Systematic and phylogeographic implications of molecular variation in the western North American roseroot, Rhodiola integrifolia (Crassulaceae).
by
Heidi J. Guest B.Sc. University of Victoria, 2001
Thesis submitted in Partial Fulfillment of the Requirements for the Degree of
MASTER OF SCIENCE
in the Department of Biology
© Heidi J. Guest, 2009 University of Victoria
All rights reserved. This thesis may not be reproduced in whole or in part, by photocopying or other means, without the permission of the author. ii
Systematic and phylogeographic implications of molecular variation in the western North American roseroot, Rhodiola integrifolia (Crassulaceae).
by
Heidi J. Guest B.Sc. University of Victoria, 2001
Supervisory Committee
Dr. Geraldine A. Allen, Supervisor (Department of Biology)
Dr. Barbara Hawkins, Departmental Member (Department of Biology)
Dr. John Taylor, Departmental Member (Department of Biology)
Dr. Ken Marr, Additional Member (Royal British Columbia Museum) iii
Supervisory Committee
Dr. Geraldine A. Allen, Supervisor (Department of Biology)
Dr. Barbara Hawkins, Departmental Member (Department of Biology)
Dr. John Taylor, Departmental Member (Department of Biology)
Dr. Ken Marr, Additional Member (Royal British Columbia Museum)
Abstract
The roseroot genus Rhodiola is widely distributed in arctic and alpine areas of the Northern Hemisphere. It is most speciose in the high mountain ranges of central Asia. Rhodiola integrifolia occurs at high altitudes and high latitudes in western North America and northeastern Asia. During the Pleistocene glaciations the region between Asia and North America known as Beringia was ice free and acted as a glacial refugium for cold- adapted taxa. I surveyed variation in a nuclear (ITS) and chloroplast (psbA-trnH spacer) DNA region in R. integrifolia and its North American relatives, R. rosea and R. rhodantha. Phylogenetic analyses based on ITS showed that (i) the western North American species R. integrifolia and R. rhodantha are distinct but closely related sister taxa; and (ii) these two species and the eastern North American R. rosea belong to separate clades within Rhodiola. Analyses of the plastid region showed that although the iv sister species R. integrifolia and R. rhodantha are distinct, some populations sampled in the southern Rocky Mountains (where the two species overlap) share psbA-trnH haplotypes, suggesting that they hybridized at some time in the past. Within R. integrifolia, both nuclear and plastid DNA regions showed strong north-south patterns of differentiation, a pattern consistent with western North America’s glacial history. Restriction site analysis and sequencing of the plastid psbA-trnH spacer region from samples from 66 populations of R. integrifolia revealed 12 restriction-site haplotypes and 28 sequence haplotypes. A few of the sequence haplotypes were widely distributed, but most were relatively localized. Of the localized haplotypes, 10 were exclusively Beringian and an additional four were found along the northern boundary of glaciation (at the last glacial maximum) in the Yukon and Alaska; two haplotypes were found in northern coastal BC (Queen Charlotte Islands and adjacent mainland), in the vicinity of possible glacial refugia on the Queen Charlotte Islands. Only five haplotypes occurred exclusively south of the glacial maximum. Haplotype diversity in R. integrifolia decreased toward the south. Populations north of 60 N contained 21 (75%) of the 28 sequence haplotypes, and often contained multiple restriction-site haplotypes. Populations south of that latitude contained a total of only 13 restriction haplotypes, and were usually monomorphic for restriction-site haplotypes. Phylogenetic analyses of R. integrifolia plastid DNA sequences supported a hypothesis of southward spread from Alaska, and suggested that two to three clades of R. integrifolia independently migrated southward in western North America. v
Table of Contents
Supervisory Committee...... ii Abstract...... iii Table of Contents...... v List of Tables ...... viii List of Figures ...... ix Acknowledgements ...... x Dedication ...... xi Chapter 1: INTRODUCTION 1.1 Climatic and Glacial History of Western North America ...... 1 1.2 Phylogeography and Plant Molecular Markers...... 6 1.3 The Study Species, Rhodiola integrifolia...... 8 1.4 Objectives ...... 12 Chapter 2: METHODS 2.1 Collection of Plant Material...... 13 2.2 DNA Extraction ...... 20 2.3 DNA Regions Sampled ...... 20 2.3.1 Nuclear DNA: ITS ...... 20 2.3.2 CpDNA Markers/Regions ...... 21 2.3.2.1 Screening of Chloroplast DNA Markers/Regions...... 21 2.3.2.2 Amplification and Sequencing of PsbA-trnH Region. 22 2.3.2.3 RFLP Sampling of the PsbA-trnH Region...... 26 2.3.2.4 Restriction Site Haplotype Determination...... 27 2.4 Data Analyses ...... 29 2.4.1 Phylogenetic Analyses ...... 29 2.4.1.1 Sequence Assembly and Alignment...... 29 2.4.1.2 ITS Analyses...... 29 2.4.1.2.1. Maximum Parsimony and Maximum Likelihood Analyses using PAUP ...... 30 vi
2.4.1.3 Chloroplast DNA Analyses...... 32 2.4.2 Haplotype Network Estimation ...... 33 2.4.3 Nested Clade Phylogeographic Analysis of RFLP data...... 35 2.4.4 Geographic Mapping of CpDNA Haplotypes ...... 36
Chapter 3: RESULTS 3.1 ITS Sequence Analyses and Relationships in Rhodiola...... 38 3.1.1 Summary of ITS Sequence Variation...... 38 3.1.2 Phylogenetic Analyses of the ITS Region of the Nuclear Genome ...... 38 3.1.3 Geographic Distributions of ITS Sequence Variants of R. integrifolia and R. rhodantha...... 43 3.2 Chloroplast DNA Sequence Analyses and Comparison of Nuclear and Chloroplast Phylogenies...... 43 3.2.1 Summary of PsbA-trnH Sequence Variation...... 43 3.2.2 Phylogenetic Analyses of the PsbA-trnH Region of the CpDNA...... 45 3.2.3 Comparison of Nuclear and Chloroplast Genome Sequences ...... 46 3.3 Chloroplast DNA Patterns and the Phylogeography of R. integrifolia.... 49 3.3.1 Restriction enzyme haplotype diversity and distributions...... 49 3.3.2 Sequence haplotype diversity and distributions...... 67 3.3.3 Statistical Parsimony and the CpDNA Sequence Haplotype Network...... 70 3.3.4 Nested Clade Phylogeographic Analyses...... 70
Chapter 4: DISCUSSION 4.1 Rhodiola Relationships...... 74 4.1.1 Similarities and Differences Between R. integrifolia and R. rosea ...... 75 4.1.1.1 Geographic Relationships...... 76 4.1.1.2 Medicinal Properties...... 77 4.1.2 Rhodiola integrifolia and R. rhodantha: Daughters of an Ancient Colonist? ...... 78 vii
4.2 Hybridization ...... 80 4.3 Phylogeography of Rhodiola integrifolia...... 82 4.3.1 Colonization and Dispersal ...... 82 4.3.1.1 Causes of Observed Geographic Patterns...... 83 4.3.1.2 Use of NCPA (or not) in the Absence of Other Methods ...... 84 4.3.2 Other Refugia ...... 86 4.4 Climate Change Implications...... 87 Literature Cited...... 89 Appendices...... 100
viii
List of Tables
Table 1 Ecological and morphological characteristics of the four subspecies of Rhodiola integrifolia...... 11
Table 2 All Rhodiola Collections by Latitude within Provincial, State or Federal Jurisdiction...... 14
Table 3 Details of PCR (polymerase chain reaction) conditions, including primers, parameters and references for eight cpDNA regions screened...... 23
Table 4 Numbers of individuals per population amplified and used in RFLP and . sequencing for all Rhodiola integrifolia, R. rhodantha and R. rosea...... 24
Table 5 Restriction enzyme recognition sequences and numbers of restriction sites for the psbA-trnH region in Rhodiola integrifolia...... 26
Table 6 Restriction digest cut site positions and patterns of cut sites for each haplotype found in psbA-trnH sequences of Rhodiola integrifolia...... 27
Table 7 Characters varying in ITS sequences of Rhodiola integrifolia and R. rhodantha as compared with 16 other species of Rhodiola...... 39
Table 8 Summary of cpDNA and ITS variation in western North American Rhodiola (including RFLP and sequence haplotypes)...... 40
Table 9 Characters varying in psbA-trnH sequences of Rhodiola integrifolia and R. rhodantha...... 44
Table 10 Distribution of psbA-trnH restriction site haplotypes among sampled populations of Rhodiola integrifolia and R. rhodantha...... 50
Table 11 PsbA-trnH sequence haplotypes of Rhodiola integrifolia and R. rhodantha...... 64
Table 12 Pairwise difference matrix of Rhodiola integrifolia psbA-trnH sequence haplotypes...... 68
Table 13 Pairwise difference matrix comparing Rhodiola integrifolia psbA-trnH restriction site haplotypes to themselves...... 70 Table 14 Inferred population demographic events from Nested Clade Phylogeographic Analysis (NCPA) of Rhodiola integrifolia psbA-trnH restriction site haplotypes psbA-trnH restriction site haplotypes...... 72
ix
List of Figures
Figure 1 Western North America at the maximal extent of the Wisconsinan glaciation ~18ky before present...... 3
Figure 2 Approximate extent of Beringian refugium during the Pleistocene epoch showing the extent of seabed of the Bering Strait that was exposed during glacial cycles...... 5
Figure 3 Ranges of the three species of Rhodiola native to North America...... 10
Figure 4 All Rhodiola integrifolia, R. rhodantha and R. rosea (North American) collection sites...... 19
Figure 5 Gel images of restriction enzyme banding patterns...... 28
Figure 6 Phylogenetic trees for 18 species of Rhodiola based on ITS...... 42
Figure 7 Phylogenetic trees for populations of R. integrifolia and R. rhodantha based on the chloroplast PsbA-trnH region, with R. rosea as outgroup. ... 47
Figure 8 A comparison of bootstrap consensus trees from nuclear (ITS) and chloroplast (psbA-trnH) DNA regions in R. integrifolia and R. rhodantha...... 48
Figure 9 Geographic distribution of cpDNA psbA-trnH restriction site haplotypes and associated sequence haplotypes in western North American Rhodiola populations...... 53
Figure 10 Geographic distribution of all R. integrifolia populations illustrating within-population haplotype diversity...... 66 Figure 11 TCS-generated network of all PsbA-trnH sequence haplotypes of R. integrifolia and R. rhodantha ...... 70
Figure 12 Network of restriction site haplotypes produced by hand...... 72
Figure 13 Nested cladogram of restriction site haplotypes ...... 72
x
Acknowledgements
Thanks are owed to so many! I thank Gerry Allen and Joe Antos for support and guidance, and John Taylor, Ken Marr and Barbara Hawkins for agreeing to be on my committee. Special thanks to Erica Wheeler for her undying support and positivity throughout and for talking me into doing this (I think!). Special thanks also to Laurie McCormick for her constant support and encouragement, and for tolerating me in the lab and helping me with the last chunk of my lab work! Thanks to my funding sources, the Natural Sciences and Engineering Research Council (NSERC), the Northern Scientific Training Program (NSTP), the University of Victoria, and the Lewis Clark Memorial Fellowship.
Many people helped with my collecting and collected samples for me. I want to give special thanks to Bruce Bennett (and his team) for the many collections he made for me in the Yukon, and to his family for their hospitality in Whitehorse, particularly when the Grunner broke down. I also thank: Ken Marr and Richard Hebda who also collected samples from many sites in Northern BC for me; Mike Miller, Emily Beinhauer, Jim Benedict, Alan Batten, David Lowry and Mike Cheney, who collected samples for me in Western North America; and Mariannick Archambault and Christine Westergaard who sent me samples from Eastern Canada and Europe. Phil Caswell and Sylvia Fischer both accompanied me on collecting missions in the Yukon. David Player and Janet Lawson not only supported me with their friendship, but also accompanied me on a couple of my collecting trips.
Many others were there with encouragement and help, and I hope you all know who you are (Charlie, Ryan, Sherri, Vicki, Steve, Victoria, the ladies from the club and of course My Family!!!).
xi
Dedication
To my Parents -
Florence Catherine Guest (September 1, 1916 – September 28, 2002)
Eric Tufts Guest (February 18, 1923 – January 31, 2005)
With Love,
Sorry you couldn’t be here to see this.
1
Chapter 1: INTRODUCTION
Determination of the factors that shape the current distribution of plant species is a central question of plant biogeography. The range of a species is the result not only of present day features of the landscape (e.g., ecology, topography, surficial geology, elevation) and climate (e.g., moisture and temperature regimes, growing degree days), but also of historical events and processes. The dispersal of a species into its present range may be influenced by a combination of factors, many of which can be surmised from our understanding of Earth’s history. Because of changes in past connections between the continents, the Pleistocene glaciations, and climatic change associated with each of these, suitable habitats for species have often been in flux, expanding, shifting and/or contracting over time.
Studies into the historical ranges of plants have traditionally relied on paleobotanical evidence in the form of macrofossils and pollen records. More recently, the advancement of molecular tools has made it possible to evaluate the degree and distribution of genetic variation within a species, which can lead to an enhanced understanding of the historical processes affecting present-day ranges and their past development and evolution.
1.1 Climatic and Glacial History of Western North America
During the Quaternary period (Pleistocene and Holocene Epochs; 2.6 million years ago (mya) to present), Earth has seen several rapid and dramatic changes in climate.
Periodic drops in global temperature, most likely brought about by Milankovitch climate 2 cycles, facilitated the formation and expansion of continental ice sheets that at times covered a large percentage of the land mass of the Northern Hemisphere (Hays et al, 1976;
Mascarelli, 2009; Andersen and Borns, 1997; Ehlers and Gibbard, 2004). Although researchers once recognized four main glacial advances punctuated by interglacial intervals
(Ogilvie 1998), fluctuations in oxygen-isotope concentrations in marine sediment and ice cores show a record of cooling and warming over the Pleistocene period accounting for as many as 24 glacial-interglacial intervals (Booth et al. 2003; Hewitt, 2000; Andersen and
Borns, 1997; Matthews, 1978).
In North America, the last major Pleistocene glaciation was the Wisconsinan approximately 115 – 10 thousand years ago (kya) (Figure 1). The last major advance of the
Wisconsinan glaciation, during which most of Canada was covered with ice, occurred between approximately 28 kya and 10 kya (Clague et al, 2004, Ehlers and Gibbard, 2009).
East of the Rocky Mountains, the Laurentide ice sheet reached its maximum extent between
21 kya and 18 kya, whereas in the west, the Cordilleran ice sheet reached its maximum extent later, approximately 15 kya to 14 kya (Booth et al, 2003; Andersen and Borns, 1997;
Clague et al, 1980; Clague and James, 2002).
In western Canada, expanding alpine glaciers and ice fields from mountain ranges along the Pacific coast (including the St. Elias Range of Alaska and the Yukon and the Coast
Ranges of British Columbia) coalesced with valley/piedmont glaciers and alpine glaciers in the Rocky Mountains to form a sheet of ice that surpassed 2000m in thickness in some areas
(Clague et al, 2004). Mountain peaks of the Rockies higher than 2500m may have protruded above the ice (Ogilvie, 1998), and many show evidence of having been ice-free (Pielou, 3
1991; Hultén, 1937). At its maximum extent, lobes of the Cordilleran ice sheet reached the
Pacific Ocean and the Interior Plains east of the Rocky
Beringia
Cordilleran Laurentide Ice Sheet Ice Sheet
Figure 1: Western North America at the maximal extent of the Wisconsinan glaciation ~18kya. Shading represents the approximate extent of continental glaciers. Putative high arctic glacial refugia not shown. (Ice sheet coverage based on figures from Williams et al, 2004, and Clague and James, 2002)
Mountains, where the Cordilleran and Laurentide ice sheets may have converged (Booth et al, 2003; Hetherington et al., 2003; Pielou, 1991).
The climatic oscillations of the Pleistocene led to several cycles of expansion and contraction in the geographical ranges of alpine and arctic plants (Comes and Kadereit, 1998;
Waltari et al, 2004). With large amounts of water locked in glaciers, sea levels dropped as 4 much as 200 m below present sea level, exposing large areas of continental shelf along coastlines worldwide (Lambeck and Chappell, 2001; Andersen & Borns, 1997; Pielou, 1991;
Hultén, 1937). Exposed coastlines, ice-free mountain tops protruding through the ice sheets
(nunataks), and larger ice-free regions both south and north of the main Cordilleran and
Laurentide ice sheets were habitable refuges for plants and animals within or near the uninhabitable glacial landscape (Clague et al, 2004; Stehlik et al, 2002; Pielou, 1991;
Matthews, 1978; Ives, 1974). All of these areas could serve as refugia i.e., geographical areas of varying size where taxa are able to persist during a period of range contraction
(Bennett and Provan, 2008; Bennett et al, 1991 in Ferris et al, 1999; Pruett and Winker,
2007). During glaciations, refugia were important reservoirs of genetic diversity for many plant species. In North America, the area south of the ice sheets that was never glaciated harboured the majority of temperate plant taxa (Soltis et al, 1997; Hewitt, 2004; Ives, 1974).
Beringia, the region northwest of the ice-sheets on either side of, and including, the exposed continental shelf of the Bering Strait (Figure 2), was also a significant refugium, especially for arctic and alpine plants (Eidesen et al, 2007; Abbott et al, 2000).
The concept of Beringia as a ‘land bridge’ linking Asia and North America had occurred to several explorers and scientists before the Swedish botanist Eric Hultén published his analysis (Hultén, 1937) of the distribution of boreal and arctic plants (Hopkins,
1967). In his “Outline of the History of Arctic and Boreal Biota during the Quaternary
Period” (1937), Hultén coined the term Beringia and concluded that this region had remained an ice-free refugium for at least the last two major glaciations. Because of the shallow waters of the Bering Strait, “a lowering of the sea-level of only 50m would result in a connection between Asia and America 300 km broad” (Hultén, 1937). The lowering of sea 5 levels during glaciations, coupled with the effects of isostasy as the Earth’s crust responded to the removal of the mass of water in some regions and the addition of the weight of ice in others, indicated that the land bridge was probably exposed during much of the past two
Siberia Yukon Alaska Beringia
Figure 2: Approximate extent of Beringian refugium (shaded area) during the Pleistocene epoch showing the extent of seabed in the Bering Strait that was exposed during glacial cycles. Outlines of Beringia based on image at: http://www.beringia.com.
million years (Morlan, 1996). Hultén proposed that Beringia was the initial centre from which most arctic plants radiated eastwards and westwards across circumpolar regions during the Late Tertiary, before the first ice age of the Pleistocene. He also hypothesized that the majority of arctic plants, although their larger ranges shifted and became fragmented 6 with each glacial cycle, were able to persist in Beringia and re-populate suitable habitats when they became available (Eidesen et al., 2007, Hultén, 1937).
1.2 Phylogeography and Plant Molecular Markers
Populations of organisms in recently colonized regions often have low genetic diversity compared with those found in long-term reservoirs of that taxon -- so-called
“leading edge colonization” (Hewitt, 1996). Taxa recolonizing formerly glaciated regions typically experience repeated genetic bottlenecks that occur when only a few individuals contribute their genetic material to new populations (Alsos et al., 2005; Ehrich et al., 2007).
In addition, once these new populations are established in a region, it may be more difficult for later long-distance immigrants to become established and contribute their genetics because the available habitat has already been taken, thus perpetuating low genetic diversity in the new range (Hewitt, 1999).
