Functional Analysis of the Promoters of the Human Red and Green Visual Pigment Genes

Salam A. Shaaban and Samir S. Deeb

PURPOSE. TO delineate czs-acting DNA elements involved in the expression of the human red and green visual pigment genes and to correlate these with transcription factor binding sites. METHODS. Assays of promoter activity were accomplished by transient transfection into WERI cells. Nested deletion and block mutagenesis were undertaken to delineate critical elements. Transcrip- tion factor binding sites were determined by DNase I footprinting and electrophoretic mobility shift (EMSA) analyses. RESULTS. The human retinoblastoma cell line WERI, but not Y-79, was found to express the red and green pigment genes. Transfection assays in WERI cells revealed that the proximal region of the red pigment gene promoter had positive (-130 to -113and -96 to -23) and negative (-190 to -130 and —113 to —96) regulatory elements. The green pigment gene promoter was found to be 2 to 4 times more active than was that of the red pigment. This difference in activity was attributable mainly to a T to C substitution at position —3. DNase I protection and EMSA studies demonstrated the binding of several ubiquitous and WERI-enriched proteins to DNA sequences between — 130 and the TATA box. The locus control region (LCR) did not have any enhancer activity in transient transfection. CONCLUSIONS. The WERI cell line is a good model system for the analysis of gene expression of the human cone visual pigment genes. The expression of these genes in a cell-specific fashion seems to be controlled mainly by positive-acting elements in the region between —130 and the TATA box. The higher activity of the green pigment gene promoter could have evolved to compensate for its longer distance from the activating LCR than that of the red pigment gene promoter (approximately 34 versus 3.5 kb). Although the LCR does not enhance transcription in transient transfection, it binds factors that also recognize the proximal promoter region. These interactions may be important for the establishment of a transcriptionally active domain in a chromatin context. (Invest Ophthalmol Vis Sci. 1998;39:885-896)

richromatic color vision in humans is mediated by three pigment gene, was shown to be essential for the expression of types of retinal cone photoreceptors. These photore- the red and green pigment genes, which led Wang et al.8 to Tceptors contain photopigments that are maximally sen- propose that the region acts as a locus control region (LCR) in sitive to lights in the blue, green, and red regions of the a manner analogous to the locus control region of the /3-globin spectrum.1 The red and green photopigments are encoded by locus. This region shows homology to the corresponding re- homologous X-chromosome-linked genes arranged in a head- gion in the mouse and bovine middle-wave cone pigments, to-tail array2'3 composed of a 5' red pigment gene followed by with a completely conserved core of 37 bases.8 The require- one or more green pigment genes. Sequence comparison indi- ment for a shared LCR would thus ensure the expression of cates that they arose by a gene duplication event in the primate either the red or the green pigment gene in the X-chromosome lineage approximately 40 million years ago.4'5 In contrast, the array in a single photoreceptor cell, probably by stable direct divergence between the red and green photopigments and the coupling to the promoter.9 blue cone photopigment or rhodopsin, however, predates ver- The exclusive expression of the different photopigment tebrate evolution.6'7 The red and green duplication event in- proteins in different cells is a prerequisite for color discrimi- volved the structural gene and the proximal promoter region nation. This exclusive expression seems to be mediated at the (to position —195 upstream of the transcription initiation site). transcription level through a combinatorial action of transcrip- A region of a few hundred bases, centered approximately 35 tional activators and repressors. Because the photopigment kb upstream of the transcription initiation site of the red proteins are markers for their respective cell types, transcription factors involved in their regulation are expected to have fundamental roles in cell-type specification in the retina during embryonic development. Only a few such transcription factors From the Departments of Medicine and Genetics, University of Washington, Seattle. have been discovered and analyzed in mammalian retinal de- Supported by National Institutes of Health grant EY08395 (SSD). velopment. In most of these cases, the transcription factors Submitted for publication June 2, 1997; revised November 13, were identified by biochemical means (DNase I footprinting 1997 and January 14, 1998; accepted February 15, 1998. and electrophoretic mobility shift assays). The photoreceptor Proprietary interest category: N. Reprint requests: Samir S. Deeb, Box 357360, Department of cell element 1 (PCE 1, also referred to as RET-1), which has the Genetics, University of Washington, Seattle, WA 98195. consensus seqvience CAATTAA/G, thus was identified in the

Downloaded from iovs.arvojournals.org on 09/26/2021 886 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

