DOCSLIB.ORG

The Role and Regulation of Histone H2B Monoubiquitination During Tumorigenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role and Regulation of Histone H2B Monoubiquitination During Tumorigenesis The role and regulation of histone H2B monoubiquitination during tumorigenesis Dissertation for the award of the degree “Doctor rerum naturalium (Dr. rer. nat.)“ Division of Mathematics and Natural Sciences of the Georg-August-Universität Göttingen submitted by Theresa Gorsler born in Leinefelde Hamburg, 2013 Members of the Thesis Committee: Prof. Dr. Steven A. Johnsen (Reviewer) Department of Tumor Biology University Medical Center Hamburg-Eppendorf, Hamburg Prof. Dr. Holger Reichardt (Reviewer) Department of Cellular and Molecular Immunology University of Göttingen Medical School, Göttingen Prof. Dr. Dieter Kube Department of Immunology and Experimental Oncology University of Göttingen Medical School, Göttingen Date of the oral examination: 3rd of june 2013 Affidavit I hereby declare that the PhD thesis entitled “The role and regulation of histone H2B monoubiquitination during tumorigenesis” has been written independently and with no other sources and aids than quoted. _____________________________ Theresa Gorsler April, 2013 Hamburg Table of Contents Abbreviations ............................................................................................... I List of Figures ............................................................................................ VI Summary ................................................................................................. VIII 1 Introduction .............................................................................................. 1 1.1 Chromatin structure ................................................................................................ 1 1.2 Histone modifications ............................................................................................. 2 1.2.1 “Histone code” ................................................................................................. 4 1.2.2 Misregulation of histone modifications ............................................................. 5 1.2.3 Histone monoubiquitination .............................................................................. 6 1.2.3.1 Histone H2Bub1 .................................................................................................................... 7 1.3 Functional role of H2B monoubiquitination ............................................................. 9 1.3.1 H2Bub1 and transcription ................................................................................ 9 1.3.2 Cellular functions of the H2Bub1 in yeast ...................................................... 10 1.3.3 The role of H2Bub1 in higher eukaryotes ....................................................... 11 1.3.4 Genome-wide distribution of H2Bub1 ............................................................ 13 1.3.5 H2Bub1 and its regulation in human cancer .................................................. 14 1.4 Histone H2B deubiquitination ............................................................................... 14 1.4.1 The SAGA complex ....................................................................................... 15 1.4.1.1 USP22 as the main deubiquitinase for H2B ........................................................................ 16 1.4.1.2 The SAGA deubiquitination module .................................................................................... 17 1.4.1.3 Other H2Bub1 deubiquitinases ........................................................................................... 18 1.5 Nucleoli and stress conditions .............................................................................. 19 1.5.1 Nucleoli .......................................................................................................... 19 1.5.2 Nucleolar reaction to stress ........................................................................... 19 1.5.3 Nucleoli and JNK signaling ............................................................................ 20 1.5.4 AMPK signaling in tumorigenesis and tumor metabolism .............................. 21 2 Materials ................................................................................................ 22 2.1 Technical equipment ............................................................................................ 22 2.2 Consumable materials ......................................................................................... 23 2.3 Chemicals ............................................................................................................ 24 2.3.1 General chemicals ......................................................................................... 24 2.3.2. Inhibitors ....................................................................................................... 28 2.4 Kits and reagents ................................................................................................. 28 2.5 Nucleic acids ........................................................................................................ 29 2.5.1 Vectors and expression constructs ................................................................ 29 2.5.2 Oligonucleotides ............................................................................................ 29 2.5.2.1 siRNA oligonucleotides ........................................................................................................ 29 2.5.2.2 RT-PCR primers .................................................................................................................... 