Insulation from Viral Transcriptional Regulatory Elements Improves Inducible Transgene Expression from Adenovirus Vectors in Vitro and in Vivo

Home , Insulator (genetics), TATA box

Gene Therapy (2000) 7, 556–567  2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt VIRAL TRANSFER TECHNOLOGY RESEARCH ARTICLE Insulation from viral transcriptional regulatory elements improves inducible transgene expression from adenovirus vectors in vitro and in vivo

DS Steinwaerder and A Lieber Division of Medical Genetics, Box 357720, University of Washington, Seattle, WA 98195, USA

Recombinant adenoviruses (Ad) are attractive vectors for enhancers as tested after gene transfer with first-generation gene transfer in vitro and in vivo. However, the widely used Ad vectors in vitro and in vivo. Optimal shielding was E1-deleted vectors as well as newer generation vectors con- obtained when the transgene expression cassette was tain viral sequences, including transcriptional elements for flanked on both sides by HS-4 elements, except for when viral gene expression. These viral regulatory elements can the HS-4 element was placed in 3Ј→5Ј orientation in front interfere with heterologous promoters used to drive trans- of the promoter. The insulators reduced basal expression to gene expression and may impair tissue-specific or inducible barely detectable levels in the non-induced stage, and transgene expression. This study demonstrates that the allowed for induction factors of approximately 40 and activity of a metal-inducible promoter is affected by Ad approximately 230 in vitro and in vivo, respectively. Induction sequences both upstream and downstream of the transgene ratios from Ad vectors without insulators were approximately cassette in both orientations. Interference with expression 40-fold lower in vitro and approximately 15-fold lower in vivo. from the heterologous promoter was particularly strong by This study proves the potential of insulators to improve viral regulatory elements located within Ad sequences inducible or tissue-specific gene expression from adenovirus nucleotides 1–341. This region is present in all recombinant vectors, which is important for studying gene functions as Ad vectors, including helper-dependent vectors. An insulator well as for gene therapy approaches. Furthermore, our data element derived from the chicken ␥-globin locus (HS-4) was show that insulators exert enhancer-blocking effects in employed to shield the inducible promoter from viral episomal DNA. Gene Therapy (2000) 7, 556–567.

Keywords: LCR; boundary elements; E1A enhancer; MRE

Introduction inducibility of these heterologous promoters. However, tissue-specific or regulatable gene expression is often a Recombinant adenoviruses are attractive vehicles for in critical prerequisite for studying gene functions in vitro vitro and in vivo gene transfer into a wide range of cell and in vivo, as well as for gene therapy approaches. For types. First generation, E1-deleted, adenovirus vectors as a number of genetic disorders, the transgene expression well as E2- and/or E4-deleted vectors contain within must be restricted to the target tissue or must be at their genome promoters for the early regions E1A, E2, E3 a specific level requiring endogenous or inducible ␣ and E4, for two delayed early units (IX and IV 2), and promoters, whose activity can be fine-tuned. for one late unit (MLP). Helper-dependent, ‘gutless’ vec- Among the viral sequences that are potentially able to 1,2 tors are deleted for viral sequences except for those interfere with the heterologous transgene promoters are required for viral replication and packaging, which the ITRs, the E1A enhancer, the E2, E4 and pIX promoters include the ITRs and part of the E1A promoter. Adenovi- (Figure 1c). All recombinant adenovirus vectors pro- ral promoters contain multiple recognition sites for tran- duced so far contain the adenoviral (Ad5) sequences from scription factors often representing cis-acting DNA nucleotide (nt) 1 to nt 341 including the Ad ITR and the sequences that increase transcription in a manner that is E1A enhancer. The 102 bp long Ad ITR contains binding independent of their orientation and distance relative to sites for a number of transcription factors (SP1, ATF, the RNA start site. The latter properties define these NFIII/OTF-1, NFI/CTF)3 which have been shown to sequences as enhancers. The presence of viral enhancers regulate transcription of cellular and viral genes. The and upstream regulatory elements in the vector genome deletion of the corresponding transcription factor binding implies a possible interference with heterologous pro- sites impairs viral replication. In its normal location, the moters used to drive transgene expression. This inter- ITR acts as an enhancer for transcription from the E4 pro- ference may affect the activity, tissue specificity and/or moter4 and stimulates transcription (in a location-dependent manner) from the E1A promoter.3,5 The region between the E1A enhancer and the ITR has also been 3 Correspondence: A Lieber shown to exhibit enhancer activity. The E1A enhancer Received 26 July 1999; accepted 27 November 1999 contains two functionally distinct domains, one is specific Insulators in adenovirus vectors DS Steinwaerder and A Lieber 557

Figure 1 Structure of constructs and recombinant adenoviruses. (a) Transgene expression cassette. The heavy-metal responsive promoter contains a core promoter and five MREs at positions −54 to −150.29 The core promoter resembles a TATA box followed by a tet-operator sequence54 and the transcription start site of the thymidine kinase gene.29 The lengths of 5Ј and 3Ј non-translated sequences present in the hAAT fragment are indicated. The 12 nt long 5ЈNTR contains the consensus sequence for an initiator element (YA+1YTCYYY).39 The schematic presentation of the transgene expression cassette used in all further constructs is shown at the bottom. bPA: bovine growth hormone gene polyadenylation signal. (b) Plasmids containing adenoviral sequences. The transgene expression cassette was inserted into a derivative of p⌬E1sp1A with Ad sequences 22–341 and 3524–5790. These regions contain the E1A enhancer (E1AE), which overlaps with the Ad packaging signal (⌿), and the pIX units including the pIX promoter directly adjacent to the insertion site. (c) First-generation adenoviruses. The vectors were obtained by recombination in 293 cells between p⌬E1sp1A derivatives containing the transgene cassette and pJM17. The adenoviral genome is deleted for the E1 genes and contains deletion/substitution within the E3 region, which do not affect the E3 promoter.55 The transgene cassette was inserted into the E1 region. The transcription start sites of promoters that can potentially interfere with the transgene expression unit are indicated. for E1A (nt 200–300) and the other transactivates all early in an E1A-independent or -dependent manner.13 Since units (nt 250–280).6–8 The upstream half of the E1A the E2 and E4 promoters require E1A for transactivation, enhancer appears to have a specific conformation critical the corresponding enhancers may not critically affect het- for its transactivation9 and represents the binding site for erologous promoters within E1-deleted vectors. On the a cellular protein termed EF-1A. The E1A enhancer over- other hand, a number of recent studies demonstrated that laps physically with cis-acting sequences required for E2 and E4 proteins are expressed in cells transduced with packaging of viral genomes (nt 194–358)10 and can there- first-generation adenovirus vectors indicating that these fore not be removed from Ad vectors (Figure 1b). The E2 enhancers are active in the absence of E1A.14,15 It was and the E4 promoters located at m.u. 77.5 and 99.1 also demonstrated earlier that cellular transcription factors contain sequences, which have the qualitative properties can functionally substitute E1A in its transactivator func- of enhancer elements.11,12 These sequences can function tion, which makes the E2 and the E4 promoter potential in either orientation over a distance of several kilobases candidates for interference.15–17 The pIX promoter is

