14. Bohlen, J., V. Šlechtová, I. Doadrio, and P. Ráb. 2007. Low mitochondrial divergence indicates a rapid expansion across Europe in the weather loach, Misgurnus fossilis (L.). Journal of Fish Biology 71 (Supplement B):186–194. Brito, P. H., and S. V. Edwards. 2008. Multilocus phylogeography and phylogenetics using sequence-based markers. Genetica 135:439–455.
46 Brylińska, M., E. Bryliński, and M. Bnińska. 1999. Tinca tinca (Linnaeus 1758). Pages 229 –302 in P.M. Bănărescu, ed. The Freshwater Fishes of Europe, 5/I: Cyprinidae 2/I. AULA-Verlag, Wiesbaden. Burridge, C. P., D. Craw, D. Fletcher, and J. M. Waters. 2008. Geological dates and molecular rates: fish DNA sheds lights on time dependency. Molecular Biology and Evolution 25:624– 633. Carlton, J. T. 1996. Biological invasions and cryptogenic species. Ecology 77:1653–1655. Chen, W. J., R. L. Mayden. 2009. Molecular systematics of the Cyprinoidea (Teleostei: Cypriniformes), the world’s largest clade of freshwater fishes: further evidence from six nuclear genes. Molecular Phylogenetics and Evolution 52:544–549. Chow, S., and K. Hazama. 1998. Universal PCR primers for S7 ribosomal protein gene introns in fish. Molecular Ecology 7:1255–1256. Clark, A. G. 1990. Inference of haplotypes from PCR-amplified samples of diploid populations. Molecular Biology and Evolution 7:111–122. Clement, M., D. Posada, and K. A. Crandall. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9:1657–1659. DeVaney, S. C., K. M. McNyset, J. B. Williams, A. T. Peterson, and E. O. Wiley. 2009. A Tale of Four “Carp”: Invasion Potential and Ecological Niche Modeling. Public Library of Science ONE 4:e5451. Dowling, T. E., C. A. Tibbets, W. L. Minckley, and G. R. Smith. 2002. Evolutionary relationships of the plagopterins (Teleostei: Cyprinidae) from cytochrome b sequences. Copeia 2002:665– 678. Dumont, P., N. Vachon, J. Leclerc, and A. Guibert. 2002. Intentional introduction of Tench in Southern Quebec. Pages 169–177 in R. Claudi, P. Nantel, and E. Muckle-Jeffs, eds. Alien invaders in Canada’s waters, wetlands and forests.Canadian Forest Service, Natural Resources Canada, Ottawa. Dupanloup, I., S. Schneider, and L. Excoffier. 2002. A simulated annealing approach to define the genetic structure of populations. Molecular Ecology 11:2571–2581. Durand, J. D., H. Persat, and Y. Bouvet. 1999. Phylogeography and postglacial dispersion of the chub (Leuciscus cephalus) in Europe. Molecular Ecology 8:989–997. Economidis P. S., E. Dimitriou, R. Pagoni, E. Michaloudi, and L. Natsis. 2000. Introduced and translocated fish species in the inland waters of Greece. Fisheries Management and Ecology 7:239–250. Excoffier, L. 2004. Patterns of DNA sequence diversity and genetic structure after a range expansion: lessons from the infinite-island model. Molecular Ecology 13:853–864.
47 Excoffier, L., G. Laval, and S. Schneider, 2005. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1:47–50. Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39, 783–791. Ferguson, A., I. Fleming, K. Hindar, Ř. Skaala, P. McGinnity, T. F. Cross, and P. Prodöhl. 2007. Farm escapes. Pages 357–398 in E. Verspoor, L. Stradmeyer, and J. Nielsen, eds. The Atlantic Salmon: Genetics, Conservation and Management. Blackwell, Oxford. Flajšhans, M., O. Linhart,V. Šlechtová, and V. Šlechta, V. 1999. Genetic resources of commercially important fish species in the Czech Republic: present state and future strategy. Aquaculture 173:469–481. Frankham, R. 2005. Stress and adaptation in conservation genetics. Journal of Evolutionary Biology 18:750–755. Fraser, D. J., A. L. S. Houde, P. V. Debes, P. O’Reilly, J. D. Eddington, and J. A. Hutchings. 2010. Consequences of farmed–wild hybridization across divergent wild populations and multiple traits in salmon. Ecological Applications 20:935–953. Fu, Y. X. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147:915–925. Fuller, P.L., L. G. Nico, and J. D. Williams. 1999. Nonindigenous Fishes Introduced into Inland Waters of the United States. American Fisheries Society Special Publication 27, Bethesda, Maryland. García-Berthou, E., D. Boix, and M. Clavero. 2007. Non-indigenous animal species naturalized in Iberian inland waters. Pages 123–140 in F. Gherardi, ed. Biological invaders in inland waters: profiles, distribution, and threats. Invading Nature: Springer Series in Invasion Ecology. Springer, Dordrecht. Gasco, L., F. Gai, C. Lussiana, R. Lo Presti, V. Malfatto, F. Daprà, and I. Zoccarato. 2010. Morphometry, slaughtering performances, chemical and fatty acid composition of the protected designation of origin “Golden hump tench of Poirino highland” product. Reviews in Fish Biology and Fisheries 20:357–365. Gela, D., O. Linhart, M. Flajšhans, and P. Duda.1998. A live gene bank of tench, Tinca tinca (L.) strains in the Czech Republic. Polish Archives of Hydrobiology 45:311–314. Gela, D., M. Flajšhans, M. Kocour, M. Rodina, and O. Linhart. 2006. Tench broodstock management in breeding station under conditions of pond culture. Aquaculture International 14:195–203.
48 Gherardi, F., S. Bertolino, M. Bodon, S. Casellato, S. Cianfanelli, M. Ferraguti, E. Lori, G. Mura, A. Nocita, N. Riccardi, G. Rossetti, E. Rota, R. Scalera, S. Zerunian, and E. Tricarico. 2008. Animal xenodiversity in Italian inland waters: distribution, modes of arrival, and pathways. Biological Invasions 10:435–454. Giovio, P. 1524. De Romanis piscibus libellus. F. Minitius Caluus, Rome. (in Latin) Glamuzina, B. 2006. Status of introduced tench, Tinca tinca in Hutovo Blato wetlands, Adriatic Sea drainage. Page 14 in IX. česká ichtyologická konference: sborník příspěvků z IX. konference s mezinárodní účastí, Vodňany, 4.–5.5. 2006. University of South Bohemia, České Budějovice. Guillot, G., R. Leblois, A. Coulon, and A. C. Frantz. 2009. Statistical methods in spatial genetics. Molecular Ecology 18:4734–4756. Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52:696–704. Hare, M. P., and S. R. Palumbi, S. R. 1999 The accuracy of heterozygous base calling from diploid sequence and resolution of haplotypes using allele-specific sequencing. Molecular Ecology 8:1749–1752. Hänfling, B., C. Dümpelmann, N. G. Bogutskaya, R. Brandl, and M. Brändle. 2009. Shallow phylogeographic structuring of Vimba vimba across Europe suggests two distinct refugia during the last glaciation. Journal of Fish Biology 75:2269–2286. Hesthagen, T., and O. T. Sandlund. 2007. Non-native freshwater fishes in Norway: history, consequences and perspectives. Journal of Fish Biology 71 (Supplement D):173–183. Hewitt, G. M. 2000. The genetic legacy of the Quaternary ice ages. Nature 405:907–913. Hicks, B. J. 2003. Biology and potential impacts of rudd (Scardinius erythrophthalmus L.) in New Zealand. Pages 49-58 in Managing Invasive Freshwater Fish in New Zealand. Proceedings of a workshop hosted by Department of Conservation 10–12 May 2001, Hamilton. Department of Conservation, Wellington, New Zealand. Huang, D., J. Liu, and C. Hu, 2001. Fish resources in Chinese reservoirs and their utilization. Pages 16-21 in S. S. De Silva, ed. Reservoir and Culture-based Fisheries: Biology and Management. Proceedings of an International Workshop held in Bangkok, Thailand from 15–18 February 2000. ACIAR Proceedings No. 98, Canberra. Hudson, R. R., and N. L. Kaplan. 1985. Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147–164. Hutchings, J. A., and D. J. Fraser. 2008. The nature of fisheries- and farming-induced evolution. Molecular Ecology 17:294–313.
49 Innal, D., and F. Erk’akan, 2006. Effects of exotic and translocated fish species in the inland waters of Turkey. Reviews in Fish Biology and Fisheries 16:39–50. Jarman, S.N., R.D. Ward, and N. G. Elliott. 2002. Oligonucleotide primers for PCR amplification of coelomate introns. Marine Biotechnology 4:347–355. Kennedy, M., and P. Fitzmaurice. 1970. The biology of the tench Tinca tinca (L.) in Irish waters. Proceedings of the Royal Irish Academy 69B:31–82. Kohlmann, K., P. Kersten, R. Panicz, D. Memiş, and M. Flajšhans. 2010. Genetic variability and differentiation of wild and cultured tench populations inferred from microsatellite loci. Reviews in Fish Biology and Fisheries 20: 279–288. Korkmaz, A.Ş., and Ö. Zencir. 2005. Tench Invasion in Turkish freshwater. Page 42 in Abstracts of the International Workshop on Biological Invasions in Inland Waters. Florence. Kotlík, P., and P. Berrebi. 2001. Phylogeography of the barbel (Barbus barbus) assessed by mitochondrial DNA variation. Molecular Ecology 10:2177–2185. Kotlík, P., N. G. Bogutskaya, and F. G. Ekmekçi. 2004. Circum Black Sea phylogeography of Barbus freshwater fishes: divergence in the Pontic glacial refugium. Molecular Ecology 13:87–95. Kotlík, P., S. Marková, L. Choleva, N. G. Bogutskaya, F. G. Ekmekçi, P. P. Ivanova. 2008. Divergence with gene flow between Ponto-Caspian refugia in an anadromous cyprinid Rutilus frisii revealed by multiple gene phylogeography. Molecular Ecology 17:1076–1088. Lajbner, Z., K. Kohlmann, O. Linhart, and P. Kotlík. 2010. Lack of reproductive isolation between the western and eastern phylogroups of the tench. Reviews in Fish Biology and Fisheries 20:289–300. Lebedev, V. D. 1960. Quaternary freshwater fish fauna of European part of USSR. Izdatelstvo Moskovskovo universiteta, Leningrad. (in Russian). Lo Presti, R., L. Gasco, C. Lisa, I. Zoccarato, and L. Di Stasio. 2010. PCR-RFLP analysis of mitochondrial DNA in tench Tinca tinca. Journal of Fish Biology 76:401–407. Lucek, K., D. Roy, E. Bezault, A. Sivasundar, O. Seehausen. 2010. Hybridization between distant lineages increases adaptive variation during a biological invasion: stickleback in Switzerland. Molecular Ecology 19:3995–4011. Lusk, S., V. Lusková, and K. Halačka. 1998. The status of tench (Tinca tinca (L.)) in aquatic habitats of the floodplain along the lower reaches of the River Dyje (Czech Republic). Polish Archives of Hydrobiology 45:407–414. Mabuchi, K., H. Senou, and M. Nishida. 2008. Mitochondrial DNA analysis reveals cryptic large- scale invasion of non-native genotypes of common carp (Cyprinus carpio) in Japan. Molecular Ecology 17, 796–809.
50 Machordom, A., and I. Doadrio. 2001. Evidence of a Cenozoic Betic-Kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae). Molecular Phylogenetics and Evolution 18:252–263. Maddison, W. P. 2008. Coalescence Package for Mesquite. Version 2.5. http://mesquiteproject.org Maddison, W. P., and D. R. Maddison. 2008. Mesquite: A modular system for evolutionary analysis. Version 2.5. http://mesquiteproject.org Mamilov N. Sh., G. K. Balabieva, and G. S. Koishybaeva. 2010. Distribution of alien fish species in small waterbodies of the Balkhash basin. Russian Journal of Biological Invasions 1(3):181– 186. Manni, F., E. Guérard, and E. Heyer. 2004. Geographic patterns of (genetic, morphologic, linguistic) variation: how barriers can be detected by “Monmonier’s algorithm”. Human Biology 76:173–190. Marie, A. D., L. Bernatchez, and D. Garant. 2010. Loss of genetic integrity correlates with stocking intensity in brook charr (Salvelinus fontinalis). Molecular Ecology 19:2025–2037. McDonald, J.H., and M. Kreitman. 1991. Adaptive protein evolution at the Adh locus in Drosophila. Nature 351:652–654. Mitrofanov V. P., and T. Petr. 1999. Fish and fisheries in the Altai, Northern Tien Shan and Lake Balkhash (Kazakhstan). Pages 149-167 in: T. Petr, ed. Fish and Fisheries at Higher Altitudes: Asia, FAO Fisheries Technical Paper 385, Food and Agriculture Organization of the United Nations, Rome, Italy. Monich, J.K. 1953. Rozmnozhenie i razvitie linja (Tinca tinca L.) v Zapadnoj Syberii (Reproduction and ontogeny of the tench (Tinca tinca L.) in Western Siberia). Trudy Tomskogo Gosudarstvennogo Universiteta. 125:106–115. (in Russian) Monmonier, M. 1973. Maximum-difference barriers: an alternative numerical regionalization method. Geographic Analysis 3:245–261. Muhlfeld, C. C., S. T. Kalinowski, T. E. McMahon, M. L. Taper, S. Painter, R. F. Leary, and F. W. Allendorf. 2009. Hybridization rapidly reduces fitness of a native trout in the wild. Biology Letters 5:328–331. Muscheler, R., B. Kromer, S. Björck, A. Svensson, M. Friedrich, K. F. Kaiser, and J. Southon. 2008 Tree rings and ice cores reveal 14C calibration uncertainties during the Younger Dryas. Nature Geoscience 1:63–267. Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. Nesbø, C. L., T. Fossheim, L. A. Vøllestad, and K. S. Jakobsen. 1999. Genetic divergence and phylogeographic relationships among European perch (Perca fluviatilis) populations reflect glacial refugia and postglacial colonization. Molecular Ecology 8:1387–1404.