promoters of rhodopsin and arrestin and was shown by south- pared using anion exchange columns from Qiagen (Chatsworth, western blot analysis to bind a protein of an apparent molec- CA). ular mass of 40 kDa.10" A putative binding site for basic helix-loop-helix transcription factor Mash-1 was described in DNA Constructs the rhodopsin promoter.12 The rhodopsin enhancer has a site For many of the deletion constructs, promoter fragments were that resembles the recognition sequence of the Drosophila amplified by polymerase chain reaction (PCR), then were melanogaster transcription factor Glass.13 The neural retina cloned into the Sma\ site of the luciferase reporter plasmid leucine zipper transcription factor NRL was implicated as a PXP122, and were sequenced. All promoter fragments ex- positive regulator of rhodopsin gene expression and was tended to base +41 at the 3' end. Block mutagenesis was done shown to bind to a sequence within the proximal promot- on the —96 to +41 promoter fragment inserted in PUC11823 er.14"17 using the Kunkel method.24 For mutants Ml, M2, M4, and M5, Nothing is known presently about the mechanisms of six bases (underlined in Fig. 2) were changed to a BgUl restric- commitment of retinal progenitor cells to the rod or cone tion site (AGATCT). For mutants M3 and M6 to M9, six bases photoreceptor pathway or about that of cones to the blue were changed to an Xbal site (TCTAGA). Deletion constructs versus red and green pathway. The red and green cones are —71, —6l, —42, and —23 were generated by deletion of a thought to be identical in all respects except for the cone BgHl-BgUl fragment in mutants Ml, M2, M4, and M5 (one BgH\ photopigment that they contain. Identifying the cis-acting DNA site is in the multiple cloning site of PXP1, and the other was elements and the corresponding transcription factors that bind introduced by mutagenesis). to them in the promoters of the red and green pigment genes would provide an understanding of the mechanism of expres- DNase I Protection sion of these genes. Toward that end, we chose to analyze the promoters of The promoter region from —130 to +41 was used for a DNase the red and green visual pigment genes by transfection analysis I protection assay. Approximately 50,000 to 100,000 cpm of in a cell line that expresses both genes. It has been reported the labeled fragment were incubated in a 10-/xl volume with 20 that some primary retinoblastoma cell lines express the visual jag nuclear protein extract in a IX binding buffer (20 mM pigment genes,18 and that the retinoblastoma cell line WERI HEPES buffer, pH 7.9, 3 mM dithiothreitol, and 0.025% NP-40) expressed the cone transducin a-subunit gene, GNAT2.19-20 In for 30 minutes at room temperature. The salt concentration this study, we showed that the retinoblastoma cell line WERI was adjusted to 100 mM NaCl. DNase I in a 20-/xl volume that also expressed the red and green visual pigment genes. Trans- also contained MgCl2 and CaCl2 at concentrations of 2.5 and fection studies in this cell line enabled us to define czs-acting 0.5 mM, respectively, and a IX was binding buffer then were elements within the proximal promoter region of the red and added and incubation continued for 1 minute. Afterward, a green pigment genes critical for transcriptional activity. We 30-jal stop solution (2% sodium dodecyl sulfate, 25 niM EDTA, also demonstrated, by DNase I protection and gel-shift analysis, 50 mM Tris-HCl [pH 7.5], 0.1 mg/ml sheared salmon sperm the binding of nuclear proteins specific to extracts from WERI DNA, and 0.5 mg/ml proteinase K) was used to quench the cells to some of these elements. reaction. Digestion with proteinase K occurred for 30 minutes at 55°C. The DNA was precipitated by adding ammonium acetate to 2.5 M and 3 vol 100% ethanol and by spinning the tubes at room temperature for 30 minutes. DNA was dissolved MATERIALS AND METHODS in formamide and was run on a 8% denaturing polyacrylamide gel. Cells and Reagents The retinoblastoma cell lines Y-79 and WERI were purchased Electrophoretic Mobility Shift Analysis from the American Type Culture Collection (Rockville, MD) and Probes for electrophoretic mobility shift analysis were synthe- were propagated in RPMI1640 (BioWhittaker, Walkersville, MD) sized as complementary single-stranded oligonucleotides with medium and 15% fetal bovine serum (HyClone, Logan, UT) sup- CCGG 5' overhangs, were annealed, and then were labeled plemented with 2 mM glutamine. Transfection was performed with the Klenow fragment of Escherichia coli DNA polymerase using lipofectin (Life Technologies, Grand Island, NY) according and [a-32P]dCTP. Nuclear protein extracts from retinal tissue to the protocol recommended by the manufacturer for suspen- 25 6 were prepared according to the method of Dignam et al., and sion cells. Transfection of 2 to 3 X 10 cells in 0.8 ml OPTI-MEM those from culture cell lines were prepared according to the was accomplished with 4.5 /Ltg reporter plasmid and 0.5 /xg method of Lawrence et al.26 For gel-shift reactions, 5 jag nu- pCMV-LacF plasmid (a gift from Richard Palmiter at the University clear protein was mixed with approximately 50,000 cpm of of Washington, Seattle), which carried the j3-galactosidase re- probe iiialX binding buffer. The final salt concentration was porter under the control of the cytomegalovirus (CMV) promoter 100 mM in NaCl. The reactions were incubated at room tem- that had been preincubated with 5 ju,g lipofectin in 0.2 ml OPTI- perature for 30 minutes, and were loaded onto a 4% native MEM. After 24 hours at 37°C, 4 ml RPMI 1640 + 15% fetal bovine polyacrylamide gel (49:1, acrylamide:bis-acrylamide) and were serum were added, and the cells were incubated for an additional run at 4°C in Tris-glycine buffer (pH 8.5). The sequence of the 48 hours before harvesting. Luciferase activity assays were per- core 37-mer sequence of the LCR was as follows: formed with reagents purchased from Promega (Madison, WI). Assays for /3-galactosidase activity were done according to Fuku- 5' GACTTGATCTTCTGTTAGCCCTAATCATCAATTAGC 3' chi et al.21 Luciferase/j3-galactosidase values for the different con- staicts were compared to correct for variation in transfection The LCR-5' oligonucleotide includes the first 20 bases, and the efficiency. DNA used in the transfection experiments was pre- LCR-3' oligonucleotide includes the last 20 bases. The se-

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, May 1998, Vol. 39, No. 6 Analysis of Red and Green Pigment Gene Promoters 887

or retina) was reverse transcribed in a 20-/xl reaction with 200 U reverse transcriptase (BRL, Gaithersburg, MD) using poly-dT and a random hexamer as primers. For the PCR reaction shown in Figure 1A, 2 /u.1 reverse transcription (RT) reaction products from WERI or Y79 were used in a total volume of 20 /u.1. The following primers were used for amplification of a 225-bp DNA fragment containing exon 4 and 5 sequences of the visual pigment:

CB-3A (5' GTGTTCAGCGGCAGCTCGTAC 3')

and

CB-79RED (5' CCAGCAGACGCAGTACGCAAAGATC 3') Red Green A WERI Retina CB-79GREEN (5' CCAGCAGAAGCAGAATGCCAGGAC3) M 1 234 12345 For quantification of red pigment mRNA in WERI and human retinas, 1 jxl (undiluted and diluted 1:5, 1:10, 1:20, and 1:40) RT RNA was used as a template in a 20-ptl PCR reaction. An initial denaturation step of 2 minutes at 94°C was followed by 25 cycles of denaturation at 94°C for 15 seconds, annealing at 64°C for 30 seconds, and extension at 72°C for 15 seconds. These steps were followed by a final extension step of 4 minutes at 72°C.

RESULTS 100 bp B Expression of the Endogenous Red and Green Pigment Genes in the Retinoblastoma Cell Line FIGURE 1. (A) Detection of the red and green visual pigment gene mRNA in Y-79 and WERI cells. A 225-bp fragment encom- WERI passing parts of exons 4 and 5 of the red or green pigment RT-PCR was used to detect the mRNA encoding the red and mRNA was amplified after reverse transcription of total cellular green visual pigment genes in total cellular RNA from the RNA isolated from Y-79 and WERI cells. The faint bands that human retinoblastoma cell lines Y-79 and WERI. In the case of appear in the Y-79 lanes are nonspecific products. (B) Relative Y-79 cells, RNA was prepared from cells grown in suspension, levels of the red pigment mRNA in WERI cells and in human attached to polylysine-coated plates, or attached and treated retinas. Shown are the 225-bp fragments amplified using vari- with succinylated concanavalin A, a treatment that was re- ous dilutions of first-strand cDNA templates, which were pre- ported to increase the expression of interphotoreceptor bind- pared by reverse transcription using 1 /xg WERI or retinal RNA 28 as templates. Lane M included a 1-kb ladder molecular weight ing protein (a photoreceptor-specific gene) in Y-79 cells. marker; Lanes 1 to 4 for each of WERI cells and retinas Figure 1A shows clearly that although WERI cells grown as a represent polymerase chain reaction products obtained from suspension culture expressed red and green visual pigment undiluted, 1:5, 1:10, and 1:20 dilutions of cDNA templates, genes, Y-79 cells grown in three different conditions did not respectively. Lane 5 (retina) represents a 1:40 dilution of a show any detectable expression. In addition, it was reported cDNA template. Relative band intensities were determined by previously that WERI cells express the blue pigment gene.29 densitometry. The relative intensities of WERI-derived bands The relative steady state levels of the mRNA encoding the red were 203, 81, and 89 for dilutions of 1:5, 1:10, and 1:20, pigment in WERI and human retinas were estimated by semi- respectively. Band intensities of 226, 89, and 52 were obtained quantitative RT-PCR analysis (as described in Materials and for retinal sample of dilutions 1:10, l;20, and 1:40. The level of Methods). The results obtained for different amounts of total red pigment mRNA in the retina is, therefore, approximately twice that in WERI cells. RNA used as templates are shown in Figure IB. Densitometric analysis of the bands (see legend to Fig. IB) showed that the mRNA level in the whole retina is approximately twice that in quence of the human Ret I oligonucleotide is GGCCCCTCTTA- WERI cells. The WERI cell line is, therefore, appropriate for GAAGCCAATTAGGCCCT.27 studying the regulator)' sequences of the human cone visual pigment genes. Reverse Transcription-Polymerase Chain Reaction Total cellular RNA was prepared from cell lines and from Functional Analysis of Red and Green Visual human retinas. Retinal tissue was collected from male donor Pigment Gene Promoters eyes within 4 hours of death. The eye specimens were ob- The proximal promoters of the human red and green visual. tained through the Lions Eye Bank of the University of Wash- pigment genes are homologous in sequence up to 190 bases ington, Seattle. One microgram total cellular RNA (WERI, Y79, upstream of the transcription initiation start site (Fig. 2). The