The term phylogeography was introduced by John Avise and coworkers in 1987, to describe a field of study that investigates the geographic distributions of genealogical lineages within or among species, or among other taxonomic groupings. The study of molecular variation within the context of geography can reveal the historical and evolutionary events and processes that led to the present evolutionary and geographical circumstances of a taxon (Koch and Kiefer, 2006, Avise et al., 1987). Although a majority of phylogeographic studies to date have dealt with animal species (Kuchta and Meyer, 2001;
Schaal et al, 1998; Brunsfeld et al, 2001), the number of plant studies has grown exponentially in the last decade (Smith, 2007; Schaal et al, 1998; Dobes et al, 2004). Most of these, however, have focused on European plant species, or on post-glacial expansions of 7 circum-arctic species within Europe (Hewitt, 2004). Phylogeographic analyses of North
American plant species, and those of northwestern North America in particular, are still relatively uncommon. Thus, significant gaps exist in our understanding of the phylogeographic history of the western North American flora.
Phylogeographical methods employ molecular techniques to uncover the genetic structure of a taxon across part or all of its range. Molecular markers commonly used for phylogenetic analysis in plants occur in both organelle and nuclear DNA regions. Of these, non-coding regions of the chloroplast DNA (cpDNA) are especially useful in the study of plant phylogeography. The chloroplast DNA genome in flowering plants is highly conserved in terms of size, structure and gene content (Olmsted and Palmer, 1994; Doyle 1993), and is one of the most attractive sources of molecular markers for the phylogenetic study of plants.
In angiosperms, cpDNA is maternally inherited and thus is only dispersed through seed.
Seeds are typically dispersed less widely than pollen, thus, the geographical migration of the species due to seed dispersal can be tracked separately from any gene flow that may be caused by pollen exchange (Petit et al 2003; Latta 2006). Since the accumulated changes in the maternal line are not obscured by the elevated gene flow associated with pollen exchange, geographic patterns are likely to be retained over longer periods than would be the case with biparentally inherited nuclear markers (Comes and Kadereit, 1998; Ferris et al,
1999; Doyle 1993; Harris and Ingram 1991, Hewitt, 2004; Tremblay and Schoen, 1999;
Soltis et al, 1997). Evidence of glacial refugia, migration routes, and range expansions that occurred in the distant past can now be inferred through examining the geographical distribution of modern cpDNA haplotypes (Comes and Kadereit, 1998). 8
The chloroplast genome harbours considerable intraspecific variation, especially in introns or non-coding spacer regions; this variation is geographically structured in many species (Soltis et al, 1997; Harris and Ingram, 1991). One widely used approach is to amplify selected DNA regions and survey these for restriction fragment length polymorphisms (RFLPs), (Wyman and White, 1980; Holderegger and Abbott, 2003).
Alternatively, DNA regions of interest such as non-coding spacers can be sequenced directly.
1.3 The Study Species, Rhodiola integrifolia
Rhodiola integrifolia Raf. is a distinctive, succulent-leaved alpine plant with reddish flowers that is widespread in western North America. It is one of 60-90 recognized species of Rhodiola (Mayuzumi and Ohba 2004; Lei et al, 2004). All of the species of this genus are native to high latitude and/or elevation, cold regions of the Northern Hemisphere with the majority concentrated in and around the central Asiatic highland (Lei et al, 2004, 2006;
Ohba, 1988; Moran, 2005 (unpublished manuscript). Several species of Rhodiola (e.g. R. rosea L., R. alsia (Fröderström) S. H. Fu, and R. crenulata (Hooker & Thomson) H. Ohba) have been in use for centuries as traditional medicines in Asia and other parts of the Old
World, and are now becoming popular in alternative medicine in the West (Lei et al, 2004,
2006, Xia et al, 2005). As a result of this recent popularity, many more species of Rhodiola are being studied and exploited for their potential medicinal properties. This, along with deforestation and grazing pressure in their historical range, may threaten several members of this genus (Lei et al, 2004, 2006; Xia et al, 2005; Wang et al, 2005).
The geographic range of Rhodiola integrifolia (Figure 3), spans previously glaciated areas as well as former refugia. In Asia, it extends from the Himalayan Mountains through 9
China to eastern Siberia, and in North America it ranges from northern and western Alaska to the western Northwest Territories, BC, Alberta, and the western continental USA. In the southernmost part of its range it is limited to high elevation areas in Colorado, New Mexico and California.
Besides R. integrifolia’s distinctive morphology and widespread (although patchy) distribution, it is also representative of Northern Hemisphere arctic/alpine plant species that were reduced in their ranges to one or a few glacial refugia during the last glaciation. These features make it a good study species to use in locating those refugia and in determining the post-glacial history of arctic/alpine plant species’ geographical expansion.
In addition to R. integrifolia, two other species of Rhodiola (R. rosea (a.k.a. Sedum rosea (L.) Scop., and R. rhodantha (A. Gray) H. Jacobsen (a.k.a. Clementsia rhodantha
(Gray) Rose, or Sedum rhodanthum Gray), are native to North America. The yellow flowered R. rosea occurs in eastern North America and east to the higher elevations and latitudes of Eurasia (Moran, 2005 (unpublished manuscript); Clausen, 1975). Rhodiola rhodantha is found in alpine habitats in the Rocky Mountains south of the glacial maximum
(Figure 3), where its range overlaps with the southern range of R. integrifolia. All three species are perennial, with thick rhizomes, succulent leaves, and annual floral stems that arise from the leaf axils. Rhodiola rhodantha has pinkish hermaphrodite flowers in an elongate, raceme-like inflorescence; R. integrifolia and R. rosea have smaller, unisexual flowers in corymbose cymes. Both R. integrifolia and R. rosea are dioecious (Clausen
1975).
The taxonomic relationship of R. integrifolia and R. rosea has been subject to debate.
Perhaps due to its similar morphology Rhodiola integrifolia has been considered to be a 10
Rhodiola rosea
Rhodiola integrifolia
Rhodiola rhodantha
Figure 3: Ranges of the three species of Rhodiola native to North America (red, R. integrifolia; yellow, R. rosea; and pink, R. rhodantha). Ranges adapted from Clausen 1975.
subspecies of R. rosea by many authors (e.g. R. rosea L. subsp. integrifolium (Raf.) Hult.
(Hultén, 1968) (1), or subsp. integrifolia (Raf.) Hara, (Uhl, 1952; Cody, 2000) (2); and,
Sedum rosea (L.) Scop. subsp. integrifolia (Welsh, 1974; Clausen, 1975) (3). More recently the two taxa have been treated as separate species within Rhodiola: R. integrifolia Raf. and
R. rosea L. (Moran, 2005 (unpublished manuscript), 2000; Amano et al, 1995; Ohba, 1999;
Lei et al, 2004). This separation of the complex into two species is based on differences in 11 chromosome numbers (R. integrifolia: n=18; R. rosea: n=11), and floral characteristics
(Clausen, 1975; Moran, 2005 unpublished manuscript). Here, botanical nomenclature follows Reid Moran’s (2005, unpublished) treatment prepared for the Flora of North
America. Currently, R. integrifolia is divided into four recognized subspecies in North
America (Ohba, 1999; Olfelt et al, 1998, 2001) (Table 1). Most R. integrifolia specimens used in this study were of subsp. integrifolia.
Table 1: Ecological and morphological characteristics of the four subspecies of Rhodiola integrifolia. (Sources: Moran, 1996 (unpublished manuscript); Clausen, 1975)
Rhodiola integrifolia subsp. subsp. subsp. subsp. integrifolia procera neomexicana leedyii One site only in Locally endemic in Widespread Southern the Sierra Blanca two disjunct areas: Alaska to Rockies of Range Mtns. of Lincoln Minnesota (two California, E to Colorado and County, New counties), and New Rockies New Mexico Mexico York (two counties) Montane to Cliffs & rocky Exposed sites on alpine slopes NW facing limestone slopes, alpine porphyritic rock Habitat among rocks, cliff ledges, 100 to 400 meadows or from 3300 to 3600 gravel or m tundra m stony loam Petal Yellow, red at Dark red or Dark red Dark red colour apex and on keel yellow at base Glaucous to Bright green, Blue-green, long, bright green, Bright green, linear- Leaves ovate to elliptic, narrow, oblong, oblanceolate oblanceolate oblanceolate oblanceolate Plant 3-15 cm up to 50 cm 15-25 cm 15-45 cm ht. Of conservation Of conservation Status Not threatened Not threatened concern concern
Although arctic and alpine ecosystems have undergone dramatic fluctuations in environmental conditions since the Pleistocene, researchers are unsure about how resilient these systems will be to rapid warming (Weider and Hobaek, 2000). It is already clear that 12 arctic and alpine habitats are at an elevated risk from climate change (Weider and Hobaek,
2000, Waltari et al., 2004; Callaghan et al., 2004), and it is expected that as warming continues the available habitat for arctic and alpine species will decrease as other plant species encroach into their ranges (Hewitt, 1996; Lesica and McCune 2004; Callaghan et al.,
2004). Understanding the local and regional variability within the genome of R. integrifolia will lead to a better understanding of its origins and evolution, and may also allow us to predict its potential future range.
1.4 Objectives:
My objectives in this study are as follows: i) to clarify R. integrifolia’s position within the genus Rhodiola and its taxonomical relationships with the other North American species; ii) to determine the origins of extant populations of R. integrifolia in western North
America; iii) to estimate macro scale dispersal patterns followed by R. integrifolia in reaching its current range, and if possible obtain information on the evolutionary processes involved; and iv) to shed some light on this species’ ability to respond to changing climates in the future. To achieve these goals, I used data from the chloroplast and nuclear genomes to investigate local and regional patterns of genetic variation in R. integrifolia, and to make comparisons with the other North American species, R. rhodantha and R. rosea. 13
Chapter 2: METHODS
2.1. Collection of Plant Material
I collected Rhodiola at 44 localities over three field seasons (northern BC and Yukon in 2004, Yukon and Alaska in 2005, and southeast BC and western continental USA in 2006
(Table 2). Potential collecting locations were identified by extracting range and locality information from published floras, consulting with local botanists, and visiting herbaria or checking their online databases. I obtained information from herbaria at the University of
Washington, University of Wyoming, University of Colorado, University of California at
Berkeley, Oregon State University, Colorado State University, the Royal BC Museum,
University of Victoria, University of British Columbia, University of Montana, University of
Alaska, and from the private herbarium of Mr. Bruce Bennett in Whitehorse, Yukon. In total
I obtained samples from 66 populations of R. integrifolia, six populations of R. rhodantha, and four populations of R. rosea (Table 2), including population samples from 22 localities contributed by other collectors (Figure 4).
At each site I collected leaves, stems and (if available) flowers from 5-20 individual plants, and one to several voucher specimens. Each population sample was collected within an area of between approximately 5m2 and 30m2, depending on plant density. I placed plant samples in individual coin envelopes, then into a resealable plastic bag containing indicating desiccant crystals for rapid drying. All voucher specimens have been deposited in either the
University of Victoria or the Royal British Columbia Museum herbarium. 14
Table 2: All Rhodiola Collections by Latitude within Provincial, State or Federal Jurisdiction Site Code Location Elevation Latitude Longitude Collector # Alaska, USA Pinnell Mtn. NW of Fairbanks, 1 PM Twelvemile Summit trailhead, 1126m 65° 24' 36" 145° 59' 06" Heidi Guest N side Hwy 6 ~km140 Bison Gulch, E side of Hwy 3 2 BG ~25 km N of entrance to 815m 63° 48' 07" 148° 58' 19" Heidi Guest Denali Park. Cantwell, NE of Jct of Hwy's 3 CA 911m 63° 23' 58" 148° 51' 57" Heidi Guest 3 & 8. Denali Hwy site 2, 60 km E of 4 D2 960m 63° 15' 03" 147° 49' 07" Heidi Guest Cantwell, S side of Hwy 8. Denali Hwy site 4, Tangle 5 D4 Lakes/ McLaren Summit, S 1250m 63° 05' 21" 146° 24' 36" Heidi Guest side of Hwy 8. Denali Hwy site 3, N side of 6 D3 Hwy 8 ~ 20 km E of Susitna 1161m 63° 03' 06" 147° 14' 57" Heidi Guest R. in Clearwater Mtns. Little Coal Creek, trailhead is 7 LC on E side of Hwy 3 ~75 km S 902m 62° 52' 54" 149° 41' 20" Heidi Guest of Denali Hwy Jct. Peter's Hills, off Hwy 3 at 8 PH Trapper Creek, ~10 km past 637m 62° 32' 10" 150° 50' 01" Heidi Guest Petersville NE of river camp Hatcher's Pass, NW off Hwy 1 at Palmer, NW above junction 9 HP 1004m 61° 46' 32" 149° 17' 52" Heidi Guest of road to Lodge with Hatcher's Pass Rd. Peter's Cr. Trail, NE of 10 PC Anchorage in residential area 936m 61° 24' 33" 149° 23' 20" Heidi Guest E of Hwy 1 at top of trail Thompson Pass, Pass above 11 TP Blueberry Lake SE side of 832m 61° 07' 38" 145° 43' 31" Heidi Guest Hwy 4 ~75 km from Valdez Blueberry Lake, Campsite #9, 12 BL Chugach Range on Hwy 4 636m 61° 07' 12" 145° 42' 18" Heidi Guest ~60 km E of Valdez Crow Pass, SE of Anchorage turn NE off Hwy 1 at 13 CP Girdwood, on slope on E side 500m 61° 02' 07" 149° 07' 16" Heidi Guest of trail ~30 minutes hike from trailhead. Swetman Mine, S from Hope (Kenai Penn), past Coeur 14 SM 549m 60° 48' 07" 149° 32' 45" Heidi Guest d'Alene campsite. E of rd. W of stream on E face of hump. Cooper's Mtn, S side of Hwy 1 on Kenai Penn, just past 15 CM 780m 60° 28' 14" 149° 50' 30" Heidi Guest Cooper's Landing NW facing mini-saddle near summit. Carbon Mtn, SE of Valdez in 16 CB 903m 60° 26' 37" 143° 53' 22" Alan Batten Chugach Mtns 15
Site Code Location Elevation Latitude Longitude Collector # Yukon Territory, Canada Kay Point, N coast of Yukon, 17 KP 1 m 69° 17' 31" 138° 23' 35" Bruce Bennett Beaufort Sea, on mud flats Blow River Delta, N coast of 18 BR 0.6 m 68° 55' 24" 137° 10' 26" Bruce Bennett Yukon, Beaufort Sea Mount Klotz Camp, in 19 MK meadows along creeks and in 1165 m 65° 21' 48" 140° 10' 54" Bruce Bennett late snow melt areas Ogilvie Mtns Site 5, Near top 21 O5 of ridge late snow melt area on 1671m 64° 47' 58" 138° 03' 49" Heidi Guest north side. Ogilvie Mtns Site 3. Ridge S 22 O3 1731m 64° 47' 28" 137° 43' 16" Heidi Guest of saddle 23 O4 Ogilvie Mountains Site 4 1527m 64° 45' 20" 137° 58' 17" Heidi Guest Gillespie Lake, Bonnet Plume 24 GL 1378m 64° 43' 43" 133° 59' 00" Bruce Bennett Drainage Pinguicula Lake, Bonnet 25 PL Plume Drainage, mid slope on 1292m 64° 41' 25" 133° 26' 18" Bruce Bennett mountain North Fork Pass, Dempster 26 NP 1270m 64° 35' 15" 138° 16' 53" Ken Marr Hwy, east facing slope. Tombstone Valley, N of Park 27 TV camp-ground, near stream, 1062m 64° 30' 47" 138° 14' 13" Heidi Guest close to trail 28 GR Grizzly Lake, Tombstone Park 1400m 64° 25' 36" 138° 27' 42" Mike Miller Top of the World Hwy, W. of 29 TW Dawson City. Midslope N 1150m 64° 11' 38" 140° 21' 40" Ken Marr facing alpine meadow Keno Hill, Road up hill above 30 KH 1609m 63° 56' 13" 135° 13' 46" Heidi Guest town NW sloping meadow North Canol Rd, in meadows 31 NC 212 miles W. of Norman 1706 m 63° 24' 42" 129° 36' 52" Bruce Bennett Wells, Dechen la'. Rose-Lapie Pass W. side & 32 RL below Hwy 6 (Canol Rd.) 1095m 61° 37' 49" 133° 03' 36" Heidi Guest between road and small lake Outpost Mtn, SW side of Hwy 33 OM 1, trail S of Kluane Lk, at 1447m 60° 58' 41" 138° 24' 38" Heidi Guest treeline W facing slope. Kluane Rock Glacier, trail off 34 KR Hwy 3, S of Haines Jct. lateral 1080m 60° 27' 01" 137° 5' 01" Heidi Guest moraine SE side. Montana Mtn. Mtn rd. S of 35 MT Carcross, N side of mountain, 1392m 60° 06' 45" 134° 40' 44" Heidi Guest N facing meadow. Montana Mtn, West above 36 MM 1485m 60° 06' 10" 134° 41' 25" Heidi Guest road along E side before slide.
British Columbia, Canada Chuck Creek, Haines Rd, 37 CC ~120 km N of Haines, Alaska, 1046m 59° 41' 58" 136° 36' 27" Heidi Guest W facing near top of trail 16
Site Code Location Elevation Latitude Longitude Collector # British Columbia, Canada 3 Guardsmen's Pass, Haines 38 TG Rd ~ 90 km N of Haines 968m 59° 36' 10" 136° 29' 21" Heidi Guest Alaska, SE side of road Mt. Fetterly, SE of Atlin, Emily 39 MF 1455m 59° 31' 42" 134° 01' 39" meadow in riparian zone. Beinhauer Moose Mtn, SE of Atlin, Steep Emily 40 MO 1448m 59° 25' 38" 133° 28' 18" SSE slope. Beinhauer Estshi Creek, Coast Mtns, 41 EC Iskut River; 6-7 km NW of 1430m 56° 45' 51" 130° 16' 15" Ken Marr Teigen Lake. S. end of Hanna Ridge N of 42 HA Meziadin Lk, Coast Mtns. 1800m 56° 13' 58" 129° 28' 57" Marr/Hebda WSW facing ridge apex. Mt. Tommy Jack, Skeena Mtns, 43 TJ ridge 2-3 km E of summit, S of 1770m 56° 03' 02" 127° 46' 13" Marr/Hebda Triangle Lake. Atna, Skeena Mtns, ridge W 44 AT side of Atna Range. E facing 1662m 56° 00' 20" 127° 40' 47" Marr/Hebda upper slope. N of Insect Creek, Nass 45 IC 1718m 55° 04' 00" 128° 34' 51" Marr/Hebda Ranges. W facing slope. Mt. Couture, SW facing saddle 46 MC 1800m 54° 53' 28" 128° 41' 27" Marr/Hebda on ridge apex Hudson Bay Mt, SW of S 47 HU 1668m 54° 49' 00" 127° 17' 10" Marr/Hebda facing slope. Hudson’s Bay Mountain, 48 HB 1707m 54° 46' 26" 127° 14' 26" Heidi Guest Crater Lake Trail. Thornhill Mtn, E of Terrace - 49 TM turn off Lakelse Rd, top of 1145m 54° 30' 33" 128° 27' 25" Heidi Guest Mtn in S facing depression Towustasin Hill, Graham Is. 50 TH 370m 53° 35' 06" 132° 26' 13" Mike Cheney Queen Charlotte Islands 0.75 km NW of Bonanza Beach, N end Rennell Sound, 51 BB 3.5m 53° 24' 52" 132° 32' 55" David Lowry Graham Is, Queen Charlotte Islands Gimli Peak, W of Valhalla 52 GP 2423m 49° 45' 39" 117° 38' 56" Heidi Guest Park, in saddle at base of spire. Fisher Peak, NE of Cranbrook, 53 FP 2154m 49° 38' 27" 115° 29' 51" Heidi Guest edge of pond at treeline
Montana, USA Reynolds Pass, Glacier National Park, steep SE facing 54 RT 2315m 48° 40' 38" 113° 43' 53" Heidi Guest scree slope above trail just before pass Goat Flats, Anaconda-Pintler Wilderness Area, tundra ridge 55 GF 2860m 46° 02' 47" 113° 16' 43" Heidi Guest above Upper Seymour Lake, gentle N facing slope.