51 Nico, L. G., and P. L. Fuller. 2010. Tinca tinca. USGS Nonindigenous Aquatic Species Database, Gainesville, FL.
52 Savvaitova K. A., and T. Petr. 1999. Fish and fisheries in Lake Issyk-Kul (Tien Shan), River Chu and Pamir Lakes. Pages 168–187 in: T. Petr, ed. Fish and Fisheries at Higher Altitudes: Asia, FAO Fisheries Technical Paper 385, Food and Agriculture Organization of the United Nations, Rome, Italy. Scheet, P., and M. Stephens. 2006. A fast and flexible statistical model for large-scale population genotype data: applications to inferring missing genotypes and haplotypic phase. American Journal of Human Genetics 78:629–644. Schneider, S., and L. Excoffier. 1999. Estimation of demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: Application to human mitochondrial DNA. Genetics 152:1079–1089. Searle, J.B., P. Kotlík, R. V. Rambau, S. Marková, J. S. Herman, and A. D. McDevitt. 2009. The Celtic fringe of Britain: insights from small mammal phylogeography. Proceedings of the Royal Society of London. Series B: Biological Sciences 276:4287–429. Steffens, W. 1995. The tench (Tinca tinca L.), a neglected pond fish species. Polish Archives of Hydrobiology 42:161–180. Stockwell, C. A. , A. P. Hendry, and M. T. Kinnison. 2003. Contemporary evolution meets conservation biology. Trends in Ecology & Evolution 18:94–101. Stokes, K., K. O'Neill, and R. A. McDonald. 2004. Invasive species in Ireland. Unpublished report to Environment and Heritage Service and National Parks and Wildlife Service. Quercus, Queens University Belfast, Belfast. Stone, G. N., R. J. Challis, R. J. Atkinson, G. Csoka, A. Hayward, S. Mutun, S. Preuss, A. Rokas, E. Sadeghi, and K. Schonrogge. 2007. The phylogeographic clade trade: tracing the impact of human-mediated dispersal on the colonisation of northern Europe by the oak gallwasp Andricus kollari. Molecular Ecology 16:2768–2781. Šedivá, A., K. Janko, V. Šlechtová, P. Kotlík, P. Simonović, A. Delic, and M. Vassilev. 2008. Around or across the Carpathians: colonization model of the Danube basin inferred from genetic diversification of stone loach (Barbatula barbatula) populations. Molecular Ecology 17:1277–1292. Šlechtová, V., J. Bohlen, J. Freyhof, H. Persat, and G. B. Delmastro. 2004. The Alps as barrier to dispersal in cold-adapted freshwater fishes? Phylogeographic history and taxonomic status of the bullhead in the Adriatic freshwater drainage. Molecular Phylogenetics and Evolution 33:225–239. Šusta, J. 1884. Výživa kapra a jeho družiny rybničné (Nutrition of carp and other pond species). ČSAZ, Praha (1884) Reviewed edition 1938, Prague. (in Czech).
53 Taberlet, P., L. Fumagalli, A. G. Wustsaucy, and J. F. Cosson. 1998. Comparative phylogeography and postglacial colonization routes in Europe. Molecular Ecology 7, 453–464. Tajima, F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595. Taylor, E. B. 2004. Evolution in mixed company: evolutionary inferences from studies of natural hybridization in Salmonidae. Pages 232–263 in A. P. Hendry and S. Stearns, eds. Evolution Illuminated. Salmon and their Relatives. Oxford University Press, Oxford. Templeton, A. R., K. A. Crandall, and C. F. Sing. 1992. A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation. Genetics 132:619–638. Thomson, G. M. 1922. The naturalisation of animals and plants in New Zealand. Cambridge University Press, Cambridge. Triantafyllidis, A., F. Krieg, C. Cottin, T. J. Abatzopoulos, C. Triantaphyllidis, and R. Guyomard. 2002. Genetic structure and phylogeography of European catfish (Silurus glanis) populations. Molecular Ecology 11:1039–1055. Tsigenopoulos, C. S., and P. Berrebi. 2000. Molecular phylogeny of North Mediterranean freshwater barbs (genus Barbus: Cyprinidae) inferred from cytochrome b sequences: biogeographic and systematic implications. Molecular Phylogenetics and Evolution 14:165– 179. Turchini, G., and S. De Silva. 2008. Bio-Economical and Ethical Impacts of Alien Finfish Culture in European Inland Waters. Aquaculture International 16:243–272. Turner, T. F., M. J. Osborne, G. R. Moyer, M. A. Benavides, and D. Alo. 2006. Life history and environmental variation interact to determine effective population to census size ratio. Proceedings of the Royal Society of London. Series B: Biological Sciences 273:3065–3073. Urchinov, Zh. U. 1995. Fisheries in the Zarafshan River basin (Uzbekistan). Pages 58-62 in: T. Petr, ed. Inland Fisheries Under the Impact of Irrigated Agriculture: Central Asia, FAO Fisheries Circular 894, Food and Agriculture Organization of the United Nations, Rome, Italy. Van Houdt, J., L. De Cleyn, A. Perretti, and F. Volckaert. 2005. A mitogenic view on the evolutionary history of the Holarctic freshwater gadoid, burbot (Lota lota). Molecular Ecology 14:2445–2457. Walker, K. F., and H. Z. Yang. 1999. Fish and fisheries in western China. Pages 231–271 in T. Petr, ed. Fish and Fisheries at Higher Altitudes. FAO Fisheries Technical Paper. Food and Agriculture Organization of the United Nations, Rome, Italy.
54 Wang, J., W. Min, M. Guan, and S. Hu. 2004. Tench farming in China: present status and future prospects. Page 32 in S. Sakowicz, ed. IVth. International Workshop on Biology and Culture of the Tench, Tinca tinca (L.). Wierzba, September 20–23 2004. Programme and Abstracts. Inland Fisheries Institute in Olsztyn, Olsztyn. Welcomme, R. L. 1988. International introductions of inland aquatic species. FAO Fisheries Technical Paper 294, Food and Agriculture Organization of the United Nations, Rome, Italy. Won, Y. J., and J. Hey.2005. Divergence population genetics of chimpanzees. Molecular Biology and Evolution 22:297–307. Wydoski, R. S., and R. R. Whitney. 2003. Inland fishes of Washington. Second Edition, Revised and Expanded. American Fisheries Society, Bethesda, Maryland and University of Washington Press, Seattle.
55 Appendix A: Origin of tench specimens with haplotype codes and frequencies.
Locality * Basin Water body Country Coordinates Haplotype codes (counts) NYear † Latitude Longitude CytB Act RpS7 ATPase Open waters (non-farm sites) Linkebeek Scheldt / Artificial B 50.77 4.33 EA1(1), E1(2), E1(2), - 5 2005 North Sea pond W1(3) W1(8) W2(1), W3(5) Osikovica Danube / Iskar BG 42.94 24.00 EI1(5) E1(10) E1(10) E1(2) 5 2005 Black Sea tributary Blagoevgrad Struma / Struma BG 42.02 23.09 EA1(1) E1(2) E1(1), - 1 2005 Aegean Sea E2(1) Karaotok Neretva / Canal Sunca BIH 43.05 17.80 W1(1) E1(1), W3(1), - 1 2005 Park Prirode Adriatic Sea ‡ W1(1) W4(1) Stolac Neretva / Bregava ‡ BIH 43.08 17.96 EA1(3) E1(2), W2(3), - 3 2005 Adriatic Sea W1(4) W3(1), W4(2) Noyan Saint Richelieu CDN 45.12 -73.26 W1(3) E1(1), E1(1), - 3 2005 Lawrence River ‡ W1(5) W2(4), River/Atlantic W3(1) Ocean Zurich Rhine / North Zurich CH 47.30 8.62 EA1(1), E1(2), E1(1), - 5 2005 Sea W1(4) W1(8) W2(6), W3(1) Lugano Po / Adriatic Lugano CH 45.98 8.97 W1(2) E1(2), W2(2), - 4 2006 Sea W1(6) W3(1), W5(1) Olomouc Danube / Morava CZ 49.61 17.25 - - - E1(2) 1 1863 Black Sea Kokořín Elbe / North Pšovka CZ 50.44 14.58 EA1(1), E1(1), W1(1), - 2 2003 Sea W1(1) W1(3) W2(1) Felchow Oder / Baltic Grosser D 53.06 14.13 W1(1) E1(2), W1(3), W1(2) 5 1997 Sea Felchowsee W1(6) W2(1) Haaven Wesser / Hunte D 53.09 8.21 W1(3), W1(8) E1(1), W1(2) 4 2004 North Sea W5(1) W1(3), W2(4) Hessen Rhine / North Rhine D 49.92 8.32 W3(4) E1(3), E1(4), - 4 2005 Sea W1(5) W2(2), W3(2) Plön Schwentine / Vierer see D 54.13 10.47 EA1(1), - - - 2 2007 Baltic Sea W1(1) Döllner Heide Oder / Baltic Kleiner D 52.98 13.57 EA1(2), E1(1), W3(6) - 5 1996 Sea Döllnsee W1(2) W1(7) Guadalupe Guadiana / Guadalupejo E 39.44 -5.31 EA1(1) E1(2) E1(2) - 1 2006 Atlantic Ocean Võnnu Narva / Baltic Emajõgi EST 58.83 27.00 EA1(5) E1(6), E1(10) - 5 2005 Sea W1(4) Priay Rhône / Ain F 46.00 5.27 W1(2) E1(1), W1(1), - 2 2005 Mediterranean W1(3) W3(1) Sea Belley Rhône / Rhône F 45.78 5.81 W1(2) W1(4) W1(4) W1(2) 2 2005 Mediterranean Sea Gérardmer Rhine / North Gérardmer F 48.07 6.87 W1(2) W1(4) E1(1), - 2 2005 Sea W3(3) Warbutts Ouse / North Artificial GB 54.05 -1.01 EA3(1), E1(3), E1(3), - 2 2005 Sea pond W1(1) W1(1) W1(1) Stillingfleet Ouse / North Artificial GB 53.86 -1.09 EA1(2) E1(3), E1(2), - 2 2005 Sea pond W1(1) W2(1), W4(1)
56 Locality * Basin Water body Country Coordinates Haplotype codes (counts) NYear † Latitude Longitude CytB Act RpS7 ATPase Cascina Po / Adriatic Adda (Cavo I 45.28 9.48 W1(3) E1(2), W1(2), - 3 2005 Belgiardino Sea Roggione) W1(4) W2(1), W3(2), W4(1) Ghazian Caspian Sea Anzalee IR 37.47 49.33 EC1(3), E1(10) E1(3), E1(2) 5 2005 lagoon EC2(1), E3(1) EC3(1) Sadyrbay Tengiz - Korgalzhyn KZ 50.59 70.29 EA1(3) E1(6) E1(6) E1(2) 3 2005 Korgalzhyn Hamilton Waikato / Hamilton NZ -37.80 175.28 EA1(1), E1(8) E1(4), E1(2) 4 2003 Tasman Sea Lake ‡ W1(2) W3(2) -2005 Lentiscais Tejo / Atlantic Tejo P 39.73 -7.49 EA1(1) - - - 1 2007 Ocean Sątopy- Pregel / Baltic Sajna PL 54.08 21.06 EA6(1), E1(1), E1(2), W1(2) 5 2006 Samulewo Sea EA7(1) E2(1), W1(2), ,W1(3) W1(8) W2(1), W3(5) Kurowo Vistula / Narew PL 53.12 22.80 EA1(2) E1(1), E1(3), - 2 2005 Baltic Sea W1(3) W1(1) Tulcea Danube / Danube delta RO 45.00 29.00 EA1(3), E1(8) E1(8) - 4 2004 Black Sea EA4(1) Astrakhan Volga / Volga RUS 46.41 48.00 EA1(4), E1(10) E1(10) E1(2) 5 2006 Caspian Sea EA8(1) Vabacken Bäveå / North Öre sjö S 58.31 12.13 EA1(1) E1(2) E1(2) E1(2) 1 2007 Sea Stockholm Mälaren / Mälaren S 59.33 18.07 EA1(1), E1(3), E1(4), - 3 2007 Baltic Sea W1(2) W1(3) W1(1), W3(1) Börringe Segeå / Baltic Havgårdssjön S 55.49 13.36 EA1(3), E1(4), E1(2), - 4 2007 Sea W2(1) W1(4) W1(2), W2(1), W3(1) Moravský Danube / Dlhé lúky SK 48.59 17.00 EA1(1), E1(3), E1(1), - 2 2006 Svätý Ján Black Sea W1(1) W1(1) W2(1), W3(2) Buzica Danube / Ida SK 48.55 21.08 EA1(2) W1(4) E1(2), - 2 2006 Black Sea W3(2) Michalovce Danube / Zemplínská SK 48.76 22.07 EA1(1) E1(1), E1(2) - 1 2006 Black Sea Šírava W1(1) Gabčíkovo Danube / Starý les SK 47.77 17.73 EA1(2), E1(4) W1(1), - 3 2004 Black Sea W3(1) W3(3) -2005 Oborín Danube / Laborec SK 48.54 21.90 EA1(2) E1(4) E1(4) - 2 2006 Black Sea Sapanca Sakarya / Sapanca gölü TR 40.71 30.28 EA1(4), E1(10) E1(10) - 5 2006 Black Sea ‡ EA5(1) Örencik Yenice Irmaği Abant gölü ‡ TR 40.60 31.28 EA1(2) E1(4) E1(4) - 2 2006 / Black Sea Gedikli Göksu / Beyşehir TR 37.91 31.33 EA1(3) E1(6) E1(6) - 3 2006 Mediterraean gölü ‡ Sea Köprüköy Kızıl Irmak / Köprüköy TR 39.57 33.43 EA1(2) E1(4) E1(4) - 2 2006 Black Sea baraji ‡ Kirikkale Kızıl Irmak / Kapulukaya TR 39.69 33.46 EA1(2) E1(4) E1(4) - 2 2004 Black Sea baraji ‡ Toklumen Kızıl Irmak / Hirfanlı TR 39.13 33.71 EA1(2) E1(4) E1(4) - 2 2005 Black Sea baraji ‡ Kırıntı Aksu Çayi / Kovada gölü TR 37.65 30.87 EA1(3) E1(6) E1(6) - 3 2006 Mediterraean ‡ Sea