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 558 orientated rightwards with respect to the viral genome elements (MREs)28,29 (Figure 1a). In the non-induced and is located directly adjacent to the E1 insertion site for stage, only minimal basal transcription is initiated from transgene cassettes. Besides enhancers that act distance the core promoter. In the presence of heavy metals, MRE and orientation independent, viral sequences contain binding transcription factors are activated and induce transcription factor binding sites that represent upstream transcription. This promoter was placed in front of the 18 ␣ regulatory elements (UREs). UREs can activate tran- human 1-antitrypsin (hAAT) cDNA followed by the scription from a core promoter when located within a bovine growth hormone polyadenylation signal (bPA). certain distance from the transcription start site. Unspecific interference by viral enhancers can be Insulators are DNA elements that protect an integrated assessed by measuring the basal and induced hAAT reporter gene from chromosomal position effects or block expression in the presence and the absence of viral enhancer activated transcription from a downstream pro- sequences within transfected test plasmids. In addition, moter (for review see Refs 19 and 20). Chromatin bound- this inducible promoter allows, on the one hand, for test- ary elements with insulator activity have been found for ing whether the insulator/s can block interference by Drosophila melanogaster loci (Gypsy, suppressor of Hairy viral enhancers as measured in changes of basal wing, scs, scsЈ, Fab-7), for the chicken ␤-globin locus, and expression and, on the other hand, for analyzing whether for the T cell receptor locus. A number of models have insulators affect the intrinsic activity of the MRE been proposed for the mode of action of insulators which promoter as measured by its inducibility. fall into two major categories: steric models and tracking To analyze the impact of viral sequences on inducible models.20,21 Steric models assume that insulators separate gene expression, the MRE-hAAT expression cassette was enhancer and promoter into two inaccessible to each cloned into pBS (pBSMRE) and into a modified p⌬E1- other domains. Tracking models postulate that insulators sp1A with Ad sequences 22–341 containing most of the block some activating signal that travels along the DNA left ITR and the E1A enhancer as well as nucleotides from enhancer to promoter. An unambiguous distinction 3523–5790 which include the pIX promoter between these models seems to be difficult due to lack of (pAdMREa/b) (see Figure 1b). These constructs were sufficient data. Furthermore, a recent study demonstrated transfected into 293 cells and hAAT concentrations were that the activity of the HS-4 insulator could be affected measured 2 days later in the culture supernatant in the by flanking chromatin sequences suggesting that the presence and absence of ZnSO4 (Figure 2a). HAAT function of HS-4 elements as insulators is more expression from the pBSMRE construct was slightly over complex.22 background in the absence of ZnSO4 and 50- to 55-fold The DNase hypersensitivity region 4 (HS-4) of the higher in the presence of ZnSO . The level of induced chicken ␤-globin locus resembles a CpG island-like 4 23 hAAT expression was comparable with that from the sequence and functions as an insulator. This region is strong RSV promoter (pAdRSV), which was not respon- located within a 1.2 kb DNA fragment, which was used sive to ZnSO induction. Non-induced, basal hAAT in most insulator studies. Two copies of the 1.2 kb frag- 4 ␥ expression was significantly higher from the adenoviral ment flanking a human -globin promoter shielded shuttle plasmids, pAdMRE-a and -b, containing the against transactivation by an upstream enhancer from the hAAT expression cassette in either orientation suggesting mouse ␤-globin locus. The HS-4 domain is DNase-I sensi- transactivation of the core promoter by viral enhancer/s. tive in all cell types indicating association with ubiqui- The inducibility of the MRE-hAAT cassette cloned in the tous factors and arguing against tissue specificity of the rightward orientation with respect to the 5ЈAd ITR given insulator.23 One of these factors, a zinc-finger DNA- (pAdMREa) was abolished since hAAT expression levels binding protein that is highly conserved in vertebrates was recently identified.24 So far, insulators have been suc- in the non-induced and induced stages were comparable. cessfully applied to shield integrated transgenes from Expression from plasmids containing the leftward orien- position effects or enhancers in a chromosomal con- tated cassette (pAdMREb) was approximately five-fold text.20,24,25 Very recently, the HS-4 insulator has been inducible compared with approximately 50-fold in constructs without Ad sequences. Interestingly, significant employed in retrovirus vectors to protect transgene ⌬ expression from negative position effects.26,27 hAAT expression was observed for p E1sp1A-based con- The goals of this study were to evaluate the potential structs only containing a rightwards-orientated hAAT effect of above mentioned viral promoter/enhancer cDNA without the MRE promoter (pAdhAATa) (Figure elements on transgene expression from a metal-inducible 2a). No hAAT expression was detected if the hAAT promoter28,29 and to test whether an insulator element cDNA was in the context of pBS without adenoviral derived from the chicken ␤-globin locus can be used to sequences. This suggests that nt 22–341 contain either an shield this promoter from undesired interference by viral intrinsic promoter or upstream regulatory elements, enhancers. The insulator effect was analyzed after which when assembled together with a suboptimal tran- adenoviral gene transfer in vitro and in vivo. Viral trans- scription start site present within the hAAT cDNA form duction studies were performed with E1-deleted, first- an active promoter. Similarly elevated basal expression generation vectors. levels which differed quantitatively depending on the orientation of the transgene cassette were observed with recombinant adenoviruses (Figure 2b). The cis-activity Results mediated by Ad nt 1–341 was even more pronounced in adenoviral vectors than on plasmid level. The pro- Interference by viral regulatory elements moterless vector with the hAAT cassette in rightward The heterologous promoter used in this study represents orientation (Ad.hAATa) yielded about one third of the a core promoter containing a transcription start site and hAAT expression of the corresponding vector with TATA box combined with five copies of metal-responsive promoter (Ad.MREa).

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 559

Figure 2 Activation of hAAT expression by viral sequences. This shows absolute hAAT levels after adjustment of transfection efficiencies as well as + − ± the ratios between ZnSO4-induced ( ) and non-induced ( ) expression (indicated on the right). Shown is the average hAAT concentration s.e.m (n Ͼ 3). HAAT expression from the MRE hAAT cassette was compared with expression from the RSV promoter, which is widely used for high-level gene expression after adenovirus-mediated gene transfer. The induction ratios for promotorless constructs were not applicable (n/a). (a) Plasmids were ␮ transfected into 293 cells in parallel in two sets of dishes. 150 m ZnSO4 was added to one set of dishes to induce the MRE promoter. Induced and basal hAAT levels were measured 2 days after transfection in culture supernatants. All test plasmids were spiked with pCMVlacZ to correct for differences in transfection efficiency (see Materials and methods). Average transfection efficiency was approximately 80% as measured by the number of ␤-gal-positive cells. Expression levels from the RSV-hAAT cassette cloned into the p⌬E1sp1A derivative were similar for both transgene cassette

orientations and did not respond to ZnSO4 addition (not shown). (b) 208f Cells were infected with adenovirus at an MOI of 100. Induction with ZnSO4 was started 6 h after infection and hAAT analysis was performed at 48 h after infection. Constructs and viruses are presented in schematic form as outlined in Figure 1. Note: pAd.hAATa/b and the viral vectors Ad.hAATa/b do not contain heterologous promoters.