Downloaded from iovs.arvojournals.org on 09/26/2021 888 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

-190 Human-R CCAG-CAAATCCCTCTGAGCCGCCCTTGCGGGCTCGCCTCAGGAGCAGGGGAGCA Human-G CC G A A Bovine '.'.'.'.-'.'.'.'.'.'.'.'.'.'.'.'.'.'.'.'. A. '.'.CC'.!:'.'.'.'.'.'. A. '.-'.'.'.'.'.'. '.QA'.CAG'. !C Mouse G. . . G GG. C AC .... GTG. ATTGGA- A. A. . T. . A. . TG -130 -113 -103 -96 -88 Human-R AGAGGT--GGGAGGAGGAGGTCTAAGTCCCAGGCCCAATTAAGAGATCAGGTAGT Human-G . .G. . .-- A.G.. Bovine CAGCACGG A A.G. . Mouse AG- . . . --A G.AT.A TG A.G. . -71 -42 Ml M2 " [-*- M3 M4 Human-R GTAGGGTTTGGGAGCT1 rTAAGGTGAA GCCCGGGCTGATCCCACAGGCCAG Human-G .A T....G. Bovine .A. . . .G . . . T TG . Mouse .A. .A.G, .TG. .TGA M5 M6 M7 M8 M9 Human-R VGCGCC 5ATGCGCCAGG[GGCCGGCTGCCGTCGGGGA( C Human-G ,C. .A Bovine .T..T...G...C.C. GCGA. T T...G.G.A..A Mouse .TC.T..A....CATA.GC.ATGTG.CAA.T.T.ACAGGT..C-A..G

Human-R AGGGCTTTCCATAGCCATG Human-G Bovine G. .G. Mouse .CA.T....T.C. FIGURE 2. Sequence of the proximal promoter region (—190 to +41) of the human red visual pigment gene aligned with those of the human green, bovine middle-wave, and mouse middle-wave cone visual pigment genes. The identity of the sequence of the human red pigment promoter is indicated by a dot. Deletion endpoints are indicated by arrows, and sequences chosen for block mutagenesis (M1-M9) are underlined. The PCE 1 element and the TATA box are in bold. +1 indicates the transcription start site.

sequence of the bovine middle-wave cone visual pigment gene activity of the —190 construct was arbitrarily set at 100%). promoter shows strong homology to the human sequence of Promoter activity increased twofold on deletion of 60 bases the same region, whereas the mouse middle-wave gene se- (from —190 to —130), but it then decreased on deletion to quence shows decreased homology beyond position —130 — 113. These results indicate the presence of a negative ele- (Fig. 2). The proximal promoter region has a canonical TATA ment between —190 and —130 and a positive one between box at -29 and a PCE 1 sequence (CAATTAAG) at -103 — 130 and —113- However, we have no evidence of a protein similar to those identified in the promoters of several photo- that binds the region between —190 and —130 and that can receptor-specific genes.10-'' 20 We used the Y-79 and WERI cell account for the apparent negative effect of this region. Further lines in transient transfection studies to assess the cell-specific deletion to —96 brought the activity up to a value similar to activity of the —190 to +41 proximal promoter region driving that of the —130 construct. It seems that the region between luciferase reporter gene expression. In WERI cells, this frag- — 113 and —96, which includes the putative PCE 1 element, ment had transcriptional activity that was 30- to 40-fold higher had an apparent repressive effect on the transcriptional activity than background values, whereas in Y-79 cells the expression of the promoter. The —71 and —61 deletion constructs had was marginally above background values (1.5- to 2-fold). A similar activities (50%- 60% of the —190 construct and approx- — 3.6-kb fragment containing the locus control region did not imately 25% of the —96 construct). The activity was reduced enhance promoter activity in either cell line. Other constructs by 50% with the deletion of an additional 19 bp to —42, which in which a 250-bp fragment containing the LCR, or the abso- indicated the presence of important positive elements in this lutely conserved 37-mer sequence of the LCR in single or short region. Surprisingly, the -23 deletion that removed the multiple copies, which were placed immediately upstream of TATA box completely was still as active as that of the —42 the —190 to +41 promoter fragment, did not have higher deletion. It seems likely, therefore, that the 65 bases between activities than the —190 construct in either cell line (data not — 23 and +41 can function as a promoter through a TATA- shown). This could indicate that the locus control region is independent mechanism. only functional in a chromatin context. A shorter promoter fragment (—96 to +41) that lacked the PCE 1 element was also Block Mutagenesis inactive in Y-79. The congruence between the results of the Fine-structure functional analysis of the proximal red pigment transfection analysis of promoter constructs and those of promoter was performed by block mutagenesis. Nine block mu- mRNA expression of the endogenous genes in WERI and Y-79 tations were introduced into the —96 construct at positions —77 cells is consistent with the cell-type-specific activity of the to -72 (Ml), -67 to -62 (M2), -56 to -51 (M3), -47 to -43 promoter. (M4), -29 to -24 (M5), -19 to -14 (M6), -10 to -5 (M7), +5 to +10 (M8), and +22 to +27 (M9) (Fig. 2). In Ml, M2, M4, and Deletion Analysis M5, the mutations introduced BgM sites (AGATCT); in M3 and M6 Figure 3 shows the activity in WERI cells of several nested to M9, Xbal sites (TCTAGA) were introduced. deletion derivatives of the promoter of the red pigment gene The activities of these block mutant promoters in WERI cells relative to that of the —190 fragment (the normalized luciferase revealed that mutations Ml to M5 and M9 all diminished the

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, May 1998, Vol. 39, No. 6 Analysis of Red and Green Pigment Gene Promoters 889