57 Locality * Basin Water body Country Coordinates Haplotype codes (counts) NYear † Latitude Longitude CytB Act RpS7 ATPase Savincy Donets / Siverskyj UA 49.38 37.02 EA1(4) E1(8) E1(8) - 4 2006 Azov Sea Donets Gola Pristan Dnipro / Dnipro delta UA 46.31 32.31 EA1(4) E1(8) E1(8) E1(4) 4 2006 Black Sea Senkove Donets / Azov Krasnyj UA 49.51 37.69 EA1(2) E1(4) E1(4) E1(2) 2 2006 Sea Oskol Medical Lake Columbia Silver lake ‡ USA 47.54 -117.65 EA1(5) E1(10) E1(10) E1(2) 5 2005 River / Pacific Ocean Fish farms Plovdiv Maritsa / Fish pond BG 42.15 24.72 EA1(2) - - - 2 2007 Aegean Sea Vegas del Guadiana / Fish pond E 38.89 -6.88 EA1(5) E1(10) E1(10) E1(2) 5 2006 Guadiana Atlantic Ocean Mionnay Rhône / Fish pond F 45.90 4.92 W1(2) W1(4) W1(1), - 2 2005 Mediterranean W2(1), Sea W3(2) Bouligneux Rhône / Fish pond F 46.02 4.99 W1(1), E1(2), W3(2) - 2 2005 Mediterranean W2(1) W1(2) Sea Perugia Tiber / Trasimeno I 43.15 § 12.10 § W1(2) W1(4) W3(4) W1(2) 2 2005 Tyrrhenian Lake § Sea Mincio, Po / Adriatic Garda Lake § I 45.55 § 10.70 § W1(3) E1(1), W1(2), - 3 2005 Bonferraro Sea W1(4), W2(2), di Sorga W2(1) W3(2) Żabieniec Vistula / Fish pond PL 52.05 21.03 W1(1), E1(3), E1(1), W1(2) 2 2005 Baltic Sea W5(1) W1(1) W3(3) Wuhan Yangtze River Fish pond PRC 30.56 114.37 EA1(3), E1(8) E1(2) E1(2) 4 2004 / East China EA2(1) Sea Italian regional breed Ceresole Po / Adriatic Fish pond I 44.80 7.82 W1(2) E1(1), W1(3), - 2 2005 d ´Alba Sea W1(3) W3(1) Live gene bank in Vodňany Regional breeds Hluboká, new Elbe / North Fish pond CZ 49.05 14.43 EA1(2), E1(1), E1(1), - 3 2004 stock Sea W1(1) W1(5) W1(2), W3(3) Hluboká, Elbe / North Fish pond CZ 49.05 14.43 EA1(3) E1(2), W2(2), - 3 2004 old stock Sea W1(4) W3(4) Mariánské Elbe / North Fish pond CZ 49.97 12.70 EA1(3) E1(3), E1(4), - 3 2005 Lázně Sea W1(3) W3(2) Tábor Elbe / North Fish pond CZ 49.45 14.36 EA1(2), E1(2), E1(2), - 4 2004 (Milevsko), Sea W1(2) W1(4) W3(2) new stock Tábor, Elbe / North Fish pond CZ 49.40 14.69 EA1(3) E1(2), E1(2), - 3 2004 old stock Sea W1(4) W1(1), W3(3) Velké Elbe / North Fish pond CZ 49.35 16.02 EA1(1), E1(2), E1(2), - 3 2004 Meziříčí Sea W1(1), W1(4) W1(4) W4(1) Vodňany Elbe / North Fish pond CZ 49.15 14.18 EA1(3) E1(4), E1(5), - 3 2004 Sea W1(2) W2(1) European breeds Königswartha Elbe / North Fish pond D 51.31 14.33 EA1(1), E1(1), E1(1), - 5 2004 (Germany) Sea W1(1) W1(9) W1(5), W2(2)
58 Locality * Basin Water body Country Coordinates Haplotype codes (counts) NYear † Latitude Longitude CytB Act RpS7 ATPase Romania Danube / Fish pond RO EA1(1) E1(5), E1(2), - 4 2004 Black Sea , B1(3) W1(3) W1(1), W3(3) Hungaria Danube / Fish pond H EA1(5) E1(2), E1(1), - 5 2004 Black Sea W1(8) W3(3) Experimental breeds Leather ‘92 Fish pond CZ W2(3) E1(1), E1(6) - 3 2004 W1(5) Synthetic Fish pond CZ EA1(3) E1(3), E1(2), - 3 2004 W1(3) W2(2), W3(2) Gynogenetic Fish pond CZ EA1(3) W1(6) E1(4), - 3 2004 W3(1), W4(1) Ornamental breeds Golden Fish pond CZ EA1(2) E1(2), E1(1), - 2 2004 W1(2) W1(3) Blue Fish pond CZ EA1(2) E1(1), E1(1), - 2 2004 W1(3) W1(1), W3(2) Alampic Fish pond CZ EA1(2) E1(1), E1(1), - 2 2004 W1(3) W1(2), W3(1)
* For the geographical breeds in the live gene bank, locality identifies the original source of the breed, while for the experimental and ornamental breeds only the breed name is given. † The countries are coded as follows: Belgium (B), Bulgaria (BG), Bosnia (BIH), Canada (CDN), Switzerland (CH), Czech Republic (CZ), Germany (D), Spain (E), Estonia (EST), France (F), Great Britain (GB), Hungary (H), Italy (I), Iran (IR), Kazakhstan (KZ), New Zealand (NZ), Portugal (P), Poland (PL), China (PRC), Romania (RO), Russia (RUS), Sweden (S), Slovakia (SK), Turkey (TR), Ukraine (UA), United States of America (USA). ‡ Known introduced population. § Information about the source population.
59 2.2. PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca.
Lajbner Zdeněk, Kotlík Petr
Molecular Ecology Resources. (Early View; published online 20 SEP 2010) (doi: 10.1111/j.1755-0998.2010.02914.x)
60 Molecular Ecology Resources (2010) doi: 10.1111/j.1755-0998.2010.02914.x
MOLECULAR DIAGNOSTICS AND DNA TAXONOMY PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca
Z. LAJBNER*† and P. KOTLI´K* *Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska´ 89, 277 21 Libeˇchov, Czech Republic, †Department of Zoology, Faculty of Science, Charles University, 128 44 Prague, Czech Republic
Abstract The tench Tinca tinca is a valued table fish native to Europe and Asia, but which is now widely distributed in many temperate freshwater regions of the world as the result of human-mediated translocations. Fish are currently being trans- planted between watersheds without concern for genetic similarity to wild populations or local adaptation, and efficient phylogeographic markers are therefore urgently needed to rapidly distinguish genetically distinct geographical popula- tions and to assess their contribution to the hatchery breeds and to the stocked wild populations. Here, we present a new method to distinguish recently discovered and morphologically undistinguishable Western and Eastern phylogroups of the tench. The method relies on PCR-RFLP assays of two independent nuclear-encoded exon-primed intron-crossing (EPIC) markers and of one mitochondrial DNA (mDNA) marker and allows the rapid identification of the Western and Eastern phylogroup and also of three geographical mtDNA clades within the Eastern phylogroup. Our method will enable researchers and fishery practitioners to rapidly distinguish genetically divergent geographical populations of the tench and will be useful for monitoring the introduction and human-mediated spread of the phylogroups in wild populations, for characterization of cultured strains and in breeding experiments.
Keywords: EPIC, exon-primed intron-crossing marker, mtDNA, stocking Received 14 July 2010; revision received 6 August 2010; accepted 7 August 2010
The tench Tinca tinca is a valued table fish, native to Recently, phylogeographic analysis of DNA Europe and Asia between the British Isles and central sequences of several exon-primed intron-crossing (EPIC) Siberia (Brylin´ska et al. 1999), but it is now widely distrib- markers and of a mitochondrial DNA (mtDNA) gene dis- uted in many temperate freshwater regions of the world covered within the Eurasian range of the tench two geo- as the result of human-mediated translocations (Welcom- graphical clades, a Western phylogroup (clade W) found me 1988). Up until recently, there has been only limited in Europe from the British Isles to Poland and an Eastern information about population structure of the tench phylogroup (clade E) distributed from Europe through- throughout its vast native range (Kohlmann et al. 2010), out Asia to China (Z. Lajbner, O. Linhart and P. Kotlı´k, resulting in the absence of efficient phylogeographic unpublished manuscript). Within the Eastern phylo- markers to monitor the genetic and geographical origin group, populations with mtDNA (but not nuclear mark- of hatchery stocks, such that fish are being transplanted ers) distinct from the major Eastern clade (EA) were from one watershed to another without concern for found in a southern tributary of the Danube River in genetic similarity to neighbouring wild populations or Bulgaria (clade EI) and in the southern part of the Caspian adaptation to local environment. Therefore, for successful Sea basin in Iran (clade EC). Separation into the phylo- fishery management and sustainable exploitation of groups most reasonably reflects long-term evolutionary tench, it is extremely important to develop easy markers isolation of populations in different parts of the native that would enable researchers and fishery practitioners range, but we have shown that tench of both phylo- to rapidly distinguish genetically distinct geographical groups can freely interbreed with one another when in populations and to assess their contribution to the hatch- contact in wild populations (Lajbner et al. 2010). The ery breeds and to the stocked wild populations. presence of both phylogroups in cultured breeds of dif- ferent geographical origins and the occurrence of EA Correspondence: Zdeneˇk Lajbner, Fax: (420) 315 639 510; haplotypes at the western edge of the native range (e.g. E-mail: [email protected] in Spain and Britain) showed that extensive admixture
2010 Blackwell Publishing Ltd 61 2 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY has occurred both in wild populations and in hatcheries, stabilizers, additives; Top-Bio, Prague, Czech Republic), largely as a consequence of fishery practices that ignore 10 pmol of each primer, 0.2 lg of template DNA and the genetic structure among and within populations. demineralized water to the final volume. To facilitate To facilitate the assessment of admixture among wild high-throughput analysis, the amplification in a PTC 200 and cultured tench, we have developed a rapid and effi- Peltier thermal cycler (MJ Research, Watertown, MA, cient method that distinguishes between the nuclear USA) was performed using the same PCR program for and mtDNA genomes of the phylogroups. The method all markers, which contained 5 min of initial denatur- further enables distinguishing between the three ation at 95 C, six cycles of a touch-down profile of 1-min mtDNA clades (EA, EI and EC) in the Eastern phylo- denaturation at 94 C, 1 min 30 s at 60–56 C with the group. The method relies on polymerase chain reaction annealing temperature lowered by 2 C after every two (PCR) restriction fragment length polymorphism (RFLP) cycles and 2-min elongation at 72 C, followed by 30 assays of two independent nuclear-encoded EPIC mark- cycles with the annealing temperature held at 54 C. For ers, the second intron of the actin gene (Act) and the the RFLP analyses, 4 lL of the PCR products were first intron of the gene coding for the S7 ribosomal pro- digested for 10 h at 37 Cin10lL reaction volumes con- tein (RpS7), and of one mtDNA marker, the cytochrome taining 4 lL of demineralized water and 1 lL of endonu- b gene (Cytb). Examination of DNA sequences of all clease buffer with 1 lL of the endonuclease Eco52I, AluI, known haplotypes for each of these three markers found MboI (Fermentas, Vilnius, Lithuania) or NdeI (New in a survey of 225 tench from a wide range of geograph- England Biolabs, Ipswich, MA, USA) and then ical regions (GenBank accession nos HM167935– deactivated at 65 C for 20 min. Restriction fragments HM167938, HM167941–HM167965) indicated that the were separated on 2% agarose gels containing 2 lLof Western and Eastern phylogroup could be reliably dis- GoldView (SBS Genetech, Shanghai, China). tinguished by cleavage of Act by Eco52I restriction endo- Digesting the amplicons of individuals carrying all nuclease, of RpS7 by NdeI endonuclease and of Cytb by known haplotypes for each of the three genes, including AluI and MboI endonucleases. In addition, cleavage of heterozygotes for each nuclear gene, yielded the pre- Cytb using AluI distinguishes the EI clade and cleavage dicted RFLP profiles (Fig. 1). The restriction digestion of with MboI the EC clade. the 1226-bp amplicon of Cytb by MboI at four cleavage To validate the new assays, tench genomic DNA was sites (345, 642, 876, 946 bp) resulted in five fragments (70, extracted from ethanol-preserved muscle tissue or fin 234, 280, 297, 345 bp) in the Eastern phylogroup, except clips using DNeasy Tissue Kit (Qiagen, Valencia, CA, in clade EC, which does not have the 642-bp and 946-bp USA). A 335-bp amplicon containing the Act intron was sites but has a 132-bp site and had a four-band pattern PCR-amplified with the EPIC primers described by (132, 213, 350, 531 bp). The Western phylogroup also has Atarhouch et al. (2003), and a 923–927-bp amplicon (928 the 132-bp site but does not have the 946-bp site and had total bp of the alignment) containing the RpS7 intron with a unique five-band pattern (132, 213, 234, 297, 350 bp). the EPIC primers published by Chow & Hazama (1998). The digestion of Cytb by AluI at three cleavage sites (184, A 1226-bp part of the mitochondrial DNA containing the 891, 1168 bp) resulted in four fragments (58, 184, 277, entire Cytb was amplified with the primers located in 707 bp) in the Eastern phylogroup, except in the EI clade, flanking tRNAs as described by Machordom & Doadrio which does not have the 1168-bp site and had a three- (2001). Primer names and sequences are listed in Table 1. band pattern (184, 335, 707 bp). The Western phylogroup The 25 lL PCRs contained 0.5· concentration of PPP does not have the 891-bp site and had a different three- Master Mix (2· stock solution: 150 mM Tris-HCl [pH 8.8], band pattern (58, 184, 984 bp), except in one of the haplo-
40 mM (NH4)2SO4, 0.02% Tween 20, 5 mM MgCl2, 400 lM types (W2), which only has the 1168-bp site and had a of each dNTP, 100 U ⁄ mL Taq-Purple DNA polymerase, two-band pattern (58, 1168 bp).