17
Site Code Location Elevation Latitude Longitude Collector # Wyoming, USA Beartooth Pass, At top of pass on Hwy 212, Montana/ 56 BP 3352 m 44° 58' 16" 109° 28' 27" Heidi Guest Wyoming border. N facing boulder field SW side of hwy Medicine Bow Mtn, Hwy 130, below summit, in S facing 57 MB 3461m 41° 21' 35" 106° 18' 36" Heidi Guest scree on trail edge (growing with R. rhodantha).
Colorado, USA Arapaho Rim, Along route from Rainbow lakes to 60 AR Arapaho Col. Jct btwn N- 3650m 40° 02' 17" 105° 15' 11" Jim Benedict sloping meadow and frost- sorted rubble stream 61 AA Above Arapaho, see above 3855m 40° 01' 19" 105° 38' 57" Jim Benedict Loveland Pass, top of Hwy 6 off I70 ~ 100 km W of 65 LP 3734m 39° 39' 36" 105° 53' 07" Heidi Guest Denver, trail N side flat area between rocky outcrops Schofield Pass 30 km N of 66 SP Crested Butte, up trail E from 3368m 39° 00' 58" 107° 02' 40" Heidi Guest summit on SW slope Handies Meadow, Col E of Cinnamon Pass on 4wd road 68 HM 3467m 37° 55' 52" 107° 30' 53" Heidi Guest btwn Lake City and Silverton, (growing with R. rhodantha). La Plata Canyon, W. of Durango, Forest Rd 124 N of 70 LA 3120m 37° 25' 56" 108° 02' 07" Heidi Guest Hesperus, SE facing slope of road cut. California, USA Paiute Pass, W on Hwy 168 from Bishop, Inyo Co. Above 71 PP 3273m 37° 13' 51" 118° 39' 10" Heidi Guest treeline trail near Loch Leven in cracks of rocks Mt Dana, Yosemite Nat'l Pk trail SE from Tioga Pass park 72 MD 3460m 37° 54' 32" 119° 14' 14" Heidi Guest entrance (E side), toe of W facing gentle slope.
Rhodiola rhodantha Wyoming, USA Snowy Range, Hwy 130, below summit of Medicine 58 SR 3461m 41° 21' 35" 106° 18' 36" Heidi Guest Bow Mtn. in S facing scree (growing with R. integrifolia)
Utah, USA Uinta Mtns, Hwy 150 , N side 59 UM 3063m 40° 42' 28" 110° 52' 07" Gerry Allen of Mirror Lake in seepy area.
18
Site Code Location Elevation Latitude Longitude Collector # Colorado, USA S. Arapaho Col. on frost 62 AC patterned, south facing slope. 3855m 40° 01' 19" 105° 38' 57" Jim Benedict See AR above Fourth of July Mine, Wetland 63 FM 3390m 40° 00' 53" 105° 39' 39" Jim Benedict bench E of Mine 4th of July Valley, Frost patterned wetland downslope 64 FV 3400m 40° 00' 31" 105° 39' 54" Jim Benedict from late-lying snowbank. Forest-tundra ecotone American Basin, same as 69 AB Handies Meadow above, (with 3456m 37° 55' 43" 107° 30' 52" Heidi Guest R. integrifolia)
Rhodiola rosea
Qinngorput, Nuuk, Greenland, Kristine 73 NU W coast, near town of Nuuk 130m 64° 10' 38" 51° 39' 39" Westergaard (Godthåb), wet S facing slope Nasarsuaq, Greenland, Kristine 74 NA Signalhojen, SE of airport, 210m 61° 09' 38" 45° 24' 28" Westergaard moist, west facing slope Eastern Canada Mariannick 75 NH Nunavik HH, Quebec n/a 59° 30' 39" 65° 39' 27" Archambault Mariannick 76 CE Cap Enragé, New Brunswick n/a 45° 35' 38" 64° 46' 48" Archambault 19
R. integrifolia R. rhodantha R. rosea
Figure 4: All Rhodiola integrifolia, R. rhodantha and R. rosea (North American) collection sites. Shaded area represents the North 19
American range of R. integrifolia. Range based on map by Clausen 1975. 20
2.2 DNA Extraction
Using approximately 10 mg of dried leaf and/or flower tissue per sample, I extracted
DNA from 10 individuals (or if <10, all individuals collected) per Rhodiola population, using a modification of the hexadectyl-trimethylammoniumbromide (CTAB) method (Doyle and
Doyle, 1990) for use with dried tissue (see details in Appendix I). I extracted DNA from 555 individuals of R. integrifolia, 50 of R. rhodantha, and 14 of R. rosea. All DNA samples were diluted 1:10 with double-distilled water (ddH2O) before further use.
2.3 DNA Regions Sampled
2.3.1 Nuclear DNA: ITS
I sequenced the internal transcribed spacers 1 and 2 of the nuclear ribosomal DNA locus (ITS) from 32 individuals of R. integrifolia (from 28 populations), four of R. rhodantha
(from four populations) and four of R. rosea (from four populations). I used primers ITS1 and ITS4 (White et al., 1990) to amplify the ITS1, 5.8S rDNA and-ITS2 regions of the nuclear ribosomal DNA as a single fragment.
For amplification, I used a mixture of 5L extraction product (1:10 dilutions), 5L
10x PCR buffer (New England Biolabs (NEB) or Invitrogen), 1.5L 50mM MgCl2
(Invitrogen), 5L 2mM dNTPs (Invitrogen), 2.5L each of forward and reverse primers
(ITS1 and ITS4 respectively (Life Technologies/Gibco)), 28.25L ddH2O, and 0.25L Taq
DNA Polymerase (5 U/L, NEB or Invitrogen). Reactions were performed on an Eppendorf
Mastercycler Gradient Thermocycler (Eppendorf, Hamburg, Germany) or on a Techne TC-
312 thermocycler (Techne, Duxford, Cambridge, UK). 21
PCR conditions for the ITS region were as follows: 3 min at 94C; 30 cycles of 30 seconds at 94C, 1 min at 55C, and 1 min at 72C; and an extension step of 10 min at 72C.
Amplification products were run on 1% TBE agarose gels, stained in ethidium bromide, and observed and photographed under short-wave UV light.
Prior to sequencing I purified the PCR products using a Qiagen QIAquick® PCR
Purification kit (Qiagen Inc., Mississauga ON, Canada). Sample concentrations of the purified PCR products were estimated on a 1% agarose gel by comparing band intensities with a 50 base pair standard reference ladder (New England Biolabs) or by measuring absorption intensity on a Nanodrop 1000 spectrophotometer (Thermo Scientific).
For sequencing, 5l of cleaned product were used for each sample. Sequencing of early samples was carried out by the University of Victoria’s Centre for Biomedical Research
(CBR), on a CEQ 8000 (Beckman Coulter) DNA sequencer with a Dye Terminator Cycle
Sequencing Quick Start Kit (Beckman Coulter). Both strands were sequenced. Later sequencing was carried out by Macrogen Inc. (Seoul, South Korea), using BigDye™ terminator conditions (Applied Biosystems, Foster City, USA). Samples were purified using ethanol precipitation and run on an ABI3730XL or BI3700 automatic sequencer (Applied
Biosystems, Foster City, USA). These sequences were determined using the reverse primer
(ITS4) only.
2.3.2 CpDNA markers/regions
2.3.2.1 Screening of chloroplast DNA markers/regions
I chose eight non-coding cpDNA regions for an initial survey of variation. These included six spacer regions (psbA-trnH, trnT-trnL, trnD-trnT, trnS-trnG, trnS-trnfM and trnL-trnF) and two introns (rpL-16 and rpS-16), all of which were reported by Shaw et al. 22
(2005) to exhibit variation in a variety of angiosperm species. Individuals of R. integrifolia from geographically widespread locations sampled in 2004 were used for this initial survey.
For all DNA regions except trnL-trnF, I selected samples from six sites: two from Yukon
(#27, #30) and four from B.C. (#37, #38, #48, #49). For the trnL-trnF spacer, I used samples from Alaska (#3), Yukon (#23/), Colorado (#66) and California (#71), amplifying four individuals from each population; I also amplified samples of R. rosea, including six individuals from Quebec (#75), and four individuals from New Brunswick (#76). Details for
PCR conditions for the eight cpDNA regions tested are presented in Table 3.
Two to four samples of R. integrifolia were sequenced for each cpDNA region
(except the rpL16 intron, which did not amplify successfully). Of the seven regions sequenced, two (trnT-trnL and trnS-trnfM) yielded poor sequence, and one (trnL-trnF) showed little variation. Of the four remaining cpDNA regions, I selected the psbA-trnH spacer for further study because it showed variation that could be readily detected with restriction enzymes.
2.3.2.2 Amplification and Sequencing of psbA-trnH region
I amplified the psbA-trnH region in ten individuals (or as many as were extracted) from each collection site, using the PCR protocols described above. A total of 613 individuals were amplified for the psbA-trnH region, including 45 individuals of R. rhodantha and 11 individuals of R. rosea. Samples were prepared for sequencing following the procedures outlined for the ITS region, using primers psbA (f) and trnH (r). Sequences of the psbA-trnH spacer region were obtained for 92 individuals of R. integrifolia, 7 individuals of R. rhodantha, and 6 individuals of R. rosea (Table 4). 23
Table 3. Details of PCR (polymerase chain reaction) conditions, including primers, parameters and references for eight cpDNA regions screened, and the samples sequenced for each region in preliminary trial. Samples sequenced listed by population number and site code/individual.
Region Primer Primer sequence Amplification Reference Samples (5’ to 3’) parameters sequenced psbA- psbA (F) GTT ATG CAT GAA CGT AAT 94ºC 3’ (Sang et al., #27 (TV2), trnH GCT C 94ºC 30” 1997) #30 (KH2), trnH (R) 57ºC 1’ 25X #37 (CC4), CGC GCA TGG TGG ATT CAC 72ºC 1’ #48 (HB2) AAA TC 72ºC 10’ trnT-L Tab A CAT TAC AAA TGC GAT GCT 94ºC 3’ (Taberlet et #30 (KH2), (F) CT 94ºC 30” al., 1991) #49 (TM6) 52ºC 1’ 30X Tab B TCT ACC GAT TTC GCC ATA 72ºC 1’ (R) TC 72ºC 10’ trnD-T trnD (F) AAC AAT TGA ACT ACA ATC 80ºC 5’ (Demensure #37 (CC4) CC 94ºC 45” et al., 1995) #48 (HB2) trnT (R) CTA CAA CTG AGT TAA AAG 52-58ºC 30” 30X GG 72ºC 1’ 72ºC 5’ trnS-G trnS (F) AGA TAG GGA TTC GAA CCC 80ºC 5’ (Shaw et al., #27 (TV2) TCG 95ºC 1’ 2005) #38 (TG4) trnG (R) GTA GCG GGA ATC GAA CCC 50ºC 1’ 35X GCA TC 65ºC 5’ 65ºC 10’ trnS-fM trnS (F) GAG AGA GAG GGA TTC GAA 80ºC 5’ (Demensure #30 (KH2) CC 94ºC 30” et al., 1995) #37 (CC4) trnfM CAT AAC CTT GAG GTC ACG 55ºC 30” 30X (R) GG 72ºC 2’ 72ºC 5’ trnL-F Tab C CGA AAT CGC TAG ACG CTA 94ºC 3’ (Taberlet et #3 (CA3) (F) CG 94ºC 30” al., 1991) #23 (O43) 52ºC 1’ 25X #66 (SP3) Tab F ATT TGA ACT GGT GAC ACG 65ºC 5’ #71 (MD3) (R) AG 65ºC 4’ rpL 16 rpL 16 GCT ATG CTT AGT GTG TGA 80ºC 5’ (Small et (not (F) CTC GTT G 95ºC 1’ al., 1998) sequenced) 50ºC 1’ 35X rpL 16 CCC TTC ATT CTT CCT CTA 72ºC 2’ (R) TGT TG 72ºC 5’ rpS 16 rpS 16 AAA CGA TGT GGT ARA AAG 80ºC 5’ (Shaw et al., #27 (TV2) (F) CAA C 94ºC 30” 2005) #49 (TM6) 50-55ºC 30” 30X rpS 16 AAC ATC WAT TGC AAS GAT 72ºC 1’ (R) TCG ATA 72ºC 5’
24
Table 4: Numbers of individuals per population amplified and used in RFLP (for psbA- trnH) and sequencing (psbA-trnH and ITS) for all Rhodiola integrifolia, R. rhodantha and R. rosea. Populations arranged by latitude within each jurisdiction (State/Province, etc.)
Number Number Number Number Site Site amplified digested sequenced sequenced number Species Site Name Code psbA-trnH psbA- PsbA- ITS trnH trnH 1 R. integrifolia Pinnell Mtn. Alaska PM 10 10 2 2 2 R. integrifolia Bison Gulch, Alaska BG 10 10 3 1 3 R. integrifolia Cantwell, Alaska CA 10 10 1 4 R. integrifolia Denali Hwy 2, Alaska D2 5 5 1 5 R. integrifolia Denali Hwy 4, Alaska D4 10 10 4 1 6 R. integrifolia Denali Hwy 3, Alaska D3 10 10 1 7 R. integrifolia Little Coal Creek, Alaska LC 10 10 2 1 8 R. integrifolia Peter's Hills, Alaska PH 10 10 1 9 R. integrifolia Hatcher's Pass, Alaska HP 10 10 1 10 R. integrifolia Peter's Cr. Trail, Alaska PC 10 10 1 11 R. integrifolia Thompson Pass, Alaska TP 10 10 2 1 12 R. integrifolia Blueberry Lake, Alaska BL 10 10 1 13 R. integrifolia Crow Pass, Alaska CP 10 10 1 14 R. integrifolia Swetman Mine, Alaska SM 11 10 1 1 15 R. integrifolia Cooper's Mtn, Alaska CM 10 10 1 16 R. integrifolia Carbon Mtn, Alaska CB 10 10 1 17 R. integrifolia Kay Point, Yukon KP 10 10 1 1 18 R. integrifolia Blow River Delta, Yukon BR 9 9 2 19 R. integrifolia Mount Klotz, Yukon MK 1 0 1 1 20 R. integrifolia Quartet Lake, Yukon QL 4 4 1 21 R. integrifolia Ogilvie Mtns 5, Yukon O5 10 10 3 22 R. integrifolia Ogilvie Mtns 3, Yukon O3 2 2 1 2 23 R. integrifolia Ogilvie Mtns 4, Yukon O4 10 10 2 24 R. integrifolia Gillespie Lake, Yukon GL 9 9 3 25 R. integrifolia Pinguicula Lake, Yukon PL 10 10 2 1 26 R. integrifolia North Fork Pass, Yukon NP 10 10 1 27 R. integrifolia Tombstone Valley, Yukon TV 10 10 1 28 R. integrifolia Grizzly Lake, Yukon GR 9 9 4 3 29 R. integrifolia Top of the World, Yukon TW 10 10 1 30 R. integrifolia Keno Hill, Yukon KH 10 10 3 1 31 R. integrifolia North Canol Rd, Yukon NC 1 0 1 1 32 R. integrifolia Rose-Lapie, Yukon RL 10 10 1 1 33 R. integrifolia Outpost Mtn Yukon OM 3 3 1 34 R. integrifolia Kluane Rock Glacier, Yukon KR 10 10 1 35 R. integrifolia Montana Mtn 04, Yukon MT 10 10 1 36 R. integrifolia Montana Mtn 05, Yukon MM 10 10 1 37 R. integrifolia Chuck Creek, BC CC 10 10 3 25
Number Number Number Number Site Site amplified digested sequenced sequenced number Species Site Name Code psbA- psbA- PsbA- ITS trnH trnH trnH 38 R. integrifolia Three Guardsmen's Pass, BC TG 10 10 2 1 39 R. integrifolia Mt. Fetterly, BC MF 10 10 1 40 R. integrifolia Moose Mtn, BC MO 8 8 2 41 R. integrifolia Estshi Creek, BC EC 6 6 1 42 R. integrifolia Hannah, BC HA 9 9 1 43 R. integrifolia Mt. Tommy Jack, BC TJ 3 3 1 44 R. integrifolia Atna, BC AT 6 6 2 1 45 R. integrifolia Insect Creek, BC IC 8 8 2 46 R. integrifolia Hudson Bay Mtn. 06, BC HU 1 1 1 47 R. integrifolia Mt. Couture, BC MC 8 8 2 1 48 R. integrifolia Hudsons Bay Mtn, 04 BC HB 8 8 1 49 R. integrifolia Thornhill Mtn, BC TM 9 9 1 50 R. integrifolia Towustasin Hill, BC TH 1 1 1 1 51 R. integrifolia Bonanza Beach, BC BB 10 10 1 1 52 R. integrifolia Gimli Peak, BC GP 9 9 1 53 R. integrifolia Fisher Peak, BC FP 10 10 1 54 R. integrifolia Reynolds Pass, Montana RT 10 10 1 1 55 R. integrifolia Goat Flats, Montana GF 10 10 1 1 56 R. integrifolia Beartooth Pass, Wyoming BP 10 10 2 1 57 R. integrifolia Medicine Bow Mtn, Wyoming MB 11 11 1 1 58 R. rhodantha Snowy Range, Wyoming SR 10 10 1 1 59 R. rhodantha Uinta Mtns, Utah UM 6 6 1 1 60 R. integrifolia Arapaho Rim, Colorado AR 2 2 0 61 R. integrifolia Above Arapaho, Colorado AA 1 1 0 62 R. rhodantha S. Arapaho Col. Colorado AC 5 5 1 63 R. rhodantha 4th of July Mine, Colorado FM 9 9 1 1 64 R. rhodantha 4th of July Valley, Colorado FV 10 10 1 65 R. integrifolia Loveland Pass, Colorado LP 10 10 1 1 66 R. integrifolia Schofield Pass, Colorado SP 9 9 1 67 R. integrifolia Cottonwood Pass, Colorado CW 9 9 1 1 68 R. integrifolia Handies Meadow, Colorado HM 10 10 1 2 69 R. rhodantha American Basin, Colorado AB 10 10 2 1 70 R. integrifolia La Plata Canyon, Colorado LA 10 10 1 1 71 R. integrifolia Mt Dana, California MD 10 10 1 1 72 R. integrifolia Paiute Pass, California PP 10 10 1 73 R. rosea Nuuk, Greenland NU 1 0 1 1 74 R. rosea Nasarsuaq, Greenland NA 1 0 1 1 75 R. rosea Nunavik HH, Quebec NH 5 0 2 1 76 R. rosea Cap Enrage', New Brunswick CE 4 6 2 1
26
2.3.2.3 RFLP sampling of the psbA-trnH region
Using the samples initially sequenced for the psbA-trnH region (Table 3), I searched for variable restriction sites using the on-line freeware program Webcutter 2.0 (Heiman,
1997). I identified five restriction enzymes (ApoI, BfaI, BstXI, MseI, and NsiI) for further testing (Table 5). The effectiveness of each restriction enzyme (RE) was tested on four amplified samples and the products run on 2% TBE agarose gels for approximately 45 minutes with a 50 bp reference ladder, followed by staining and observation under UV light.
Of the five restriction enzymes (RE’s) that cut the psbA-trnH region at variable restriction sites in the sequenced samples, four produced repeatable and unambiguous banding patterns.
Table 5: Restriction Enzyme recognition sequences and numbers of restriction sites for the psbA-trnH region in Rhodiola integrifolia.
Enzyme & supplier Recognition Sequence Number and Positions of variable restriction sites
APO1, New England Biolabs R/AATTY 3 cut sites. Cuts once or twice at position 86, 243 or 293 BstXI, New England Biolabs CCANNNNN/NTGG 1 cut site. Does not cut or cuts once at position 244 MseI, New England Biolabs T/TAA 4 cut sites. Cuts 1 to 3 times at positions 133, 167, 202, or 267 NsiI, New England Biolabs ATGCA/T 1 cut site. Does not cut or cuts once at position 132
I performed restriction digests using the four selected REs on each of 614 samples amplified for the psbA-trnH region. Gel concentrations and migration times were adjusted in order to optimize band resolution. For ApoI and MseI the optimal gel concentration was 3% run on a single tier for approximately 70 to 75 minutes. BstXI and NsiI, yielding fewer bands, could be run in two tiers on a 2% gel for approximately 30 to 40 minutes. The 27 combination of the four restriction enzymes yielded a total of 11 variable restriction sites over all samples examined (Table 6).
