DOCSLIB.ORG

Anatomy of a Eeljkaryc)'Ticprotein Gene ~

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Anatomy of a Eeljkaryc)'Ticprotein Gene ~ Under$tJncl]ng Inhentance 11+~ ANATOMY OF A EELJKARYC)’TICPROTEIN GENE ~ - Promoter (TATA box) Downstream enhancer -1 Stop site Start site Upstream Poly A site enhancer ~ ATG r r TAA1 1] Sense 5’ [ II strand Exon Intron Exon Intron Exon Template 3’ I Ill ~ strand Upstream Transcription Downstream region region region ~ach eukaryotic gene is placed in one of stream of the poly A site. Within the poly A The region upstream of the promoter and, three classes according to which of the site are sequences that, when transcribed, less frequently, the downstream region or three eukaryotic RNA polymerases is in- signal the location at which the primary RNA the transcription region itself contain se- volved in its transcription. The genes for transcript is cleaved and equipped with a quences that control the rate of initiation of RNAs are transcribed by RNA polymerases “tail” composed of a succession of ribo- transcription. Although expression of a pro- I and Ill. The genes for proteins, the class nucleotides containing the base A. (The tein gene is regulated at a number of stages first brought to mind by the word “gene” and poly A tail is thought to aid the transport of in the pathway from gene to protein, control the class focused on here, are transcribed messenger RNA from the nucleus of a cell of replication initiation is the dominant regu- by RNA polymerase II (po/ 11). to the cytoplasm,) Note that the poly A site latory mechanism, (Primary among the other lies downstream of the DNA codon (here regulatory mechanisms is control of splic- Shown above are the components of a TAA) corresponding to one of the RNA ing.) The regulated expression of a gene prototypic protein gene. By convention the codons (UAA) that signals the end of trans- (the when, where, and degree of expres- sense strand of the gene, the strand with the lation of the transcribed RNA. sion) is the key to phenotypic differences sequence of DNA bases corresponding to between the various cells of a multicellular the sequence of RNA bases in the primary Within the transcription region are exons organism and also between organisms that RNA transcript, is depicted with its 5’-to-3’ and introns. Exons tend to be about 300 possess similar genotypes, direction coincident with the left-to-right di- base pairs long; each is a succession of rection. (Often only the sense strand of a codons uninterrupted by stop codons. ln- Initiation of transcription is controlled mainly gene is displayed.) The left-to-right direc- trons, on the other hand, are not uninterrupted by DNA sequences (cis elements) and by tion thus coincides with the direction in successions of codons, and the RNA seg- certain proteins, many but not all of which which the template strand is transcribed. ments transcribed from introns are spliced are sequence-specific DNA-binding proteins The terms “upstream” and “downstream” out of the primary RNA transcript before (Vans-acting transcription factors). Thus describe the location of one feature of a translation, A few protein genes contain no both temporal and cellular specificities of gene relative to that of another, Their mean- introns (the human a–interferon gene is an transcription control are governed by the ings in that context are based on regarding example), most contain at least one, and availability of the different tram-acting tran- transcription as a directional process analo- some contain a large number (the human scription factors. Interactions of transcrip- gous to the flow of water in a stream, thyroglobulin gene contains about forty). tion factors with Ciselements and with each Generally the amount of DNA composing other lead to formation of complex protein The start site is the location of the first the introns of a protein gene is far greater assemblies that control the ability of po/ II to deoxyribonucleotide in the template strand than the amount composing its exons. initiate transcription. Most of the complexes that happens to be transcribed, It defines enhance transcription initiation, but some the beginning of the transcription region of Close upstream of the start site is a pro- act as repressors. Enhancers and repres- the gene. Note that the start site lies up- moter sequence, where po/ II binds and sors can be located as far as 10,000 base stream of the DNA codon (ATG) corre- initiates transcription. A common promoter pairs away from the transcription region, sponding to the RNA codon (AUG) that sequence in eukaryotic genes is the so- signals the start of translation of the tran- called TATA box, which has the consensus Class Iand class Ill genes differ from protein scribed RNA, The transcription region ends sequence 5 ‘-TATAAA and is located at a genes not only in their anatomies but also in at sclme nonspecific deoxyribonucleotide variable short distance (about 30 base pairs) the promoters, cis elements, and trarw- between 500 and 2000 base pairs down- upstream of the start site. acting factors involved in their transcription, 64 L~)\,4/~/~~]oTS(icn((, Number 20 19(12.