Table 1 Primers and their sequences
Marker (amplicon size) Primer Sequence (5¢ to 3¢) Reference
Cytb (1226 bp) GluF AACCACCGTTGTATTCAACTACAA Machordom & Doadrio (2001) ThrR ACCTCCGATCTTCGGATTACAAGACCG Machordom & Doadrio (2001) RpS7 (923–927 bp)* S7RPEX1F TGGCCTCTTCCTTGGCCGTC Chow & Hazama (1998) S7RPEX2R AACTCGTCTGGCTTTTCGCC Chow & Hazama (1998) Act (335 bp) Act-2-F GCATAACCCTCGTAGATGGGCAC Atarhouch et al. (2003) Act-2-R ATCTGGCACCACACCTTCTACAA Atarhouch et al. (2003)
*Length variation because of gaps.
2010 Blackwell Publishing Ltd 62 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY 3
(a) Cytb (MboI) Cytb (AluI) (b) RpS7 (NdeI) (c) Act (Eco52I) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
1000 500 500
100 100 bp bp
Fig. 1 Agarose gels showing diagnostic restriction fragment patterns. (a) Cytb assays. Lanes 1, 5 and 10: 100-bp ladder molecular weight standard (500- and 1000-bp bands highlighted); lane 2: Western phylogroup digested with MboI; lane 3: EC clade digested with MboI; lane 4: other Eastern clades digested with MboI; lane 6: W2 haplotype digested with AluI; lane 7: other Western haplotypes digested with AluI; lane 8: EI clade digested with AluI; lane 9: other Eastern clades digested with AluI. (b) RpS7 assay with NdeI. Lanes 11 and 15: 100-bp ladder; lane 12: Western phylogroup; lane 13: Western ⁄ Eastern heterozygote; lane 14: Eastern phylogroup. (c) Act assay with Eco52I. Lanes 16, 20 and 24: 100-bp ladder (500-bp band highlighted; note different version of ladder than in panels a and b); lanes 17–19: native PCR product; lane 17: Western phylogroup; lane 18: Western ⁄ Eastern heterozygote; lane 19: Eastern phylogroup; lanes 21–23: target amplicon (335-bp) purified by gel-extraction prior to endonuclease treatment; lane 21: Western phylogroup; lane 22: Western ⁄ Eastern heterozygote; lane 23: Eastern phylogroup. Note that fragments with size under 100 bp are difficult to visualize but this does not affect scoring.
The digestion of the 923–927-bp amplicon of RpS7 All individuals with previously sequenced amplicons (size range is because of gaps) by NdeI yielded a two- (Cytb: n = 17; RpS7: n = 11; Act: n = 11) were correctly band pattern for the Eastern phylogroup and a three- genotyped by the new method, which demonstrates its band pattern for the Western phylogroup (Fig. 1b). There accuracy. An additional 71 tench, originated from two is a cleavage site at 110 bp common to both phylogroups lakes in Germany where the Western and Eastern phylo- that produced a small fragment (110 bp) in both phylo- group (EA clade) coexist (Lajbner et al. 2010), were groups and a second, large fragment (813–817-bp) in the screened by these assays (only 35 fish for Cytb) to verify Eastern phylogroup. An additional cleavage site at the efficiency of the protocol. All specimens were unam- 478 bp that is absent in the Eastern phylogroup produced biguously genotyped as either the Western phylogroup two fragments of an intermediate size (368, 446–448 bp) (Cytb: n = 32; RpS7: n = 55; Act: n = 42) or Eastern phylo- in the Western phylogroup. group (Cytb: n =3;RpS7: n =4;Act: n = 1) or heterozyg- The digestion of the 335-bp amplicon of Act by Eco52I otes (RpS7: n = 12; Act: n = 28). Thus, the new RFLP at a single cleavage site (182 bp), which is absent in the assays are a robust and rapid method to distinguish the Eastern phylogroup, resulted in two fragments (153, Western and Eastern phylogroup and also the three 182 bp) in the Western phylogroup (Fig. 1c). mtDNA clades in the Eastern phylogroup of the tench. The amplification of Act under the above-mentioned The assays will be useful for monitoring the human-med- conditions produced a second major amplicon of a lar- iated dispersal of the phylogroups among wild popula- ger molecular size (approximately 580 bp) than our tions currently occurring via aquaculture, for marker, plus a minor amplicon (approximately 430 bp). characterization and identification of cultured strains, The genome of teleost fishes contains multiple paralo- and in breeding experiments. gous actin genes (Venkatesh et al. 1996), and these addi- tional amplicons thus were most probably derived from Acknowledgements paralogous annealing of the EPIC primers. The extra amplicons were not cleaved with Eco52I, so that for reli- The authors thank Silvia Markova´ for laboratory assistance and able genotyping of our EPIC marker, they did not need for advice. The work was supported by the Ministry of Educa- tion, Youth and Sports of the Czech Republic (LC06073) and by to be removed (see Fig. 1c). Occasionally, the amplifica- the Academy of Sciences of the Czech Republic (IRP IAPG tion of RpS7 also yielded up to three minor amplicons AV0Z50450515 and IGA UZFG ⁄ 05 ⁄ 22). of different molecular sizes in addition to the expected amplicon, some of which were present in multiple indi- viduals (most notably amplicons of approximately 580 References and 1600 bp), but these minor amplicons were not Atarhouch T, Rami M, Cattaneo-Berrebi G et al. (2003) Primers for EPIC cleaved by NdeI and did not interfere with the genotyp- amplification of intron sequences for fish and other vertebrate popula- ing. tion genetic studies. BioTechniques, 35(4), 676–682.
2010 Blackwell Publishing Ltd 63 4 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY
Brylin´ska M, Brylin´ski E, Bnin´ska M (1999) Tinca tinca (Linnaeus, 1758). Reviews in Fish Biology and Fisheries, 20, 289–300. doi:10.1007/s11160- In: The Freshwater Fishes of Europe, 5 ⁄ I: Cyprinidae 2 ⁄ I (ed. Ba˘na˘rescu 009-9137-y PM), pp. 229–302. AULA-Verlag, Wiesbaden. Machordom A, Doadrio I (2001) Evidence of a Cenozoic Betic-Kabilian Chow S, Hazama K (1998) Universal PCR primers for S7 ribosomal connection based on freshwater fish phylogeography (Luciobarbus, protein gene introns in fish. Molecular Ecology, 7(9), 1255–1256. Cyprinidae). Molecular Phylogenetics and Evolution, 18(2), 252–263. Kohlmann K, Kersten P, Panicz P, Memis¸D, Flajsˇhans M (2010) Genetic Venkatesh B, Tay BH, Elgar G, Brenner S (1996) Isolation, characterization variability and differentiation of wild and cultured tench populations and evolution of nine pufferfish (Fugu rubripes) actin genes. Journal of inferred from microsatellite loci. Reviews in Fish Biology and Fisheries, 20, Molecular Biology, 259(4), 655–665. 279–288. doi:10.1007/s11160-009-9138-x Welcomme RL (1988) International introductions of inland aquatic species. Lajbner Z, Kohlmann K, Linhart O, Kotlı´k P (2010) Lack of reproductive FAO Fisheries, Technical Paper No. 294, , Food and Agriculture Orga- isolation between the Western and Eastern phylogroups of the tench. nization of the United Nations, Rome, Italy.
2010 Blackwell Publishing Ltd 64 2.3. Lack of reproductive isolation between the Western and Eastern phylogroups of the tench.
Lajbner Zdeněk, Kohlmann Klaus, Linhart Otomar, Kotlík Petr (2010)
Reviews in Fish Biology and Fisheries 20, 289-300. (doi: 10.1007/s11160-009-9137-y)
65 Rev Fish Biol Fisheries (2010) 20:289–300 DOI 10.1007/s11160-009-9137-y
RESEARCH PAPER
Lack of reproductive isolation between the Western and Eastern phylogroups of the tench
Zdeneˇk Lajbner • Klaus Kohlmann • Otomar Linhart • Petr Kotlı´k
Received: 2 November 2008 / Accepted: 21 September 2009 / Published online: 14 November 2009 Ó Springer Science+Business Media B.V. 2009
Abstract The Eurasian range of the tench distribu- lakes within the contact zone in Germany. The test is tion is subdivided into deeply divergent Western and based on the expectation that in the presence of Eastern phylogroups evidenced by nuclear and mito- strong barriers to reproduction, a hybrid population chondrial DNA sequence markers. A broad zone of will show genome-wide associations among alleles overlap exists in central and western Europe, sug- and genotypes from each phylogroup even after gesting post-glacial contact with limited hybridisa- hundreds of generations of interbreeding. In contrast tion. We conducted a population genetic test of this to this expectation, no consistent significant devia- indication that the two phylogroups may represent tions from linkage and Hardy–Weinberg equilibria distinct species. We analysed variation at introns of were found. Samples from both lakes did show nuclear genes, microsatellites, allozymes and mito- significant disequilibria but they were limited to chondrial DNA in populations from two postglacial individual loci and were not concordant between populations, and were not robust to the method used. The single consistent association can be attributed to Z. Lajbner (&) P. Kotlı´k Department of Vertebrate Evolutionary Biology physical linkage between two microsatellite loci. and Genetics, Institute of Animal Physiology Thus, results of our study support the hypothesis of and Genetics, Academy of Sciences of the Czech free interbreeding between the two phylogroups of Republic, Rumburska´ 89, 277 21 Libeˇchov, tench. Therefore, although the phylogroups may be Czech Republic e-mail: [email protected] considered as separate phylogenetic species, the present data suggest that they are a single species Z. Lajbner under the biological species concept. Department of Zoology, Faculty of Science, Charles University, 128 44, Prague, Czech Republic Keywords Allozymes Microsatellites K. Kohlmann mtDNA Disequilibrium Hybridization Department of Aquaculture and Ecophysiology, Tinca tinca Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Mueggelseedamm 310, P.O. Box 850119, 12561 Berlin, Germany Introduction O. Linhart ˇ University of South Bohemia, Ceske´ Budeˇjovice, Most freshwater fish species in Eurasia show phylog- Research Institute of Fish Culture and Hydrobiology at Vodnˇany, Za´tisˇ´ı 728/II, 389 25 Vodnˇany, eographic subdivisions of their geographic ranges that Czech Republic developed in response to recurrent isolation in glacial 123
66 290 Rev Fish Biol Fisheries (2010) 20:289–300 refugia during the Pleistocene (Hewitt 2004). These The present study examines the existence of range shifts and the accompanying demographic barriers to reproduction between the Western and changes resulted in divergence between refugial Eastern phylogroups of tench in two lakes within the populations, which in some species may have pro- zone of their postglacial contact. The Grosser ceeded towards speciation (see Bernatchez and Wil- Felchowsee and Kleiner Do¨llnsee lakes are situated son 1998; Knowles 2001; Carstens and Knowles in north-eastern Germany in an area covered by the 2007). A recent phylogeographic study of the tench Scandinavian ice sheet during the Weichselian gla- Tinca tinca (L.) demonstrated that the Eurasian range ciation (Ehlers et al. 2004). The phylogeographic of this species is subdivided into deeply divergent study revealed the presence of markers characteristic Western and Eastern phylogroups (i.e. clades with of the Western as well as the Eastern phylogroup in geographically adjacent distributions), evidenced by both lakes (Lajbner et al. unpublished). The lakes phylogenetic analysis of sequence variation at introns could only be colonised by tench after the deglaci- of nuclear genes (actin, S7 ribosomal protein and ATP ation, and the populations inhabiting the lakes today synthase beta subunit) and at a mitochondrial (mt) most likely were not founded before the end of the DNA gene (cytochrome b) (Lajbner et al. 2007). Younger Dryas (Jahns 2000), about 11,500 years ago Similar to other European freshwater fish species (Muscheler et al. 2008). Nevertheless, the period (Durand et al. 1999; Nesbø et al. 1999; Kotlı´k and since then corresponds to roughly 3,000 generations Berrebi 2001), these phylogroups probably diverged of tench, and the populations founded by a mixture of after a colonization of western Europe from the Black the Western and Eastern phylogroups should not Sea basin during a Pleistocene interglacial and their show genome-wide associations among alleles and subsequent separation by cold periods, conforming to genotypes from each phylogroup if they have been the ‘chub’ paradigm pattern (Hewitt 2004). A broad freely interbreeding (Nagylaki 1976, 1977; Barton zone of overlap was formed upon the geographic and Gale 1993). If, on the contrary, the phylogroups contact between the tench phylogroups in central and show genetic incompatibilities in terms of differential western Europe following their postglacial expansion frequency or viability of homospecific versus heter- from two principal freshwater refugia, the Ponto- ospecific crosses, the populations should display