Effects of insulators in vitro expression cassette (Figure 3). Using only one-sided insu- The HS-4 insulator was selected because it appeared to lation was expected to allow for better differentiation function within mammalian cells in a cell-type inde- between the impact of upstream and downstream viral pendent manner and to lack evident enhancer/promoter enhancers on transactivation. An additional aim was to elements.23 This was a prerequisite for our aim to analyze whether or not the orientation of the insulator improve regulated gene expression in adenoviral vectors. with regard to the MRE promoter and the viral sequences We used the 1.2 kb fragment derived from the 5Ј end of influences its function. Therefore, a total of 16 different the chicken ␤-globin locus containing the HS-4 region, constructs with all possible combinations and orien- hereafter designed as HS-4 insulator. In order to exert its tations of transgene cassette and insulator/s were gener- enhancer-blocking activity, the insulator must be inserted ated and tested in transfection experiments. between the enhancer and the promoter of interest. As Interestingly, constructs with the HS-4 element in outlined above, Ad vectors contain the E1A enhancer 3’→5’ orientation upstream of the MRE promoter demon- upstream of a transgene inserted into the E1 region and strated high basal expression levels suggesting that an the E2, E3, and E4 enhancers downstream of the insertion intrinsic cis-activating activity was present in the HS-4 site. This implies that the promoter or expression cassette fragment when cloned in this constellation (data not should be flanked on both sides by insulators. To prove shown). To investigate this effect further, transfection this, p⌬E1sp1A-based constructs were generated contain- studies with pBS-based constructs containing the insu- ing one or two HS-4 insulators flanking the MRE-hAAT lator in different orientation linked to the MRE-hAAT

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 560 were infected with a multiplicity of infection (MOI) of 100 p.f.u./per cell and hAAT expression was analyzed

48 h later in parallel with and without ZnSO4 induction. A MOI of 100 was used because this was the lowest MOI that allowed for transduction of 100% of 208f cells as testes with a lacZ expressing adenovirus (data not shown). Transduction studies were performed in 208f cells, because this cell line did not support signiﬁcant Ad Figure 3 Adenoviral shuttle vectors containing HS-4 insulators. The replication, in contrast to most hepatoma cell lines.30 detailed structure of individual elements is described in Figure 1. HS-4 The vector with the rightwards-orientated cassette is the 1.2 kb insulator element derived from the chicken ␤-globin locus. The arrow indicates the orientation of the HS-4. Elements labeled with (Ad.MREa) demonstrated higher basal expression levels ‘→’ have the 250 bp GC-rich core region on the left side of the fragment. resulting in lower induction ratios than the vector with Sixteen different p⌬E1sp1A-based shuttle vectors containing all possible the expression cassette cloned in leftward orientation insulator/transgene cassette combinations were generated and tested in (Ad.MREb). One insulator inserted downstream of the transfection experiments. rightwards cassette (Ad.Ins1/1a) reduced basal expression. This effect was more pronounced with one insulator inserted upstream of the rightwards cassette (Ad.Ins1/3a). This indicates that the Ad region nt 1–341 contain enhancer as well as a distance depending cis- activating activity, which was described earlier for phAATa/b constructs (Figure 2). Two insulators sur- rounding the rightwards cassette (Ad.Ins2/1a) have a clear additive shielding effect resulting in induction factors that were approximately 40-fold higher than the corresponding insulatorless control (Ad.MREa). The double insulator combination affected the absolute hAAT levels upon activation compared with the control Ad.MREa. However, while the levels for activated expression Figure 4 Effect of different orientations of HS-4 elements on hAAT dropped only by a factor of four, the two insulators expression. To investigate better the presence of cis-activating activity in Ad.2/1a reduced the non-induced, basal expression within the HS-4 element, the insulator was cloned together with the MRE- by more than a factor of 200 compared with the hAAT cassette into pBS in different orientations and hAAT concentrations were measured with and without induction (n = 3). insulatorless control. When inserted between the leftward-orientated cas- cassette were performed (Figure 4). Basal expression from sette and downstream Ad sequences (AdIns1/3b), one the pIns1/4 was 10 to 20-fold higher than from constructs insulator can improve the inducibility of the MRE pro- with other insulator/transgene cassette combinations. moter and shield against downstream enhancers. In this Due to this interfering effect, all constructs containing case, the induction factor was approximately 19-fold this particular insulator/expression cassette constellation compared with approximately 12-fold for the corre- were excluded from further studies. sponding construct without the insulator (pAdMREb). The most informative p⌬E1sp1A-based constructs One insulator inserted between the upstream Ad were used to produce the corresponding recombinant sequence and leftward cassette (AdIns1/1b) blocked the adenoviruses and tested in vitro (Figure 5). 208f Cells interference by the enhancers present in Ad region nt 1–

Figure 5 Effect of insulators on hAAT expression after adenovirus infection in vitro. The most informative p⌬E1sp1A derivatives shown in Figure 3 were used to produce ﬁrst-generation adenoviruses. 208f Cells were infected with a MOI of 100, which was sufﬁcient to transduce all cells. HAAT expression was measured with and without induction as described in Figure 2. Absolute hAAT concentrations and induction ratios are shown (n Ͼ 3). Note: Induction studies with Ad vectors could not be performed in E1A expressing 293 cells due to development of cytopathic effects.

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 561 341 when compared with AdMREb. This indicates that interfering enhancer/s are present upstream as well as downstream of the expression cassette. Again, the vectors with two insulators flanking the leftward cassette showed the best induction factors. For Ad.Ins2/1b the levels of activated expression were approximately seven- fold reduced whereas the basal expression was inhibited by approximately 30-fold to nearly undetectable levels. In conclusion, comparing the induction ratios from Ad vectors with a leftwards-orientated hAAT cassette (Ad.MREb, Ad.Ins1/1b, Ad.Ins1/3b), the shielding effect of one insulator against downstream enhancers (Ad.MREb versus Ad.Ins1/3b) and upstream located viral enhancers (Ad.MREb versus Ad.Ins1/1b) becomes evident. Two insulators have a clear additive enhancer- blocking effect in adenoviruses (Ad.Ins2/1a/b, Ad.Ins2/2b). Importantly, both hAAT cassette orientations gave similarly high induction factors (approximately 40-fold) when shielded with two insulators in contrast to the corresponding vectors without insulators (no induction and 12-fold induction for rightwards and leftwards directed expression cassettes, respectively). Two insulators affected the absolute Figure 6 Shielding effect of truncated HS-4 elements. The adenovirus vec- expression levels upon activation. This effect was more tor Ad.⌬Ins1 or Ad.⌬Ins2 contained a 1.0 kb or 0.5 kb fragment of the pronounced for certain double insulator-transgene cas- original HS-4 elements used in Ad.Ins2/2b (see Figure 5). The restriction sette combinations (Ad.Ins2/1b) than for others sites HindIII and AflII used to produce the Ad.Ins2/2b derivatives containing the truncated HS-4 fragments are indicated in the upper chart. (Ad.2/2b). However, the inhibitory effect of double insu- Ad.MREb is the corresponding non-insulated vector with the transgene lators was much less for activated expression than for cassette in leftward orientation (see Figure 5). 208f Cells were infected basal expression resulting in greatly improved induction with a MOI of 100. HAAT expression was measured with and without factors compared with insulator-less vectors. induction. Absolute hAAT concentrations and induction ratios are In an attempt to better characterize the structural shown (n Ͼ 3). elements within the 1.2kb HS-4 elements that are involved in insulation, we performed analyses with the double insulator virus that had demonstrated the best dominantly in hepatocytes.32 hAAT expression from the insulation and induction rates (Ad.Ins2/2b). Two deriva- MRE promoter was induced by ZnSO4 added to the tives of Ad.Ins2/2b were generated that contained trunc- drinking water. Serum hAAT levels were measured ated HS-4 elements flanking the transgene cassette before and after induction (Figure 7). The data obtained (Figure 6). These DNA fragments were deleted for the in vivo are widely consistent with the key conclusions 250 bp insulator core region, which, according to recent drawn based on the in vitro studies. However, there were publications, accounts for a large portion of the enhancer a number of interesting differences between in vitro and 24 blocking activity. Viruses with truncated HS-4 elements in vivo studies: the basal expression without ZnSO4 (Ad.⌬Ins1 and Ad.⌬Ins2) demonstrated lower induction induction was generally lower and the expression levels rates than Ad.Ins2/2b. Basal expression from Ad.⌬Ins1 after induction were higher in vivo resulting in approxi- and Ad.⌬Ins2 was comparable with that from the non- mately four-fold greater induction factors. This is surpris- insulated vector, Ad.MREb indicating less efficient insu- ing because one would expect that traces of heavy metals lation. This suggested that the insulator effect was greatly present in the blood or hepatocytes would result in diminished when the functional important 250 bp HS-4 higher background levels. The cis-activating activity core region was removed from the 1.2 kb fragment. The located within nt 1–341 was not detectable in vivo data with vectors containing the 0.5 and 1.0 kb DNA frag- (Ad.hAATa/b). The highest induction ratios (230-fold) ment give an example that the insertion of random ‘stuf- were obtained with vector containing a leftwards-orien- fer’ DNA flanking the expression cassette will not exert tated transgene cassette flanked by insulators. Activated the same shielding effects as the complete HS-4 element. expression from double-insulator vectors, particularly from those containing the leftwards orientated was less Insulator effect in vivo effected in vivo than in vitro. For the best variant (2/1b), Our ultimate goal was to test whether insulators can shi- the levels of induced expression dropped only by a factor eld the MRE promoter when the vectors were applied in of 1.6 whereas the levels of basal expression decreased vivo. Therefore, the adenovirus vectors used before in the by approximately 12-fold. in vitro studies were injected via tail vein infusion into Induction of hAAT expression was maintained at the