Load more

Recommended publications
  • Preinitiation Complex
    Science Highlight – June 2011 Transcription Starts Here: Structural Models of a “Minimal” Preinitiation Complex RNA polymerase II (pol II) plays a central role in the regulation of gene expression. Pol II is the enzyme responsible for synthesizing all the messenger RNA (mRNA) and most of the small nuclear RNA (snRNA) in eukaryotes. One of the key questions for transcription is how pol II decides where to start on the genomic DNA to specifically and precisely turn on a gene. This is achieved during transcription initiation by concerted actions of the core enzyme pol II and a myriad of transcription factors including five general transcription factors, known as TFIIB, -D, -E, -F, -H, which together form a giant transcription preinitiation complex on a promoter prior to transcription. One of the most prominent core promoter DNA elements is the TATA box, usually directing transcription of tissue-specific genes. TATA-box binding protein (TBP), a key component of TFIID, recognizes the TATA DNA sequence. Based on the previous crystallographic studies, the TATA box DNA is bent by nearly 90 degree through the binding of TBP (1). This striking structural feature is thought to serve as a physical landmark for the location of active genes on the genome. In addition, the location of the TATA box at least in part determines the transcription start site (TSS) in most eukaryotes, including humans. The distance between the TATA box and the TSS is conserved at around 30 base pairs. TBP does not contact pol II directly and the TATA-containing promoter must be directed to the core enzyme through another essential transcription factor TFIIB.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • Comparative Analyses of Long Non-Coding RNA in Lean and Obese Pigs
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 25), pp: 41440-41450 Research Paper Comparative analyses of long non-coding RNA in lean and obese pigs Lin Yu1, Lina Tai1, Lifang Zhang1, Yi Chu1, Yixing Li1 and Lei Zhou1 1State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of Animal Science and Technology, Guangxi University, Nanning, P.R. China Correspondence to: Yixing Li, email: [email protected] Lei Zhou, email: [email protected] Keywords: lncRNA, pig, obesity, QTL Received: April 28, 2017 Accepted: May 15, 2017 Published: May 26, 2017 Copyright: Yu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Objectives: Current studies have revealed that long non-coding RNA plays a crucial role in fat metabolism. However, the difference of lncRNA between lean (Duroc) and obese (Luchuan) pig remain undefined. Here, we investigated the expressional profile of lncRNA in these two pigs and discussed the relationship between lncRNA and fat deposition. Materials and Methods: The Chinese Luchuan pig has a dramatic differences in backfat thickness as compared with Duroc pig. In this study, 4868 lncRNA transcripts (including 3235 novel transcripts) were identified. We determined that patterns of differently expressed lncRNAs and mRNAs are strongly tissue-specific. The differentially expressed lncRNAs in adipose tissue have 794 potential target genes, which are involved in adipocytokine signaling pathways, the PI3k-Akt signaling pathway, and calcium signaling pathways.
    [Show full text]
  • Tnlo-Encoded Tet Repressor Can Regulate an Operator-Containing
    Proc. Nati. Acad. Sci. USA Vol. 85, pp. 1394-1397, March 1988 Biochemistry TnlO-encoded tet repressor can regulate an operator-containing plant promoter (cauliflower mosaic virus 35S promoter/electroporation/transient chloramphenicol acetyltransferase assays) CHRISTIANE GATZ* AND PETER H. QUAILt Departments of Botany and Genetics, University of Wisconsin, Madison, WI 53706 Communicated by Folke Skoog, October 26, 1987 (receivedfor review July S, 1987) ABSTRACT The TnlO-encoded tet repressor-operator The TnlO-encoded tet repressor regulates the expression system was used to regulate transcription from the cauliflower of the Tc resistance operon by binding to nearly identical mosaic virus (CaMV) 35S promoter. Expression was moni- operator sequences that overlap with three divergent pro- tored in a transient assay system by using electric field- moters (14, 15). The genes of the tet operon are only mediated gene transfer ("electroporation") into tobacco pro- transcribed in the presence of the inducer Tc, which pre- toplasts. The tet repressor, being expressed in the plant cells vents the repressor from binding to its operator sequences. under the control of eukaryotic transcription signals, blocks The tet repressor was chosen for regulating a plant promoter transcription of a CaMV 35S promoter chloramphenicol ace- for two reasons. (i) With a native molecular mass of 48 kDa, tyltransferase (cat) fusion gene when the two tet operators diffusion into the nucleus seemed likely (16). (ii) The high flank the "TATA" box. In the presence of the inducer equilibrium association constant of the repressor-inducer tetracycline, expression is restored to full activity. Location of complex ensures efficient induction at sublethal Tc concen- the operators 21 base pairs downstream of the transcription trations (17), thus making the system useful as an on/off start site does not significantly affect transcription in the switch for the specific regulation of transferred genes.