Caspian refugium (Ba˘na˘rescu 1991; Kotlı´k et al. genome-wide linkage and Hardy–Weinberg disequi- 2004) and the western European refugium (e.g. libria, even after the many generations of interbreed- Durand et al. 1999; Nesbø et al. 1999; Kotlı´k and ing (e.g. Lajbner et al. 2009). To rectify this issue, Berrebi 2001). The sequence divergence between the tench sampled from these lakes were genotyped for tench phylogroups at mtDNA (1.3% for cytochrome b two introns of nuclear genes (actin and S7 ribosomal gene) approaches divergence among distinct fish protein) and for a mtDNA. These three markers are species (Hendry et al. 2000a) and it roughly corre- fully diagnostic between the two phylogroups in that sponds to a separation time for at least 750,000 years they posses alternate, DNA sequence-based classes of (see Waters et al. 2007). Allopatric speciation takes alleles (Lajbner et al. 2007), which were distin- usually a prolonged time (McCune and Lovejoy 1998) guished here by restriction fragment length polymor- but there are exceptions (Near and Benard 2004), and phism (RFLP) assay. To provide a broader genomic in sympatry mating barriers can evolve in just few coverage of markers, these data were analysed along generations (Hendry et al. 2000b). The existence of with genotypes for the same individuals at additional broad contact zone with the presence of individuals of fourteen genetic loci with unknown phylogroup apparently hybrid ancestry (i.e. heterozygous for specificity (allozyme and microsatellite), which were alternate phylogroup-specific alleles at nuclear loci scored by starch electrophoresis (allozymes for the or homozygous at a nuclear locus but with mtDNA of Felchowsee individuals) or were available from the opposite phylogroup) suggests that there is earlier studies (Kohlmann and Kersten 1998, 2006; incomplete reproductive isolation between the tench Kohlmann et al. 2007, 2009). phylogroups. On the other hand, the fact they have The principal question addressed by this study is remained effectively allopatric outside the contact whether there is evidence of two genetically distinct zone suggests the existence of mechanisms restricting reproductive units in each lake. More specifically, the introgression. results are used to determine whether the lakes show 123
67 Rev Fish Biol Fisheries (2010) 20:289–300 291 signs of a hybrid population structure (i.e. purebred Total DNA of fish from Felchowsee and Do¨llnsee
Western, purebred Eastern, F1 hybrids etc.), and if was extracted from ethanol-preserved muscle tissue there are consistent (between lakes and across loci or from fin clips by using Dneasy Tissue Kit and methods) deviations from linkage and Hardy– (Qiagen). A part of nuclear DNA containing 2nd Weinberg equilibria in these lakes that could be intron of actin gene (336 bp) was amplified using attributed to the existence of barriers to merging of primers Act-2-R and Act-2-F designed by Touriya gene pools of the two founding phylogroups. et al. (2003) and another part containing 1st intron of RPS7 gene (900 total bp) using primers S7RPEX2R and S7RPEX1F (Chow and Hazama 1998). In Materials and methods addition, an approximately 1,225 bp long portion of mtDNA containing entire gene for cytochrome b was Data acquisition amplified for fish from Felchowsee using primers GluF and ThrR (Machordom and Doadrio 2001). For The study was conducted on 49 tench collected from a the sake of simplicity, the PCR program was unified wild population inhabiting Lake Grosser Felchowsee for all markers and contained 5 min of initial (160 ha; 53°30N, 14°80E). This sampling was supple- denaturation at 95°C, touch-down profile of 1 min mented by an additional 19 individuals from Lake at 94°C, two cycles at 60–56°C(2°C/cycle) for 1 min Kleiner Do¨llnsee (25 ha; 52°590N, 13°340E). Both 30 s, and 2 min at 72°C followed by 30 cycles with lakes are situated in Germany in the north-eastern part annealing temperature held at 54°C. The PCR of the Oder River drainage of the Baltic Sea basin, in reaction mix consisted of 12.5 mm3 of Top-Bio the lowland area rich in lakes and wetlands. There PPP Master Mix (Top-Bio, Prague, Czech Republic), have probably never been introductions of foreign 10 pmol of each primer, 0.2 lg of DNA and demi- tench into the lakes or supportive artificial reproduc- neralised water up to 25 mm3. For RFLP analysis, tion of the indigenous tench from the lakes (T. Lo¨we, 4mm3 of the PCR products were digested for 10 h at Lake Felchowsee owner, personal communication). 37°Cin10mm3 volumes containing 4.7 mm3 of Recently conducted large scale phylogeographic demineralised water and 1 mm3 of Y?/Tango buffer study (Lajbner et al. 2007) gives a possibility to with 0.3 mm3 of the restriction endonucleases AluI, discriminate the two evolutionary lineages of tench Eco52I or MboII (Fermentas, Vilnius, Lithuania) for on the basis of two nuclear markers and one fragments in the same order as listed above and than mitochondrial marker, which can be easily scored deactivated at 65°C for 20 min. Restriction fragments by RFLP. A restriction map was generated for each were separated on 2% agarose gel containing 2 mm3 marker using the CLC Free Workbench 4.5.1 (CLC of GoldView (SBS Genetech, Shanghai, China). bio) from haplotype sequences of T. tinca (Lajbner Samples from Felchowsee were analysed for their et al. unpublished) and endonucleases digesting the genetic variability in 11 enzymatic systems repre- markers at lineage specific positions were selected. senting 24 gene loci by horizontal starch gel electro- The phylogroup specific restriction endonuclease phoresis (Aebersold et al. 1987) (Table 1). Staining Eco52I was selected for the 2nd intron of the actin of all but two enzymes followed the standard gene and MboII for the 1st intron of the S7 ribosomal procedures of Shaw and Prasad (1970) and the protein (RPS7) gene. Both endonucleases were modified protocol of Vuorinen (1984). Creatine predicted to yield phylogroup-specific RFLP profiles kinase was visualised using general protein staining following digestion of the respective polymerase (amido black). Superoxide dismutase appeared as chain reaction (PCR) products due to restriction sites light, whitish spots on gels stained for alcohol present only in one of the phylogroups. The restric- dehydrogenase, glycerol-3-phosphate dehydrogenase tion endonuclease AluI was predicted to yield or phosphoglucomutase, respectively. Enzyme band- phylogroup-specific RFLP profiles following diges- ing patterns were read by using the tench gene tion of a PCR product of the mtDNA cytochrome b nomenclature of Sˇlechtova´ et al. (1995), which gene due to a diagnostic restriction site, which follows the rules suggested by Shaklee et al. unambiguously identified each individual to either (1990). Alleles were named according to their Eastern or Western phylogroup maternal ancestry. relative electrophoretic mobilities. 123
68 292 Rev Fish Biol Fisheries (2010) 20:289–300
Table 1 Enzymes and tissues examined, number of loci screened and buffer systems used Enzyme E.C. number Abbreviation Tissue Number of loci Buffera
Aspartate aminotransferase 2.6.1.1. mAAT Muscle 2 B sAAT Muscle/liver 1 B Alcohol dehydrogenase 1.1.1.1. ADH Liver 1 C Creatine kinase 2.7.3.2. CK Muscle 1 A Glycerol-3-phosphate dehydrogenase 1.1.1.8. G3PDH Muscle/liver 2 C Glucose-6-phosphate isomerase 5.3.1.9. GPI Muscle/liver 2 A Isocitrate dehydrogenase 1.1.1.42. mIDHP Muscle 2 C sIDHP Liver 2 B Lactate dehydrogenase 1.1.1.27. LDH Muscle/liver 3 B Malate dehydrogenase 1.1.1.37. mMDH Muscle/liver 2 B sMDH Muscle/liver 2 B Phosphogluconate dehydrogenase 1.1.1.44. PGDH Liver 1 B ? C Phosphoglucomutase 5.4.2.2. PGM Muscle/liver 2 C Superoxide dismutase 1.15.1.1. SOD Liver 1 C a Buffers: A Tris–citric acid, pH 8.5 (gel) and lithium hydroxide—boric acid, pH 8.1 (tray; Ridgway et al. 1970), B Citric acid— morpholine, pH 6.5 (Clayton and Tretiak 1972, modified by Vuorinen 1984), C Tris–citric acid, pH 7.1 (Shaw and Prasad 1970)
Additional raw data for the same allozyme loci for tables (with the same allelic counts) with the same or fish from Do¨llnsee and 6 microsatellite loci for fish lower probability. Two variants of the more powerful from both lakes were taken from studies of Kohlmann score test (U test) were run, which assumed, respec- and Kersten (1998, 2006) and Kohlmann et al. (2007, tively, heterozygote excess or heterozygote defi- 2009). Microsatellite locus MTT8 was inferred to ciency as the alternative hypothesis to panmixia contain a null allele (Kohlmann et al. 2009) and was (Rousset and Raymond 1995). The Markov chain therefore discarded from most analyses. Allelic algorithm to estimate without bias the exact P-value frequencies of MTT6 and MTT2 were compared of this test (Guo and Thompson 1992) was conducted with raw data of Kohlmann et al. (2009) from Las by 1,000 batches of 20,000 iterations following Vegas del Guadiana fish farm in Spain (Bada), 20,000 dememorization steps. Wuhan in China (Chin) and Lake Sapanca in Turkey Wright’s F-statistics was used as another means of (Turk) that appeared to contain only Eastern phylo- quantifying the conformity of genotype frequencies to group alleles (Lajbner et al. unpublished). Hardy–Weinberg proportions and to test the existence of geographical subdivision of populations. Two Data analyses parameters were estimated for the polymorphic loci according to Weir and Cockerham (1984) with the For each population, variation at polymorphic loci Genetix software package, v.4.05 (Belkhir et al. was summarized as Nei’s unbiased expected hetero- 2004). The inbreeding coefficient FIS was estimated zygosity or gene diversity (Nei 1987). by the estimator f, and the fixation index FST by the Three types of exact test of Hardy–Weinberg estimator h (Weir and Cockerham 1984). The signif- equilibrium were conducted for each population by icance of the multilocus estimates was assessed by a using Genepop 4.0 (Rousset 2008), which all assume permutation test using a 20,000 randomised data set the same null hypothesis (random union of gametes) generated by permuting the alleles among individuals but differ in the construction of the rejection zone. In for FIS and the individuals among the samples for FST the exact probability test (e.g. Haldane 1954; Weir (Dallas et al. 1995; Balloux and Lugon-Moulin 2002). 1996), the probability of the observed sample is used Exact multilocus tests for association between to define the rejection zone, and the P-value of the alleles were also computed using software MLD test corresponds to the sum of the probabilities of all (Zaykin et al. 1995) allowing haplo-diploid data 123