C57Bl/6 mice. This mouse strain is known for a persistent same high level as long as ZnSO4 was applied to the ani- hAAT expression, which appears not to be affected by mals (not shown). Furthermore, we demonstrated that 10 cellular or humoral immune responses against viral pro- days after removal of ZnSO4 from the drinking water teins or hAAT.31 This allows for performing induction hAAT expression dropped again to basal levels (Figure studies over longer time-periods. Earlier studies have 8). A repeated administration of ZnSO4 resulted in the demonstrated that after systemic vector application, 90% same induction factor and kinetics as observed for the of infused adenoviral genomes are found in the liver, pre- initial induction round. Expression from the MRE pro-

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 562

Figure 7 Effect of insulators on hAAT expression in vivo. Adenovirus (2 × 109 p.f.u.) was administered to C57Bl/6 mice by tail vein infusion. From independent experiments, it was known that induced hAAT expression from the MRE promoter reached a plateau at day 7 and maintained this level for the time of analysis (3 months). Ten days after adenovirus infusion, the basal hAAT concentration was determined in serum from animals. After

obtaining this blood sample, 25 mm ZnSO4 was added to the drinking water and induced hAAT levels were measured 7 days later. Absolute hAAT = expression levels before and during ZnSO4 induction and induction ratios are shown at a (n 3). Notes: hAAT concentrations are shown at a logarithmic scale. The same virus preparations were used for in vitro and in vivo studies.

moter can also be induced by cadmium, bismuth, silver, gene expression from tissue-speciﬁc promoters in aden- cobalt, copper, mercury or nickle.28 In our hands, intra- ovirus vectors was not limited to the corresponding

peritoneal injection of CdSO4, 20 and 6 h before analysis endogenous tissue but occurred in other cell types as allowed for a quick induction of transgene expression, well.35–38 In consensus with earlier reports, the present however absolute hAAT levels were approximately 10- study demonstrated that adenoviral sequences affect fold lower than after induction with ZnSO4. The reason basal as well as induced expression from a metal-depen- for this remains to be clarified. dent promoter. This effect was seen regardless of the In summary, the adenovirus-based, heavy metal- orientation of the transgene cassette, indicating interac- inducible MRE promoter used in this study is a straight- tion with viral enhancers located upstream and down- forward and reliable system to obtain up to 230-fold stream of the insertion site. Interference with viral induction of transgene expression in vivo when the trans- elements was quantitatively more pronounced with the gene cassette is flanked on both sides with insulators. transgene cassette cloned in rightwards direction. In this orientation, a high basal expression was detected in vitro Discussion even in the absence of a heterologous promoter. This was attributed to an URE-mediated cis-activating activity, The goal of this study was to evaluate the interference of which was present within adenovirus genome nt 1–341 viral promoter/enhancer elements on the transgene in addition to an intrinsic enhancer activity. An insulator expression from an inducible promoter and to test inserted between nt 1–341 and the rightwards-orientated whether HS-4 insulators can improve inducible gene MRE-hAAT cassette blocked this interfering activity. expression from first-generation adenovirus vectors. Since the insulator did not contain canonical polyadenyl- Interference of adenoviral sequences with the activity ation signals, the latter activity was most probably caused or specificity of heterologous promoters is an expected by UREs rather than by an active transcription start site problem that was reported earlier. Adenoviral sequences present within nt 1–341. In support of this hypothesis, it present in p⌬E1sp1B including the E1A enhancer and the is notable that the 12 bp long, 5Ј non-translated region of pIX promoter affected the activity and tissue specificity the hAAT cDNA fragment used in our constructs con- of transgene expression from a muscle-specific promoter tained the consensus sequence for initiator elements as tested in plasmid transfection.33 The inhibitory effect (YA+1YTCYYY).39 Initiators are core promoters that was observed for both orientations of the transgene cas- allow for efficient initiation of transcription in conjunc- sette. Friedman et al34 reported that cell type-specific tion with upstream regulatory elements or enhancers. In expression from the rat albumin promoter within the conclusion, the strong cis-activating activity present in adenovirus genome in human hepatoma cells was low nt 1–341 appears in part to be caused by upstream regu- compared with that of the endogenous albumin gene. latory elements, which in conjunction with a potential Similar observations were described by Babiss et al35 for initiator present in the hAAT cDNA assemble into an the ␤-globin promoter. A number of reports noted that active promoter. Clearly, mapping of transcription start