Table 6: Restriction digest cut site positions and patterns of cut sites for each haplotype found in psbA-trnH sequences of R.integrifolia. Numbers below restriction enzyme names refer to the 5’ position along the psbA-trnH sequence where the cut site or indel occurs.
Haplotype ApoI ApoI BstXI MseI MseI MseI NsiI ApoI MseI MseI Number 243 293 244 133 167 267 132 18-23 72-79 94-99 1 0 0 0 0 1 0 0 0 0 0 2 0 1 1 0 1 0 0 0 0 0 3 0 0 1 0 0 0 0 0 0 0 4 0 0 1 1 1 0 1 0 0 0 5 0 0 1 0 1 0 0 0 0 0 6 1 0 0 0 1 0 0 0 0 0 7 0 0 1 0 1 1 0 0 0 0 8 0 0 1 0 1 0 0 1 0 0 9 0 1 1 0 1 1 0 0 0 0 10 0 0 1 0 0 0 0 0 0 1 11 0 0 1 0 1 0 0 0 1 0
2.3.2.4 Restriction site haplotype determination
From photographs of gels I could detect restriction digest fragments corresponding to the presence or absence of restriction sites within the psbA-trnH spacer. BstXI and NsiI bands were easily distinguishable, and variation in fragment length due to the presence/absence of indels was discernable in BstXI banding patterns. The various combinations of fragments and banding patterns found for ApoI and MseI were more complex (Figure 5).
By cross-referencing with sequence data and comparing gel patterns with the 50 base pair reference ladder on the gels, I was able to ascertain the lengths of restriction fragments in the digest photographs. If band lengths did not add up to the approximate total length of the PCR product (375 bp), other scenarios were considered. These included the presence
a) b)
Figure 5: Gel images of ApoI (a), and MseI (b) restriction enzyme banding patterns. Band sizes are given once for each banding
pattern. Bands denoted in the column to the right of the image as series of 0’s and 1’s. 28
29 of more than one band of the same length, the presence of very short bands that migrated to the end of the gel and thus were not detected, and the possibility of length variation in the PCR product (resulting from an insertion or deletion). In several cases these irregularities were resolved by sequencing the samples in question. I determined restriction digest haplotypes by combining the fragment patterns and lengths of all four restriction enzyme digests. Each unique combination of fragment patterns and indels was deemed a haplotype and given a numeric code (Table 6).
2.4 Data Analyses
2.4.1 Phylogenetic analyses
2.4.1.1 Sequence assembly and alignment
I assembled forward and reverse sequence chromatograms into consensus sequences using SeqMan II (SeqMan 5.07, DNAStar Inc., Madison, WI). Sequences were aligned in ClustalX 1.81 (Thompson et al. 1997). All sequences were checked against sequence traces (chromatograms). I used the online service “Reverse
Complement” (http://www.bioinformatics.org/ sms/index.html) to get complementary sequences where needed. In preparation for phylogenetic analyses, the aligned and trimmed sequence datasets were converted to NEXUS format (Maddison et al. 1997) using ClustalX.
2.4.1.2 ITS Analyses
I determined ITS sequence haplotypes for R. integrifolia and R. rhodantha by grouping similar sequences from the ClustalX alignments. These groupings were confirmed when the sequences were analyzed using the freeware computer program TCS 30 version 1.21 (Clement et al. 2000) (see section 2.4.2). Each R. integrifolia and R. rhodantha ITS sequence haplotype was given a lower case letter code.
For phylogenetic analyses, two different ITS datasets were used. The first was made up of sequences of 16 species of Rhodiola (including R. rosea) obtained from
Genbank (Mayuzumi and Ohba, 2002) (Appendix 2), together with six sequences of R. integrifolia, one of R. rhodantha and two of R. rosea from my samples. This dataset was used to determine the phylogenetic position of the three North American Rhodiola species (R. integrifolia, R. rosea and R. rhodantha) within the genus. On the basis of its reportedly very close relationship with the genus Rhodiola (Mayuzumi and Ohba, 2004), a Genbank sequence of Pseudosedum sp. was used here as an outgroup. The second dataset consisted of 19 individuals of R. integrifolia and one of R. rhodantha together with one sequence of R. rosea used here as an outgroup. Only individuals for which both
ITS and psbA-trnH sequences were available were included in this dataset which was used to clarify the position of R. integrifolia with respect to the other two North
American Rhodiola species.
2.4.1.2.1 Maximum Parsimony and Maximum Likelihood Analyses using PAUP
PAUP 4.0 beta test version 4.0b (Swofford, 2002) was used to analyze each dataset for the best tree, using three different methods: neighbour-joining, maximum parsimony (MP), and maximum likelihood (ML). Initially, neighbour-joining trees were produced. I then carried out heuristic searches using the Maximum Parsimony (MP) optimality criterion. I performed each heuristic search with 100 replicates added randomly (holding one tree at each step). In all analyses gaps were treated as missing data (causing one single base repeat to be omitted). Starting trees were obtained stepwise 31 and added in a random sequence. Tree-bisection–reconnection (TBR) branch swapping, and “multrees” were in effect. All characters were treated as unordered and equally weighted. A bootstrap consensus tree was estimated from 500 bootstrap replicates.
In order to determine the best maximum likelihood (ML) model I used the online version of ModelTest 3.8, ModelTest Server 1.0 (http://darwin.uvigo.es/software/ modeltest_server.html) (Posada, 2006). This freeware program allows the user to determine the most appropriate model of nucleotide substitution to use for a specific dataset in a maximum likelihood phylogenetic analysis. It selects from among 56 models and presents an output file with the best model based on both Hierarchical Likelihood
Ratio Tests (hLRTs) and the Akaike Information Criterion (AIC), with a set of commands that can be inserted into a PAUP block or added from the command-line in a terminal interface version of PAUP (Posada and Crandall, 1998). Although the hLRTs have been the more often used model selection strategy, I chose the AIC, considered by
Posada & Buckley (2004) to be the superior approach. The optimal ML analysis model was determined to be the Tamura/Nei (1993) equal base frequency model with gamma shape parameter distribution (TrNef+G), (AIC), which assumes base frequencies to be equal and the proportion of invariable sites to be zero. Starting trees were obtained via stepwise addition with random addition of sequences. Any branch lengths less than or equal to 1e-08 were collapsed (creating polytomies). Maximum likelihood phylogenetic analyses in PAUP were run on the two 600 bp ITS sequence datasets following this model.
32
2.4.1.3 Phylogenetic analyses of Chloroplast DNA sequences
I assembled and aligned sequences of the psbA-trnH spacer region of the chloroplast genomes of R. integrifolia, R. rhodantha and R. rosea as outlined above.
Sequence haplotypes for R. integrifolia and R. rhodantha were determined by grouping similar ClustalX sequence alignments, and haplotype matrices and networks were produced as outlined below. Each sequence haplotype was given an upper case letter code. Rhodiola rosea was used as the outgroup in all cpDNA sequence and RFLP analyses. Analyses were performed on datasets in NEXUS format containing one example of each haplotype. Indels in the chloroplast sequences were treated as single characters, as was a four-base inversion (See Appendix 3 for sequence alignments).
Two sets of psbA-trnH sequences were used in phylogenetic analyses. The first was made up of one sequence of each haplotype. This included 27 sequences of R. integrifolia, one R. rhodantha sequence, and one sequence of R. rosea included as the outgroup. The second dataset was made up of a subset of the samples that were also sequenced for ITS. This dataset contained 19 R. integrifolia sequences and one R. rhodantha sequence.
Phylogenetic trees were constructed for both datasets according to both the
Maximum Parsimony and the Maximum Likelihood optimality criteria. ModelTest was run on these datasets, as described above, to determine the optimal model for maximum likelihood phylogenetic analyses. ML analysis was performed by PAUP following the
TIM+I+G model (AIC) using nucleotide frequencies calculated from the dataset
(A=0.3872, C=0.1486, G=0.1186 and T=0.3456). Starting trees were obtained via 33 stepwise addition with random addition of sequences. Any branch lengths less than or equal to 1e-08 were collapsed (creating polytomies).
2.4.2 Haplotype Network Estimation
Pairwise difference matrices were constructed manually by comparing all pairs of haplotypes in a dataset. The number of character differences between each pair of restriction site or sequence haplotypes was determined and recorded in a table.
In restriction site data, a character difference consists of the presence or absence of a restriction site. For my analyses, although each of the four restriction enzymes resulted in a distinct pattern of restriction fragments, it was necessary to make sure that a mutation causing variation with more than one cutter was not counted twice. Through comparison of restriction site cut patterns with sequences I found that the NsiI cut site and one MseI cut site were affected by the same mutation, although the recognition sequences were different. These were therefore counted as one character.
For the sequence haplotype dataset a character difference consisted of the presence or absence of a base substitution, indel, tandem repeat or inverted complement.
I treated all indels, tandem repeats and inverted complements as single characters as explained above.
From the psbA-trnH restriction digest haplotype matrix I created a haplotype network by hand. I first linked all the haplotypes that differed by a single character into one-step networks, then added haplotypes that differed by two characters at the most parsimonious position. This process was continued, successively adding haplotypes that were separated by three, four, or five or more character differences. These additions either linked up two or more of the one-step networks, or were added to an existing 34 network. When all of the haplotypes were connected by the number of steps corresponding to the number of character differences in the matrix, the network was complete.
I used TCS to calculate an absolute distance matrix of the psbA-trnH sequence haplotypes linking all the sampled haplotypes by the least number of mutational steps, based on statistical parsimony. When TCS creates a distance matrix it also computes the probability of parsimony for the numbers of mutational differences between haplotypes until the probability just exceeds 0.95. This number is the greatest number of steps between haplotypes that can be legitimized by the ‘parsimony’ criterion (Clement et al,
2003). The program provides a pairwise distance matrix, the probabilities of parsimony and a cladogram (haplotype network) that connects all the haplotypes according to the minimum number of mutational steps, with missing intermediate steps represented by open circles within the network.
I prepared input files for TCS by modifying NEXUS files created in ClustalX. TCS was not used to construct the restriction site distance matrix; the probability of parsimony cannot be calculated for RFLP haplotypes since for RFLPs the parsimony connection limit could vary depending on the number of shared sites (see Clement et al., 2005).
Both haplotype networks included closed loops indicating more than one possible minimum route between two haplotypes. The single loop in the restriction site network was resolved on the basis of the geographical proximity of the haplotype ranges. Loops in the psbA-trnH sequence haplotype network were resolved using the topology of the
MP and ML trees produced in phylogenetic analyses of this dataset.
35
2.4.3. Nested Clade Phylogeographic Analysis of RFLP data
Nested clade phylogeographic analysis (NCPA), a relatively new but already controversial statistical technique (see Knowles and Maddison, 2002; Beaumont and
Panchal, 2008; Garrick et al, 2008; Knowles, 2008; Petit, 2008, and Templeton, 2008), tests phylogeographic hypotheses through “an evolutionarily nested analysis of the spatial distribution of genetic variation” (Templeton et al. 1995; Templeton, 1998). The technique aims to differentiate between the effects of current evolutionary genetic processes (gene flow, genetic drift) and historical events (fragmentation, range expansion) on the geographic structuring of genetic variation (Templeton et al, 1987;
Templeton, 1998, 2004; Posada et al., 2000).
Nested clade phylogeographical analysis (NCPA) was performed on the psbA- trnH restriction site haplotype data. I constructed a nested cladogram according to the nesting algorithm of Templeton et al. (1987), using my haplotype network constructed by hand (Templeton et al., 1987; 1993).
GEODIS 2.6 (Posada et al, 2000), a freeware computer program designed to run
NCPA, initially runs a permutation analysis to test the null hypothesis of no association between haplotype diversity and geographic distribution. It then calculates two kinds of distance measures from the haplotype data. Average clade distance (DC) is a measure of the spatial spread of a clade calculated as the average distance of individuals within a clade from the geographic centre of that clade. The nested clade distance (DN), which indicates how widespread a certain clade is relative to the clade that contains it, is calculated as the average distance from each individual within a clade of interest to the 36 geographic centre of all individuals within all the clades contained within the same higher nesting level clade. The statistical significance of these two measures of distance between clades is calculated by running random permutation tests against a null hypothesis of random geographic association (Templeton, 1998; 2004; Pfenninger and
Posada, 2002).
The input file for GEODIS 2.6 was based on the nested cladogram for the psbA- trnH restriction-site dataset. To retain a level of statistical significance ≥ 0.95 (p < 0.05),
1000 permutations of the analysis were performed. The null hypothesis was rejected by the first test if significant associations were found to exist between clade and geographical location, between within-clade haplotype diversity and geographic location.
Contrasts of DC and DN between tip and interior clades were then evaluated using
Templeton’s inference key for the nested haplotype tree analysis of geographical distances (Appendix 4), to infer the possible types of population demographic processes influencing the present range of the haplotypes.
2.4.4 Geographic Mapping of cpDNA haplotypes
I mapped the geographic distribution of the psbA-trnH haplotypes of R. integrifolia and R. rhodantha, using the freeware program MapPad (Keltner and Maher,
1996). On each map, the locations of all populations with a particular restriction site haplotype were plotted. Within each of these, subgroups that corresponded to one of the sequence haplotypes were depicted by a separate symbol.
The maps of the restriction site and sequence haplotypes were used to assess overall geographic patterns of genetic diversity (for example, the relative haplotype diversity in unglaciated and previously glaciated regions). In combination with the 37 results of phylogenetic analyses, they were also used to infer possible directions of migration in R. integrifolia, including potential dispersal routes. 38
Chapter 3 RESULTS
3.1 ITS sequence analysis and relationships in Rhodiola
3.1.1 Summary of ITS sequence variation
The aligned length of the ITS sequence data set was 600 base pairs, with lengths of individual sequences varying from 595 to 600 bases (Appendix 5). The average G/C content for all the Rhodiola species combined was 53.6%. For the complete ITS data set
(with all 19 Rhodiola species), the ITS region contained 31 variable sites (5.2% of the sequence); the dataset of only R. integrifolia sequences contained 8 variable sites (1.3%)
(Table 7). Within R. integrifolia, the ITS1 region included four base substitutions (all transitions) and a single one-base insertion, and the ITS2 region included three transitions
(Table 7). In 31 samples of R. integrifolia, six distinct ITS sequences were present. All four samples of R. rhodantha had the same ITS sequence, which was different from any of the R. integrifolia sequences (Appendix 5, Table 8).
3.1.2 Phylogenetic analyses of the ITS region of the nuclear genome
Maximum parsimony (MP) analysis of 19 species of Rhodiola (with
Pseudosedum from Genbank as outgroup) yielded 96 minimum-length trees with a length of 166 steps. The consistency (CI) and retention (RI) indices were 0.8373 and 0.8911 respectively. Maximum likelihood (ML) analysis of this data set, carried out using the
TrNef+G model of nucleotide substitution yielded a single most likely tree with a –ln likelihood value of 1843.83. The 50% majority tree obtained from MP bootstrap analysis and the ML tree produced from this dataset are presented in Figure 6. In both trees the R. 39
Table 7: Characters varying in ITS sequences of Rhodiola integrifolia and R. rhodantha as compared with 16 other species of Rhodiola. Bolded entries represent character changes occurring within and contributing to the variability within R. integrifolia.
5' Mutation type and 5' Mutation type and position description position description 4 transition G - A 205 transition T - C 15 transversion C - G 391 transition G - A 32 transition C - T 394 transition C - T 42 transition G - A 398 transversion C - A 48 transition G - A 400 transition A - G 55 transition G - A 404 transition A - G 64 transversion C - A 434 transition G - A 85 transition T - C 437 transversion T - A 99 transition A - G 438 transition T - C 114 transversion A - C 452 transition G - A 116 transition T - C 481 transition C - T 154 transition T - C 485 transition A - G 160 transversion T - G 514 transversion G - T 163 transition G - A 519 transition G - A 176 transition C - T 521 transversion C - A 194 insertion G
integrifolia sequences form a strongly supported clade (96% bootstrap support). Within this clade are two subclades made up of sequence variants “a” to “d” and “e + f” respectively, each with 87% bootstrap support. In both trees R. rhodantha and R. integrifolia are sister species (95% bootstrap support) and the clade formed by these two species is sister to a clade including the Eurasian species R. wallichiana (Hook.) S. H. Fu. and R. serrata H. Ohba (73% support). A separate, larger clade made up of 11 Rhodiola species, including R. rosea, is distinct from the first group. Rhodiola rosea is most closely related to R. ishidae (Miyabe & Kudo) H. Hara, and these two species form a clade sister to a clade made up of seven other Asian Rhodiola species (Figure 6). These analyses indicate that R. integrifolia and R. rosea are not closely related within the genus
Rhodiola, despite their similar morphology. On the other hand, R. integrifolia and R. rhodantha, which are morphologically distinct, are closely related sister species. 40
Table 8: Summary of cpDNA and ITS variation in western North American Rhodiola (including RFLP and sequence haplotypes and variants). Populations are arranged by latitude (north to south) within species.