69 Rev Fish Biol Fisheries (2010) 20:289–300 293 combination. In this test, the proportion of 20,000 crossing between the parental species were allowed permuted multilocus genotypic arrays as probable or (pure Western phylogroup, pure Eastern phylogroup, less probable than the sample forms an estimate of the F1 hybrid, F2 hybrid, BC1 to Western phylogroup, significance level. Pairwise genotypic and allelic BC1 to Eastern phylogroup and their crosses). Three linkage disequilibria were calculated by Black and separate NewHybrids analyses were run, the first for Krafsur (1985) method of Linkdos (Garnier-Ge´re´ and the Felchowsee and Do¨llnsee together, the second for Dillmann 1992) implemented in Genetix 4.05 (Belk- the Felchowsee alone, and the third for the Do¨llnsee hir et al. 2004), and using Cockerham and Weir’s alone. For all analyses the Markov chain was run with (1977) coefficient of gametic disequilibrium for each a burn-in period of 100,000 iterations and 1,000,000 pair of loci (Dij) and Weir’s (1979) correlation iterations following the burn-in, and assuming unin- coefficient between alleles at two loci (Rij). The formative Jeffreys-type priors on the parameters. significance of the genotypic linkage disequilibria was Each analysis was run several times to assess calculated using 10,000 permutations of genotypes convergence. The analysis was considered to have among individuals within each population while converged upon a stationary distribution if the significance of allelic associations were estimated by independent runs generated similar results. the chi-square test (Weir 1979). Pairwise genotypic We determined the number of subpopulations of associations among all loci (nuclear-encoded and tench within each lake using a statistical procedure mitochondrial) were also calculated by Linkdos (Pritchard et al. 2000) that attempts to minimize (Garnier-Ge´re´ and Dillmann 1992) as implemented disequilibrium (Hardy–Weinberg and linkage) within in Genepop 4.0 (Rousset 2008). Contingency tables groupings. The number of subpopulations (K) with the were created for all pairs of loci for each lake and a G highest posterior probability was estimated by using test was computed for each table using the Markov the program Structure 2.2 (Pritchard et al. 2000; chain algorithm of Raymond and Rousset (1995). Falush et al. 2003, 2007). The admixture model and Bayesian method and the program NewHybrids the option of correlated allele frequencies between v.1.1 (Anderson and Thompson 2002) were used for populations (also called the F-model) were selected quantifying the level of certainty that each individual because it is considered the superior model for belongs to each of pre-specified genotype classes. detecting structure even among closely related pop- The method does not require that allele frequencies of ulations (Falush et al. 2003). Markov Chain Monte each of the species are known and the loci used do Carlo runs consisted of 100,000 burn-in iterations not necessarily need to be diagnostic. Rather, it uses a followed by 1,000,000 iterations. We explored K in Markov chain Monte Carlo simulation to integrate the range from one to nine and performed 10 runs for over possible values of the model parameters (i.e. the each K value in each lake separately. proportion of individuals from the different genotype classes and the allele frequencies of each species), and estimates the posterior probability that an indi- Results vidual belongs to each genotype class (Anderson and Thompson 2002). The inheritance model imple- Hardy–Weinberg and linkage equilibrium mented assumes that a sample has been drawn from a mixed population of two species with unknown Tench populations from Felchowsee and Do¨llnsee were proportions of individuals from the different hybrid moderately but significantly differentiated (FST = classes. Although it is generally possible to consider 0.012, P \ 0.05). Samples from each lake were there- as many hybrid classes as needed, the finite number fore treated separately in the analyses. of available loci is not sufficient to reliably distin- Heterozygote deficiencies measured by the guish between these numerous categories, and it is inbreeding coefficient and by the exact tests of thus more appropriate to concentrate on the early Hardy–Weinberg equilibrium (probability and scores generation hybrid classes (Boecklen and Howard test) revealed a significant deviation of genotype 1997; Epifanio and Philipp 1997; Rieseberg and frequencies from Hardy–Weinberg proportions in Linder 1999). Therefore, only those genotype classes both lakes. However, the loci that showed deviations that could occur after up to three generations of in Felchowsee were not the same as the loci that 123
70 294 Rev Fish Biol Fisheries (2010) 20:289–300 showed significant patterns in Do¨llnsee (Table 2). lower than for K = 1, and higher values of K Multilocus heterozygote deficiencies measured by the received progressively decreasing probabilities. inbreeding coefficient revealed a significant deviation The NewHybrids analysis did not detect any from Hardy–Weinberg proportions in Felchowsee individual that could be classified as either purebred
(FIS = 0.079, P \ 0.01) but not in Do¨llnsee (FIS = Western or purebred Eastern or any of the early- 0.040, P [ 0.05). The exclusion of locus MTT8 from generation hybrids. Instead, the analyses assigned all this analysis slightly reduced the values of the individuals from both lakes as advanced backcrosses inbreeding coefficient but did not reduce the levels to Western phylogroup. Genotypically, this category of significance of these findings in Felchowsee corresponds to the product of mating of the first-
(FIS = 0.059, P \ 0.05) or in Do¨llnsee (FIS = generation backcrosses of a backcross-to-Western 0.032, P [ 0.05). The significant indication of mul- type among themselves. The posterior probability of tilocus heterozygote deficiency is further suported in assignment to this category was similar for individ- Felchowsee (P \ 0.001) but not in Do¨llnsee (P [ uals from Felchowsee (mean 0.884, SD 0.066) and 0.05) by the multilocus score test under the hetero- Do¨llnsee (mean 0.735, SD 0.021) and for a pooled zygote deficiency alternative hypothesis. The result sample (0.923, SD 0.039). remained significant after the exclusion of MTT8 locus in Felchowsee (P \ 0.05) and insignificant in Do¨llnsee (P [ 0.05). Discussion Multilocus test of linkage disequilibria detected significant associations in both lakes (MLD exact Despite their high evolutionary divergence (1.3% for test, P \ 0.05). However, few significant pairwise cytochrome b gene) that compares with genetic genotypic disequilibria were found (Table 3) and no distance between species (Avise et al. 1998), two significant cytonuclear disequilibria were detected. phylogroups of tench emanating from different Only the disequilibrium between microsatellite loci Pleistocene refugia form a broad contact zone in MTT2 and MTT6 was consistently significant in both Europe composed of individuals of mixed ancestry lakes, independent on the method used (Table 3). The (Lajbner et al. unpublished). The present study found associated alleles of these loci were the same in both evidence that these phylogroups are not separated by lakes (Table 4), and they were indistinguishable in strong barriers to reproduction and that they merged size from alleles fixed in three putatively pure Eastern back into a single population after colonization of the populations (Bada, Chin and Turk) analysed by same postglacial lake. Kohlmann et al. (2009). If the phylogroups evolved genetic incompatibil- ities during their refugial isolation, the current hybrid Population and hybrid structure populations should consistently display significant associations among alleles and genotypes from each Partitioning of the tench populations in two distinct phylogroup caused by lowered frequency and/or reproductive units (i.e. subpopulations) was not viability of crosses between the phylogroups (e.g. supported by the Structure analysis. Although the Caputi et al. 2007; Sta¨dler et al. 2008; Lajbner et al. prior parameters for the F model (gamma distribution 2009). If, on the contrary, they freely interbreed, with mean 0.01 and SD 0.05) were chosen to allow current populations that were postglacially founded the existence of two populations even with very by both phylogroups should not show genome-wide similar allele frequencies, in both populations the associations anymore as the result of inter-locus highest log likelihood value (Felchowsee: mean recombination over the many generations of inter- -1,168.467, SD 0.327; Do¨llnsee: mean -406.750, breeding (see Templeton 2006). SD 0.565) was found for K = 1. Log likelihood Results of the various analyses in this study values for the population consisting of two (Fel- strongly supported the hypothesis of free interbreed- chowsee: mean -1,175.483, SD 4.080; Do¨llnsee: ing between the phylogroups as opposed to strong mean -407.420, SD 0.258) or three separate repro- barriers to reproduction. The Structure analysis ductive units (Felchowsee: mean -1,190.433, SD (Pritchard et al. 2000) suggested that tench in each 9.279; Do¨llnsee: mean -408.840, SD 0.559) were lake corresponded with the highest probability to a 123
71 e ihBo ihre 21)20:289–300 (2010) Fisheries Biol Fish Rev
Table 2 Variation at each polymorphic locus and conformity to Hardy–Weinberg expectations evaluated with four different tests Marker Felchowsee Do¨llnsee
Sample Number of Gene FIS FIS HW HE HD Sample Number of Gene FIS FIS HW HE HD size alleles diversity (P) (P) (P) (P) size alleles diversity (P) (P) (P) (P)
Actin 36 2 0.3658 -0.2963 0.0871 0.1555 0.0838 1.0000 17 2 0.4011 -0.0275 0.7109 1.0000 0.7120 0.7631 RPS7 36 2 0.3658 0.3196 0.0714 0.0724 0.9901 0.0727 17 2 0.2139 -0.1065 0.8229 1.0000 0.8212 1.0000 MTT1 47 7 0.7884 -0.1078 0.0980 0.4743 0.0914 0.9154 19 5 0.7397 0.1496 0.1975 0.0415 0.9607 0.0396 MTT2 49 2 0.3737 0.1273 0.2991 0.4415 0.8999 0.2947 19 2 0.4623 -0.2611 0.2706 0.3449 0.2683 0.9586 MTT5 49 4 0.6449 0.1149 0.1397 0.2172 0.8243 0.1739 19 4 0.6615 0.2895 0.0456 0.0890 0.9806 0.0267 MTT6 49 5 0.7084 0.1950 0.0236 0.2101 0.9887 0.0108 18 6 0.6238 -0.1632 0.2273 0.3824 0.2552 0.8516 MTT8 49 3 0.2401 0.5775 0.0001 0.0002 0.9999 0.0002 17 3 0.1693 0.3118 0.0898 0.0909 0.9690 0.0931 MTT9 49 19 0.9007 0.0488 0.1945 0.8056 0.8431 0.1111 18 9 0.8587 -0.0362 0.5197 0.5184 0.4565 0.5859 sAAT* 49 2 0.1851 0.1193 0.3969 0.3992 0.9390 0.3978 19 2 0.3087 -0.2000 0.5133 1.0000 0.5105 1.0000 ADH* 49 2 0.2897 0.0850 0.4307 0.6160 0.8669 0.4287 19 2 0.2347 -0.1250 0.7404 1.0000 0.7416 1.0000 GPI-1* 49 2 0.0978 0.3766 0.1044 0.1015 0.9984 0.1016 19 1 0 GPI-2* 48 2 0.2211 0.0581 0.5443 0.5432 0.8642 0.5449 19 2 0.3087 0.4953 0.0796 0.0762 0.9976 0.0763 mIDHP-2* 49 2 0.2619 0.1442 0.2922 0.2936 0.9365 0.2929 19 2 0.2347 0.3333 0.2618 0.2587 0.9887 0.2585 LDH-2* 49 2 0.0978 -0.0435 0.8994 1.0000 0.8982 1.0000 19 1 0 PGDH* 49 2 0.3158 0.0310 0.5692 1.0000 0.7611 0.5713 19 2 0.3087 -0.2000 0.5187 1.0000 0.5103 1.0000 SOD* 49 2 0.3518 -0.0447 0.5504 1.0000 0.5588 0.7601 19 2 0.3983 0.2117 0.3537 0.5498 0.9362 0.3492
Only eight out of 24 examined allozyme loci were polymorphic in Felchowsee and six in Do¨llnsee. Test probabilities (P) are given for the inbreeding coefficient FIS, for the exact probability test of Hardy–Weinberg proportions (HW), and for two variants of the score test assuming respectively heterozygote excess (HE) or heterozygote deficiency (HD) as the alternative hypothesis to panmixia. Probability values lower than 5% are in bold Locus symbols are italicized for allozyme loci and include an asterisk to distinguish them from abbreviations of the enzymes they code (see Shaklee et al. 1990) 123 295 72 296 123
Table 3 Linkage disequilibria in Do¨llnsee (above the diagonal) and Felchowsee (below the diagonal) expressed as average correlation coefficients between alleles (Rij) at each pair of loci
Marker Actin RPS7 MTT1 MTT2 MTT5 MTT6 MTT8 MTT9 sAAT* ADH* GPI-1* GPI-2* mIDHP-2* LDH-2* PGDH* SOD*
Actin – 0.0286 0.1922 0.1669 0.2772 0.3233 0.3178 0.1845 0.1480 0.3064 – 0.0639 0.4006 – 0.0617 0.4041 RPS7 0.0857 – 0.3006 0.5243 0.2820 0.3031 0.1839 0.2956 0.4931 0.3804 – 0.4711 0.0159 – 0.1057 0.2885 MTT1 0.2040 0.1240 – 0.2091 0.1614 0.2093 0.1466 0.2045 0.3242 0.2660 – 0.1900 0.2066 – 0.2714 0.2460 MTT2 0.0863 0.1308 0.1871 – 0.1410 0.4322**/** 0.0898 0.1551 0.3636 0.3514 – 0.2634 0.0754 – 0.3636 0.1674 MTT5 0.1260 0.2043 0.0927 0.1602 – 0.1732 0.2999 0.2889*/NS 0.1944 0.2250 – 0.1368 0.1617 – 0.1997 0.2304 MTT6 0.1319 0.2000 0.1452NS/* 0.3166***/*** 0.1187 – 0.1041 0.2699 0.2556 0.1894 – 0.4008*/NS 0.2053 – 0.1707 0.1783 MTT8 0.2775*/NS 0.2216NS/** 0.1703 0.0552 0.1376 0.1456 – 0.1984 0.1175 0.2196 – 0.2027 0.1574 – 0.2513 0.2589 MTT9 0.1663 0.1108 0.1139 0.1204 0.1256 0.1020 0.1070 – 0.2033 0.2796 – 0.2158 0.2781 – 0.1675 0.1638 sAAT* 0.0266 0.0194 0.1176 0.2083 0.0546 0.1422 0.1917 0.1027 – 0.0413 – 0.1002 0.1773 – 0.1005 0.2235 ADH* 0.0087 0.1460 0.1321 0.1358 0.1756 0.0670 0.1179 0.1354 0.0391 – – 0.3491 0.3035 – 0.2203 0.4407 GPI-1* 0.0162 0.1177 0.1336 0.0400 0.0528 0.0747 0.0988 0.1255 0.0026 0.1305 – – – – – – GPI-2* – – 0.1189 0.1377 0.1650 0.0931 0.0925 0.1318 0.0489 0.1790 0.1512 – 0.0241 – 0.0728NS/* 0.2073 mIDHP-2* 0.0314 0.1416 0.1350 0.1403 0.1111 0.1189 0.0482 0.1280 0.0052 0.0141 0.0496 0.1017 – – 0.0333 0.0552 LDH-2* 0.1619 0.2501 0.1828 0.2622 0.0587 0.1419 0.1188 0.0999 0.0031 0.0911 0.0965 0.1608 0.1865 – – – PGDH* 0.0149 0.1447 0.1835 0.1323 0.1610 0.0672 0.1196 0.1427 0.0100 0.1058 0.1076 0.1183 0.0555 0.1293 – 0.0536 NS/* SOD* 0.2381 0.1039 0.1137 0.0438 0.2070 0.0944 0.0115 0.1036 0.0411 0.0414 0.0754 0.1158 0.2187 0.0294 0.1627 – 20:289–300 (2010) Fisheries Biol Fish Rev
Superscript asterisks denote significance with the results obtained with the permutation method (Garnier-Ge´re´ and Dillmann 1992) separated by a slash mark (/) from the results obtained with the Markov chain method (Raymond and Rousset 1995) where at least one method gave a significant result (in bold). The values for the linkage disequilibrium measures between GPI-2* and the two intron loci are missing due to missing data * P \ 0.05; ** P \ 0.01; *** P \ 0.001; NS, non-significant 73 Rev Fish Biol Fisheries (2010) 20:289–300 297