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 563 based on reduced basal expression and higher expression levels after induction. Insertion of one HS-4 element on either site of the transgene cassette demonstrated that expression from the MRE promoter was affected by upstream (eg E1A) enhancers as well as by viral elements located downstream of the insertion site (eg E2, E3, E4 or MLP). Logically, two insulators flanking the transgene cassette conferred maximal insulation and induction ratios which were approximately 230-fold in vivo and approximately 40-fold in vitro. Our data suggest that transgene cassettes flanked by direct repeated HS-4 insulators (Ad.Ins2/1a and Ad.Ins2/1b) were better shielded against cis-activation in vitro and in vivo than transgene cassettes flanked by inverse repeated HS-4 elements (Ad.Ins2/2b). For the same recombinant virus, basal expression levels and induction ratios differed between in vitro studies performed in 208f cells and in vivo studies which mostly reflect transgene expression within mouse hepatocytes. Activation of viral enhancers/silencers by tissue-specific transcription factors may account for these differences.34,41 Importantly, the HS-4 element appeared to function in a cell-type-independent manner and exerted its insulating effect in rat 208f cells and in mice. Since the function of enhancers as well as of insulators24 involves DNA binding proteins specific for a given cell type, enhancer or insulator, caution should be exercised in generalizing our results for other regulated systems. The insulator/s prevented interference between the MRE promoter and viral enhancers/silencers, however, certain insulator/transgene combinations also had Figure 8 Induction kinetics in vivo. (a) Repeated induction of transgene decreased absolute hAAT expression levels upon induc- expression with ZnSO4. The intervals of ZnSO4-administration (given tion, which was more pronounced in the in vitro studies. with drinking water) are indicated. Representative data are shown for = This may suggest that in the induced stage, viral Ad.Ins1/3b (n 3). (b) CdCl2 was administered to another group of ani- enhancers probably contribute to transcriptional acti- mals. CdCl2 was injected intraperitoneally into all animals 20 and 6 h before obtaining the serum sample for the first time-point after induction. vation from the MRE promoter in addition to the specific Data for viruses Ad.Ins1/3a and Ad.Ins2/1a in two individual animals activation by metal-responsive elements and that insu- are shown. lators would block this additional cis-activation. Alterna- tively, in these cases the HS-4 element/s may affect, to a certain degree, the interaction between the MREs with sites is required to prove this hypothesis. Importantly, the corresponding core promoter. Importantly, the HS-4 the nt 1–341 region contains the packaging signal and is insulator/s reduced the levels of basal expression to a therefore essential for propagation of all recombinant much greater extent than the levels of activated adenoviruses. This includes high-capacity, ‘gutless’ vec- expression resulting in higher induction factors com- tors, which contain Ad5 nt 1–440 and 35 818–35 935.1 pared with the insulator-free control. While levels of We selected the chicken HS-4 insulator because it is the basal expression in vitro decreased by factor 200 or 30 only insulator derived from mammalian genomes that (for Ad.Ins2/1a or Ad2/1b), levels of induced expression demonstrated a clear enhancer-blocking activity in a het- dropped only four- or seven-fold, respectively. In vivo erologous context.22–27 In earlier studies, we have unsuc- basal expression was reduced by factor 15 or 12, whereas cessfully attempted to use the Drosophila ‘gyspy’ insu- expression levels upon activation were only four- or 1.7- lator for shielding heterologous promoters in Ad vectors fold lower, for Ad.Ins2/1a or Ad.Ins2/2b, respectively. (DS, AL, unpublished results). Vectors with a leftwards- Notably, the absolute levels of induced hAAT with dou- orientated hAAT cassette demonstrated higher induction ble-insulator constructs in vivo were approximately factors than the rightwards-directed cassette on a plas- 1500 ng/ml, which is in the range of the Rous sarcoma mid and an adenoviral level. This is consistent with earl- virus (RSV) or phosphoglycerate kinase (PGK) promoters ier reports indicating that unspecific activation by the used for high-level in vivo gene expression.42 Also, for E1A regulatory region could be reduced when the trans- most inducible systems (eg for expression of toxic gene gene expression cassette was inserted in the leftward, products) a minimized basal expression is more 3Ј→5Ј orientation with respect to the Ad 5ЈITR (for important than a maximal, activated expression. review see Ref. 40). However, this report as well as The HS-4 fragment used in this study had a length of others,33,37 demonstrated significant interference even if 1.2 kb. The relatively large size of this element is prob- the transgene expression unit is cloned in leftward orien- ably not problematic when used in ‘gutless’ vectors, how- tation towards the 5Ј Ad ITR. Despite quantitative differ- ever, may reduce the cloning capacity of first-generation ences, independent of the orientation of the hAAT cas- vectors. Much of the insulator activity of HS-4 domain is sette, vectors with insulators had greater induction ratios contained within a 250 bp core element.21 Our studies

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 564 with truncated HS-4 fragments support the functional time, there was unspecific activation of the MRE pro- importance of this core element. Current efforts are moter by Ad enhancers resulting in high basal expression focused on testing whether this small core element as from AdMREa and AdMREb in vivo. This basal mono- or multimer exerts similar effects as the 1.2 kb expression could be reduced by more than 10-fold by two fragment. insulators flanking the expression cassette demonstrating In constructs where the HS-4 element was linked in a clear enhancer-blocking effect of insulators at a magni- 3Ј→5Ј orientation to the MRE promoter, a significant tude that is in agreement with other studies on HS-4 intrinsic cis-activating activity originating from the HS-4 elements.22,24,25 Importantly, studies with HS-4 elements fragment was detectable. While lacking a classical TATA truncated for the 250 bp-core region underscored the or initiator sequence, the G+C-rich HS-4 region contains enhancer-blocking function of HS-4 elements in Ad vec- a number of binding sites for transcription factors23 tors. Taken together, our data demonstrated that the which may function as UREs. This may account for the shielding effect of HS-4 elements was in part due to an elevated basal expression observed with this particular enhancer-blocking activity. insulator/promoter constellation. From the data The HS-4 insulator was recently used in a regulatable, presented in Figure 4, it cannot be concluded that the helper-dependent adenovirus.2 In this study, a duplicate blocking activity of the HS-4 fragment is directional. It is of the insulator was employed to block the nonspecific generally thought that insulators act independent of their interaction between the heterologous promoters of two orientation as was demonstrated for the scs or scsЈ expression cassettes present within the same vector. elements.43 However, the 2.4 kb HS-4 dimer significantly affected the It is known that enhancer activity is approximately 50- activity and/or specificity of the two promoters in vivo fold higher on chromatin assembled plasmid DNA than and did improve the inducible expression system. As that on naked DNA.44 In this context, the issue of whether suggested in the present report, the 3Ј→5Ј orientation of or not the process of insulation requires the involvement the HS-4 domain exerts cis-activating activity, which may of chromatin and chromosomal context of the transgene have contributed to the problems encountered by Burcin is controversially discussed in the literature. It has been et al.2 shown that scs or scsЈ can block enhancer-activated tran- Ring et al38 had previously shown that the specificity scription on plasmid DNA microinjected into Xenopus of an ERBB2 promoter to ERBB2 expressing breast cancer laevis oocytes.45,46 However, this assay cannot definitively cells was lost when the promoter was used in adenovirus discriminate the transcription activity from plasmid DNA vectors. The authors speculated that ‘cryptic’ transcrip- fully assembled or unassembled into mini-nucleosomes. tion start sites within the Ad genome were not respon- The incoming adenoviral genome has a supercoiled sible for this loss of tissue specificity. In a recent study by structure and is associated with core proteins VII, V and Vassaux et al50 from the same group, an ERBB2 promoter- IV␣2. Several studies indicate that once the viral genome thymidine kinase (tk) expression cassette was flanked on is translocated to the nucleus, the viral core structure is both sides by bovine growth hormone polyadenylation replaced by a nucleosome-like structure involving cellu- signals (bPA) in order to increase selectivity of tk lar histones.47–49 Similarly to the adenoviral genome, expression to breast cancer cells. Specificity of tk transfected plasmids associate with histones and are expression was assessed based on sensitisation to gancy- packaged into a nucleosome-like structure shortly after clovir or RT-PCR. The data suggest that the bPA-contain- transfection. Therefore, while our study demonstrates ing vector did not significantly express TK in ERBB2 that insulators can act in cis on episomal DNA this does negative cells, whereas the vector without bPAs did. Our not exclude that chromatin-like structures are func- results support their observation that UREs (particularly tionally important for insulators. within Ad nt 1–341) located in proximity to the heterolog- The concrete mechanism of action of HS-4 insulators is ous promoter can contribute to nonspecific cis-activation unclear. The insulation effect cannot be simply reduced and that this interaction can be disrupted by inserting a to termination of transcription from cryptic promoters DNA spacer between the UREs and the promoter. How- present within the adenoviral genome. There are no ever, it is unlikely that bPAs will block cis-activation by canonical poly-adenylation signals within the 1.2 kb HS- distant viral enhancers. Our study, albeit limited to one 4 elements. Furthermore, these HS-4 elements have been expression cassette, suggests that this can be achieved by incorporated into retrovirus vectors without affecting the HS-4 insulators in vitro and in vivo. virus titers, which indicates that transcription of the Our data demonstrate that the double insulator combi- retrovirus genome is not prematurely terminated by the nations allowed for an up to 230-fold and 40-fold induc- HS-4 elements.26,27 In vitro, part of the activation of basal tion of hAAT expression in vivo and in vitro, respectively. expression by the Ad region 1–341 is caused by upstream This, in combination with barely detectable basal hAAT regulatory elements that form together with an initiator expression makes the technically straightforward, sequence in the hAAT fragment, an active promoter. This inducible MRE promoter flanked by insulators practically promoter configuration can be disrupted by an HS-4 important. For example, minimized basal expression may element as it can probably be disrupted by any random allow for the generation of viruses with potential cyto- DNA fragment. However, this effect cannot fully account toxic proteins or proteins that affect the adenovirus life for the reduction of basal expression by HS-4 elements in cycle. In addition, as a proof of principle, our study sug- vitro. A clear cis-activation by adenoviral enhancers that gests that the employment of insulators may be can be blocked by HS-4 elements is evident if one com- important for incorporating other inducible systems into pares hAAT levels for AdMREb versus Ad.Ins1/3b or adenovirus vectors including the Tet-,51 or RU 486-regu- AdMREa versus Ad.Ins1/3a. More importantly, the pro- lated52 systems where the absolute induction factor criti- moter activity formed by joining the Ad1–314 and the cally depends on the level of basal expression in the non- hAAT fragment was not observed in vivo. At the same induced stage. Furthermore, insulators may improve the