31 2.5.2.3 qPCR primers ....................................................................................................................... 31 2.5.2.4 ChIP primers ........................................................................................................................ 32 2.5.2.4 Primers for ChIP-seq library preparation ............................................................................ 32 2.6 Proteins ................................................................................................................ 33 2.6.1 Molecular weight standards ........................................................................... 33 2.6.2 Enzymes ........................................................................................................ 33 2.6.3 Antibodies ...................................................................................................... 34 2.6.3.1 Primary antibodies .............................................................................................................. 34 2.6.3.2 Secondary antibodies .......................................................................................................... 35 2.7 Cells ..................................................................................................................... 35 2.7.1 Bacteria cells ................................................................................................. 35 2.7.2 Eukaryotic cell lines ....................................................................................... 35 2.8 Buffers and solutions ............................................................................................ 36 2.9 Software ............................................................................................................... 42 3 Methods................................................................................................. 43 3.1 Cell culture ........................................................................................................... 43 3.1.1 Culturing cells ................................................................................................ 43 3.1.2 Reverse-transfection with siRNA ................................................................... 43 3.1.3 Colony formation assay ................................................................................. 43 3.1.4 Migration assay .............................................................................................. 44 3.1.5 Measurement of DNA of single cells by flow cytometry ................................. 44 3.1.6 ATP determination assay ............................................................................... 45 3.2. Molecular biology ................................................................................................ 45 3.2.1 RNA isolation ................................................................................................. 45 3.2.2 cDNA synthesis.............................................................................................. 45 3.2.3 Quantitative real-time PCR ............................................................................ 46 3.2.4 Microarray analyses ....................................................................................... 46 3.2.5 Chromatin immunoprecipitation (ChIP) .......................................................... 48 3.2.6 Chromatin immunoprecipitation-sequencing (ChIP-Seq) ............................... 49 3.3 Protein biochemistry ............................................................................................. 53 3.3.1 SDS-PAGE .................................................................................................... 53 3.3.2 Western blot analysis ..................................................................................... 53 3.3.3 In vitro deubiquitination assay ........................................................................ 53 3.3.4 Immunohistochemistry on paraffin sections ..................................................
Load more

Recommended publications
  • FACT Sets a Barrier for Cell Fate Reprogramming in C. Elegans and Human
    bioRxiv preprint doi: https://doi.org/10.1101/185116; this version posted September 6, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. FACT sets a barrier for cell fate reprogramming in C. elegans and Human Authors: Ena Kolundzic1, Andreas Ofenbauer1, Bora Uyar1, Anne Sommermeier1,2, Stefanie Seelk1, Mei He1, Gülkiz Baytek1, Altuna Akalin1, Sebastian Diecke1,3*, Scott A. Lacadie1,3*, Baris Tursun1* Affiliations: 1Berlin Institute for Medical Systems Biology, Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Berlin, Germany; 2Department of Biology, Humboldt University, Berlin, Germany; 3 Berlin Institute of Health, Berlin, Germany *Correspondence to: [email protected] (BT), [email protected] (SL), [email protected] (SD) Lead Contact: [email protected] (BT) 1 bioRxiv preprint doi: https://doi.org/10.1101/185116; this version posted September 6, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Summary: The chromatin regulator FACT (Facilitates Chromatin Transcription) is essential for ensuring stable gene expression by promoting transcription. In a genetic screen using C. elegans we identified that FACT maintains cell identities and acts as a barrier for transcription factor-mediated cell fate reprogramming. Strikingly, FACT’s role as a reprogramming barrier is conserved in humans as we show that FACT depletion enhances reprogramming of fibroblasts into stem cells and neurons. Such activity of FACT is unexpected since known reprogramming barriers typically repress gene expression by silencing chromatin.