Table 4 Allelic associations between alleles at the microsat- significance of linkage disequilibria (permutations vs. ellite loci MTT2 and MTT6 expressed as correlation coeffi- Markov chain Monte Carlo approximation). Kohl- cients (Rij) mann et al. (2009) explained the heterozygote defi- Alleles Felchowsee Do¨llnsee ciency found in Felchowsee at the microsatellite locus MTT8 by the presence of a ‘null’ allele not amplified Rij PRij P with the current primers, resulting in a biased estimate 236-160 0.6672 0.0001 0.7379 0.0017 of population genotype frequencies at this locus. 236-164 – – 0.2161 0.3592 Of all pairwise comparisons, only the microsatel- 236-168 – – 0.1483 0.5293 lite loci MTT2 and MTT6 were in significant linkage 236-170 -0.1424 0.3188 -0.4323 0.0667 disequilibrium in both lakes and this pattern was not 236-172 -0.4675 0.0011 -0.5994 0.0110 dependent on the method. Because no other pair of 236-174 -0.1123 0.4319 -0.2965 0.2084 loci showed consistent disequilibria, it seems most 236-176 -0.0707 0.6208 – – reasonable to attribute the observed association 240-160 -0.6672 0.0001 -0.7379 0.0017 between MTT2 and MTT6 to strong physical linkage 240-164 ––-0.2161 0.3592 of these loci (Page and Holmes 1998). The relative 240-168 – – -0.1483 0.5293 location of the markers in the tench genome is, 240-170 0.1424 0.3188 0.4323 0.0667 however, currently unknown and this hypothesis 240-172 0.4675 0.0011 0.5994 0.0110 needs further testing. Furthermore, the comparison 240-174 0.1123 0.4319 0.2965 0.2084 with purebred Eastern populations suggest positive 240-176 0.0707 0.6208 – – association of alleles at these loci within phylogroups. Although the tench phylogroups formed a broad Significant probability values (at the 0.05 level) are in bold and alleles present in the three presumably pure Eastern contact zone during their postglacial dispersions, they populations (Bada, Chin and Turk) are in italics have remained effectively allopatric outside the contact zone. This is especially evident in the Eastern phylogroup that shows no signs of introgression with single population at equilibrium (Hardy–Weinberg genes from the Western phylogroup throughout its and linkage). The NewHybrids analysis (Anderson broad distribution between the Danube River in the and Thompson 2002) did not detect any individual west to Lake Baikal in the east (Lajbner et al. that could be classified as either purebred Western or unpublished). This is remarkable given that the purebred Eastern or any of the early-generation present study demonstrated that the phylogroups are hybrids, and it assigned all individuals from both not reproductively isolated and their gene pools have lakes as advanced backcrosses to the Western phylo- effectively merged in mixed populations. Further- group. This suggests that the data does not fit well the more, it is reasonable to expect that similar patterns NewHybrids model assuming two hybridizing popu- to that observed today were created by dispersion lations, which is consistent with the result of the from the refugia also following earlier glacial max- Structure analysis. ima because the mtDNA divergence between the The conformity of genotype frequencies to Hardy– phylogroups covers multiple glacial-interglacial Weinberg proportions could not be rejected for the cycles (Hewitt 2004). What could have caused the majority of loci by any of the methods. Although the refugial populations to retain their genetic integrity in samples from both lakes showed significant disequi- face of recurrent contacts and interbreeding? The libria at some loci, the patterns were not concordant: answer may be found in the dynamics of species the loci that showed deviations from the Hardy– response to changing climate. If, as appears to be the Weinberg or linkage equilibrium in Felchowsee were case, most species responded to glacier advances by not the same as the loci that showed a significant extinction of populations in northerly areas with only disequilibrium in Do¨llnsee. Furthermore, whether a populations in the vicinity or refugia surviving locus showed a significant deviation was dependent on (Hewitt 2004), the admixed populations outside the the statistics used to quantify the conformity of the refugia would have been extirpated at the onset of samples to the Hardy–Weinberg proportions (FIS vs. each glaciation, protecting the genetic purity of exact test) or on the method used to estimate the refugia (Hofreiter et al. 2004). 123
74 298 Rev Fish Biol Fisheries (2010) 20:289–300
The tench phylogroups can be considered separate Anderson EC, Thompson EA (2002) A model-based method species according to the phylogenetic species concept for identifying species hybrids using multilocus genetic data. Genetics 160:1217–1299 (Mishler and Theriot 2000; Wheeler and Platnick Avise JC, Walker D, Johns GC (1998) Speciation durations and 2000). Some genetic disequilibria were detected in Pleistocene effects on vertebrate phylogeography. Proc R natural hybrid populations but the pattern is not Soc Lond B 265:1707–1712 consistent between populations and across methods Balloux F, Lugon-Moulin N (2002) The estimation of popu- lation differentiation with microsatellite markers. Mol as would be expected in case of a strong reproductive Ecol 11:155–165 barrier. Thus, the present data suggest that the tench Ba˘na˘rescu PM (1991) Zoogeography of fresh waters, 2: dis- can be considered a single species under the biolog- tribution and dispersal of fresh water animals in North ical species concept (Mayr 1942, 1963). America and Eurasia. AULA-Verlag, Wiesbaden Barton NH, Gale KS (1993) Genetic analysis of hybrid zones. The fact that tench phylogroups can interbreed but In: Harrison RG (ed) Hybrid zones and the evolutionary remained distinct in the refugia has important process. Oxford University Press, Oxford, pp 13–45 practical implications. For example, populations in Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (2004) the vicinity of the refugia may show physiological Genetix 4.05, Logiciel sous Windows pour la Ge´ne´tique des Populations. Laboratoire Genome, Populations, adaptations to different selective environments that Interactions, CNRS UMR. 5171. Universite´ de Montpel- could be lost if these populations were extirpated lier II, Montpellier (e.g. by anthropogenic habitat change) or admixed by Bernatchez L, Wilson CC (1998) Comparative phylogeography stocking with individuals of the opposite phylogroup of nearctic and palearctic freshwater fishes. Mol Ecol 7:431–452 or the mixed ancestry (Allendorf et al. 2001). On the Black WC IV, Krafsur ES (1985) A FORTRAN program for other hand, since the two phylogroups readily form the calculation and analysis of two-locus linkage dis- mixed populations without detectable negative fitness equilibrium coefficients. Theor Appl Genet 70:491–496 consequences and tench are widely used for aqua- Boecklen WJ, Howard DJ (1997) Genetic analysis of hybrid zones: numbers of markers and power of resolution. culture, controlled genetic experiments can be envis- Ecology 78:2611–2616 aged to identify the genes underlying important Buerkle CA, Lexer C (2008) Admixture as the basis for genetic physiological or structural phenotypes (Nikinmaa mapping. Trends Ecol Evol 23:686–694 and Waser 2007). Furthermore, many tench popula- Caputi L, Andreakis N, Mastrototaro F, Cirino P, Vassillo M, Sordino P (2007) Cryptic speciation in a model inverte- tions in Europe are admixed, which offers a unique brate chordate. Proc Natl Acad Sci USA 104:9364–9369 opportunity to identify the genetic basis of pheno- Carstens BC, Knowles LL (2007) Shifting distributions and typic traits by the admixture mapping approach speciation: species divergence during rapid climate (Buerkle and Lexer 2008). Tench phylogroups, change. Mol Ecol 16:619–627 Chow S, Hazama K (1998) Universal primer for S7 ribosomal therefore, represent unique genetic resources and a protein gene intron in fish. Mol Ecol 7:1255–1256 valuable new model for applied genetic research. Clayton JW, Tretiak DN (1972) Amine-citrate buffers for pH control in starch gel electrophoresis. J Fish Res Board Can Acknowledgments The authors thank Petra Kersten for 29:1169–1172 laboratory assistance and Silvia Markova´ and Petr Ra´b for Cockerham CC, Weir BS (1977) Digenic descent measures for advice. The work was supported by the Ministry of Education, finite populations. Genet Res 30:121–147 Youth and Sports of the Czech Republic (LC06073, Dallas JF, Dod B, Boursot P, Prager EM, Bonhomme F (1995) MSM6007665809), and by the Academy of Sciences of the Population subdivision and gene flow in Danish house Czech Republic (IRP IAPG AV0Z50450515, IGA UZFG/05/ mice. Mol Ecol 4:311–320 22 and IGA UZFG/08/13). Durand JD, Persat H, Bouvet Y (1999) Phylogeography and postglacial dispersion of the chub (Leuciscus cephalus)in Europe. Mol Ecol 8:989–997 Ehlers J, Eissmann L, Lippstreu L, Stephan H-J, Wansa S (2004) Pleistocene glaciations of Northern Germany. In: References Ehlers J, Gibbard PL (eds) Quaternary glaciations—extent and chronology. Elsevier B.V., Amsterdam, pp 135–146 Aebersold PB, Winans GA, Teel DJ, Millner GB, Utter FM Epifanio JM, Philipp DP (1997) Sources for misclassifying (1987) Manual for starch gel electrophoresis: A method genealogical origins in mixed hybrid populations. J Hered for the detection of genetic variation. NOAA Technical 88:62–65 Report NMFS 61. U.S. Department of Commerce Falush D, Stephens M, Pritchard JK (2003) Inference of pop- Allendorf FW, Leary RF, Spruell P, Wenburg JK (2001) The ulation structure using multilocus genotype data: linked problems with hybrids: setting conservation guidelines. loci and correlated allele frequencies. Genetics 164:1567– Trends Ecol Evol 16:613–622 1587 123
75 Rev Fish Biol Fisheries (2010) 20:289–300 299
Falush D, Stephens M, Pritchard JK (2007) Inference of pop- Mayr E (1942) Systematics and the origin of species. Harvard ulation structure using multilocus genotype data: domi- University Press, Cambridge nant markers and null alleles. Mol Ecol Notes 7:574–578 Mayr E (1963) Animal species and evolution. Harvard Uni- Garnier-Ge´re´ P, Dillmann C (1992) A computer program for versity Press, Cambridge testing pairwise linkage disequilibria in subdivided pop- McCune A, Lovejoy NR (1998) The relative rate of sympatric ulations. J Hered 83:239 and allopatric speciation in fishes. In: Howard DJ, Berl- Guo SW, Thompson EA (1992) Performing the exact test of ocher SH (eds) Endless forms: species and speciation. Hardy–Weinberg proportion for multiple alleles. Bio- Oxford University Press, Oxford, pp 172–185 metrics 48:361–372 Mishler BD, Theriot EC (2000) The phylogenetic species con- Haldane JBS (1954) An exact test for randomness of mating. J cept (sensu Mishler and Theriot): monophyly, apomorphy, Genet 52:631–635 and phylogenetic species concepts. In: Wheeler QD, Meier Hendry AP, Vamosi SM, Latham SJ, Heilbuth JC, Day T R (eds) Species concepts and phylogenetic theory. A (2000a) Questioning species realities. Conserv Genet debate. Columbia University Press, NY, pp 44–54 1:67–76 Muscheler R, Kromer B, Bjo¨rck S, Svensson A, Friedrich M, Hendry AP, Wenburg JK, Bentzen P, Volk EC, Quinn TP (2000b) Kaiser KF, Southon J (2008) Tree rings and ice cores Rapid evolution of reproductive isolation in the wild: evi- reveal 14C calibration uncertainties during the Younger dence from introduced salmon. Science 290:516–518 Dryas. Nat Geosci 1:263–267 Hewitt GM (2004) Genetic consequences of climatic changes Nagylaki T (1976) The evolution of one- and two-locus sys- in the Quaternary. Phil Trans R Soc Lon B 359:183–195 tems. Genetics 83:583–600 Hofreiter M, Serre D, Rohland N, Rabeder G, Nagel D, Conard Nagylaki T (1977) The evolution of one- and two-locus sys- N, Mu¨nzel S, Pa¨a¨bo S (2004) Lack of phylogeography in tems II. Genetics 85:347–354 European mammals before the last glaciation. Proc Natl Near TJ, Benard MF (2004) Rapid allopatric speciation in log- Acad Sci USA 101:12963–12968 perch darters (Percidae: Percina). Evolution 58:2798–2808 Jahns S (2000) Late-glacial and Holocene woodland dynamics Nei M (1987) Molecular evolutionary genetics. Columbia and land-use history of the Lower Oder valley, north- University Press, New York eastern Germany, based on two, AMS 14C dated, pollen Nesbø CL, Fossheim T, Vøllestad LA, Jakobsen KS (1999) profiles. Veg Hist Archaeobot 9:111–123 Genetic divergence and phylogeographic relationship Knowles LL (2001) Did the Pleistocene glaciations promote among European perch (Perca fluviatilis) populations