    [Show full text]
  • Differences in Methylation Patterns in the Methylation Boundary Region of IDS Gene in Hunter Syndrome Patients: Implications for Cpg Hot Spot Mutations
    European Journal of Human Genetics (2006) 14, 838–845 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE Differences in methylation patterns in the methylation boundary region of IDS gene in hunter syndrome patients: implications for CpG hot spot mutations Shunji Tomatsu*,1, Kazuko Sukegawa2, Georgeta G Trandafirescu1, Monica A Gutierrez1, Tatsuo Nishioka1, Seiji Yamaguchi3, Tadao Orii2, Roseline Froissart4, Irene Maire4, Amparo Chabas5, Alan Cooper6, Paola Di Natale7, Andreas Gal8, Akihiko Noguchi1 and William S Sly9 1Department of Pediatrics, Saint Louis University, Pediatric Research Institute, St Louis, MO, USA; 2Department of Pediatrics, Gifu University School of Medicine, Gifu, Japan; 3Department of Pediatrics, Shimane University, Shimane, Japan; 4Centre d’Etude des Maladies Me´taboliques, Hoˆpital Debrousse, Lyon France; 5Institut de Bioquimica Clinica, Barcelona, Spain; 6Willink Biochemical Genetics Unit, Royal Manchester Children’s Hospital, Great Britain, UK; 7Department of Biochemistry and Medical Biotechnologies, University of Naples, Federico II, Italy; 8Institut fur Humangenetik, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany; 9Edward A. Doisy Department of Biochemistry and Molecular Biology, Saint Louis University School of Medicine, St Louis, MO, USA Hunter syndrome, an X-linked disorder, results from deficiency of iduronate-2-sulfatase (IDS). Around 40% of independent point mutations at IDS were found at CpG sites as transitional events. The 15 CpG sites in the coding sequences of exons 1 and 2, which are normally hypomethylated, account for very few of transitional mutations. By contrast, the CpG sites in the coding sequences of exon 3, though also normally hypomethylated, account for much higher fraction of transitional mutations.
    [Show full text]
  • Lecture #1: Introduction Syllabus Introduction to Biology
    Special Topics in Computational Biology Lecture #1: Introduction Bud Mishra Professor of Computer Science and Mathematics 1 ¦ 25 ¦ 2001 Syllabus • Introductory Material – What do we know? – Biological information – Biotechnology (e.g. arrays, PCR, hybridization; single molecules; mass spectrometry) – Some biology (terminology) • Population Genetics – Diseases – Linkage analysis – Kinship analysis • Comparative Genomics – Phylogeny – Gene rearrangements between species – Gene families within specie • Functional Genomics – Taking cells at different stages of development, what can we infer from gene expression levels data? Can we determine the sequence of gene activation? Tools that allow biologists to try to answer these questions.) – Genetic Networks – Clustering algorithms • Proteomics • Cancer Genomics – (What can be done here) Introduction to Biology • Genome: – Hereditary information of an organism is encoded in its DNA and enclosed in a cell (unless it is a virus). All the information contained in the DNA of a single organism is its genome. • DNA molecule can be thought of as a very long sequence of nucleotides or bases: = {A, T, C, G} Complementarity • DNA is a double-stranded polymer and should be thought of as a pair of sequences over . However, there is a relation of complementarity between the two sequences: – A , T, C , G – That is if there is an A (respectively, T, C, G) on one sequence at a particular position then the other sequence must have a T (respectively, A, G, C) at the same position. • We will measure the sequence length (or the DNA length) in terms of base pairs (bp): for instance, human (H. sapiens) DNA is 3.3 £ 109 bp measuring about 6 ft of DNA polymer completely stretched out! Genome Size The genomes vary widely in size: measuring from » 11 • Few thousand base pairs for viruses to 2 » 3 £ 10 bp for certain amphibian and flowering plants.