    [Show full text]
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • SUPT6H Controls Estrogen Receptor Activity and Cellular Differentiation by Multiple Epigenomic Mechanisms
    Oncogene (2015) 34, 465–473 & 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE SUPT6H controls estrogen receptor activity and cellular differentiation by multiple epigenomic mechanisms U Bedi1,2, AH Scheel3,4, M Hennion2, Y Begus-Nahrmann2,JRu¨ schoff3 and SA Johnsen1,2 The estrogen receptor alpha (ERa) is the central transcriptional regulator of ductal mammary epithelial lineage specification and is an important prognostic marker in human breast cancer. Although antiestrogen therapies are initially highly effective at treating ERa-positive tumors, a large number of tumors progress to a refractory, more poorly differentiated phenotype accompanied by reduced survival. A better understanding of the molecular mechanisms involved in the progression from estrogen-dependent to hormone-resistant breast cancer may uncover new targets for treatment and the discovery of new predictive markers. Recent studies have uncovered an important role for transcriptional elongation and chromatin modifications in controlling ERa activity and estrogen responsiveness. The human Suppressor of Ty Homologue-6 (SUPT6H) is a histone chaperone that links transcriptional elongation to changes in chromatin structure. We show that SUPT6H is required for estrogen-regulated transcription and the maintenance of chromatin structure in breast cancer cells, possibly in part through interaction with RNF40 and regulation of histone H2B monoubiquitination (H2Bub1). Moreover, we demonstrate that SUPT6H protein levels decrease with malignancy in breast cancer. Consistently, SUPT6H, similar to H2Bub1, is required for cellular differentiation and suppression of the repressive histone mark H3K27me3 on lineage-specific genes. Together, these data identify SUPT6H as a new epigenetic regulator of ERa activity and cellular differentiation.
    [Show full text]
  • Differential Expression of Multiple Disease-Related Protein Groups
    brain sciences Article Differential Expression of Multiple Disease-Related Protein Groups Induced by Valproic Acid in Human SH-SY5Y Neuroblastoma Cells 1,2, 1, 1 1 Tsung-Ming Hu y, Hsiang-Sheng Chung y, Lieh-Yung Ping , Shih-Hsin Hsu , Hsin-Yao Tsai 1, Shaw-Ji Chen 3,4 and Min-Chih Cheng 1,* 1 Department of Psychiatry, Yuli Branch, Taipei Veterans General Hospital, Hualien 98142, Taiwan; [email protected] (T.-M.H.); [email protected] (H.-S.C.); [email protected] (L.-Y.P.); fi[email protected] (S.-H.H.); [email protected] (H.-Y.T.) 2 Department of Future Studies and LOHAS Industry, Fo Guang University, Jiaosi, Yilan County 26247, Taiwan 3 Department of Psychiatry, Mackay Medical College, New Taipei City 25245, Taiwan; [email protected] 4 Department of Psychiatry, Taitung Mackay Memorial Hospital, Taitung County 95064, Taiwan * Correspondence: [email protected]; Tel.: +886-3888-3141 (ext. 475) These authors contributed equally to this work. y Received: 10 July 2020; Accepted: 8 August 2020; Published: 12 August 2020 Abstract: Valproic acid (VPA) is a multifunctional medication used for the treatment of epilepsy, mania associated with bipolar disorder, and migraine. The pharmacological effects of VPA involve a variety of neurotransmitter and cell signaling systems, but the molecular mechanisms underlying its clinical efficacy is to date largely unknown. In this study, we used the isobaric tags for relative and absolute quantitation shotgun proteomic analysis to screen differentially expressed proteins in VPA-treated SH-SY5Y cells. We identified changes in the expression levels of multiple proteins involved in Alzheimer’s disease, Parkinson’s disease, chromatin remodeling, controlling gene expression via the vitamin D receptor, ribosome biogenesis, ubiquitin-mediated proteolysis, and the mitochondrial oxidative phosphorylation and electron transport chain.
    [Show full text]
  • Comparative Analyses of Long Non-Coding RNA in Lean and Obese Pigs
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 25), pp: 41440-41450 Research Paper Comparative analyses of long non-coding RNA in lean and obese pigs Lin Yu1, Lina Tai1, Lifang Zhang1, Yi Chu1, Yixing Li1 and Lei Zhou1 1State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of Animal Science and Technology, Guangxi University, Nanning, P.R. China Correspondence to: Yixing Li, email: [email protected] Lei Zhou, email: [email protected] Keywords: lncRNA, pig, obesity, QTL Received: April 28, 2017 Accepted: May 15, 2017 Published: May 26, 2017 Copyright: Yu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Objectives: Current studies have revealed that long non-coding RNA plays a crucial role in fat metabolism. However, the difference of lncRNA between lean (Duroc) and obese (Luchuan) pig remain undefined. Here, we investigated the expressional profile of lncRNA in these two pigs and discussed the relationship between lncRNA and fat deposition. Materials and Methods: The Chinese Luchuan pig has a dramatic differences in backfat thickness as compared with Duroc pig. In this study, 4868 lncRNA transcripts (including 3235 novel transcripts) were identified. We determined that patterns of differently expressed lncRNAs and mRNAs are strongly tissue-specific. The differentially expressed lncRNAs in adipose tissue have 794 potential target genes, which are involved in adipocytokine signaling pathways, the PI3k-Akt signaling pathway, and calcium signaling pathways.