divergence? Tests of explicit refugial models in montane reflect glacial refugia and postglacial colonisation. Mol grasshoppers. Mol Ecol 10:691–701 Ecol 8:1387–1404 Kohlmann K, Kersten P (1998) Enzyme variability in a wild Nikinmaa M, Waser W (2007) Molecular and cellular studies population of tench (Tinca tinca). Pol Arch Hydrobiol in evolutionary physiology of natural vertebrate popula- 45:303–310 tions: influences of individual variation and genetic Kohlmann K, Kersten P (2006) Microsatellite loci in tench: components on sampling and measurements. J Exp Biol isolation and variability in a test population. Aquac Int 210:1847–1857 14:3–7 Page RD, Holmes EC (1998) Molecular evolution: a phylo- Kohlmann K, Kersten P, Flajsˇhans M (2007) Comparison of genetic approach. Blackwell, Oxford microsatellite variability in wild and cultured tench (Tinca Pritchard JK, Stephens M, Donnelly P (2000) Inference of tinca). Aquaculture 272S1:S147–S151 population structure using multilocus genotype data. Kohlmann K, Kersten P, Panicz P, Memis¸D, Flajsˇhans M (2009) Genetics 155:945–959 Genetic variability and differentiation of wild and cultured Raymond M, Rousset F (1995) An exact test for population tench populations inferred from microsatellite loci. Rev differentiation. Evolution 49:1283–1286 Fish Biol Fisher. doi:10.1007/s11160-009-9138-x Ridgway GJ, Sherburne SW, Lewis RD (1970) Polymorphism Kotlı´k P, Berrebi P (2001) Phylogeography of the barbel in the esterases of Atlantic herring. Trans Am Fish Soc (Barbus barbus) assessed by mitochondrial DNA varia- 99:147–151 tion. Mol Ecol 10:2177–2185 Rieseberg LH, Linder RC (1999) Hybrid classification: insights Kotlı´k P, Bogutskaya NG, Ekmekc¸i FG (2004) Circum Black from genetic map-based studies of experimental hybrids. Sea phylogeography of Barbus freshwater fishes: diver- Ecology 80:361–370 gence in the Pontic glacial refugium. Mol Ecol 13:87–95 Rousset F (2008) Genepop’007: a complete re-implementation Lajbner Z, Linhart O, Kotlik P (2007) Molecular phylogeog- of the genepop software for Windows and Linux. Mol raphy of the tench Tinca tinca (Linnaeus, 1758). In: Buj I, Ecol Res 8:103–106 Zanella L, Mrakovcic M (eds) The 12th European con- Rousset F, Raymond M (1995) Testing heterozygote excess gress of ichthyology, book of abstracts, Cavtat, 2007, p 35 and deficiency. Genetics 140:1413–1419 Lajbner Z, Sˇlechtova´ V, Sˇlechta V, Sˇva´tora M, Berrebi P, Shaklee JB, Allendorf FW, Morizot DC, Whitt GS (1990) Gene Kotlı´k P (2009) Rare and asymmetrical hybridization of nomenclature for the protein-coding loci in fish. Trans Am the endemic Barbus carpathicus with its widespread Fish Soc 119:2–15 congener B. barbus. J Fish Biol 74:418–436 Shaw CR, Prasad R (1970) Starch gel electrophoresis of enzymes– Machordom A, Doadrio I (2001) Evidence of a cenozoic Betic- a compilation of recipes. Biochem Genet 4:297–320 Kabilian connection based on freshwater fish phylogeog- Sˇlechtova´ V, Sˇlechta V, Valenta M (1995) Genetic protein raphy (Luciobarbus, Cyprinidae). Mol Phylogenet Evol variability in tench (Tinca tinca L.) stocks in Czech 18:252–263 republic. Pol Arch Hydrobiol 42:133–140 123
76 300 Rev Fish Biol Fisheries (2010) 20:289–300
Sta¨dler T, Arunyawat U, Stephan W (2008) Population dates and molecular rates: rapid divergence of rivers and genetics of speciation in two closely related wild tomatoes their biotas. Syst Biol 56:271–282 (Solanum section Lycopersicon). Genetics 178:339–350 Weir BS (1979) Inferences about linkage disequilibrium. Templeton AR (2006) Population genetics and microevolu- Biometrics 35:235–254 tionary theory. Wiley, Hoboken Weir BS (1996) Genetic data analysis II. Sinauer, Sunderland Touriya A, Rami M, Cattaneo-Berrebi G, Ibanez C, Augros S, Weir BS, Cockerham CC (1984) Estimating F-statistics for the Boissin E, Dakkak A, Berrebi P (2003) Primers for EPIC analysis of population structure. Evolution 38:1358–1370 amplification of intron sequences for fish and other ver- Wheeler QD, Platnick NI (2000) The phylogenetic species tebrate population genetic studies. BioTechniques 35: concept (sensu Wheeler and Platnick). In: Wheeler QD, 676–678, 680, 682 Meier R (eds) Species concepts and phylogenetic theory. Vuorinen J (1984) Electrophoretic expression of genetic vari- A debate. Columbia University Press, NY, pp 55–69 ation and duplicate gene activity in vandace, Coregonus Zaykin D, Zhivotovsky LA, Weir BS (1995) Exact test for albula (Salmonidae). Hereditas 101:85–96 association between alleles at arbitrary number of loci. Waters JM, Rowe DL, Apte S, King TM, Wallis GP, Anderson Genetica 96:169–178 L, Norris RJ, Craw D, Burridge CP (2007) Geological
123
77 3. Shrnutí výsledků a jejich význam
Prostorová genetická analýza variability sekvencí čtyř nezávislých genů odhalila dvě hlavní skupiny populací lína obecného. Každá z nich je jen málo geograficky strukturovaná, ale vzájemně se významně liší (Lajbner a kol. v tisku). Lokalizovala rovněž hlavní geografické bariéry v toku genů (shodující se ve více genech), které jsou způsobeny pouze částečně se překrývajícím rozšířením dvou relativně vzdálených evolučních linií-Západní a Východní. Tyto linie mají pravděpodobně původ v odlišných glaciálních refugiích, ze kterých kolonizovaly své současné areály. Geny obou evolučních linií jsou přítomny v evropských kulturních liniích. Východní evoluční linie se navíc vyskytuje ve volných vodách západní Evropy, kde v některých oblastech dokonce početně převládá nad Západní linií. Toto je s největší pravděpodobností důsledek migrace zprostředkované lidmi. Ryby, lína nevyjímaje, jsou často vysazovány daleko od místa jejich původu, nehledě na genetickou podobnost a lokální adaptace. Nezřídka dokonce dochází k zarybňování volných vod populacemi z chovů, což vede k jejich křížení s původními populacemi a genové introgresi. Díky rozsáhlému vyšetření světové populace línů se mi podařilo navrhnout restrikční enzymy, které specificky štěpí tři diagnostické geny (1 mitochondriální a 2 jaderné), a již podle elektroforetického vzoru tak lze snadno a rychle zjistit, k jaké patří evoluční linii (Lajbner a Kotlík 2010). Tato metoda umožní jak vědeckým pracovníkům tak i rybářským praktikům rychle identifikovat geneticky odlišné populace lína a bude užitečná také pro monitoring lidmi zprostředkovaného šíření evolučních linií v divokých populacích, pro genetickou charakterizaci kulturních linií a pro křížící experimenty. Populačně genetická analýza intronů jaderných genů, mikrosatelitů, alozymů a mitochondriální DNA v populacích dvou postglaciálních jezer v zóně kontaktu mezi Západní a Východní linií v Německu sice ukázala jednotlivé, statisticky významné vazebné nerovnováhy, ty však byly omezeny na jednotlivé lokusy, v naprosté většině nebyly shodné pro obě jezera a lišily se také v závislosti na použité statistické metodě (Lajbner a kol. 2010). Test byl založen na předpokladu, že v případě existence silných reprodukčních bariér budou v hybridní populaci mezi alelami a genotypy pozorovatelné nenáhodné vztahy odrážející jejich fylogenetický původ a to i navzdory možnosti křížení v zóně kontaktu. Mé výsledky naopak ukazují, že evoluční linie lína nejsou efektivně reprodukčně izolované a nepředstavují tak samostatné biologické druhy. Odlišení efektu přirozených historických procesů od výsledků sekundárního šíření představuje pro studium historické biogeografie trvalou výzvu, což platí dvojnásob v případě hospodářsky významných druhů záměrně rozšiřovaných člověkem. Moje práce ukazuje, že u takových druhů může být užitečné na antropogenní migraci pohlížet jako na proces komplementární k přirozené
78 fylogeografické strukturaci, spíše než oba jevy považovat za vzájemně se vylučující příčiny současné genetické a prostorové populační struktury. Z mých výsledků je zřejmé, že přirozené historické procesy hrají důležitou roli v genetické strukturaci současných populací lína a jejich stopy jsou stále zjistitelné na různých genech (Lajbner a kol. v tisku). Oproti tomu jsem ukázal, že člověkem zprostředkované migrace významně ovlivnily nedávnou evoluční historii lína, přičemž směsné genetické složení kulturních linií má pravděpodobně podíl na zvýšené introgresi mezi geneticky odlišnými populacemi (Lajbner a kol. v tisku). Výsledky této studie by se mohly uplatnit při modelování šíření druhu, přispět ke zpřesnění odhadu adaptability konkrétních populací a ke zvýšení efektivity konzervačních strategií budoucnosti (Scoble a Lowe 2010). Přetrvávajícím stereotypem v obhospodařování sladkých volných vod je jejich zarybňování nepůvodními druhy ryb, rybami z umělého výtěru, kdy není brán ohled na geografický původ rodičů, či přímo rybami z akvakultury. Pokud budou stávající praktiky obhospodařování pokračovat, považuji za pravděpodobné, že člověkem zprostředkovaná migrace smaže přirozený fylogeografický vzor v podstatné části línem obývaného areálu. Také je možné, že hybridizace (např. zvýšením adaptivní variability) zesílí invazní potenciál smíšených populací mimo přirozený areál (viz. Lucek a kol. 2010). Je také pravděpodobné, že populace v blízkosti refugiálních oblastí mohou disponovat fyziologickými adaptacemi na odlišná životní prostředí, které by však mohly být ztraceny pokud by tyto populace vyhynuly například v důsledku destrukce habitatu, nebo pokud by byly kontaminované jedinci z opačné evoluční linie nebo smíšeného původu (např. Allendorf a kol. 2001). Tyto vlivy tak mohou postupně redukovat evoluční potenciál divokých populací a snižovat jejich šance na přežití tváří v tvář globálním antropogenním změnám životního prostředí (Stockwell a kol. 2003; Frankham 2005). Jelikož se však obě evoluční linie kříží (Lajbner a kol. 2010), kontrolované genetické experimenty by mohly pomoci identifikovat klíčové geny zodpovědné za důležité fyziologické či strukturní fenotypy (např. Nikinmaa a Waser 2007). Mnoho populací lína ve volných vodách je smíšených, což spolu s možností identifikovat specifické markery (Lajbner a Kotlík 2010) nabízí unikátní příležitost identifikovat genetickou podstatu fenotypových znaků s využitím koncepce příměsového mapování (Buerkle a Lexer 2008). Evoluční linie lína, které jsem objevil, tedy představují unikátní genetické zdroje a cenný nový model pro aplikovaný genetický výzkum s možností uplatnění výsledků v praxi. Rychlost růstu, konverze krmiva a další geneticky podmíněné vlastnosti ryb úzce souvisí s rentabilitou chovu, přičemž identifikace geneticky odlišných evolučních linií umožní informované a cílené šlechtitelské zásahy.
79 3.1 Seznam použité literatury:
Allendorf FW, Leary RF, Spruell P, Wenburg JK (2001) The problems with hybrids: setting conservation guidelines. Trends in Ecology and Evolution 16:613-622. Buerkle CA, Lexer C (2008) Admixture as the basis for genetic mapping. Trends in Ecology and Evolution 23:686-694. Frankham R (2005) Stress and adaptation in conservation genetics. Journal of Evolutionary Biology 18:750-755. Lajbner Z, Kohlmann K, Linhart O, Kotlík P (2010) Lack of reproductive isolation between the Western and Eastern phylogroups of the tench. Reviews in Fish Biology and Fisheries 20: 289-300. Lajbner Z, Kotlík P (Early View; published online 20 SEP 2010) PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca. Molecular Ecology Resources. (doi: 10.1111/j.1755-0998.2010.02914.x) Lajbner Z, Linhart O, Kotlík P (v tisku) Human-aided dispersal has altered but not erased the phylogeography of the tench. Evolutionary Applications. (doi:10.1111/j.1752-4571.2010.00174.x) Lucek K, Roy D, Bezault E, Sivasundar A, Seehausen O (2010) Hybridization between distant lineages increases adaptive variation during a biological invasion: stickleback in Switzerland. Molecular Ecology 19:3995-4011. Nikinmaa M, Waser W (2007) Molecular and cellular studies in evolutionary physiology of natural vertebrate populations: influences of individual variation and genetic components on sampling and measurements. Journal of Experimental Biology 210:1847-1857. Scoble J, Lowe AJ (2010) A case for incorporating phylogeography and landscape genetics into species distribution modelling approaches to improve climate adaptation and conservation planning. Diversity and Distributions 16:343-353. Stockwell, C. A. , A. P. Hendry, and M. T. Kinnison. 2003. Contemporary evolution meets conservation biology. Trends in Ecology & Evolution 18:94-101. Waters JM, Rowe DL, Apte S, King TM, Wallis GP, Anderson L, Norris RJ, Craw D, Burridge ChP (2007) Geological Dates and Molecular Rates: Rapid Divergence of Rivers and Their Biotas. Systematic Biology 56:271-282.
80