    [Show full text]
  • Control of Gene Expression
    Control of! Gene Expression Heterochromatin vs Euchromatin • heterochromatin • euchromatin – tight coils of DNA – loose coils of DNA Regulatory Elements in Gene Expression • promoter (TATA) • transcription factors • enhancers/activators • repressors Prok vs Euk ! DNA arrangement 1. 1x circular DNA 1. multiple, linear chs 2. 1x origin of 2. multiple origins replication 3. no operons 3. operon control 4. many introns 4. no introns 5. modifications (*methylation) 6. transposons Prok vs Euk ! Transcription & Translation 1. tcn & tln in cytoplasm 1. tcn (nucleus); tln (cytoplasm) 2. no post-transcriptional 2. post-transcriptional modifications modifications (methylation, 5’cap & 3’tail) 3. no introns 3. introns spliced out 4. 70S ribosome 4. 80S ribosome • RNA polymerase • aminoacyl synthase (adds aa to tRNA) • transcription factors • peptidyl transferase (makes peptide bonds) lac Operon • inducible – always “OFF” (negative control) • turned ON by inducer (lactose); inactivates the repressor lac Operon - cast of characters • promotor TATA box, transcription factors, RNA polymerase • lacI – gene for repressor • lacZ, lacY, and lacA - genes for metabolizing lactose (galactosidase, permease, transacetylase) • inducer - lactose sugar trp Operon • repressible – always “ON” (positive control) • turned OFF by negative feedback - product tryptophan binds to repressor lac Operon model *grocery shopping • repressor – credit card bill • inducer – paycheck • gene A – taking money out of an ATM • gene B – driving to a supermarket • gene C – pushing a shopping
    [Show full text]
  • The Symmetry of the Yeast U6 RNA Gene's TATA Box and the Orientation of the TATA-Binding Protein in Yeast TFIIIB
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press The symmetry of the yeast U6 RNA gene's TATA box and the orientation of the TATA-binding protein in yeast TFIIIB Simon K. whitehall,' George A. Kassavetis, and E. Peter Geiduschek Department of Biology and Center for Molecular Genetics, University of California at San Diego, La Jolla, California 92093-0634 USA The central RNA polymerase I11 (Pol 111) transcription factor TFIIIB is composed of the TATA-binding protein (TBP), Brf, a protein related to TFIIB, and the product of the newly cloned TFC5 gene. TFIIIB assembles autonomously on the upstream promoter of the yeast U6 snRNA (SNR6)gene in vitro, through the interaction of its TBP subunit with a consensus TATA box located at base pair -30. As both the DNA-binding domain of TBP and the U6 TATA box are nearly twofold symmetrical, we have examined how the binding polarity of TFIIIB is determined. We find that TFIIIB can bind to the U6 promoter in both directions, that TBP is unable to discern the natural polarity of the TATA element and that, as a consequence, the U6 TATA box is functionally symmetrical. A modest preference for TFIIIB binding in the natural direction of the U6 promoter is instead dictated by flanking DNA. Because the assembly of TFIIIB on the yeast U6 gene in vivo occurs via a TFIIIC-dependent mechanism, we investigated the influence of TFIIIC on the binding polarity of TFIIIB. TFIIIC places TFIIIB on the promoter in one direction only; thus, it is TFIIIC that primarily specifies the direction of transcription.
    [Show full text]
  • Antisense Rnas During Early Vertebrate Development Are Divided in Groups with Distinct Features
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Research Antisense RNAs during early vertebrate development are divided in groups with distinct features Sanjana Pillay,1 Hazuki Takahashi,2 Piero Carninci,2,3 and Aditi Kanhere4,5 1Department of Cell, Developmental and Regenerative Biology, Mount Sinai School of Medicine, New York, New York 10029, USA; 2Laboratory for Transcriptome Technology, RIKEN Center for Integrative Medical Sciences, Yokohama, Kanagawa, 230-0045, Japan; 3Fondazione Human Technopole, 20157 Milan, Italy; 4Institute of Systems, Molecular and Integrative Biology, University of Liverpool, Liverpool, L69 3GE, United Kingdom Long noncoding RNAs or lncRNAs are a class of non-protein-coding RNAs that are >200 nt in length. Almost 50% of lncRNAs during zebrafish development are transcribed in an antisense direction to a protein-coding gene. However, the role of these natural antisense transcripts (NATs) during development remains enigmatic. To understand NATs in early vertebrate development, we took a computational biology approach and analyzed existing as well as novel data sets. Our analysis indicates that zebrafish NATs can be divided into two major classes based on their coexpression patterns with re- spect to the overlapping protein-coding genes. Group 1 NATs have characteristics similar to maternally deposited RNAs in that their levels decrease as development progresses. Group 1 NAT levels are negatively correlated with that of overlapping sense-strand protein-coding genes. Conversely, Group 2 NATs are coexpressed with overlapping protein-coding genes. In contrast to Group 1, which is enriched in genes involved in developmental pathways, Group 2 protein-coding genes are en- riched in housekeeping functions.