250 *** *• *

*** "S 150 < £ 100 T il * 50 • •* i II ****** i i i i II II o so

Promoter Length (bp) Promoter Construct FIGURE 3. The activities of 5' deletions of the proximal promoter region of the human red pigment gene. WERI cells were transfected with red pigment gene promoter constructs driving the expression of the luciferase reporter gene. The activities (expressed relative to that of the —190 construct) were corrected for transfection efficiency by dividing by the j3-galactosidase activity of a cotransfected pCMV-LacF plasmid. The values shown represent the average of four transfections. Error bars represent standard deviation. Asterisks above the bars denote the level of significance (JP value) for the difference between the activities of the various deletions and the —190 construct (*O.O25 < P < 0.05; ** 0.01 < P < 0.025; and *** P < 0.01). The luciferase activities ranged from approximately 5,000 to 40,000 lux. The background (promoterless) activity was approximately 500 light units, representing 3% to 5% of the —190 construct. For comparison, the activity of a Rous O < < H O •" O sarcoma virus promoter driving luciferase expression was approximately 1.8 X 106 lux. Promoter Construct B FIGURE 5. Comparison between activities of the red and green pigment gene promoters. (A) Activities of the —190 and —96 promoter strength considerably (>50% reduction), the latter hav- constructs of the red (R) and green (G) pigment gene promot- ing the strongest effect (fourfold reduction; Fig. 4). M6 and M7 ers in WERI cells. (B) Activities of wild-type RP(~96), had activity similar to the wild type. M8 resulted in a twofold GP(~96), and RP(~96) mutants with the indicated substitutions that make them resemble the sequence of the green pigment gene promoter. The values shown represent the av- 250 erage of four transfections. Error bars represent standard deviation. Asterisks denote the level of significance (see legend to Fig- 3). 200

"5 150 enhancement of activity. Initially, we suspected that the M5 mu- < tation that abolished the TATA box had residual activity caused by 30 '•C 100 the TATA-like sequence, TTTAA, at position -67. This possibil- 2 ity was excluded because the double mutant M2M5, which de- stroyed this sequence and the canonical TATA box, retained 29% 50 *** *** of the activity of the wild-type —96 construct. The results of block mutagenesis point to the importance LLLUHti of the conserved sequences upstream of the TATA box in the transcriptional activity of the red and green pigment gene Mutant Promoter Construct promoters. They also corroborate the results of the deletion analysis in several ways. First, both sets of results showed that FIGURE 4. Activities of the block mutants (M1-M9 and the the TATA box is not absolutely essential for activity, which M2M5 double mutant) relative to that of the wild-type —96 suggests that there is an alternate TATA-independent mode of construct (100%) of the red pigment gene promoter. The transcriptional initiation of these genes. The TATA block mu- values shown represent the average of four transfections. The activity of the promoterless construct was approximately 3% to tant had approximately 10-fold higher activity than that of the 5% of that of the wild-type construct. Error bars represent promoterless construct. Second, both sets of results point to standard deviation. Asterisks denote the level of significance the necessity for the conserved sequences between the base (see legend to Fig. 3). — 96 and the TATA box for full promoter activity.

Downloaded from iovs.arvojournals.org on 09/26/2021 890 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

The nonconserved sequences between the TATA and the referred to as a GA box or CT element.31"33 The GA box/CT transcription start site are less essential. Changes in sequences element has been shown to bind single- and double-stranded downstream of the transcription initiation site (M8 and M9), DNA binding proteins31"33 in addition to SP1. The protected however, had strong effects on luciferase activity. Because M8 region FP2 encompassed the PCE 1 element and surrounding and M9 are in the 5' untranslated region of the mRNA, their sequences. FP3 protection was stronger with the extract from effects may have been exerted at the post-transcriptional level WERI cells, whereas FP1 and FP2 protections also were ob- (stability or translatability of the message). served with the Y-79 extract. FP3 included three blocks of sequences conserved with the mouse middle-wave cone pig- Activity of Red Versus Green Pigment Gene ment promoter (GGGTTTGGG, TTTAAGT, and GAGGCC). The Promoters in WERI Cells first and second of these7 sequences were similar to a con- The proximal promoters of the red and green pigment genes served sequence in the promoter of the human blue visual differ by 13 bases within the —190 to +41 region. We com- pigment gene (AGGTTTAGGT).34 The third block was identi- pared their activities in transient transfection in WERI cells and cal with the shared sequence between the Ret2 and Ret3 found that the —190 green pigment gene promoter construct was fourfold more active than the equivalent construct derived from the red pigment gene (Fig. 5A). The —96 green pigment B gene promoter construct, however, was only twofold more active than the red (Fig. 5A). This is consistent with the obser- 12 3 4 5 6 12 3 4 5 6 vation that the deletion of bases between -190 and -96 caused a twofold enhancement in the activity of the red pigment gene promoter (Fig. 3) but had no effect on the activity of the green. Therefore, the region between —166 and —134, which contained differences at five positions (Fig. 2), was responsible for the twofold higher activity of the green pigment gene promoter. The —96 construct contained only seven bases that differed between the red and green promoters. To determine which positions were responsible for the other twofold difference in activity, we made base substitutions in the —96 red promoter construct to alter various sites to those present in the green promoter. Figure 5B shows that the difference could be solely attributed to the change from T to C at position —3- This result was intriguing because T at position — 3 was not conserved between humans and mice. It could be that this change provided a more favorable context for transcription initiation by RNA polymerase II at the transcription Start site.

DNase I Protection The promoter fragment extending from -130 to +41 was analyzed for DNase I protection by incubation with 20 /xg FP3 nuclear extract from WERI cells. As shown in Figure 6, three regions were protected (FP1, FP2, and FP3). The sequence in FP1 resembled an SP1 binding site that has been variously

FIGURE 6. DNase I footprinting. Autoradiographs showing DNase I protection of the proximal red pigment gene promoter from position —130 to position +41. (A) Protection on the lower strand. Lane 1 shows the DNase I digestion pattern of the naked fragment with 0.05 U DNase I. Lanes 2 and 3 show the digestion pattern of the same fragment preincubated with GGGAGGAGGAGGTCTAAGTCCCAGGCrCAATTAAOAGAl'CAQGTA 20 fjig WERI nuclear cell extract then digested with 0.1 and 0.2 U DNase I, respectively. Lanes 4 and 5 show the digestion pattern with either 0.1 or 0.2 U DNase T, respectively, after 1 p preincubation with Y-79 nuclear extract. T^ane 6 shows the protection pattern with 0.2 U DNase I after preincubation with GTGTAGGGTTTGGGAGCTTTTAAGGTGAAGAGGCCCGGGCTGATC nuclear extract from the human monocytic leukemia cell line mt mt m THP1. (B) Protection on the upper strand. Lanes 1 to o'had the t T T fTT T •'," T T > I same treatments as in (A). (C) The sequence of the —130 to CCACAGGCCAGTATAAAGCGCCGTGACCCTCAGGTGATGCGCCAG +4l promoter fragment with the positions of DNase I protec- ft tion (labeled footprints [FP] 1, 2, and 3) and hypersensitivity shown by lines and arrows, respectively. GGCCGGCTGCCGTCGGGGACAGGGCTTTCCATAGCCATG

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, May 1998, Vol. 39, No. 6 Analysis of Red and Green Pigment Gene Promoters 891

regions of the rat rhodopsin promoter.35 Ret2 and Ret3 were shown to bind the same retina-specific factor.35 A region flanking the TATA box showed many weak DNase I hypersensitive o 1 sites on the upper strand (Fig. 6C) and partial protection of the Competitor/ lower strand in Y-79 and WERI cells when lower concentra- Antibody Z T tions of DNase I were used (data not shown).