    [Show full text]
  • Prenatal Diagnosis of Maternal Partial Trisomy 9P23p24.3 and 14Q11.2Q21.3 in a Fetus: a Case Report J
    Wu et al. Molecular Cytogenetics (2020) 13:6 https://doi.org/10.1186/s13039-020-0473-x CASE REPORT Open Access Prenatal diagnosis of maternal partial trisomy 9p23p24.3 and 14q11.2q21.3 in a fetus: a case report J. B. Wu1†, J. Sha1†, J. F. Zhai1*, Y. Liu2 and B. Zhang1 Abstract Objective: This study aimed to report a fetus with maternal partial trisomy 9p and 14q and the phenotype detected in ultrasound. Methods: The chromosome rearrangements in the fetus were characterized by G-banding and chromosome microarray analysis based on single nucleotide polymorphism (SNP) array of cultured amniocytes and compared with the parents’ karyotypes. Results: The fetal abnormal karyotype was 47,XY,+der(14)(9;14)(p23;q22). The SNP array revealed a duplicate 11.8- Mb 9p23-p24.3 fragment and a duplicate 29.6-Mb 14q11.2-q21.3 fragment. The peripheral blood karyotype of the mother was 46,XX,t(9;14)(p23;q22), while the father’s was normal at the level of 300~400 bands. A high-resolution karyotype analysis conformed the same abnormality of the mother at the level of 550~650 bands. These results indicated that the fetal chromosomal abnormality probably derived from the mother. The fetal nuchal translucency thickness was 3.5 mm, and the fetal heart was detected with around 1.0-mm ventricular defect by the ultrasound examination at 12-week gestation. The couple decided to terminate the pregnancy. They opted for in vitro fertilization and embryo transfer for the fourth pregnancy, which was successful. Conclusions: The SNP array combined with cytogenetic analysis was particularly effective in identifying abnormal chromosomal rearrangements.
    [Show full text]
  • Histone Monoubiquitination in Chromatin Remodelling: Focus on the Histone H2B Interactome and Cancer
    cancers Review Histone Monoubiquitination in Chromatin Remodelling: Focus on the Histone H2B Interactome and Cancer Deborah J. Marsh 1,2,* , Yue Ma 1 and Kristie-Ann Dickson 1 1 Translational Oncology Group, Faculty of Science, School of Life Sciences, University of Technology Sydney, Ultimo, NSW 2007, Australia; [email protected] (Y.M.); [email protected] (K.-A.D.) 2 Kolling Institute, Faculty of Medicine and Health, Northern Clinical School, University of Sydney, Camperdown, NSW 2006, Australia * Correspondence: [email protected]; Tel.: +61-2-9514-7574 Received: 17 October 2020; Accepted: 17 November 2020; Published: 20 November 2020 Simple Summary: Post-translational modifications (PTM) of histone tails represent epigenomic regulation of the chromatin landscape, influencing gene expression and the response to DNA damage. This review focusses on cancer-associated roles of ubiquitin as a histone PTM, specifically in conjunction with an E3 ubiquitin ligase cascade that results in the addition of a single ubiquitin (monoubiquitination) to histone H2B at lysine 120 (H2Bub1). H2Bub1 has roles in chromatin accessibility important for transcriptional elongation, the DNA damage response, cellular proliferation and developmental transitions, including in stem cell plasticity. It has been implicated in inflammation and tumour progression, with examples of its loss associated with a worse prognosis for patients with some cancers. Many factors involved in the H2Bub1 interactome are well known cancer-associated proteins, including p53, BRCA1 and components of the SWI/SNF remodelling complex. Increased knowledge of H2Bub1 and its interactome offers new opportunities for therapeutic targeting of malignancy. Abstract: Chromatin remodelling is a major mechanism by which cells control fundamental processes including gene expression, the DNA damage response (DDR) and ensuring the genomic plasticity required by stem cells to enable differentiation.