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 565 speciﬁcity and/or activity of tissue-speciﬁc promoters in fragment into the corresponding sites of pAd+ resulted in adenovirus vectors. pAdhAATa. Insertion of hAAT cDNA containing 1.6 kb KpnI/HindIII fragment from pBShAAT into the corresponding sites of pAd− resulted in pAdhAATb. Materials and methods pAdMREa was constructed by fusing the MRE containing 400 bp ClaI/SpeI fragment of pSLMRE to pAdhAATa Plasmid constructs opened with ClaI/XbaI. Ligation of a 600 bp MRE con- Sequences of the metal-responsive promoter and the HS- taining HindIII/SalI fragment to pAd+ opened with KpnI 4 element were taken from the plasmids pMRENeo28,29 and to a hAAT cDNA containing 1.6 kb Kpn/HindIII (gift from Richard Palmiter, University of Washington) fragment resulted in pAdMREb. The construction of and pJC5–4 (GenBank accession No. U78775)23,25 (gift pAd/RSVhAAT was described earlier.42 from G Felsenfeld, NIH), respectively. To facilitate clon- ␣ ing, the MRE, HS-4 element, and the human 1-antitrypsin (hAAT) cDNA were subcloned in the cloning vectors Adenovirus vectors pBSK(+) (Stratagene, La Jolla, CA, USA) and pSL1190 All adenovirus vectors were generated by homologous (GenBank accession No. U13866). A HS-4 containing 1.2 recombination with pJM17 (Microbix, Toronto, Ontario, kb XbaI fragment and a MRE promoter containing 200 bp Canada) in 293 cells. The shuttle vectors pAdIns1/1a, SacII/SacI fragment were inserted into the corresponding pAdIns1/1b, pAdIns1/3a, pAdIns1/3b, pAdIns2/1a, sites of the pSL1190 polylinker to generate pSLMRE and pAdIns2/1b, pAdIns2/2a, pAdIns2/2b, pAdhAATa, pSLJCa and pSLJCb with the HS-4 element in 5Ј→3Ј (a) pAdhAATb, pAd.MREa and pAdMREb were cotrans- or 3Ј→5Ј (b) orientation, respectively. The 250 bp GC-rich fected with pJM17 into low passage 293 cells by calcium region of HS-4 including the unique HindIII site is phosphate coprecipitation as previously described.15 The referred to as being the element’s 5Ј terminus. Accord- plaque titers of all viruses were determined on 293 cells. ingly, elements labeled ‘→’ contain the GC-rich region The presence of replication-competent adenovirus and and the HindIII site on their left side. A 1.7 kb contamination with endotoxin in virus preparations was HindIII/XhoI fragment from pBShAAT42 containing the excluded by tests described earlier.53 Viruses with a titer hAAT cDNA and the bovine growth hormone gene poly- of 5 × 1011 p.f.u./ml were stored at −80°Cin10mm Tris-