Electrophoretic Mobility Shift Analysis Several of the regions implicated by deletion and point mutation analyses and by DNase I protection as having roles in the SP1- transcriptional activity of the promoter were investigated for the ability to bind nuclear proteins from WERI cells and from SP3 monkey retinas. The regions from —134 to —113, -119 to SP3- -101, -118 to -84, -81 to -60, -61 to -46, -56 to -40, —47 to —30, and +21 to +36 (Fig. 2) were synthesized as double-stranded oligonucleotides and were used in electrophoretic mobility shift analysis. The regions from —119 to — 101, -61 to —46, and +21 to +36 did not show any detectable specific binding (data not shown). The region from -134 to —113 gave five specific (as defined by competition with a 50- to 100-fold molar excess of unlabeled —134 to -113 double-stranded oligonucleotide but FrGURE 7. Electrophoretic mobility shift analysis of the — 134 not with other unrelated oligonucleotides) gel-shifted bands to —113 promoter segment. Autoradiograph of the binding (Fig. 7). One of the bands was shown to be caused by SP1 and patterns with WERI cell nuclear extract. Neither the competi- two caused by SP3 binding by supershift analysis with anti-SPl tor nor the antibody was added. A 100-fold excess of the and anti-SP3 antibodies (Fig. 7). unlabeled competitor oligonucleotide (GA box, -134 to — 113, or unrelated oligo) was added just before the addition of the The region from —81 to —60 gave a specific gel-shifted probe. The sequence of the GA box oligonucleotide is AAGT- band with WERI nuclear cell extract (Fig. 8A) but not with TGGGGGGAGGGACCTA; the unrelated oligonucleotide covers other cell extracts (Fig. 8A). As shown in Figure 8B (lanes 5 and the sequences between —61 and —46 of the red pigment gene 6), the M2 mutation (TTTAAG -» AGATCT), which lies within promoter. SP1 and SP3 antibodies were added 30 minutes after the region from —67 to -62, abolished the ability of the the addition of the labeled oligonucleotide probe, and incuba- unlabeled —81 to —60 oligonucleotide to compete out the tion on ice was continued for an additional 30 minutes. specific band, and the Ml mutation (TTTGGG -» AGATCT) compromised that ability (lanes 3 and 4). It seems likely, therefore, that the binding site for the protein responsible for

3 < 3 * g 1 1 Extract ? Competitor 9 § c -s i i)|i..U I.HIW

FIGURE 8. Electrophoretic mobility shift analysis of the —81 to —60 segment. (A) Autoradio- graph of the binding pattern in nuclear protein extracts prepared from monkey retina, WERI, Y-79, THP1 (human monocytic leukemic), 3T3 (mouse fibroblast), C2C12 (mouse myoblast), HEPG2 (human hepatocyte), and HELA (human fibroblast) cells. (B) Competition analysis with wild-type (-81 to -60), Ml, and M2 mutants (see Fig. 2) that alters the TTTGGG and TTTAAG sequences, respectively, and with a 100-fold excess of two unrelated oligonucleotides (-134 to -113 and LCR-3')-

Downloaded from iovs.arvojournals.org on 09/26/2021 892 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

Competitor o (100X) I

FIGURE 9- Electrophoretic mobility shift analysis of the -56 to —40 and the —47 to —30 segments. (A) Autoradiograph of binding patterns (with WERI cell nuclear extract) to the -56 to —40 segment in the absence (None) or presence of a 100-fold excess of the competitor DNA fragment indicated at the top of each lane. The unlabeled competitor oligonucleotide was added to the electrophoretic mobility shift analysis reaction before the addition of the labeled probe. Competition was performed with oligonucleotide A (—56 to -40 segment), oligonucleotide B (-47 to -30 segment), the 3' half of the 37-mer of the locus control region (LCR), an oligonucleotide B in which GATC between -41 and -44 had been changed to CTAG, an oligonucleotide encompassing the -61 to -46 region, and oligonucleotide A, in which GCTGA between bases -43 and -47 had been changed to AGATC. (B) Electrophoretic mobility shift analysis of the -47 to -30 segment (oligonucleotide B) using the same competitor DNA fragments used in A.

the band encompassed sequences altered by the Ml and M2 -101 regions, which contained the GGCCC sequence, it mutations. seemed more likely that these two proteins bound the CAAT- Each region from —56 to —40 and from —47 to —30 gave TAA sequence. two specific binding activities that were enriched in the nuclear extract from WERI cells (Fig. 9A). Figure 9B shows that the gel-shifted bands competed with an excess of the cold DISCUSSION competitor from either region but not with the corresponding oligonucleotides containing mutations in few bases in the re- Retinoblastoma tumors arise from photoreceptor precursor gion of overlap (—47 to -40). The binding also competed ceils during retinal development. Some of the established cell efficiently with a fragment representing the 5' half of the lines derived from these tumors display either rod-like or cone- 37-mer sequence of the LCR. Sequence comparison revealed like gene expression patterns.18 The human retinoblastoma that the LCR fragment had a homologous region (TGATCT) to cell line Y-79 was shown to express mainly rod-specific the TGATCC between -45 and -40 in the promoter. Such genes.36 Another retinoblastoma cell line, WERI, earlier was sequences are the hallmarks of hormone nuclear receptor shown to express cone transducin a-subunit (GNAT2)19l2° and half-sites. blue opsin29 mRNA. We showed in this study that WERI, but The PCE 1 sequence (CAATTAAG) had an apparent inhib- not Y-79, cells express mRNA encoding the red and green itory effect on the transcriptional activity of the red pigment opsins. The WERI cell line is most likely heterogeneous, be- promoter. A double-stranded oligonucleotide (-118 to -84) cause it is composed of cells that express blue, red, or green containing this sequence bound a protein (labeled BP1 in Fig. opsin genes. It is not known whether all cells express cone 10) from retinal extracts and from both retinoblastoma cell pigments. The level of red pigment mRNA in WERI cells is lines (WERI and Y-79). This protein also bound to the abso- approximately half that in whole human retinas. The red cones lutely conserved 37-mer of the LCR (Fig. 10B). In addition, constitute only less than 1% of retinal cells (taking a rod/cone WERT and Y-79 cells contained a strong binding activity (la- ratio of 50:1 and assuming that red cones are 50% of all cones). beled BP2 in Fig. 10) that seemed to be absent or reduced in This makes the percentage of red opsin expression in WERI extracts made from the whole retina. BP1 and BP2 were al- cells relative to that in retinal cone cells approximately 0.5% on lowed to compete with excess unlabeled oligonucleotides con- a per cell basis. If, however, only a fraction of WERI cells taining the 3' half of the 37-mer sequence of the LCR and with expresses the red opsin gene, then the percentage would be a Retl sequence11 derived from the promoter of the human higher. Therefore, we used WERI cells to functionally dissect rhodopsin gene (Fig. 10C). This -118 to -84 region shared the c/s-DNA elements in the promoters of these two genes. We with the Retl sequence and the 3' half of the 37-mer two observed that the proximal 96 bases of the red and green sequences of homology, PCE 1 (CAATTAA/G) and GGCCC. pigment gene promoters were sufficient to confer significant Because neither BP1 nor BP2 competed with the —119 to and WERI cell-specific expression.