psbA-trnH psbA-trnH ITS Site Site RFLP Sequence Sequence number Site Name Code Haplotype(s) Haplotype(s) Variant Rhodiola integrifolia populations north of 60° N. latitude 17 Kay Point, Yukon KP 1 A d 18 Blow River Delta, Yukon BR 1 A 1 Pinnell Mtn. Alaska PM 1,3,6 B, C c 19 Mount Klotz, Yukon MK N/A A a 20 Quartet Lake, Yukon QL 1 A 21 Ogilvie Mtns. 5, Yukon O5 1,4,5,6 D, E, F 22 Ogilvie Mtns. 3, Yukon O3 6 E a 23 Ogilvie Mtns. 4, Yukon O4 1, 3 B, D 24 Gillespie Lake, Yukon GL 1,3,6 B, G 25 Pinguicula Lake, Yukon PL 4, 7 H, I a 26 North Fork Pass, Yukon NP 1, 5 F 27 Tombstone Valley, Yukon TV 1, 8 J 28 Grizzly Lake, Yukon GR 1,4,7 K, L a 29 Top of the World, Yukon TW 1 A 30 Keno Hill, Yukon KH 1,6,8 E, M, N a 2 Bison Gulch, Alaska BG 1, 9 N, O a 31 North Canol Rd., Yukon NC N/A F a 3 Cantwell, Alaska CA 1 A 4 Denali Hwy. 2, Alaska D2 5 P 5 Denali Hwy. 4, Alaska D4 1, 6 Q a 6 Denali Hwy. 3, Alaska D3 5 P 7 Little Coal Creek, Alaska LC 1, 9 A, R a 8 Peter's Hills, Alaska PH 5 P 9 Hatcher's Pass, Alaska HP 1 S 32 Rose-Lapie, Yukon RL 5 T a 10 Peter's Cr. Trail, Alaska PC 1 S 11 Thompson Pass, Alaska TP 1, 5 A, U b 12 Blueberry Lake, Alaska BL 1, 5 U 13 Crow Pass, Alaska CP 5 U 33 Outpost Mtn. Yukon OM 4 H 14 Swetman Mine, Alaska SM 1 A a 15 Cooper's Mtn., Alaska CM 1 A 34 Kluane Rock Glacier, Yukon KR 4, 5 T 16 Carbon Mtn., Alaska CB 1 A 35 Montana Mtn. 04, Yukon MT 1, 4 A 36 Montana Mtn. 05, Yukon MM 4 H Rhodiola integrifolia populations south of 60° N. and north of 49° N. latitude 37 Chuck Creek, BC CC 1, 4, 5 A, H, T 38 Three Guardsmen's Pass, BC TG 1, 4 A a 39 Mt. Fetterly, BC MF 1 A 40 Moose Mtn., BC MO 1, 7 A, I
41
psbA-trnH psbA-trnH ITS Site Site RFLP Sequence Sequence number Site Name Code Haplotype(s) Haplotype(s) Variant
Rhodiola integrifolia populations south of 60° N. and north of 49° N. latitude 41 Estshi Creek, BC EC 1 A 42 Hannah, BC HA 1 A 43 Mt. Tommy Jack, BC TJ 1, 7 I 44 Atna, BC AT 7 I b 45 Insect Creek, BC IC 1, 7 A, V 46 Hudson Bay Mtn. 06, BC HU 1 A 47 Mt. Couture, BC MC 1, 10 A b 48 Hudsons Bay Mtn. 04 BC HB 1 A 49 Thornhill Mtn., BC TM 7 I 50 Towustasin Hill, BC TH 10 W b 51 Bonanza Beach, BC BB 5 P a 52 Gimli Peak, BC GP 5 T 53 Fisher Peak, BC FP 5 F Rhodiola integrifolia populations south of 49° N. latitude 54 Reynolds Pass, Montana RT 5 F 55 Goat Flats, Montana GF 5 P 56 Beartooth Pass, Wyoming BP 6 X e Medicine Bow Mtn., 57 Wyoming MB 11 Z f 60 Arapaho Rim, Colorado AR 11 61 Above Arapaho, Colorado AA 11 65 Loveland Pass, Colorado LP 11 Z f 66 Schofield Pass, Colorado SP 11 AA 67 Cottonwood Pass, Colorado CW 11 AA f 68 Handies Meadow, Colorado HM 11 AA f 70 La Plata Canyon, Colorado LA 11 Y f 71 Mt Dana, California MD 7 AB f 72 Paiute Pass, California PP 7 I
Rhodiola rhodantha populations south of 49° N. latitude 58* Snowy Range, Wyoming SR 11 AA g 59* Uinta Mtns., Utah UM 11 AA g 62* S. Arapaho Col, Colorado AC 11 AA 63* 4th of July Mine, Colorado FM 11 AA g 64* 4th of July Valley, Colorado FV 11 AA 69* American Basin, Colorado AB 11 AA g
42
Pseudosedum Pseudosedum R.integrifolia a R. chrysanthemifoliassp sacra R. sinuata R.integrifolia b 87 R.chrysanthemifolia ssp chrysanthemifolia R.integrifolia c 96 R. integrifolia d R. wallichiana R. integrifolia e R. serrata 95 87 R.integrifolia f R. rhodantha R. integrifolia f 73 R.rhodantha R. wallichiana R. integrifolia e 98 R. serrata R. integrifolia a R. integrifolia b R. nepalica R. integrifolia c R. bupleuroides R. integrifolia d R. cretinii R. humilis 51 R. macrocarpa R. nobilis R. heterodonta R.yunnanensis R. fastigiata 95 R. ishidae R. dumulosa 51 R. rosea New Brunswick R. roseaJapan 66 R. roseaNew Brunswick R. rosea Greenland 52 65 R. roseaGreenland R. rosea Japan 52 R. bupleuroides R. ishidae R. nobilis 84 R. heterodonta R. macrocarpa R. yunnanensis R. cretinii R. sinuata R. nepalica R.chrysanthemifolia ssp sacra R.chrysanthemifolia ssp chrysan. R. fastigiata R. dumulosa R. humilis 0.1 a. b.
Figure 6: Phylogenetic trees for 18 species of Rhodiola based on ITS. (a) Maximum parsimony 50% majority rule consensus tree, (b) Maximum likelihood tree. The outgroup is Pseudosedum. Lower case letters next to R. integrifolia leaves are ITS sequence variants. 42
43
3.1.3 Geographic distributions of ITS sequence variants of R. integrifolia and R. rhodantha
ITS sequence variants “a” and “b” (Appendix 5, Table 8) were found in populations extending from unglaciated parts of Alaska and the Yukon, south through
British Columbia to approximately latitude 49º N. Sequence variants “c” and “d” were both found only in the far north of the sampled range of R. integrifolia (northeastern
Alaska and northwestern Yukon). Rhodiola integrifolia ITS sequence variants “e” and
“f”, and R. rhodantha sequence variant “g” were only found at latitudes south of the
Wisconsinan glacial maximum. In both trees presented in Figure 6, the more northerly sequence variants “a” to “d” and the southern variants “e” and “f” form separate subclades within R. integrifolia.
3.2 Chloroplast DNA sequence analyses and comparison of nuclear and chloroplast phylogenies
3.2.1 Summary of psbA-trnH sequence variation
The aligned length of the psbA-trnH spacer region of R. integrifolia and R. rhodantha was 300 base pairs (Appendix 3), with G/C content averaging 28.6%. The region contained 23 polymorphic characters, including substitutions at 19 base positions
(representing 84% of all ingroup differences), three indels (including two tandem repeats), and one inversion (Table 9). Of these characters, 13 were phylogenetically informative. Twenty-three intraspecific differences within a short sequence is a high level of intraspecific variation, but the psbA-trnH intergenic spacer region is recognized to have high nucleotide variation (Stǒrchová and Olson, 2007; Kress et al., 2005). A four base-pair inversion occurred between approximately positions 222 44
Table 9: Characters varying in psbA-trnH sequences of Rhodiola integrifolia and R. rhodantha.
Char. # 5' position Mutation type and description
1 18-23 indel CTAGTC
2 33 transversion A - C
3 41 transversion C - A
4 60 transition A - G
5 72-79 tandem repeat TTTTCTTA
6 83 transition G - A
7 91 transversion T - G
8 97-102 tandem repeat GTAAAT
9 119 transversion A - C
10 129 transversion T - G
11 133 transversion C - A
12 140 transversion G - T 13 142 transversion T - G 14 178 transition A - G
15 193 transversion T - G 16 201 transversion A - C
17 204-207 inverted complement GAAA to TTTC
18 210 transversion T - G
19 210 transition G - A
20 218 transversion A - C
21 229 transversion A - T
22 230 transition T - C
23 230 transversion A - C
24 258 transition A - G
25 260 transversion G - T
and 225 from the beginning of the 5’ end of the psbA sequence. In twelve haplotypes found in R. integrifolia and R. rhodantha, the sequence reads (5’ to 3’) GAAA (Table 9)
(Appendix 3). In the other 16 haplotypes (found only in R. integrifolia), the sequence (5’ to 3’) reads TTTC. In sequences of R. rosea the base sequence is TAAA. A conserved 45 stem loop structure consisting of 44 base pairs was discovered near the 3’ end of the sequences. The four base pair inversion falls at the centre of this region of the spacer, and forms the loop of the structure. This stem loop structure is a highly conserved artifact in the psbA-trnH intergenic spacer in all angiosperms (Stǒrchová and Olson,
2007).
Sequences from 92 individuals of R. integrifolia yielded 28 distinct sequence haplotypes. One of these, haplotype AA, was also found in R. rhodantha. Sequences of the psbA-trnH region of R. rosea differed in at least four indels and seven base substitutions from those of the other two species.
3.2.2 Phylogenetic Analyses of the PsbA-trnH region of the cpDNA
Phylogenetic analysis was performed on a data set consisting of a single sample of each haplotype, with R. rosea as outgroup. Since sequence haplotype AA was identical in both R. integrifolia and R. rhodantha, a sequence of haplotype AA from a sample of R. rhodantha was used. In this way the position of R. rhodantha within the tree could be confirmed. The aligned length of sequences was 330 base pairs. Indels and inversions were treated as single characters.
The MP analysis produced 261,300 equally parsimonious trees 41 steps in length.
The overall consistency index (CI) was 0.7317, and the CI excluding uninformative characters was 0.61. The retention index was 0.7442, resulting in a rescaled CI of
0.5445. The overall homoplasy index was 0.2683 (0.3929 with uninformative characters excluded). This low consistency obtained with the MP analysis suggested that this dataset was better suited to ML analysis (Li, 1997). The -Ln likelihood of the best ML tree produced was 609.49. 46
A majority rule consensus tree of the MP trees and the maximum likelihood (ML) tree produced from this dataset are presented in Figure 7. Both trees are incompletely resolved; however, some subclades within R. integrifolia were present in both trees. For example, haplotypes Q and G are sister to the rest of the R. integrifolia sequences, and five two-haplotype subclades (F–D, B–W, O–R, M–J, and S–A) are supported in both trees. In addition, haplotype U is sister to the F-D clade, and haplotypes Y, Z and AA form a clade. The R. rhodantha haplotype AA (which also occurred in some populations of R. integrifolia) is embedded within the R. integrifolia clade.
3.2.3 Comparison of nuclear and chloroplast genome sequences
The correspondence of nuclear and chloroplast phylogenies of R. integrifolia was examined using 22 individuals of R. integrifolia and one individual of R. rhodantha for which both nuclear (ITS) and chloroplast (psbA-trnH) sequences were available. These included samples representing all 11 restriction site haplotypes and 20 of the 28 sequence haplotypes identified in the psbA-trnH region. Bootstrap consensus trees based on nuclear and cpDNA data for these samples are presented in Figure 8. In the ITS phylogeny, R. rhodantha and R. integrifolia are sister species, and each species has specific ITS variants. In contrast, in the cpDNA phylogeny, the R. rhodantha sequence is embedded within R. integrifolia, and sequence haplotype AA occurs in both R. integrifolia and R. rhodantha (Figure 8, Table 8). The ITS phylogeny is concordant with morphological features of the two species, with both of these types of data suggesting 47
Figure 7: Phylogenetic trees for populations of R. integrifolia and R. rhodantha based on sequences of the chloroplast PsbA-trnH region, with R. rosea as outgroup. (a) 50% majority rule consensus of 261,300 MP trees; (b) maximum likelihood tree. Consensus support (50% maj. MP), and bootstrap values (in parentheses) are given on tree a. See Table 8 for sequence haplotype codes. 4 7
48
ITS (Nuclear genome) PsbA-trnH (Chloroplast genome) R. rosea R. rosea h R. rhodantha (CO) R. integrifolia (AK) O
a R. integrifolia (AK) M a R. integrifolia (YT) K a R. integrifolia (YT) W
a R. integrifolia (AK) P a R. integrifolia (YT) U a R. integrifolia (YT) G
a R. integrifolia (BC) L 65 a R. integrifolia (YT) I a R. integrifolia (YT) R 85 a R. integrifolia (BC) F
a R. integrifolia (AK) R. integrifolia (WY) X 60 a R. integrifolia (YT) C 52 b R. integrifolia (BC) J
b R. integrifolia (BC) E c D 65 R. integrifolia (AK) 97 c R. integrifolia (AK) V
e R. integrifolia (WY) R. rhodantha (CO) B
88 f R. integrifolia (CO) Z 70 f R. integrifolia (CO) A
Figure 8: Comparison of bootstrap consensus trees from nuclear and chloroplast DNA regions of R. integrifolia and R. rhodantha. Nuclear sequence variants (lower case letters), and cpDNA haplotypes (upper case letters) are to right/left (respectively) of species name and location code. (Location codes: BC = British Columbia, YT = Yukon, AK = Alaska, WY = Wyoming, CO = Colorado.) 4 48 7
49 that the two species are quite distinct. In combination with these results, the occurrence of common cpDNA sequences in R. rhodantha and R. integrifolia suggests that hybridization between the two species may have occurred at some time in the past, resulting in a chloroplast capture event
3.3 Chloroplast DNA patterns and the phylogeography of R. integrifolia
3.3.1 Restriction Enzyme Haplotype Diversity and Distributions.
For the psbA-trnH region of the chloroplast genome, I found 11 distinct restriction-site haplotypes (Table 10). Within these, I identified 28 sequence haplotypes
(Table 11). The geographic distributions of the restriction site and sequence haplotypes are presented in Figures 9a - k.
Of the eleven R. integrifolia psbA-trnH restriction site haplotypes, four (#1, #5,
#6, and #7) were relatively widespread and the rest were more localized (Table 10,
Figures 9a-k). Of the localized haplotypes, five (#2, #3, #4, #8, and #9) were strictly northern, one (#11) was strictly southern, and one (#10) was found only in the Queen
Charlotte Islands and the adjacent mainland of BC.
Of the 64 populations of R. integrifolia surveyed for restriction site variation, 29 were from the glaciated region, 23 were from areas within or adjacent to the Beringian refugium, and 12 were from south of the Wisconsinan glacial boundary (Table 10).
Northern populations tended to show higher genetic variation. Populations from within
Beringia averaged 1.69 haplotypes per population, and 52% of these populations were polymorphic. Populations within previously glaciated areas of British Columbia averaged 1.41 haplotypes per population, and 38% were polymorphic (all of the 50 populations with multiple haplotypes occurred north of approximately latitude 55). All populations south of the glacial boundary, and within the glaciated region in southern
BC, contained only a single haplotype.
Table 10: Distribution of psbA-trnH restriction site haplotypes among sampled populations of Rhodiola integrifolia and R. rhodantha, arranged within species by latitude from north to south. A total of 612 individuals (from 70 populations) were sampled for RFLP’s. Haplotype # 1 2 3 4 5 6 7 8 9 10 11 # of Haplotypes Species Population #, name, location in population R. integrifolia populations north of 60° N. latitude R. integrifolia 17 Kay Point Camp, Yukon 10 1 R. integrifolia 18 Blow River Delta, Yukon 8 1 R. integrifolia 1 Pinnell Mtn. Trail, Alaska 1 4 5 3 R. integrifolia 20 Quartet Lake. Yukon 4 1 R. integrifolia 21 Ogilvie site 5, Yukon 1 2 5 2 4 R. integrifolia 22 Ogilvie site 3. Yukon 2 1 R. integrifolia 23 Ogilvie site 4, Yukon 7 3 2 R. integrifolia 24 Gillespie Lk, Yukon 3 1 5 3 R. integrifolia 25 Pinguicula Lake, Yukon 2 8 2 R. integrifolia 26 North Fork Pass, Yukon 2 8 2 R. integrifolia 27 Tombstone Valley, Yukon 2 8 2 R. integrifolia 28 Grizzly Lake, Yukon 2 1 1 3 R. integrifolia 29 Top of the World, Yukon 10 1 R. integrifolia 30 Keno Hill, Yukon 7 1 2 3 R. integrifolia 2 Bison Gulch, Alaska 9 1 2 R. integrifolia 3 Cantwell, Alaska 10 1 R. integrifolia 4 Denali Hwy 2, Alaska 5 1 R. integrifolia 5 Denali Hwy 4, Alaska 10 1 R. integrifolia 6 Denali Hwy 3, Alaska 10 1 R. integrifolia 7 Little Coal Creek, Alaska 1 9 2 R. integrifolia 8 Peter's Hills, Alaska 10 1 R. integrifolia 9 Hatcher's Pass, Alaska 10 1 R. integrifolia 32 Rose-Lapie Pass, Yukon 10 1 R. integrifolia 10 Peter's Creek Trail, Alaska 10 1 R. integrifolia 11 Thompson Pass, Alaska 5 5 2 R. integrifolia 12 Blueberry Lake, Alaska 2 8 2 R. integrifolia 13 Crow Pass, Alaska 10 1 R. integrifolia 33 Outpost Mountain, Yukon 3 1 R. integrifolia 14 Swetman Mine Rd, Alaska 10 1 R. integrifolia 15 Cooper's Mtn, Alaska 10 1 R. integrifolia 34 Kluane Rock Glacier, Yukon 8 2 2 R. integrifolia 16 Carbon Mtn, Alaska 10 1 51
Haplotype # 1 2 3 4 5 6 7 8 9 10 11 # Haplotypes Species Population #, name, location /population R. integrifolia 35 Montana Mountain, Yukon 8 2 2 R. integrifolia 36 Montana Mtn, Yukon 10 1 R. integrifolia populations north of 49° N. latitude R. integrifolia 37 Chuck Creek, BC 5 3 2 3 R. integrifolia 38 3 Guardsmen's 2 8 2 R. integrifolia 40 Moose Mountain, BC 7 1 2 R. integrifolia 41 Estshi Creek, BC 6 1 R. integrifolia 42 Hannah, BC 9 1 R. integrifolia 43 Mt. Tommy Jack, BC 2 1 2 R. integrifolia 44 Atna, BC 6 1 R. integrifolia 45 Insect Creek, BC 5 3 2 R. integrifolia 46 Mt. Couture, BC 7 1 2 R. integrifolia 47 Hudson Bay Mt 06, BC 1 1 R. integrifolia 48 Hudson Bay Mt 04, BC 8 1 R. integrifolia 49 Thornhill Mountain, BC 9 1 R. integrifolia 50 Towustasin Hill, BC 1 1 R. integrifolia 51 Bonanza Beach, BC 10 1 R. integrifolia 52 Gimli Peak, BC 9 1 R. integrifolia 53 Fisher Peak, BC 10 1 R. integrifolia populations south of 49° N. latitude R. integrifolia 54 Reynolds Pass Trail, Montana 10 1 R. integrifolia 55 Goat Flats, Montana 10 1 R. integrifolia 56 Beartooth Pass, Wyoming 10 1 R. integrifolia 57 Medicine Bow Mtn, Wyoming 11 1 R. integrifolia 60 Arapaho Rim Trail, Colorado 2 1 R. integrifolia 61 Above Arapaho Col, Colorado 1 1 R. integrifolia 65 Loveland Pass, Colorado 10 1 R. integrifolia 66 Schofield Pass, Colorado 9 1 R. integrifolia 67 Cottonwood Pass, Colorado 9 1 R. integrifolia 68 Handies Meadow, Colorado 10 1 R. integrifolia 70 La Plata Canyon, Colorado 10 1 R. integrifolia 71 Paiute Pass, California 10 1 R. integrifolia 72 Mt Dana, California 10 1 Total # individuals sampled: 200 4 9 45 132 30 49 10 10 2 62
Haplotype # 1 2 3 4 5 6 7 8 9 10 11 # Hap/ population R. rhodantha R. rhodantha 58 Snowy Range, Wyoming 10 1 R. rhodantha 59 Uinta Mtns, Utah 10 1 R. rhodantha 62 S. Arapaho Col, Colorado 10 1 R. rhodantha 63 Fourth of July Mine, Colorado 9 1 R. rhodantha 64 4th July Valley, Colorado 10 1 R. rhodantha 69 American Basin, Colorado 10 1 Total # individuals sampled: 59 52
Figure 9a: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #1, and associated sequence haplotypes, in 52 western North American Rhodiola populations. 53
5
Figure 9b: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #2, and associated sequence haplotype, in 3 western North American Rhodiola populations. 54
5
Figure 9c: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #3, and associated sequence haplotype, in western 4 North American Rhodiola populations. 55
Figure 9d: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #4, and associated sequence haplotype, in
western North American Rhodiola populations. 5 5
56
Figure 9e: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #5, and associated sequence haplotypes, in western North American Rhodiola populations. 5 6
57
Figure 9f: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #6, and associated sequence haplotypes, in western North American Rhodiola populations. 57
58
Figure 9g: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #7, and associated sequence haplotypes, in western North American Rhodiola populations. 5 8
59
Figure 9h: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #8, and associated sequence haplotypes, in western North American Rhodiola populations. 5 9
60
Figure 9i: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #9, and associated sequence haplotypes, in western North American Rhodiola populations. 60
61
Figure 9j: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #10, and associated sequence haplotype, in western North American Rhodiola populations. 61
62
Figure 9k: Geographic distribution of cpDNA psbA-trnH restriction site haplotype #11, and associated sequence haplotypes, in
western North American Rhodiola populations. 62
63
Table 11: PsbA-trnH sequence haplotypes of Rhodiola integrifolia and R. rhodantha (populations in order from North to South)
Haplotype A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA AB R. integrifolia populations north of latitude 60° N Population 17 Kay Point + 18 Blow River ++ 1 Pinnell Mtn. + + 19 Mount Klotz + 20 Quartet Lake + 21 Ogilvie site 5 + + + 22 Ogilvie site 3 + 23 Ogilvie site 4 + + 24 Gillespie Lk + ++ 25 Pinguicula Lk + + 26 North Fork Pass + 27 Tombstone V. + 28 Grizzly Lake + + + 29 Top of the World + 30 Keno Hill + + + 2 Bison Gulch ++ + 31 North Canol Rd + 3 Cantwell + 4 Denali Hwy 3 + 5 Denali Hwy 4 ++++ 6 Denali Hwy 2 + 7 Little Coal Cr + + 8 Peter's Hills + 9 Hatcher's Pass + 32 Rose-Lapie Pass + 63
10 Peter's Creek + 11 Thompson Pass + + 64
Haplotype A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA AB R. integrifolia populations north of 60° N. latitude Population 13 Crow Pass + 33 Outpost Mtn + 14 Swetman Mine + 15 Cooper's Mtn + 34 Kluane Rock + 16 Carbon Mtn + 35 Montana Mtn 04 + 36 Montana Mtn 05 + R. integrifolia populations south of 60° and north of 49° N. latitude 37 Chuck Creek + + + 38 3 Guardsmen's ++ 39 Mt. Fetterly + 40 Moose Mtn + + 41 Estshi Creek + 42 Hannah + 43 Tommy Jack + 44 Atna ++ 45 Insect Creek + + 46 Hudson Bay 06 + 47 Mt. Couture + + 48 Hudsons Bay 04 + 49 Thornhill Mtn + 50 Towustasin Hill + 51 Bonanza Beach ++ 52 Gimli Peak + 53 Fisher Peak + R. integrifolia populations south of 49° N. latitude 64
54 Reynolds Pass + 55 Goat Flats + 65
Haplotype A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA AB R. integrifolia populations south of 49° N. latitude Population 56 Beartooth Pass ++ 57 Medicine Bow + 65 Loveland Pass + 66 Schofield Pass + 67 Cottonwood Pass + 68 Handies Meadow + 70 La Plata Canyon + 71 Mt Dana + 72 Paiute Pass +
R. rhodantha 58 Snowy Range + 59 Uinta Mtns + 62 Arapaho Col + 63 4th July Mine + 64 4th July Valley + 69 American Basin +
65
66
3.3.2 Sequence Haplotype Diversity and Distributions
Each restriction site haplotype included one to five sequence haplotypes, and these also were most diverse in the north (Figure 10). Populations north of 60 N contained 21
(75%) of the 28 sequence haplotypes and populations south of that latitude contained only 13 haplotypes; eight haplotypes occurred south of 50 N (Table 11, Figure 10). A few
Sequence Haplotypes A E I M Q U Y B F J N R V Z C G K O S W AA D H L P T X AB
Figure 10 . Geographic distribution of all R. integrifolia populations with sequence haplotypes colour coded to illustrate within-population haplotype diversity. Circles split horizontally by colour = populations with two haplotypes. Circles split vertically by colour = populations with three haplotypes. 67 haplotypes were widespread but most were localized. Four haplotypes (F, I, P and T) were present in both northern and southern populations. Of the localized haplotypes, 10 were exclusively Beringian and four were found along the northern glacial boundary. Five haplotypes occurred exclusively south of the glacial maximum. Two haplotypes (V and W) were found in northern coastal BC (Queen Charlotte Islands and adjacent mainland).