    [Show full text]
  • Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham a Thesis Submitted in Conformity
    Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Edward James Higginbotham 2020 i Abstract Characterizing Genomic Duplication in Autism Spectrum Disorder Edward James Higginbotham Master of Science Graduate Department of Molecular Genetics University of Toronto 2020 Duplication, the gain of additional copies of genomic material relative to its ancestral diploid state is yet to achieve full appreciation for its role in human traits and disease. Challenges include accurately genotyping, annotating, and characterizing the properties of duplications, and resolving duplication mechanisms. Whole genome sequencing, in principle, should enable accurate detection of duplications in a single experiment. This thesis makes use of the technology to catalogue disease relevant duplications in the genomes of 2,739 individuals with Autism Spectrum Disorder (ASD) who enrolled in the Autism Speaks MSSNG Project. Fine-mapping the breakpoint junctions of 259 ASD-relevant duplications identified 34 (13.1%) variants with complex genomic structures as well as tandem (193/259, 74.5%) and NAHR- mediated (6/259, 2.3%) duplications. As whole genome sequencing-based studies expand in scale and reach, a continued focus on generating high-quality, standardized duplication data will be prerequisite to addressing their associated biological mechanisms. ii Acknowledgements I thank Dr. Stephen Scherer for his leadership par excellence, his generosity, and for giving me a chance. I am grateful for his investment and the opportunities afforded me, from which I have learned and benefited. I would next thank Drs.
    [Show full text]
  • A Role for the RNA Pol II–Associated PAF Complex in AID-Induced Immune Diversification
    Article A role for the RNA pol II–associated PAF complex in AID-induced immune diversification Katharina L. Willmann,1,2 Sara Milosevic,4 Siim Pauklin,1 Kerstin-Maike Schmitz,2 Gopinath Rangam,1,2 Maria T. Simon,1 Sarah Maslen,3 Mark Skehel,3 Isabelle Robert,4 Vincent Heyer,4 Ebe Schiavo,4 Bernardo Reina-San-Martin,4 Svend K. Petersen-Mahrt1,2 1DNA Editing Laboratory, London Research Institute, South Mimms EN6 3LD, England, UK 2DNA Editing in Immunity and Epigenetics, IFOM-Fondazione Instituto FIRC di Oncologia Molecolare, Via Adamello 16, 20139 Milano, Italy 3Protein Analysis and Proteomics Laboratory, London Research Institute, South Mimms EN6 3LD, England, UK 4Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Institut National de la Santé et de la Recherche Médicale (INSERM) U964, Centre National de la Recherche Scientifique (CNRS) UMR7104, Université de Strasbourg, 67404 Illkirch, France Antibody diversification requires the DNA deaminase AID to induce DNA instability at immunoglobulin (Ig) loci upon B cell stimulation. For efficient cytosine deamination, AID requires single-stranded DNA and needs to gain access to Ig loci, with RNA pol II transcrip- tion possibly providing both aspects. To understand these mechanisms, we isolated and characterized endogenous AID-containing protein complexes from the chromatin of diversi- fying B cells. The majority of proteins associated with AID belonged to RNA polymerase II elongation and chromatin modification complexes. Besides the two core polymerase sub- units, members of the PAF complex, SUPT5H, SUPT6H, and FACT complex associated with AID. We show that AID associates with RNA polymerase-associated factor 1 (PAF1) through its N-terminal domain, that depletion of PAF complex members inhibits AID-induced immune diversification, and that the PAF complex can serve as a binding platform for AID on chromatin.