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, May 1998, Vol. 39, No. 6 Analysis of Red and Green Pigment Gene Promoters 893

(Pig. 3) and bound SP1 and SP3 (as defined by supershift with B antibodies) plus two other unknown ubiquitous proteins (Fig. 7). The GGGAGG sequence was footprinted (FP1 in Fig. 6). A «8 w ^ similar sequence (GGTGGGAGGA) also is present just up- £ .s Extract f stream of the TATA box of the human blue visual pigment gene Extract 'f g promoter.34 The promoter of the gene encoding the photore- a! ceptor-specific interphotoreceptor retinoid-binding protein (IRBP) has a similar element (GGGAGGAG), which was shown to bind SP1 and other ubiquitous factors.37 Ret4, a positive- acting rhodopsin promoter element identified using a bovine retina in vitro transcription system, has the sequence TAGG- GAGGG and binds ubiquitous factors,38 which are likely to be SP1 and SP3. It seems, therefore, that the GA box has a positive regulatory role in the expression of photoreceptor-specific genes. Second, FP2 between —109 and —93 contains the photoreceptor cell element PCE 1 (CAATTAAG). This element first was discovered in the proximal promoter of rhodopsin and was later recognized in the 5' flanking regions of many vertebrate photoreceptor-specific genes.101120 It is also present in the absolutely conserved 37-mer core of the LCR of the color vision gene array.8 In addition, PCE 1 has homology to the RCS 1 I consensus sequence (AAYYCAATTAG) previously identified II*- .fed 2 in the promoters of many photoreceptor-specific genes of Competitor a £* 0* ^ oe ^ r- £ Drosophila melanogaster?9'*2 RCS I seems to cooperate with (iaOX) zJjjj:7tf;75 upstream elements to confer photoreceptor subclass-specific gene expression.39 The PCE I sequence, which is present in the promoters of rod- and cone-specific genes, may have a similar role in mammalian retinas, because it is important for expression in photoreceptor cells in general, whereas other elements determine rod-specific versus cone-specific expression. Recently, the cone-rod homeobox protein CRX has been reported to bind the PCE 1/Ret 1 element found in the promoters of several photoreceptor-specific genes, including opsin genes.43'44 CRX also bound other sequences in the rhodopsin promoter (the GCTTAG of Ret4 and GATTAA and CATTAA of FIGURE 10. Electrophoretic mobility shift analysis of the -118 BAT-1).44 CRX was found to transactivate the rhodopsin pro- to —84 segment. (A) The radiolabeled —118 to —84 segment moter sixfold in human embryonic kidney cells293 and to act was incubated with nuclear extracts from monkey retina, synergistically with NRL (115-fold activation of the rhodopsin WERI, Y-79, and THP1 cells and mouse brain. (B) Binding to promoter), but it did not have an effect in primary chick retinal the 37-mer sequence of the locus control region (LCR). The cells.44 A minimal interphotoreceptor binding protein pro- labeled 37-mer was incubated with the same nuclear extracts as in A. (C) Competition analysis of WERI nuclear binding moter also was transactivated by CRX in a CRX-binding site- dependent manner.43 CRX is expressed in rod and cone pho- activities to the -118 to —84 fragment: A 100-fold excess of 45 the competitor DN A fragment indicated at the top of each lane toreceptors, and its mutation causes cone-rod dystrophy. It was added to the reaction before the addition of the —118 to is still unknown whether CRX is a positive factor for cone gene —84 labeled probe. expression. It would be interesting to test the effect of CRX overexpression on the activity of the red opsin promoter in WERI. It would also be worthwhile to determine whether Critical Elements in the Proximal Promoter WERI cells express CRX. Our observation that the PCE l/RETl Four critical regions of the proximal promoter were delineated sequences act as a negative element in the transient transfec- by transfection analysis and in vitro DNA binding and footprint- tion assay is intriguing. It could indicate that these sequences ing studies, Footprinting studies were performed using nuclear are subject to binding by an inhibitory activity in WERI cells or extracts from WERI cells. Nuclear extracts from a monkey that the PCE 1 binding proteins in WERI cells interfere with retina did not result in well-defined footprints. This could have adjacent downstream positive elements. Alternatively, the been caused by the relatively low abundance of cone-specific higher activity of the promoter construct with the deleted PCE binding proteins in whole retinas, evidenced by gel-shift ex- 1 element may be a result of the new sequence created at the periments. Cone photoreceptors represent a small fraction of vector/promoter junction. We speculate that the PCE 1 se- the total number of cells in the whole retina, and, therefore, a quences are required to function as chromatins to facilitate the large number of retinas may be necessary to allow the detec- creation of a transcriptionally active domain by the LCR. tion of footprints. Third, FP3—deletion of which caused a significant reduction First, the region between —130 and —113, which contains in promoter activity (Fig. 3)—has three conserved blocks of a GA box (GGGAGG), had a positive effect on transcription sequence (GGGTTTGGG, TTTAAGT, and GAGGCC). Mutations

Downloaded from iovs.arvojournals.org on 09/26/2021 894 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