3.3.2 Statistical parsimony and the cpDNA sequence haplotype network
In the Rhodiola psbA-trnH sequence haplotype pairwise difference matrix (Table 12), the maximum number of steps between R. integrifolia haplotypes was eight.
The Rhodiola psbA-trnH sequence haplotype network (Figure 11), contained several loops, indicating alternative possible pathways between haplotypes. These were resolved so as to minimize conflicts between the haplotype network and the ML tree shown in Figure
7(b). Some haplotype groupings or clades were apparent in both the network and the cladograms (Figures 7 and 10). These included several small groups (M + J, O + R, B + W,
A + S, F + D, F + D + U, and Y + Z + AA) as well as a larger clade made up of haplotypes
N, S, A, H, M and J. Other interpretations of how to resolve the loops in the sequence haplotype network based on various criteria such as frequency of haplotypes, topological relationships within the network, and geographical proximity (Pfenninger and Posada, 2002) were considered. The interpretation given in Figure 11 was the most reasonable with respect to these considerations as well as particular character differences (specifically the four-base inversion), while remaining consistent with the ML tree. The outgroup species R. rosea differed by 12 steps from the nearest R. integrifolia sequence haplotype (haplotype Q), which occurred in central Alaska. 68
Table 12: Pairwise difference matrix among Rhodiola integrifolia psbA-trnH sequence haplotypes to themselves. Numbers in bold along top and down side of matrix are haplotype codes, numbers within the matrix denote the number of differences that exist between the two haplotypes being compared.
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA AB A 0 1 5 4 6 4 5 6 3 4 5 4 5 6 7 6 5 5 5 6 7 6 5 6 5 2 6 6 B 1 0 6 5 5 3 6 5 4 5 6 5 6 7 6 7 6 4 6 7 8 5 4 5 4 1 7 5 C 5 6 0 3 5 3 4 5 2 1 4 3 4 5 6 5 4 4 4 5 6 5 4 5 2 7 3 5 D 4 5 3 0 2 2 3 4 1 2 3 2 3 4 5 4 3 3 3 4 5 4 3 4 3 6 4 4 E 5 4 4 3 0 2 5 4 3 4 5 4 5 6 5 6 5 3 5 6 7 4 3 4 3 6 6 4 F 4 3 3 2 2 0 3 2 1 2 3 2 3 4 3 4 3 1 3 4 5 2 1 2 1 4 4 2 G 5 6 4 3 5 3 0 1 2 3 4 3 4 1 6 5 4 4 4 5 6 5 4 3 4 7 5 5 H 6 5 5 4 4 2 1 0 3 4 5 4 5 2 5 6 5 3 5 6 7 4 3 2 3 6 6 4 I 3 4 2 1 3 1 2 3 0 1 2 1 2 3 4 3 2 2 2 3 4 3 2 3 2 5 3 3 J 4 5 1 2 4 2 3 4 1 0 3 2 3 4 5 3 2 3 3 4 5 4 3 4 1 6 2 4 K 5 6 4 3 5 3 4 5 2 3 0 3 2 5 4 5 4 4 4 3 4 5 4 5 4 7 5 5 L 4 5 3 2 4 2 3 4 1 2 3 0 1 2 5 4 3 3 1 4 5 4 3 4 3 6 4 4 M 5 6 4 3 5 3 4 5 2 3 2 1 0 3 4 5 4 4 2 3 4 5 4 5 4 7 5 5 N 6 7 5 4 6 4 1 2 3 4 5 2 3 0 7 6 5 5 3 6 7 6 5 4 5 8 6 6 O 7 6 6 5 5 3 6 5 4 5 4 5 4 7 0 7 6 3 6 7 8 5 2 3 4 7 7 1 P 6 7 5 4 6 4 5 6 3 3 5 4 5 6 7 0 1 5 5 6 7 4 5 6 4 8 5 6 Q 5 6 4 3 5 3 4 5 2 2 4 3 4 5 6 1 0 4 4 5 6 3 4 5 3 7 4 5 R 5 4 4 3 3 1 4 3 2 3 4 3 4 5 3 5 4 0 4 5 6 3 1 2 2 5 5 2 S 5 6 4 3 5 3 4 5 2 3 4 1 2 3 6 5 4 4 0 5 6 5 4 5 4 7 5 5 T 6 7 5 4 6 4 5 6 3 4 3 4 3 6 7 6 5 5 5 0 1 6 5 6 5 8 6 6 U 7 8 6 5 7 5 6 7 4 5 4 5 4 7 8 7 6 6 6 1 0 7 6 7 6 9 7 7 V 6 5 5 4 4 3 5 4 3 4 5 4 5 6 5 4 3 3 5 6 7 0 3 4 3 6 6 4 W 5 4 4 3 3 1 4 3 2 3 4 3 4 5 2 5 4 1 4 5 6 3 0 1 2 5 5 1 X 6 5 5 4 4 2 3 2 3 4 5 4 5 4 3 6 5 2 5 6 7 4 1 0 3 6 6 2 Y 5 4 2 3 3 1 4 3 2 1 4 3 4 5 4 4 3 2 4 5 6 3 2 3 0 5 3 3 Z 2 1 7 6 6 4 7 6 5 6 7 6 7 8 7 8 7 5 7 8 9 6 5 6 5 0 8 6 AA 6 7 3 4 6 4 5 6 3 2 5 4 5 6 7 5 4 5 5 6 7 6 5 6 3 8 0 6 AB 6 5 5 4 4 2 5 4 3 4 5 4 5 6 1 6 5 2 5 6 7 4 1 2 3 6 6 0
68
69
Northern
Central
Southern
Widespread
12 steps
R. rosea
Figure 11: TCS-generated network of all PsbA-trnH sequence haplotypes of R. integrifolia and R. rhodantha. Haplotypes coded by geographical distribution (northern, central, southern and widespread). Haplotype AA includes R. rhodantha. 69
70
3.3.3 Nested Clade Phylogeographic Analyses
In an attempt to separate population structure from population history (Posada et al., 2000), I performed nested clade phylogeographical analysis (NCPA) on the cpDNA restriction site haplotype dataset. Based on the pairwise difference matrix of this dataset
(Table 13), the restriction site haplotype network (Figure 12) contained four 1-step clades that were connected to form the total cladogram at the 2nd nesting level (Figure 13).
Genetic and geographic variation was sufficient for analysis in three of the four 1-step clades and at the total cladogram level, and all of these demonstrated highly significant
(>99%) geographic association between haplotypes at the 95% confidence level. The null hypothesis of no association was accepted for clade 1-1 and rejected in all other clades. I used Alan Templeton’s Inference Key (Templeton, 2004; Appendix 5) to interpret the significant DC and DN values within clades and work out the types of population demographic processes that could be affecting the present range of the haplotypes. The
Table 13: Pairwise difference matrix comparing Rhodiola integrifolia psbA-trnH restriction site haplotypes to themselves. Numbers in bold along top and down side of matrix are haplotype codes, numbers within the matrix denote the number of differences that exist between the two haplotypes being compared.
1 2 3 4 5 6 7 8 9 10 11 1 0 2 2 0 3 2 2 0 4 2 2 2 0 5 1 1 1 1 0 6 1 3 3 3 2 0 7 2 2 2 2 1 3 0 8 2 2 2 2 1 3 2 0 9 3 1 3 3 2 4 1 3 0 10 3 3 1 3 2 4 3 3 4 0 11 2 2 2 2 1 3 2 2 3 3 0
71
11
CO, WY 4 (Incl. R. 7 YT, N BC YT,BC,CA rhodantha)
10 3 5 2 9 NW BC AK, YT Widespread NE AK Central AK
8 1 Central YT AK,YT,BC
6 AK, YT, WY
Figure 12: Network of psbA-trnH restriction site haplotypes in R. integrifolia (all haplotypes) and R. rhodantha (included in haplotype 11) produced by hand with geographic localities indicated (dotted line represents alternate connection).
4 11 7
10 3 5 2 9 1-1 1-2 1-3
8
1 Total Cladogram 1-4 6
Figure 13: Clade groupings of restriction site haplotypes of R. integrifolia from western North America for Nested Clade Phylogeographic Analysis.
72 outcomes for each significant clade are presented in Table 14. In all but clade 1-4, more than one possible demographic process or event was inferred. Restricted gene flow was inferred in the largest clade (clade 1-2), as well as in the total cladogram. Isolation by distance was also inferred in two instances. From this analysis I was unable to determine whether the haplotypes in clade 1-3 were affected more by fragmentation or isolation by distance. This clade includes only two haplotypes (2 and 9), each represented by only a few individuals from three localities in central Alaska. Samples from more populations with these haplotypes would be needed to resolve this.
Table 14: Inferred population demographic events from Nested Clade Phylogeographic Analysis (NCPA) of Rhodiola integrifolia psbA-trnH restriction site haplotypes (Appendix 4). Chi - Nested square Chain of Clade statistic P inference Inferred demographic event
1-2 1059.757 0.000 1-2-3-5-6-7 Yes Restricted Gene Flow/Dispersal, but with some Long Distance Dispersal
1-3 14.000 0.002 1-2-3-4-9-10 No Geographical sampling scheme inadequate to discriminate between Fragmentation and Isolation by Distance
1-4 355.356 0.000 1-2-11-12 No Contiguous Range Expansion
Total 1073.546 0.000 1-2-3-4 No Restricted Gene Flow with Isolation by Distance Cladogram
The population demographic processes suggested by NCPA to have led to the present range of psbA-trnH haplotypes imply recent southward movement from the more genetically diverse northern part of R. integrifolia’s North American range. The geographical expansion of R. integrifolia haplotypes out of Beringia is compatible with the phylogenetic patterns of relatedness obtained from MP and ML analyses of both the psbA-trnH spacer region and the ITS region. The apparent early phylogenetic split 73 between R. rosea and R. integrifolia, along with the non-overlapping nature of each species’ present day geographic distribution suggests that R. integrifolia and R. rosea entered North America from via different routes. However, although cpDNA spacer regions evolve rapidly, the amount of variation in both the sequence and restriction site haplotypes of R. integrifolia, R. rhodantha and R. rosea is too low to assume, with certainty, any timeframe beyond one cycle of glacial advance and retreat (i.e. the
Wisconsinan glaciation).
74
Chapter 4: DISCUSSION
The glacial cycles of the Pleistocene have dramatically influenced the geographic distribution of plant species worldwide in ways well documented in the literature (e.g.
Erich et al., 2007; Koch and Kiefer, 2006; Alsos et al, 2005; Hewitt, 2004a; Taberlet and
Cheddadi, 2002). Any species in the path of the ice during a glaciation would be wiped out unless it was able to migrate to an unglaciated refugium (Hewitt, 1996; Ehrich et al,
2007). Many temperate montane and sub alpine species faced range contractions towards southern refugia (Williams et al., 2004; Soltis et al., 1997; Cwynar and MacDonald,
1987). Arctic and alpine species retrenched either in high latitude refugia and/or alpine nunataks or south of the ice sheets, or they underwent other more complex range shifts
(Hewitt, 1996; Stehlik et al., 2001; Marr et al., 2008). The genus Rhodiola belongs in this latter group.
4.1 Rhodiola Relationships
Rhodiola has been treated as a subgenus of Sedum or as a distinct genus of 60 to
90 species (Clausen, 1975; Moran, 2000; Hegi 1963 and Ohba 1975 in Lei et al, 2004;
Mayuzumi and Ohba, 2004). In an ITS-based phylogeny of 74 Asian species of the
Crassulaceae subfamily Sedoideae (including R. rosea but not R. integrifolia or R. rhodantha), Mayuzumi and Ohba (2004) established Rhodiola as a distinct clade separate from Sedum and provided preliminary data concerning relationships within Rhodiola.
The ITS-based phylogeny of Rhodiola presented here (Figure 6) expands these results by including populations of all three North American species. The sister clade to the western North American R. integrifolia – R. rhodantha clade consists of the Eurasian 75 species R. wallichiana and R. serrata. However, the eastern North American R. rosea is most closely related to the Japanese species R. ishidae (Miyabe & Kudo) H. Hara. In their phylogeny of the subfamily Sedoideae, Mayuzumi and Ohba (2004) showed that R. rosea and 14 other Rhodiola species form a well supported clade (with 91% bootstrap support) that is sister to a second clade formed from eight other species of Rhodiola, including R. wallichiana and R. serrata. Lei et al, (2004) found similar clade groupings
(with 78% bootstrap support) in their ITS phylogeny of 22 Rhodiola species from eastern
Asia. The close relationship that I showed between R. integrifolia and the two Eurasian species R. wallichiana and R. serrata indicates that it is allied with the second clade above and does not have a recent common ancestor with R. rosea. Such a large phylogenetic distance between R. integrifolia and R. rosea is surprising given their similarities in morphology, but a high degree of morphological convergence is a frequently observed quality of the Crassulaceae that has made this family well known for its taxonomic difficulties (Van Ham and T’Hart, 1998). The apparent deep separation between R. integrifolia and R. rosea suggests that the two species have been long diverged and most likely arrived in North America in two separate migrations, probably via two different migration routes.
4.1.1 Similarities and differences between R. integrifolia and R. rosea
Rhodiola rosea and R. integrifolia closely resemble each other morphologically, but are distinct in several characters. The most notable of these is flower colour; the corolla of R. rosea is yellow whereas R. integrifolia usually has deep red petals, although rarely with yellow streaks or yellow petals with red at the apex. Rhodiola rosea tends to have glaucous leaves and its flowers are usually 4-merous, whereas R. integrifolia’s 76 leaves are usually bright green and tend to be longer and narrower and its flowers have a greater tendency to be 5-merous. Although based on relatively few chromosome counts, the two species appear to also be distinct cytologically. On the basis of counts by Dawe and Murray (1979) of two specimens from Alaska, Uhl (1952) of nine specimens from
Minnesota, New York, New Mexico and California, and Löve (1985) of four specimens from New York, Minnesota, New Mexico and Colorado, R. integrifolia has 18 chromosome pairs (2n = 36). Chromosome counts made for R. rosea from several locations are n=11 (2n = 22) (Uhl, 1952; Clausen, 1975; Amano et al, 1995).
Chromosome counts were not made of the specimens used in this study.
4.1.1.1 Geographic relationships
It is noteworthy that the geographic ranges of R. integrifolia and R. rosea do not overlap in North America. Eric Hultén (1937) observed this in describing Sedum roseum
(in which he included both R. integrifolia and R. rosea) as an exception to a large group of arctic montane species that spread from northeastern Asia to North America before the last glacial maximum. He suggests that the other members of this group expanded across
North America along the arctic coast, then colonized the continent from the north as the ice retreated. In the case of R. rosea s.l., the large gap that exists in the Arctic archipelago between the western (R. integrifolia) and eastern (R. rosea) populations sets it apart from the rest of the group. Since Hultén (1937) was not convinced of the possibility of amphi-Atlantic migrations of arctic-alpine plants, he was not able to explain how this species could have such a discontinuous range.
Rhodiola rosea is widespread in Eurasia, and extends into far eastern Siberia where its range overlaps with that of R. integrifolia (Amano et al, 1995), but its North 77
American distribution is limited to the northeast, within an area that was almost completely covered by ice during the last ice age. Uhl (1952) noted this in trying to explain the presence of two chromosomal strains of the then-considered single species
Sedum rosea. He suggested that the n = 11 chromosome strain found only in the east must have invaded this eastern range since the Pleistocene, and since it is indistinguishable from its n = 11 counterparts in Europe, he asserted that it must be more closely related to European populations than to the n = 18 chromosome strain of western
North America (Uhl 1952). He went on to argue that the n = 18 chromosome strain, although appearing both in the east and the west of the continent, occurred far beyond the limit of the [most recent] Pleistocene glaciation, suggesting its longer presence in North
America. If the two species entered North America from opposite coasts, their divergence likely occurred a long time ago, most probably when the ancestral species was still in Asia. Clausen (1975) was quite firm in his assertion of a post-glacial arrival of R. rosea in North America, suggesting that it appeared less than ten thousand years ago, and stating that “if ever a genetic interaction occurred involving [R.] rosea and [R.] integrifolia, it must have occurred in Asia at a much earlier time.”