    [Show full text]
  • Differences in Methylation Patterns in the Methylation Boundary Region of IDS Gene in Hunter Syndrome Patients: Implications for Cpg Hot Spot Mutations
    European Journal of Human Genetics (2006) 14, 838–845 & 2006 Nature Publishing Group All rights reserved 1018-4813/06 $30.00 www.nature.com/ejhg ARTICLE Differences in methylation patterns in the methylation boundary region of IDS gene in hunter syndrome patients: implications for CpG hot spot mutations Shunji Tomatsu*,1, Kazuko Sukegawa2, Georgeta G Trandafirescu1, Monica A Gutierrez1, Tatsuo Nishioka1, Seiji Yamaguchi3, Tadao Orii2, Roseline Froissart4, Irene Maire4, Amparo Chabas5, Alan Cooper6, Paola Di Natale7, Andreas Gal8, Akihiko Noguchi1 and William S Sly9 1Department of Pediatrics, Saint Louis University, Pediatric Research Institute, St Louis, MO, USA; 2Department of Pediatrics, Gifu University School of Medicine, Gifu, Japan; 3Department of Pediatrics, Shimane University, Shimane, Japan; 4Centre d’Etude des Maladies Me´taboliques, Hoˆpital Debrousse, Lyon France; 5Institut de Bioquimica Clinica, Barcelona, Spain; 6Willink Biochemical Genetics Unit, Royal Manchester Children’s Hospital, Great Britain, UK; 7Department of Biochemistry and Medical Biotechnologies, University of Naples, Federico II, Italy; 8Institut fur Humangenetik, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany; 9Edward A. Doisy Department of Biochemistry and Molecular Biology, Saint Louis University School of Medicine, St Louis, MO, USA Hunter syndrome, an X-linked disorder, results from deficiency of iduronate-2-sulfatase (IDS). Around 40% of independent point mutations at IDS were found at CpG sites as transitional events. The 15 CpG sites in the coding sequences of exons 1 and 2, which are normally hypomethylated, account for very few of transitional mutations. By contrast, the CpG sites in the coding sequences of exon 3, though also normally hypomethylated, account for much higher fraction of transitional mutations.
    [Show full text]
  • Lecture #1: Introduction Syllabus Introduction to Biology
    Special Topics in Computational Biology Lecture #1: Introduction Bud Mishra Professor of Computer Science and Mathematics 1 ¦ 25 ¦ 2001 Syllabus • Introductory Material – What do we know? – Biological information – Biotechnology (e.g. arrays, PCR, hybridization; single molecules; mass spectrometry) – Some biology (terminology) • Population Genetics – Diseases – Linkage analysis – Kinship analysis • Comparative Genomics – Phylogeny – Gene rearrangements between species – Gene families within specie • Functional Genomics – Taking cells at different stages of development, what can we infer from gene expression levels data? Can we determine the sequence of gene activation? Tools that allow biologists to try to answer these questions.) – Genetic Networks – Clustering algorithms • Proteomics • Cancer Genomics – (What can be done here) Introduction to Biology • Genome: – Hereditary information of an organism is encoded in its DNA and enclosed in a cell (unless it is a virus). All the information contained in the DNA of a single organism is its genome. • DNA molecule can be thought of as a very long sequence of nucleotides or bases: = {A, T, C, G} Complementarity • DNA is a double-stranded polymer and should be thought of as a pair of sequences over . However, there is a relation of complementarity between the two sequences: – A , T, C , G – That is if there is an A (respectively, T, C, G) on one sequence at a particular position then the other sequence must have a T (respectively, A, G, C) at the same position. • We will measure the sequence length (or the DNA length) in terms of base pairs (bp): for instance, human (H. sapiens) DNA is 3.3 £ 109 bp measuring about 6 ft of DNA polymer completely stretched out! Genome Size The genomes vary widely in size: measuring from » 11 • Few thousand base pairs for viruses to 2 » 3 £ 10 bp for certain amphibian and flowering plants.
    [Show full text]