in these blocks all had strong deleterious effects on activity (Fig. Role of the LCR 4). A double-stranded oligonucleotide that includes the first two Upstream sequences of the red and green pigment gene array blocks bound a nuclenr protein specific to WERI cells (Fig. 8A). that contain the putative LCR, including a 37-bp region that is These two blocks show honiology to an evolutionarily conserved totally conserved in humans, cattle, and mice, had no enhancer sequence in the blue cone pigment gene promoter (AGGTT- 34 effect in the transient transfection system. We interpret this to TAGG at -105 to ~97). These facts suggest that these ele- mean that these sequences can act only in a chromatin context ments, and their associated DNA-binding proteins, play a role in to cooperate with the promoter to form a transcriptionally cone photoreceptor-specific expression. active chromatin domain.49"51 LCRs and other upstream regu- Fourth, the conserved region between —49 and -40 latory elements have been hypothesized to exert their effects (GGGCTGATCC) is similar to the NRL half-site (first six on promoters by a looping mechanism that brings the up- bases) and to the hormone receptor half-site (reverse orien- stream elements to the vicinity of the transcription initiation tation of the last six bases). We demonstrated the binding of site by means of protein-protein interactions.52"55 In this re- two nuclear proteins from WERI cells that seem to recognize gard, we observed that two nuclear proteins from WERI cells the TGATCC sequence. These proteins also bind a similar that bind the PCE 1 sequence (CAATTAAG) in the proximal sequence in the 3' half of the 37-mer sequence of the LCR. promoter (Fig. 10) also bind the 3' half of the totally conserved Binding experiments in the presence of anti-NRL antibodies 37-mer sequence of the LCR, which contains the same ele- failed to supershift the bands resulting from these two ment. The sequence of this element suggests that the bound activities or of activities that bind a longer region (—61 to proteins belong to the homeodomain family of transcription — 30) (data not shown). It seems, therefore, as unlikely that factors. Two other proteins that bind the TGATCC motif, NRL contributes to binding to the proximal promoters of the which resembles a monomeric binding site for a hormone red and green pigment genes as it does to the rhodopsin nuclear receptor, located between positions —45 and —40 in promoter. The TGATCC may be a binding site for a hormone the proximal promoter also bind the 5' half of the LCR (Fig. nuclear receptor that can bind to monomeric response ele- 10C), which has a TGATCT sequence. Finally, the -134 to 6 ments." COUP-TF is such a factor that is present in the — 113 region that bound SP1, SP3, and two other proteins retina and in WERI cells and that was shown to have a shows homology to a sequence (AGGTGGGAGGAGG) in the positive regulatory role in the expression of the mouse LCR located 37 bp downstream of the totally conserved 37- 47 arrestin gene. Similar sequences are present in the human mer.8 All these proteins (homeodomain proteins, hormone blue pigment promoter GGTGATCC immediately upstream nuclear receptors, and SP1) that bind the proximal promoter of the TATA box and TGCTGACCC, at position -280. and the LCR previously have been shown to be capable of forming higher order protein complexes on DNA that can Activity Differences between Red and Green bring distant DNA elements into proximity.54"57 Pigment Gene Promoters In this study, we defined the as-acting elements that We found that the —190 green pigment gene promoter play important roles in the expression of the red and green construct had four times the activity of the corresponding visual pigment genes in the WERI retinoblastoma cell line. red construct. The two differ in sequence at 13 positions We think that delineation of these elements has biologic within this region. A —96 green promoter construct had relevance because WERI cells seem to display a cone-like only two times the activity of the corresponding red pro- rather than a rod-like gene expression pattern. The signifi- moter construct. One or more of the six base differences cance of these elements for the proper developmental reg- between the red and green pigment gene promoters in the ulation and photoreceptor cell specification should now be region between -190 and —130 must account for the two- determined in a transgenic mouse system. Identification of fold difference in activity. It is noteworthy that the two transcription factors that bind these as-acting elements by substitutions at positions —166 and —165 create an AP-1 site cloning would contribute to a better understanding of the (CCGCCCCC) and that the two substitutions at —144 and mechanisms of regulation of these genes. — 141 create an Ets-2 recognition site (AAGGAA) in the Acknowledgments green pigment gene promoter. We found that within the —96 promoter construct only The authors thank Anand Swaroop for providing anti-NRL antibodies. one base difference (T versus C at position —3) accounts for the twofold difference in activity between the red and the References green promoters. Because the region between the TATA and 1. Kaiser PK, Boynton RM. Human Color Vision. 2nd ed. Washing- the transcription start site is not evolutionarily conserved ton, DC: Optical Society of America; 1996: 140-161. and because it can tolerate changes without the loss of 2. Feil R, Aubourg P, Heilig R, Mandel JL. A 195-kb cosmid walk promoter activity, we suggest that the change of T to C at encompassing the human Xq28 color vision pigment genes. position —3 is a gain of function substitution. The change Genomics. 1990;6:367-373. 3- Nathans J, Thomas D, Hogness DS. Molecular genetics of human results in the creation of a recognition site for transcription color vision: the genes encoding blue, green, and red pigments. factor CIIIB (CAGGTGAC), previously shown to be involved Science. 1986;232:193-202. in the regulation of the promoters of the apo-C III and apo-A 4. Ibbotson RE, Hunt DM, Bowmaker JK, Mollon JD. Sequence diver- II genes/18 Because the green pigment gene is more distal to gence and copy number of the middle- and long-wave photopig- the LCR than the red pigment gene, its stronger intrinsic ment genes in old world monkeys. Proc R Soc Land. 1992;247B: 1992:145-154. promoter activity may have evolved to offset the distance 5. Jacobs GH, Neitz J. Inheritance of color vision in a new world disadvantage in competing with the red pigment promoter monkey (Samiris sciureus). Proc Natl Acad Sci USA. 1987;84: for coupling to the LCR. 2545-2549.

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, May 1998, Vol. 39, No. 6 Analysis of Red and Green Pigment Gene Promoters 895