adenylation signal was cloned into the HindIII/XhoI sites Cl (pH 8.0)–1 mm MgCl2–10% glycerol. of pBSK(+) (pBShAAT). pMREhAAT was obtained by ligating a 200 bp MRE promoter comprising SacII/SacI fragment to a 2.7 kb SacI/XmnI fragment of pBShAAT Tissue culture and a 1.9 kb SacII/XmnI fragment of pBSK(+). The inter- 293 (Human embryonic kidney cells) and 208f (rat mediate constructs pJCMREa and pJCMREb were con- fibroblasts) cells were cultured in Dulbecco’s modified structed by inserting a HS-4 containing 1.2 kb XbaI frag- Eagle’s medium (DMEM) supplemented with 10% fetal ment and MRE containing 200 bp SacII/SacI fragment bovine serum (Gibco, BRL, Grand Island, NY, USA) and into the polylinker of pSL1190. The intermediate con- Pen/Strep. FBS was pretreated to eliminate potentially structs pJChAATa and pJChAATb were obtained by interfering heavy metal traces by filtration through inserting the HS-4 comprising 1.2 kb KpnI/SalI fragments Chelex 100 resin (BioRad, Hercules, CA, USA). Fifty ml of pSLJCa/b into pBShAAT opened by KpnI/XhoI diges- of FBS were applied to a column matrix formed of 5 g tion. Insertion of a 250 bp MRE containing fragment into resin. The procedure was repeated five times. To evaluate the SacII/SpeI sites of pJChAATa/b formed the con- the promoter activity in vitro, expression constructs were structs pIns1/1 and pIns1/2. Fusion of a 1.6 kb SpeI/KpnI transfected into 293 cells using Qiagen superfect transfec- fragment of pMREJCa/b to a 2.6 kb SpeI/XmnI fragment tion reagent (Qiagen, Valencia, CA, USA). 106 Cells were of pBShAAT and a 1.9 kb KpnI/XmnI fragment of seeded in six-well dishes and 24 h later, 2.5 ␮g expression pBSK(+) resulted in pIns1/3 and pIns1/4. The constructs plasmid were cotransfected with 0.25 ␮g pCMVlacZ. Six ␮ pIns2/1, pIns2/2, pIns2/3 and pIns2/4 were constructed hours after transfection, 150 m ZnSO4 was added to a by three fragment ligation of a 1.6 kb SpeI/KpnI fragment subset of culture dishes to induce the MRE promoter. of pMREJCa/b, a 3.8 kb SpeI/XmnI fragment of Forty-eight hours after transfection the concentration of pJChAATa/b, and a 1.9 kb KpnI/XmnI fragment of hAAT in the supernatant was evaluated by ELISA. Trans- pBSK(+). Plasmid vectors containing adenoviral fection efficiencies were determined by quantification of sequences were based on p⌬E1sp1A. The polylinker of ␤-galactosidase activity in cell lysates using a chemilumi- p⌬E1sp1A was modified by insertion of the sequences nescent ␤-gal reporter gene assay (Boehringer Mannheim, AGCTTGCGGCCGCTTACGCGGTACCT and CTA- Mannheim, Germany). Induction studies with Ad vectors GAGCGGCCGCATACGCGGTACCA adding new could not be performed in E1A expressing 293 cells due restriction sites (pAd+ and pAd−). Insertion of a 3.1 kb to development of cytopathic effects. To analyze the pro- KpnI/NotI fragment of pIns1/1 and pIns1/2 into the cor- moter activity within viral vectors, 5 × 105 208f cells were responding sites of pAd+ and pAd− resulted in seeded in six-well dishes 24 h before infection. Cells were pAdIns1/1a, pAdIns1/1b, pAdIns1/2a, and pAdIns1/2b. infected in 0.5 ml culture media containing adenovirus ␮ Fusion of a 4.3 kb KpnI fragment of pIns1/3, pIns1/4, (MOI 100). Six hours after infection, 150 m ZnSO4 was pIns2/1, pIns2/2, pIns2/3, and pIns2/4 to the KpnI site added to a subset of cells to induce the MRE promoter. of pAd+ in both orientations produced the constructs One hundred per cent transduction efficiency under these pAdIns1/3a, pAdIns1/3b, pAdIns1/4a, pAdIns1/4b, conditions was verified by infection with Ad.␤-Gal and pAdIns2/1a, pAdIns2/1b, pAdIns2/2a, pAdIns2/2b, X-gal staining 48 h after infection. Forty-eight hours after pAdIns2/3a, pAdIns2/3b, pAdIns2/4a, pAdIns2/4b. infection the concentration of hAAT in the supernatant Insertion of a hAAT cDNA containing 1.6 kb XbaI/XhoI was analyzed by ELISA.

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 566 Animals 10 Grable M, Hearing P. Cis and trans requirements for the selec- Animal studies were performed in accordance with the tive packaging of adenovirus type 5 DNA. J Virol 1992; 66: institutional guidelines set forth by the University of 723–731. Washington. All animals were housed in SPF facilities. 11 Loeken MR, Brady J. The adenovirus E2a enhancer: analysis of Four- to 5-week-old female C57/BL6 mice were pur- regulatory sequences and changes in binding activity of ATF chased from Jackson Laboratories (Bar Harbor, ME, and E2F following adenovirus infection. J Biol Chem 1989; 264: 6572–6579. USA). For in vivo transduction experiments 2 × 109 p.f.u. ␮ 12 Zajchowski DA, Jalinot P, Kedinger C. E1a-mediated stimu- adenovirus diluted in 200 l DMEM were injected via tail lation of the adenovirus E3 promoter involves an enhancer vein infusion. Blood samples were obtained by retroorbi- element within the nearby E2a promoter. J Virol 1988; 62: tal bleeding and hAAT concentrations were determined 1762–1767. by ELISA. CdCl2 triggered expression was induced by 13 Imperiale MJ, Hart RP, Nevins JR. An enhancer-like element in ␮ intraperitoneal injection of 1 g CdCl2 per gram bod- the adenovirus E2 promoter contains sequences essential for yweight 20 and 6 h before the first bleeding time-point. uninduced and E1A-induced transcription. Proc Natl Acad Sci ZnSO4-induced expression was mediated by sup- USA 1985; 82: 381–385. plementing drinking water with 25 mm ZnSO4 for 7 days 14 Yang Y et al. Cellular immunity to viral antigens limits E1- per induction round. Mice were supplied with regular deleted adenoviruses for gene therapy. Proc Natl Acad Sci USA drinking water for 10 days between induction rounds. 1994; 91: 4407–4411. 15 Lieber A et al. Recombinant adenoviruses with large deletions ELISA generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and hAAT concentrations were determined by ELISA as pre- 42 in vivo. J Virol 1996; 70: 8944–8960. viously described. The detection limit of the assay was 16 Spergel JM, Chen-Kiang S. Interleukin 6 enhances a cellular 500 pg/ml. Culture supernatants were used undiluted for activity that functionally substitutes for E1a protein in trans- hAAT detection. HAAT concentration in serum samples activation. Proc Natl Acad Sci USA 1991; 88: 6472–6476. represents the weighted average of different dilutions 17 La Thangue NB, Rigby PW. An adenovirus E1a-like transcrip- from every sample. tion factor is regulated during the differentiation of murine embryonal carcinoma cells. Cell 1987; 49: 507–513. 18 Ptashne M. How eukaryotic transcriptional activators work. Acknowledgements Nature 1988; 335: 683–689. We thank Zong-Yi Li and Greg Priestley for technical 19 Felsenfeld G et al. Chromatin structure and gene expression. Proc Natl Acad Sci USA 1996; 93: 93840–93886. assistance. We are grateful to Cheryl Carlson, Dmitry 20 Udvardy A. Dividing the empire: boundary chromatin elements Shayakhmetov, and David Russell for critical discussion. delimit the territory of enhancers. EMBO J 1999; 18: 1–8. We thank David Emery for providing the HS-4 insulator 21 Bell AC, Felsenfeld G. Stopped at the border: boundaries and element and Richard Palmiter for the MRE promoter insulators. Curr Opin Genet Dev 1999; 9: 191–198. fragment. This work was supported by the Cystic 22 Walters MC et al. The chicken beta-globin 5Ј HS4 boundary Fibrosis Foundation, and NIH grants R01 CA80192–01, element blocks enhancer-mediated suppression of silencing. Mol R21 DK55590–01. DS is a recipient of a predoctoral Cell Biol 1999; 19: 3714–3726. DAAD fellowship. 23 Chung JH, Bell AC, Felsenfeld G. Characterization of the chicken beta-globin insulator. Proc Natl Acad Sci USA 1997; 94: 575–580. References 24 Bell AC, West AG, Felsenfeld G. The protein CTCF is required for enhancer blocking activity of vertebrate insulators. Cell 1999; 1 Schiedner G et al. Genomic DNA transfer with a high-capacity 98: 387–396. adenovirus vector results in improved in vivo gene expression Ј and decreased toxicity. Nat Genet 1998; 18: 180–183. 25 Chung JH, Whiteley M, Felsenfeld G. A 5 element of the 2 Burcin MM et al. Adenovirus-mediated regulable target gene chicken beta-globin domain serves as an insulator in human expression in vivo. Proc Natl Acad Sci USA 1999; 96: 355–360. erythroid cells and protects against position effects in Droso- 3 Hatfield L, Hearing P. Redundant elements in the adenovirus phila. Cell 1993; 74: 505–514. type 5 inverted terminal repeat promote bidirectional transcrip- 26 Emery DW, Yannaki E, Spyridis J, Stamatoyannopoulos G. A tion in vitro and are important for virus growth in vivo. Virology chromatin insulator inhibits negative position effects on retro- 1991; 184: 265–276. virus vector expression in vivo. American Society of Gene Ther- 4 Miralles VJ, Cortes P, Stone N, Reinberg D. The adenovirus apy, 2nd Annual Meeting of the American Society of Gene Ther- inverted terminal repeat functions as an enhancer in a cell-free apy, 1999, Vol. abstr. No. 951, p 240a. system. J Biol Chem 1989; 264: 10763–10772. 27 Rivella S et al. The insulator cHS4 increases the probability that 5 Leza M, Hearing P. Cellular transcription factors bind to adeno- randomly integrated recombinant retroviruses escape transcrip- virus early region promoters and to cAMP response elements. tional silencing: implication for gene therapy. American Society J Virol 1988; 62: 3003–3013. of Gene Therapy, Washington, DC, 2nd Annual Meeting of the 6 Sassone-Corsi P et al. Far upstream sequences are required for American Society of Gene Therapy, 1999, Vol. abstr. No. 66, efficient transcription form the adenovirus-2 E1A transcription p 17a. unit. Nucleic Acids Res 1983; 11: 8735–8745. 28 Palmiter RD. Regulation of metallothionein genes by heavy met- 7 Hearing P, Shenk T. The adenovirus type 5 E1A transcriptional als appears to be mediated by a zinc-sensitive inhibitor that control region contains a duplicated enhancer element. Cell 1983; interacts with constitutively active transcription factor, MTF-1. 33: 695–703. Proc Natl Acad Sci USA 1994; 91: 1219–1223. 8 Hearing P, Shenk T. Adenovirus 5 E1A enhancer contains two 29 Searle PF, Stuart GW, Palmiter RD. Metal regulatory elements distinct domains: one is specific for E1A and the other modu- of the mouse metallothionein-I gene. EXS 1987; 52: 407–414. lates expression of all early units in cis. Cell 1986; 45: 229–236. 30 Nelson J, Kay MA. Persistence of recombinant adenovirus in 9 Ohyama T. Bent DNA in the human adenovirus type 2 E1A vivo is not dependent on vector replication. J Virol 1997; 71: enhancer is an architectural element for transcription stimu- 8902–8907. lation. J Biol Chem 1996; 271: 27823–27828.