4.1.1.2 Medicinal properties
Rhodiola rosea is one of the most widely researched of the putatively medicinal species in the genus, and its pharmaceutical properties, including anti-fatigue, anti-toxin, anti-radiation, anti-oxidant and anti-aging qualities, are becoming well known in the alternative medicine community (Brown 2002; Kelly, 2001; Bucci, 2000). On the other hand, R. integrifolia has not been reported to have any notable medicinal qualities, although studies of its biochemical properties have not been done. Rhodiola crenulata 78
(Hook. & Thomson) Ohba, another traditionally used medicinal member of the genus, is closely related to R. wallichiana and R. serrata (and thus to R. integrifolia) in Lei et al’s
(2004) phylogeny of 22 Asian Rhodiola. Whether or not any of the specific medicinal properties or compounds found in R. crenulata are found in R. integrifolia is unknown, but knowledge of the presence (or absence) of these compounds might help in further establishing relationships within the Rhodiola genus.
4.1.2 Rhodiola integrifolia and R. rhodantha: Daughters of an ancient colonist?
The origin of R. rhodantha, the only endemic North American species of the genus, is unknown and understudied. Its close relationship with R. integrifolia in the ITS phylogeny (Figure 6) provides evidence that the two species are sister to one another.
There are other lines of evidence that suggest R. rhodantha as the potential ancestor to R. integrifolia. Clausen proposed the existence of a large, perfect, 5-merous, pink flowered ancestor that occurred in temperate situations, and suggested that the likelihood of yellow-flowered R. rosea arising from such a parent would be low. Rhodiola integrifolia however, with its red petals (larger than those of R. rosea) and occasionally hermaphroditic flowers may have evolved from such an ancestor (Clausen 1975).
Because in most cases dioecy derives from a hermaphrodite ancestor (Charlesworth &
Charlesworth, 1978), it is possible that R. integrifolia derives from R. rhodantha. Indeed,
Clausen’s (1975) observation of rudimentary carpels in male flowers of R. integrifolia may suggest a fairly recent development of the trait of dioecy in this species.
This ancestor could also have given rise to the pink flowered, hermaphrodite R. rhodantha. Clausen mentioned a remarkable similarity between the central Asian species
Sedum semenovii (Regel & Herder) Mast. (now Rhodiola semenovii (Regel & Herder) 79
Boriss.) and R. rhodantha. He relates that J. N. Rose wrote to N. L. Britton in 1902 suggesting the two species be placed in a separate genus, Clementsia (Clausen 1975).
The genus was not well accepted and is now considered a subgenus of Rhodiola
(Mayuzumi and Ohba, 2004). The enticing questions of when and where such an ancestor existed, whether R. integrifolia and R. rhodantha evolved from it in Asia or
North America, whether R. rhodantha evolved first and R. integrifolia derived from it, and when the two species diverged, invite various speculative explanations but are beyond the scope of this study.
There remains the discrepancy in chromosome numbers between the two species.
Uhl explored this issue in 1952. Assuming that R. integrifolia was a form of Sedum rosea, he suggested a base chromosome number of six for North American Rhodiola species. He proposed that R. rhodantha (n = 7) could have been derived from the diploid, and R. integrifolia (n = 18) could have evolved as a hexaploid of the n = 6 ancestor. An alternative hypothesis was that the n = 18 strain of S. rosea (= R. integrifolia) was an allopolyploid derived from the n=11 strain of S. rosea (= R. rosea s.s.) and an n = 7 parent (possibly R. rhodantha?) (Uhl, 1952). No experimental evidence for an allopolyploid origin of R. integrifolia exists, and given the geographical range separation of R. rosea and R. integrifolia, the first hypothesis is just as plausible on the basis of available evidence.
Because the chromosome numbers add up it is tempting to assume on of these hypotheses is correct, however, there are several reasons why they may be misleading.
The Crassulaceae are notorious for variation in chromosome numbers (Mort et al., 2001).
Furthermore, because of incomplete mitosis in somatic tissues we can often see much 80 higher chromosome numbers in somatic cells than in sexual cells (Nair, 2007).
Regardless of this, species with different chromosome numbers can still hybridize – their
F1 offspring may not be viable, but in long living plants that can persist and multiply clonally by division of the rootstock (such as members of Rhodiola), mutations could accumulate that would make it possible for these offspring to breed eventually.
4.2 Hybridization
The two western North American species R. integrifolia and R. rhodantha are sister taxa and their ranges are partially sympatric in the southern Rocky Mountains.
Although both morphology and the nrDNA ITS sequences show distinct differences between R. integrifolia and R. rhodantha, the similarity in the sequences of the psbA- trnH region of the chloroplast DNA (Figure 7) raises the possibility of introgression (or chloroplast capture) involving the two species. This incongruence between the two phylogenies could be the result of various processes. Convergence in the psbA-trnH non- coding region of the cpDNA in either the southern populations of R. integrifolia or in R. rhodantha is possible but unlikely. Joint retention of a shared ancestral psbA-trnH haplotype could only be shown if an immediate ancestor of the two species were known
(Rieseberg and Brunsfeld, 1992). The possibility of an ancient hybridization event between R. integrifolia and R. rhodantha seems the most likely scenario, given their range overlap (Rieseberg and Brunsfeld, 1992; Wendel and Doyle, 1998). Furthermore, crossability is a widely retained characteristic of the Crassulaceae family (Van Ham and
T’Hart, 1998).
A single hybridization event that gives rise to offspring with nuclear genes from both parents, but plastid DNA from only one parent, can remain evident in the genome of 81 the descendents for a long time (Rieseberg and Brunsfeld, 1992). Because the chloroplast genome is maternally inherited in angiosperms and does not recombine parental cpDNA traits, if the hybrid offspring backcrosses with the male (pollen) parent, after many generations the descendents that inherited their cpDNA from the seed parent, even though their nuclear DNA is 99% like that of the pollen parent, will result in plants that still carry that maternally inherited cpDNA (Rieseberg and Brunsfeld, 1992; Avise,
1994; Wendel and Doyle, 1998). Thus a plant that has the morphological characteristics of the male parent’s species can still carry evidence of the female parent in its cpDNA.
The frequency and extent of the occurrence of this process, known as cytoplasmic or chloroplast introgression, and also as chloroplast capture, was unclear until recently
(Rieseberg and Brunsfeld, 1992). The proliferation of studies employing molecular tools, in particular RFLP and sequencing, has led to a rapid accumulation of examples of this phenomenon (e.g. Populus nigra and P. alba (Smith and Sytsma, 1990), Helianthus annuus ssp. texanus and H. debiolis ssp. cucumerfolius (Rieseberg et al., 1990),
Draba aizoides (Widmer and Baltisberger, 1999), Arabis holboellii and A. drummondii
(Dobes et. al. 2004, see also Wendel and Doyle, 1998 and Arnold, 2006). A hybridization event at some time since R. integrifolia and R. rhodantha speciated, followed by backcrossing of the offspring with one or the other of the parents would be consistent with some R. integrifolia populations carrying the signal of R. rhodantha in their cpDNA or vice-versa.
R. T. Clausen proposed subsp. procera[um] for large, vigorous individuals of R. integrifolia from Colorado, New Mexico and California that resemble the tall individuals often found inland in Alaska and parts of the Yukon and BC (considered to be part of R. 82 integrifolia subsp. integrifolia) (Reid Moran, unpublished manuscript). The geographic proximity (i.e. Colorado) of the putative R. integrifolia/R. rhodantha hybrids with that of
R. integrifolia ssp. procera is noteworthy. Based on examples in Claytonia (Doyle and
Doyle, 1998) and Lotus (Liston et al., 1990), Rieseberg and Brunsfeld (1992) suggest that not all rDNA markers would be rapidly lost through backcrossing and that some genes affecting morphology might remain over longer periods of time. Cryptic, remnant rDNA genes from the R. rhodantha hybrid parent involved in tallness (a trait of R. rhodantha) may have persisted in the R. integrifolia hybrids. If more than one hybridization event occurred, or if there was occasional backcrossing with R. rhodantha, the chances of the tallness genes passing from R. rhodantha to R. integrifolia would be greater. Individuals of R. integrifolia in my study that exhibited cpDNA sequence haplotypes identical to R. rhodantha specimens (haplotype AA) were all of a tall morphotype. Two of the three
Southern Rockies individuals of R. integrifolia that differed from R. rhodantha in their sequence haplotype (both cpDNA haplotype Z) were of the short morphotype. In order to determine if R. integrifolia subsp. procera is the result of a possible introgression event further sampling and molecular analysis of individuals of both R. rhodantha and R. integrifolia from their region of sympatry would be necessary.
4.3 Phylogeography of Rhodiola integrifolia
4.3.1 Colonization and Dispersal
Savile (1972) argued for a mid-Tertiary origin for arctic plants and suggested that as arctic habitats became available they were populated by alpine plants from nearby mountain ranges (Savile, 1972; Abbot et al, 2000). It seems likely that at some time during the Pleistocene, when the Beringian land route was available, R. integrifolia or its 83 recent ancestor moved into North America from Northeast Asia via Beringia. The high genetic diversity of R. integrifolia in Beringia (Tables 12 and 14, Figures 9a-k) is consistent with a long occupation of the area, possibly through more than one glacial cycle. After deglaciation, these northern populations could then have migrated south and east of Beringia (Pielou, 1991). Similar trends have been identified in other plant species
(e.g. Dryas integrifolia Vahl (Tremblay and Schoen, 1999), Saxifraga oppositifolia L.
(Abbot at al., 2000; Abbot and Comes, 2003), Vaccinium uliginosum L. (Alsos et al.,
2005), Cassiope tetragona (L.) D. Don (Eidesen et al., 2007), Oxyria digyna (L) Hill
(Marr et al., 2008).
The observed connections between R. integrifolia and R. rosea and among the R. integrifolia haplotypes, together with their geographic distributions, provide support for a hypothesis of southward spread from Alaska. These two lines of evidence also suggest that several clades of R. integrifolia (haplotype X (Montana/Wyoming border in
Beartooth Mountains), haplotypes Y, Z and AA (Colorado and southern Wyoming) and haplotype AB (Yosemite National Park, California, in Sierra Nevada Mountains) have independently migrated to the south.
4.3.1.1 Causes of the Observed Geographic Patterns
The Nested Clade Phylogeographic Analysis (NCPA) performed on the restriction site haplotype data suggested that the decrease in the psbA-trnH haplotype diversity of R. integrifolia at lower latitudes could have resulted from several possible factors. The distribution of some clade 1-2 haplotypes (#4, #5, #8) in the Yukon and northern BC is probably the result of restricted dispersal and gene flow. Long distance dispersal since the last glaciation (Table 15, Figure 13) was suggested as the most likely reason for the 84 presence of haplotypes #7 and #11 in California and Colorado (Figures 9g, 9k), but the
Colorado populations might well be older – possibly the result of range contraction or fragmentation after a previous interglacial expansion out of Beringia. In the Beringian clade 1-3, haplotypes #2 and #9 (Figures 9b and 9i), both of which exist in multiple haplotype populations, are geographically close and could have resulted from either fragmentation or isolation by distance. The two sites for haplotype #9 are both higher in elevation than their surroundings. Warming of the climate in the past may have resulted in upward elevational shift of a contiguous, lower elevation population, with subsequent disappearance of the species from the intervening areas (Gutierrez Larena et al., 2002;
Marr et al., 2008). Clade 1-4 contains the most widespread haplotype, #1 (Figure 9a), and haplotype #6 (Figure 9f). Contiguous range expansion, as suggested by NCPA, seems a likely explanation for the distributions of these haplotypes in Beringia and northern BC. However, in the case of one population of haplotype #6 from the Beartooth
Mountains on the Montana/Wyoming border (= sequence haplotype X), contiguous range expansion seems unlikely given geographical limitations. Sequence data for samples of haplotype #6 from each of the six populations (Figures 7, 9f, and10) showed that the southern sample is distinct from the northern samples of this restriction-site haplotype, and probably represents either an independent long distance dispersal event or fragmentation by intervening ice sheets.
4.3.1.2 Use of NCPA (or not) in the absence of other methods
Information from any single genome can be misleading (Knowles and Maddison,
2002); therefore biogeographic inferences about R. integrifolia must be made with caution, since they are based on only one region of the cpDNA genome of R. integrifolia 85
(Garrick et al. 2008). In addition, various authors (Knowles and Maddison, 2002;
Beaumont and Panchal, 2008; Knowles, 2008, and Petit, 2008) have questioned the validity of inferences based on NCPA, suggesting that conclusions based on this method should not be relied upon, at least until it has been thoroughly evaluated. Criticism of the
NCPA method of statistical phylogeography is focused on concerns about incorrect inferences from the inference key (Knowles and Maddison, 2002). In simulation studies conducted to evaluate the validity of results obtained through NCPA, false positives
(suggesting processes that were not occurring) were returned in a high proportion of scenarios (Petit, 2008; Beaumont and Panchal, 2008; Knowles, 2008). However, other authors (Templeton, 2008, 2009; Garrick et al., 2008) have concluded that (i) the test for population structure and the rejection of the null model are made with statistical rigor, thus the conclusion that a biological process (e.g. range expansion or restricted gene flow) is involved is statistically sound; and, (ii) the determination of which biological process(es) are responsible can be made with reasonable confidence using Templeton’s
NCPA inference key.
In the absence of any one single method for evaluating scenarios of demographic history, NCPA is an attractive tool to use in phylogeography. Other statistical methods can partially resolve the processes responsible for current population genetic structure, but are not able to evaluate multiple historic and demographic processes (Knowles, 2008;
Beaumont and Panchal, 2008; Templeton, 2009). The use of NCPA in conjunction with other analyses and/or strong a priori expectations, rather than as a “prospecting tool in relentless pursuit of some form of statistical significance” is favoured by proponents of the method (Templeton, 2008; Garrick et al., 2008). The use of this method here offered 86 some insight into the possible mechanisms involved in the recolonization of western
North America by R. integrifolia, and most of the inferences obtained from it made sense in light of conclusions from the other analyses (i.e., that R. integrifolia survived in
Beringia during the last ice age and expanded southwards following deglaciation).
Ideally the inferences supplied by NCPA should be tested using other analysis methods tailored to each suggested mode of demographic change.
4.3.2 Other Refugia
The expected evidence for founder effects associated with re-colonization of glaciated habitats would be low haplotype diversity and few, if any, unique haplotypes in the younger habitat (Marr et al., 2008). Two psbA-trnH sequence haplotypes (V and W) occur exclusively in north-coastal BC (in the BC Coast Mountains near the southern end of the Alaska panhandle, and in the Queen Charlotte Islands). These sites probably would have been covered by ice at the last glacial maximum (Hetherington et al., 2004;
Lacourse et al., 2005; Hebda and Haggarty, 1997; Warner et al., 1982; Calder and Taylor,
1968). The presence of these two haplotypes in this area, geographically far from known refugia in Beringia or in the south, might suggest their long-term residence in the region, or their early arrival after the ice retreated. Parts of the Queen Charlotte Islands may have been unglaciated since at least the late Wisconsinan glaciation (Warner et al., 1982;
Pielou, 1991; Hebda and Haggarty, 1997; Lacourse et al., 2005). Fossil plant communities found to the east of Graham Island dated to approximately 18,000 years suggest that the area was a “late glacial centre of biotic diversity” (Lacourse et al., 2005).
The sites of present–day populations R. integrifolia in the northern Coast Mountains
(Figures 9g, 9j) probably would have been largely ice-covered at the glacial maximum 87
(Warner et al., 1982; Hetherington et al., 2004); however, evidence of high elevation nunataks in the mountains of the Alaska panhandle (Pielou, 1991; Heusser, 1954 in
Hebda and Haggarty, 1997) suggest the possibility of nearby ice-free refugia. The ice- free, exposed and vegetated continental shelf along the BC coast and particularly around the Queen Charlotte Islands may have offered a possible early migration route for R. integrifolia from refugial populations further north (Lacourse et al., 2005; Hetherington et al., 2004).
Decreases in the genetic diversity of a population as its distance from a refugium increases is consistent with the population bottlenecks and founder effects that occur along the leading edge of an expanding range (Comes and Kadereit, 1998; Schaal et al,
1998; Hewitt, 2000; Cisci et al 2003; Eidesen et al., 2007). Range shifts also require adaptation to new geographical locations, and although alleles or populations may be lost, new mutations may appear over time and spread via selection (Hewitt, 2004).
Accumulated genetic differences conserved in non-coding DNA regions can serve as molecular markers to trace the patterns of dispersal that populations of a species followed in expanding into its new range (Tremblay and Schoen, 1999). These markers, combined with knowledge of present range and life history factors as well as past geomorphic processes or climatic events can help to explain the present geographical distribution of a taxon (Schaal et al, 1998; Brunsfeld et al, 2001; Kuchta and Meyer, 2001).
4.4 Climate change implications
During past warming phases, arctic and alpine plant species survived by seeking cooler habitats, which usually involved either moving upward in elevation or migrating northward (if they could disperse fast enough and if the intervening terrain was suitable). 88
With the present warming of the climate, arctic and alpine species will once again be pushed upwards both in latitude and altitude. It is expected that as warming continues, the available habitat for arctic and alpine species, such as R. integrifolia and R. rhodantha, will decrease as other plant species encroach into their ranges (Lesica and
McCune 2004; Callaghan et al., 2004) and as geographical barriers such as the arctic coastline restrict their movement.
Rhodiola integrifolia’s high level of genetic diversity in North American
Beringian populations might lend it more resilience to climatic changes than less genetically diverse populations at higher elevations further south. The range of habitats in which it could be found growing (dry ridge tops to lush depressions) may be a further indication of its plasticity with regard to habitat requirements. The species’ capability to disperse from presently favourable locations to those that will become favourable habitats in the future must also be considered. Long-distance dispersal ability is difficult to quantify (Alsos et al., 2007) and has not been addressed in this study, but will be a critical factor in whether R. integrifolia can find new favourable habitats when its present ones are no longer habitable.
If the habitat of a species is at risk, even a species that enjoys a relatively safe status at the moment may be imperiled. Knowledge of a taxon’s present range and genetic diversity provides a benchmark for assessing the effects climate change may have on its ecology in the future. “Preserving biodiversity requires knowledge of its geographical distribution as well as the mechanisms that sustain and develop it over long periods of time” (Alsos et al, 2005). 89
Literature Cited
Abbott, R. J., Lisa C. Smith, Richard I. Milne, Robert M. M. Crawford, Kirsten Wolff, Jean Balfour. 2000. Molecular analysis of plant migration and refugia in the Arctic. Science 289: 1343-1346.
Abbott, R. J. and C. Brochmann. 2003. History and evolution of the arctic flora: in the footsteps of Eric Hultèn. Molecular Ecology 12(2): 299-313.
Abbott, R. J. and H. P. Comes. 2003. Evolution in the Arctic: a phylogeographic analysis of the circumarctic plant, Saxifraga oppositifolia (Purple saxifrage). New Phytologist 161: 211-224.
Alsos, I. G., T. Engelskjon, L. Gielly, P. Taberlet and C. Brochmann. 2005. Impact of ice ages on circumpolar molecular diversity: insights from an ecological key species. Molecular Ecology 14: 2739-2753.
Alsos, I. G., P. B. Eidesen, D. Erlich, I. Skrede, K. Westergaard, G. H. Jacobsen, J. Y. Landvik, P. Taberlet and C. Brochmann. 2007. Frequent long-distance plant colonization in the changing Arctic. Science. 316: 1606-1608.
Amano, M., M. Wakabayashi and H. Ohba. 1995. Cytotaxonomical studies of Siberian Sedoideae (Crassulaceae) I. Chromosomes of Rhodiola in the Altai Mountains. Journal of Japanese Botany 70(6): 334 – 338.
Andersen, B. G. and H. W. Borns. 1997. The Ice Age World An introduction to Quarternary History and Research with Emphasis on North America and Northern Europe During the Last 2.5 Million Years. Scandinavian University Press, Oslo.
Arnold, M. L. 2006. Evolution through Genetic Exchange. Oxford University Press, Oxford.
Avise, J. C. 1994. Molecular Markers, Natural History and Evolution. Chapman and Hall, New York.
Avise, J. C., J. Arnold, R. M. Ball, E. Bermingham, T. Lamb, J. E. Neigel, C. E. Reeb and N. C. Saunders. 1987. Intraspecific phylogeography: The mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics 18: 449-522.