6. Yokoyama S, Starmer WT, Yokoyama R. Paralogous origin of the 29- Appukuttan B, Dulai KS, Hunt DM. Isolation and characteriza- red- and green-sensitive visual pigment genes in vertebrates. Mol tion of protein binding sites in the 5' flanking region of blue BiolEvol. 1993;lO:527-538. cone pigment (BCP) genes. Invest Ophthalmol Vis Sci. 1996; 7. Okano T, Kojima D, Fukada Y, Shichida Y, Yoshizawa T. Primary 37:S337. structures of chicken cone visual pigments: vertebrate rhodopsins 30. Verrijdt G, Swinnen J, Peeters B, Verhoeven G, Rombauts W, have evolved out of cone visual pigments. Proc Natl Acad Sci USA. Claessens F. Characterization of the human secretory compo- 1992;89:5932-5936. nent gene promoter. Biochim Biophys Ada. 1997;1350:l47- 8. Wang Y, Macke JP, Merbs SL, et al. A locus control region adjacent 154. to the human red and green visual pigment genes. Neuron. 1992; 31. Michelotti EF, Michelotti GA, Aronsohn Al, Levens D. Heteroge- 9:429-440. neous nuclear ribonucleoprotein K is a transcription factor. Mol 9. Winderickx J, Battisti L, Motulsky AG, Deeb SS. Selective expres- Cell Biol. 1996;l6:2350-2360. sion of human X chromosome-linked green opsin genes. Proc Natl 32. Michelotti EF, Tomonaga T, Krutzsch H, Levens D. Cellular nucleic Acad Sci USA. 1992;89:9710-97l4. acid binding protein regulates the CT element of the human c-myc 10. Kikuchi T, Raju K, Breitman ML. The proximal promoter of the proto-oncogene. / Biol Chem. 1995;270:1995:9494-9499. mouse arrestin gene directs gene expression in photoreceptor 33- Henson JW. Regulation of die glial-specific JC virus early promoter by cells and contains an evolutionarily conserved retinal factor-bind- the transcription factor Spl./Biol Chem. 1994;269:1046-1050. ing site. Mol Cell Biol. 1993:13:4400-4408. 34. Chiu MI, Nathans J. Blue cone and cone bipolar cells share 11. Morabito MA, Yu X, Barnstable CJ. Characterization of develop- transcriptional specificity as determined by expression of hu- mentally regulated and retina-specific nuclear protein binding to a man blue visual pigment-derived transgene. / Neurosci. 1994; site in the upstream region of the rat opsin gene. / Biol Chem. 14:3426-3436. 1991:266:9667-9672. 35- Yu X, Chung M, Morabito MA, Barnstable CJ. Shared nuclear 12. Ahmad I. Mash-1 is expressed during rod photoreceptor differen- protein binding sites in the upstream region of the rat opsin gene. tiation and binds an E-box, E (opsin)-l in the rat opsin gene. Brain Biochem Biophys Res Commun. 1993; 191:76-82. Res Dev Brain Res. 1995:90:184 -189. 36. Di Polo A, Farber DB. Rod photoreceptor-specific gene expression 13. Sheshberadaran H, TakahashiJS. Characerization of the chicken in human retinoblastoma cells. Proc Natl Acad Sci USA. 1995;92: rhodopsin promoter: identification of retina-specific and glass- 4016-4020. like protein binding domains. Mol Cell Neurosci. 1994;5:309- 37. Bobola N, Hirsch E, Albini A, Altruda F, Noonan D, Ravazzolo R. A 318. single czs-acting element in a short promoter segment of the gene 14. Kumar R, Chen S, Scheurer D, et al. The bZIP transcription factor encoding the interphotoreceptor retinoid-binding protein confers Nrl stimulates rhodopsin promoter activity in primary retinal cell tissue-specific expression. / Biol Chem. 1995;270:289-1294. cultures. / Biol Chem. 1996;271:296l2-296l8. 38. Chen SM, Zack DJ. Ret 4, a positive acting rhodopsin regulatory 15. Liu Q, Ji X, Breitman ML, Hitchcock PF, Swaroop A. Expression of element identified using a bovine retina in vitro transcription the bZip transcription factor gene Nrl in the developing nervous system./Biol Chem. 1996;271:28549-28557. system. Oncogene. 1996;12:207-211. 39- Fortini ME, Rubin GM. Analysis of cis-acting requirements of the Rh3 16. Rehmetulla A, Warwar R, Kumar R, Ji X, Zack DJ. The basic motif- and Rh4 genes reveals a bipartite organization to rhodopsin promot- leucine zipper transcription factor Nrl can positively regulate rhodop- ers in Drosophila melanogaster. Genes Dev. 1990;4:444-463. sin gene expression. Proc Natl Acad Sci USA. 1996;93:191-195. 40. Mismer D, Rubin GM. Definition of cfa-acting elements regulating 17. Swaroop A, Xu JZ, Pawar H, Jackson A, Skolnick C, Agarwal N. A expression of the Drosophila ninE opsin gene by oligonucleotide- conserved retina-specific gene encodes a basic motif/leucine zip- directed mutagenesis. Genetics. 1989:121:77-87. per domain. Proc Natl Acad Sci USA. 1992;89:266-270. 41. Mismer D, Michael WM, Laverty TR, Rubin GM. Analysis of the 18. Bogenmann E, Lochrie MA, Simon MI. Cone cell-specific genes promoter of the Rh2 opsin gene in Drosophila melanogaster. expressed in retinoblastoma. Science. 1988;240:76-78. Genetics. 1988; 120:173-180. 19. Morris TA, Fong WB, Ward MJ, Hu H, Fong SL. Localization of 42. Mismer D, Rubin GM. Analysis of the promoter of the ninE opsin upstream silencer elements involved in the expression of cone gene in Drosophila melanogaster. Genetics. 1987;116:565- transducin alpha-subunit (GNAT2). Invest Ophthalmol Vis Sci. 578. 1997:38:196-206. 43. Furukawa T, Morrow EM, Cepko CL. Crx, a novel ofcv-like ho- 20. Morris TA, Fong SL. Characterization of the gene encoding meobox gene, shows photoreceptor-specific expression and reg- human cone transducin a-subunit (GNAT2). Genomics. 1993; ulates photoreceptor differentiation. Cell. 1997;91:531-54l. 17:442-448. 44. Chen S, Wang Q-L, Nie Z, et al. Crx, a novel ofcxr-like paired- 21. Fukuchi K, Hearn MG, Deeb SS, et al. Activity assays of nine homeodomain protein, binds to and transactivates photoreceptor- heterogeneous promoters in neural and other cultured cells. In specific genes. Neuron. 1997; 19:1017-1030. Vitro Cell Dev Biol Anim. 1994;3OA:3OO-3O5. 45. Freund CL, Gregory-Evans CY, Furukawa T, et al. Cone-rod dystro- 22. Nordeen SK. Luciferase reporter gene vectors for analysis of pro- phy due to mutations in a novel photoreceptor-specific homeobox moters and enhancers. Biotechniques. 1988;6:454-458. gene (Cell Growth Differ. 1993; on the frequency and duration of LCR-mediated gene transcrip- 4:1-7. tion. Cell. 1996;87:105-ll4.

Downloaded from iovs.arvojournals.org on 09/26/2021 896 Shaaban and Deeb IOVS, May 1998, Vol. 39, No. 6

51. Reitman M, Lee E, Westphal H, Felsenfeld G. An enhancer/locus synergism and enhancement. Proc Natl Acad Sci USA. 1991 ;88: control region is not sufficient to open chromatin. Mol Cell Biol. 5670-5674. 1993;13:3990-3998. 55. Su W, Jackson S, Tjian R, Echols H. DNA looping between sites for 52. Cvekl A, Paces V. Interactions between proteins bound to the duck transcriptional activation: self-association of DNA-bound Spl. beta a-globin gene promoter and enhancer detected by the DNAse Genes Dev. 1991;5:820-826. 1 footprinting. Gene. 1992;110:225-228. 56. Kersten S, Gronemeyer H, Noy N. The DNA binding pattern of the 53 Knight JD, Li R, Botchan M. The activation domain of die bovine retinoid X receptor is regulated by ligand-dependent modulation papillomavirus E2 protein mediates association of DNA-bound dimers of its oligomeric state. / Biol Chem. 1997;272:12771-12777. to form DNA loops. ProcNatl Acacl Set USA. 1991;88:3204-3208. 57. Beachy PA, Varkey J, Young KE, von-Kessler DP, Sun BI, Ekker SC. 54. Mastrangelo IA, Courey AJ, Wall JS, Jackson SP, Hough PV. DNA Cooperative binding of an ultrabithorax homeodomain protein to Looping and Spl multimer links: a mechanism for transcriptional nearby and distant DNA sites. Mol Cell Biol. 1993;13:694l-6956.

Downloaded from iovs.arvojournals.org on 09/26/2021