    [Show full text]
  • UN2005/UN2401 '20 -- Lecture # 13 -- RNA & Protein Synthesis 0. Energy Poll (#1 of Last Time) Revisited II . Central Dogma
    UN2005/UN2401 '20 -- Lecture # 13 -- RNA & Protein Synthesis (c) 2020 Mowshowitz Department of Biological Sciences Columbia University New York, NY. Last revised 10/22/20 Handouts: You will need 12 A – PCR 13 A -- code table & tRNA structure 13 B -- DNA synthesis vs RNA synthesis PDFs are linked to the Handouts page. Note that Dr. Mary Ann Price has made videos of all class demonstrations; see the videos link on the Course Menu. (We also have 2 older videos of protein synthesis; links are below.) 0. Energy Poll (#1 of last time) Revisited Qs: How many ATPs are used and how many ‘high energy bonds’ are broken to add one dCMP to a growing chain? Ans: It takes two ATP but >2 high energy bonds. Details: 1. Two high energy bonds (in ATP) are broken to convert dCMP to dCTP. This is not a net change, but involves the breaking of 2 high energy bonds (in the ATP) to form 2 (in the dCTP). 2. Then two P's in the dCTP are knocked off in two steps, breaking two high energy bonds. (First, the bond between the inner P and the other 2 is broken, and PPi is released. Then the bond between the two 2 P's in PPi is broken.) P = phosphate. 3. Overall: Four high energy bonds are broken, but two are made, for a net change of 2. So 4 high energy bonds are broken, but only 2 high energy bonds are used up (net), More Q to think about: 1. How come the same enzyme can catalyze a reaction in both directions? Say A B and B A? 2.
    [Show full text]
  • Identification of Novel Non-Coding RNA-Based Negative Feedback Regulating the Expression of the Oncogenic Transcription Factor GLI1
    Accepted Manuscript Identification of novel non-coding RNA-based negative feedback regulating the expression of the oncogenic transcription factor GLI1 Victoria E. Villegas, Mohammed Ferdous-Ur Rahman, Maite G. Fernandez-Barrena, Yumei Diao, Eleni Liapi, Enikö Sonkoly, Mona Ståhle, Andor Pivarcsi, Laura Annaratone, Anna Sapino, Sandra Ramírez Clavijo, Thomas R. Bürglin, Takashi Shimokawa, Saraswathi Ramachandran, Philipp Kapranov, Martin E. Fernandez- Zapico, Peter G. Zaphiropoulos PII: S1574-7891(14)00057-X DOI: 10.1016/j.molonc.2014.03.009 Reference: MOLONC 487 To appear in: Molecular Oncology Received Date: 16 November 2013 Revised Date: 18 February 2014 Accepted Date: 11 March 2014 Please cite this article as: Villegas, V.E., Ferdous-Ur Rahman, M., Fernandez-Barrena, M.G., Diao, Y., Liapi, E., Sonkoly, E., Ståhle, M., Pivarcsi, A., Annaratone, L., Sapino, A., Ramírez Clavijo, S., Bürglin, T.R., Shimokawa, T., Ramachandran, S., Kapranov, P., Fernandez-Zapico, M.E., Zaphiropoulos, P.G., Identification of novel non-coding RNA-based negative feedback regulating the expression of the oncogenic transcription factor GLI1, Molecular Oncology (2014), doi: 10.1016/j.molonc.2014.03.009. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT Identification of novel non-coding RNA-based negative feedback regulating the expression of the oncogenic transcription factor GLI1 Victoria E.Villegas 1,2§ , Mohammed Ferdous-Ur Rahman 1§ , Maite G.
    [Show full text]