Gene Therapy Insulators in adenovirus vectors DS Steinwaerder and A Lieber 567 31 Barr D et al. Strain related variations in adenoviral mediated mediated gene transfer into mouse hepatocytes. Hepatology 1995; transgene expression from mouse hepatocytes in vivo: compari- 21: 815–819. son between immunocompetent and immunodeficient inbred 43 Kellum R, Schedl P. A group of scs elements function as domain strains. Gene Therapy 1995; 2: 151–156. boundaries in an enhancer blocking assay. Mol Cell Biol 1992; 32 Vrancken Peeters M-J, Lieber A, Perkins J, Kay MA. Method for 12: 2424–2431. multiple portal vein infusions in mice: quantification of adeno- 44 Workman JL, Taylor ICA, Kingston RE. Activation domains of virus-mediated hepatic gene transfer. BioTechniques 1996; 20: stably bound Gal4 derivatives alleviate repression of promoters 278–285. by nucleosomes. Cell 1991; 64: 533–544. 33 Shi Q, Wang Y, Worton R. Modulation of the specificity and 45 Dunaway M, Hwang JY, Xiong M, Yuen H-L. The activity of activity of a cellular promoter in an adenoviral vector. Hum Gene the scs and scsЈ insulator elements is not dependent on chromo- Ther 1997; 8: 403–410. somal context. Mol Cell Biol 1997; 17: 182–189. 34 Friedman JM, Babiss LE, Clayton DF, Darnell JE Jr. Cellular pro- 46 Krebs JE, Dunaway M. The scs and scsЈ insulator elements moter incorporated into adenovirus genome: cell specificity of impart a cis requirement on enhancer–promoter interactions. albumin and immunoglobulin expression. Mol Cell Biol 1986; 6: Mol Cell 1998; 1: 301–308. 3791–3797. 47 D’ery CV et al. The structure of adenovirus chromatin in infected 35 Babiss LE, Friedman JM, Darnell JE Jr. Cellular promoter incor- cells. J Gen Virol 1985; 66: 2671–2684. porated into adenovirus genome: effects of viral regulatory 48 Daniell E, Groff DE, Fedor MJ. Adenovirus chromatin structure elements on transcription rates and cell specificity of albumin at different stages of infection. Mol Cell Biol 1981; 1: 1094–1105. and beta-globin promoters. Mol Cell Biol 1986; 6: 3798–3806. 49 Wong ML, Tsu MT. Psoralen-crosslinking study of the organiza- 36 Quantin B, Perricaudet LD, Tajbakhsh S, Mandel J-L. Aden- tion of intracellular adenovirus nucleoprotein complexes. J Virol ovirus as an expression vector in muscle cells in vivo. Proc Natl 1988; 62: 1227–1234. Acad Sci USA 1992; 89: 2581–2584. 50 Vassaux G, Hurst HC, Lemoine NR. Insulation of a con- 37 Imler J-L et al. Targeting cell type-specific gene expression with ditionally expressed transgene in an adenoviral vector. Gene an adenovirus vector containing the lacZ gene under the control Therapy 1999; 6: 1192–1197. of the CFTR promoter. Gene Therapy 1996; 3: 49–58. 51 Kistner A et al. Doxycycline-mediated quantitative and tissue- 38 Ring CJA, Harris JD, Hurst HC, Lemoine NR. Suicide gene specific control of gene expression in transgenic mice. Proc Natl expression in tumour cells transduced with recombinant aden- Acad Sci USA 1996; 93: 10933–10938. oviral, retroviral and plasmid vectors containing the ERBB2 pro- 52 Wang Y, O’Malley BW Jr, Tsai SY, O’Malley BW. A regulatory moter. Gene Therapy 1996; 3: 1094–1103. system for use in gene transfer. Proc Natl Acad Sci USA 1994; 39 Smale SR, Baltimore D. The ‘initiator’ as a transcriptional control 91: 8180–8184. element. Cell 1989; 57: 103–113. 53 Lieber A et al. The role of Kupffer cell activation and viral gene 40 Hitt MM, Addison CL, Graham FL. Human adenoviral vectors expression in early liver toxicity after infusion of recombinant for gene transfer into mammalian cells. Adv Pharmacol 1997; 40: adenovirus vectors. J Virol 1997; 71: 8798–8807. 137–205. 54 Gossen M, Bujard H. Tight control of gene expression in mam- 41 Griscelli F et al. Heart-specific targeting of beta-galactosidase by malian cells by tetracycline-responsive elements. Proc Natl Acad the ventricle-specific cardiac myosin light chain 2 promoter Sci USA 1992; 89: 5547–5551. using adenovirus vectors. Hum Gene Therapy 1998; 9: 1919–1928. 55 Bett AJ, Krougliak V, Graham FL. DNA sequence of 42 Kay MA, Graham F, Leland F, Woo SL. Therapeutic serum con- deletions/insertions in early region 3 of Ad5 dl309. Virus Res centrations of human alpha1-antitrypsin after adenoviral- 1995; 39: 75–82.

Gene Therapy