Beaumont, M. A. and M. Panchal. 2008. On the validity of nested clade phylogeographical analysis. Molecular Ecology 17: 2563-2565
Bennett, K.D., P. C. Tzedakis, and K. J. Willis. 1991. Quaternary refugia of north European trees. Journal of Biogeography. 18: 103–115. 90
Bennett, K.D. and J. Provan. 2008. What do we mean by ‘refugia’? Quaternary Science Reviews 27: 2449–2455.
Booth, D. B., K. G. Troost, J. J. Clague, and R. B. Waitt. 2003. The Cordilleran ice sheet. In The Quaternary Period in the United States. Alan R. Gillespie, Stephen C. Porter and Brian F. Atwater eds. Elsevier International 17-33.
Brown, Richard P., Patricia L. Gerbarg and Zakir Ramazanov. 2002. Rhodiola rosea: A Phytomedicinal Overview. HerbalGram 56: 40-52.
Brunsfeld, S. J., J. Sullivan, D. E. Soltis and P. S. Soltis. 2001. Comparative phylogeography of north-western North America: a synthesis. In Integrating ecology and evolution in a spatial context. J. S. Brunsfeld and J. Antonovics. Eds. Blackwell Publishing, Williston VT. 319-339.
Bucci, Luke R. 2000. Selected herbals and human exercise performance. American Journal of Clinical Nutrition 72(suppl)6: 24S–36S.
Callaghan, T. V., Lars Olof Bjorn, Yuri Chernov, Terry Chapin, Torben R. Christensen, Brian Huntley, Rolf A. Ims, Margareta Johansson, Dyanna Jolly, Sven Jonasson, Nadya Matveyeva, Nicolai Panikov, Walter Oechel, and Gus Shaver. 2004. Climate change and UV-B impacts on arctic tundra and polar desert ecosystems - past changes in arctic terrestrial ecosystems, climate and UV radiation. Arctic Climate Impact Assessment. Ambio 33(7): 398-403.
Calder, James A. and Roy L. Taylor. 1968. Flora of the Queen Charlotte Islands Part I: Systematics of the Vascular Plants. Research Branch, Canada Department of Agriculture Monograph number 4, Part 1.
Charlesworth, Brian, and Deborah Charlesworth. 1978. A Model for the Evolution of Dioecy and Gynodioecy. The American Naturalist 112(988): 975-997.
Cisci, Jorge V., Liliana Katinas and Paula Posadas. 2003. Historical Biogeography: an Introduction. Harvard University Press, Cambridge.
Clague, J. J., J. E. Armstrong and W. H. Mathews. 1980. Advance of the Late Wisconsin Cordilleran ice sheet in southern British Columbia since 22,000 yr B.P. Quarternary Research 13: 322-326.
Clague, J. J., and T. S. James. 2002. History and isostatic effects of the last ice sheet in southern British Columbia. Quaternary Science Reviews 21(1): 71-87.
Clague, J. J., T. A. Ager and Rolf W. Mathews. 2004. Environments of Northwestern North America before the Last Glacial Maximum. In Entering America: Northeast Asia and Beringia before the last glacial maximum. D. B. Madsen ed. University of Utah Press, Salt Lake City, UT. 63-94. 91
Clausen, Robert T. 1975. Sedum of North America North of the Mexican Plateau. Cornell University Press, London.
Clement, M., D. Posada and K. A. Crandall. 2000 TCS: a computer program to estimate gene genealogies. (Program Note) Molecular Ecology 9(10): 1657 – 1659.
Clement, Mark, Quinn Snell, and Peter Walker. 2003. TCS: Estimating Gene Genealogies. www.hicomb.org/papers/HICOMB2002-03.pdf
Clement, Mark, Jacob Derington, Steve Woolley and David Posada. 2005. TCS 1.21.html. PDF accompanying TCS http://darwin.uvigo.es/software/tcs.html
Cody, William J. 1996 - 2000. Flora of the Yukon Territory. National Research Council, Research Press, Ottawa, Ontario.
Comes, H. P. and J. W. Kadereit. 1998. The effect of Quarternary climatic changes on plant distribution and evolution. Trends in Plant Science 3(11): 432-438.
Cwynar, L. C. and G. M. Macdonald. 1987. Geographical variation of lodgepole pine in relation to population history. American Naturalist 129(3): 463-469.
Dawe, J. C., and D. F. Murray. 1979. In IOPB Chromosome number report LXIII. Taxon 28(1): 267.
Demensure, B., N Sodzi and R. J. Petit. 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology 4: 129-131
Dobes, C. H., T. Mitchell-Olds, and M. A. Koch. 2004. Extensive chloroplast haplotype variation indicates Pleistocene hybridization and radiation of North American Arabis drummondii, A. x divaricarpa, and A. holboellii (Brassicaceae). Molecular Ecology 13(2): 349-370.
Doyle, J. J., and Jane L. Doyle. 1990. Isolation of plant DNA from fresh tissue. Focus 12(1): 13-15.
Doyle, Jeff J. 1993. DNA, Phylogeny, and the Flowering of Plant Systematics BioScience 43(6): 380-389.
Eidesen P. B., I. G. Alsos, M. Popp, Ø. Stensrud, J. Suda and C. Brochmann. 2007. Nuclear vs. plastid data: complex Pleistocene history of a circumpolar key species. Molecular Ecology 16: 3902–3925.
Ehlers, J. and P. Gibbard. 2004. Quaternary Glaciations – Extent and Chronology Part II North America. Elsevier, Boston.
92
Ehrich, D., M. Gauduel, A. Assefa, M. A. Koch, K. Mummenhoff, S. Nemomissa, Intrabiodiv Consortium, and C. Brochmann. 2007. Genetic consequences of Pleistocene range shifts: contrast between the Arctic, the Alps and the East African mountains. Molecular Ecology 16: 2542-2559.
Ferris, C., R. A. King and G. M. Hewitt. 1999. Isolation within species and the history of glacial refugia. In Molecular Systematics and Plant Evolution. P. M. Hollingsworth, R. M. Bateman and R. J. Gornall. London, Taylor and Francis. 20-34.
Garrick R. C., R. J. Dyer, L. B. Beheregaray and P. Sunnucks. 2008. Babies and bathwater: a comment on the premature obituary for nested clade phylogeographical analysis. Molecular Ecology 17: 1401-1403.
Gutierrez Larena, B., J. Fuertes Aguilar and G. Nieto Feliner. 2002. Glacial-induced altitudinal migrations in Armeria (Plumbaginaceae) inferred from patterns of chloroplast DNA haplotype sharing. Molecular Ecology 11: 1965-1974.
Hays, J. D., John Imbrie and N. J. Shackleton. 1976. Variations in the Earth’s orbit: Pacemaker of the ice ages. Science 194: 1121-1132.
Harris S. A. and R. Ingram. 1991. Chloroplast DNA and Biosystematics: The Effects of Intraspecific Diversity and Plastid Transmission Taxon 40:3 393-412.
Hebda, Richard J. and James C. Haggarty. 1997. Brooks Peninsula An Ice Age Refugium on Vancouver Island. Occasional Paper Number 5. Province of British Columbia.
Hedderson, T.A. and G.R. Brassard. 1992. Encalypta affinis subsp. macounii and E. brevipes new to eastern North America from the Torngat, Northern Labrador, Canada. Bryologist 95: 31-32.
Heiman, Max. 1997. WEBCUTTER 2.0. http://rna.lundberg.gu.se/cutter2.
Hetherington, R., J.V Barrie, R.G.B. Reid, R. MacLeod and D. J. Smith. 2004. Paleogeography, glacially induced crustal displacement, and late Quaternary coastlines on the continental shelf of British Columbia, Canada. Quaternary Science Reviews 23(3-4): 295-318.
Hewitt, G. M. 1996. Some genetic consequences of ice ages, and their role in divergence and speciation. Biological Journal of the Linnean Society 58: 247- 276.
Hewitt, G. M. 2000. The genetic legacy of the Quarternary ice ages. Nature 405: 907- 913.
93
Hewitt, G. M. 2004. Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 359(1442): 183-195.
Holderegger, R. and R. J. Abbott. 2003. Phylogeography of the arctic-alpine Saxifraga oppositifolia (Saxifragaceae) and some related taxa based on cpDNA and its sequence variation. American Journal of Botany 90(6): 931-936.
Hopkins, David M. 1967. The Bering Land Bridge. Stanford University Press, Stanford, California.
Hultén, Eric. 1968. Flora of Alaska and Neighbouring Territories. Stanford University Press, Stanford, California.
Hultén, Eric. 1937. Outline of the History of Arctic and Boreal Biota During the Quarternary Period. Lehre J. Cramer, New York.
Ives, J. D. 1974. Biological refugia and the nunatak hypothesis. In: Arctic and alpine environments. J. D. Ives and R. G. Barry eds. Methuen, London. 606-636.
Jacobs, David K., Todd A. Haney, and Kristina D. Louie. 2004. Genes, diversity, and geologic process on the Pacific coast. Annual Review of Earth and Planetary Sciences 32: 601-652.
Kelly, G. S. 2001. Rhodiola rosea: A possible plant adaptogen. Alternative Medicine Review 6: 293-302.
Keltner, J., and L. Maher. 1996. MapPad version 2.0 (Beta 4). NOAA Paleoclimatology Program, http://www.ngdc.noaa.gov/paleo/paleo.html
Knowles, L. L. 2008. Why does a method that fails continue to be used? Evolution 62:11 2713-2717.
Knowles, L. L., and W. P. Maddison. 2002. Statistical phylogeography. Molecular Ecology 11: 2623-2635.
Koch, M. A., and C. Kiefer. 2006. Molecules and migration: biogeographical studies in cruciferous plants. Plant Systematics and Evolution 259: 121-142.
Kress, J. W., K. J. Wurdack, E. A. Zimmer, L. A. Weigt, and D. H. Janzen. 2005. Use of DNA barcodes to identify flowering plants. Proceedings of the National Academies of Science 102:23 8369-8374.
Kuchta, S. R. and D. Meyer. 2001. A genealogical view of geographical variation. Molecular Ecology 10: 2569-2576.
94
Lacourse, T., R. W. Mathewes, and D. W. Fedje. 2005. Late-glacial vegetation dynamics of the Queen Charlotte Islands and adjacent continental shelf, British Columbia, Canada. Palaeogeography, Palaeoclimatology, Palaeoecology 226: 36 –57.
Latta, Robert G. 2006. Integrating patterns across multiple genetic markers to infer spatial processes. Landscape Ecology (2006) 21: 809–820.
Lei, Yidong, Hong Gao, Tashi Tsering, Suhua Shi, and Yang Zhong. 2006. Determination of genetic variation in Rhodiola crenulata from the Hengduan Mountains Region, China using inter-simple sequence repeats. Genetics and Molecular Biology 29(2): 339-344. Lei, Yidong, Xianhua Tang, Tashi Tsering, Suhua Shi, and Yang Zhong. 2004. A preliminary phylogenetic analysis of some Rhodiola species based on nrDNA ITS sequences. Journal of Genetics and Molecular Biology 15(4): 190-197.
Lemmen, D. S. 1989. The last glaciation of Marvin Peninsula, northern Ellesmere Island, High Arctic, Canada. Canadian Journal of Earth Sciences 26: 2578-2590.
Lesica, P. and B. McCune. 2004. Decline of arctic-alpine plants at the southern margin of their range following a decade of climate warming. Journal of Vegetation Science 15: 679-690.
Li, Wen-Hsiung. 1997. Molecular Evolution. Sinauer Associates, Sunderland MA.
Löve, Áskell. 1985. Chromosome number reports LXXXVI. Taxon 34(1): 159-164.
Maddison, D. R., D. L. Swofford and W. P. Maddison. 1997. NEXUS: An extensible file format for systematic information. Systematic Biology 46(4): 590-621.
Marr, K. L., G. A. Allen and R. J. Hebda. 2008. Refugia in the Cordilleran ice sheet of western North America: chloroplast DNA diversity in the Arctic-alpine plant Oxyria digyna. Journal of Biogeography 35(7): 1323 – 1334.
Matthews, J. V. J. 1978. Tertiary and Quaternary environments: Historical background for an analysis of the Canadian insect fauna. In Canada and Its Insect Fauna. H. V. Danks ed. Ottawa, Entomological Society of Canada. 31-86.
Mayuzumi, S. and H. Ohba. 2004. The phylogenetic position of eastern Asian Sedoideae (Crassulaceae) inferred from chloroplast and nuclear DNA sequences. Systematic Botany 29(3): 587-598.
Moran, Reid. 2000. Rhodiola integrifolia Raf. – A rambling account, with two new combinations. Cactus and Succulent Journal (U.S.) 72(3): 137-139.
Morlan, R. E., 1996. Beringia. Beringian Research Notes, No. 9, Yukon Tourism, 4 p. 95
Mort, Mark E., Douglas E. Soltis, Pamela S. Soltis, Javier Francisco-Ortega, and Arnoldo Santos-Guerra. 2001. Phylogenetic relationships and evolution of Crassulaceae inferred from matK Sequence data. American Journal of Botany 88(1): 76–91.
Nair, Raghavan Ramakrishnan. 2007. Aneuploid Variation of Chromosome Number in the Somatic Cells of Piper magnificum Trel. Cytologia 72: 239-242.
Ogilvie R. T. 1998. Vascular Plants. In Assessment of species diversity in the Montane Cordillera Ecozone. Smith, I.M., and G.G.E. Scudder, eds. Burlington: Ecological Monitoring and Assessment Network.
Ohba, Hideaki. 1988. The Himalayan Plants Volume 1. The University Museum, The University of Tokyo Bulletin No. 31, Hideaki Ohba and Samal B. Malta eds.
Ohba, Hideaki. 1999. New infraspecific names in Rhodiola integrifolia Raf. and Orostachys aliciae (Raym.-Hamet) H. Ohba (Crassulaceae). Journal of Japanese Botany 74:1 61-62.
Olfelt, J. P., G. R. Furnier and J. L. Luby. 2001. What data determine whether a plant taxon is distinct enough to merit legal protection? A case study of Sedum integrifolium (Crassulaceae). American Journal of Botany 88(3): 401-410.
Olfelt, J. P., G. R. Furnier and J. L. Luby. 1998. Reproduction and development of the endangered Sedum integrifolium ssp. leedyi (Crassulaceae). American Journal of Botany 85:3 346-351.
Olmsted, Richard G. and Jeffrey D. Palmer. 1994. Chloroplast DNA systematics: A review of methods and data analysis. American Journal of Botany 81(9): 1205- 1224.
Petit, R. J., I. Aguinagalde, J-L de Beaulieu, C. Bittkau, S. Brewer, R. Cheddadi, R. Ennos, S. Fineschi, D. Grivet, M. Lascoux, A. Mohanty, G. Muller-Starck, B. Demesure-Musch, A. Palme, J. P. Martin, S. Rendell, G. G. Vendramin. 2003. Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300: 1563-1565.
Petit, R. J. 2008. The coup do grace for the nested clade phylogeographic analysis? Molecular Ecology 17: 516-518.
Pfenninger, M., and D. Posada. 2002. Phylogeographic history of the land snail Candidula unifasciata (Helicellinae, Stylommatophora): fragmentation, corridor migration, and secondary contact. Evolution 56(9): 1776-1788
Pielou E. C. 1991. After the Ice Age: The return of life to glaciated North America. University of Chicago Press, Chicago and London.
96
Posada, D., K. A. Crandall and A. R. Templeton. 2000. GeoDis: a program for the cladistic nested analysis of the geographical distribution of genetic haplotypes. Molecular Ecology 9(4): 487-488.
Posada D. 2006. ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online. Nucleic Acids Research 34: W700- W703.
Posada D., and K. A. Crandall 1998. ModelTest: testing the model of DNA substitution. Bioinformatics 14: 817–818.
Posada D., and T. R. Buckley. 2004. Model selection and model averaging in phylogenetics: advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793–808.
Pruett Christin L. and Kevin Winkler. 2007. Evidence for cryptic northern refugia among high- and temperate-latitude species in Beringia. Climatic Change 86(1- 2): 23-27.
Rieseberg, L. H., S. Beckstrom-Sternberg and K. Doan. 1990. Helianthus annus ssp. texanus has chloroplast DNA and nuclear ribosomal DNA genes of Helianthus debiolis ssp. cucumerifolius. Proceedings of the National Academy of Sciences USA. 87: 598-597.
Rieseberg, L. H., and S. J. Brunsfeld. 1992. Molecular evidence and plant introgression. In Molecular Systematics of Plants. D. E. Soltis, P. S. Soltis and J. J. Doyle eds. Routledge, Chapman and Hall, New York. 151-176.
Sang, T., D. Crawford and T. Stuessy. 1997. Chloroplast DNA phylogeny, reticulate evolution and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120-1136.
Savile, D. B. O. 1972. Arctic Adaptations in Plants. Monograph no. 6. Canadian Department of Agriculture, Ottawa.
Schaal, B. A., D. A. Hayworth, K. M. Olsen, J. T. Rauscher and W. A. Smith. 1998. Phylogeographic studies in plants: problems and prospects. Molecular Ecology 7: 465-474.
Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Suripun, C. T. Winder, E. W. Schilling and R. L. Small. 2005. "The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis." American Journal of Botany 92(1): 142-166.
97
Small, R. L., J. A. Ryburn, R. C. Chronn, T. Seelanan, and J. F. Wendel. 1998. The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogenetic reconstruction in a recently diverged plant group. American Journal of Botany, 85: 1301-1315.
Smith, Christopher I. 2007 Historical Biogeography: The New Synthesis. Current Biology 17:15 R598-R560.
Smith, R. L., and K. J. Sytsma. 1990. Evolution of Populus nigra (sect. Aegiros): Introgressive hybridization and the chloroplast contribution of Populus alba (sect. Populus). American Journal of Botany. 77: 1176-1187.
Soltis, D. E., Matthew A. Gitzendanner, Darren D. Strenge and Pamela S. Soltis. 1997. Chloroplast DNA intraspecific phylogeography of plants from the Pacific Northwest of North America. Plant Systematics and Evolution 206: 353-373.
Stehlik, I., J. J. Schneller and K. Bachmann. 2001. Resistance or emigration: response of the high-alpine plant Eritrichium nanum (L.) Gaudin to the ice age within the Central Alps. Molecular Biology 10: 357-370.
Stehlik, I. F. R. B., R. Holderegger and K. Bachmann. 2002. Nunatak survival of the high Alpine plant Eritrichium nanum (L.) Gaudin in the central Alps during the ice ages. Molecular Ecology 11: 2027-2036.
Storchová H., and M. S. Olson. 2007. The architecture of the chloroplast psbA-trnH non-coding region in angiosperms Plant Systematics and Evolution 268: 235–256.
Swofford, D. L. 2002. PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods) Version 4. Sinauer Associates, Sunderland Massachusetts.
Taberlet, P., L. Gielly, G. Pautou and J. Bouvet. 1991. Universal Primers for Amplification of 3 Noncoding Regions of Chloroplast DNA. Plant Molecular Biology 17(5): 1105-1109.
Templeton, A. R. 1998. Nested clade analyses of phylogeographic data: testing hypotheses about gene flow and population history. Molecular Ecology 7(4): 381- 397.
Templeton, A. R. 2004. Statistical phylogeography: methods of evaluating and minimizing inference errors. Molecular Ecology 13: 789-809.
Templeton, A. R. 2008. Nested clade analysis: an extensively validated method for strong phylogeographic inference. Molecular Ecology 17: 1877–1880.
Templeton, A. R. 2009. Why does a method that fails continue to be used? The answer. Evolution 63(4): 807-812. 98
Templeton, A. R., E. Boerwinkle, and C. F. Sing. 1987. A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping. I. Basic theory and an analysis of alcohol dehydrogenase activity in Drosophila. Genetics 117: 343-351.
Templeton, A. R. and C. F. Sing 1993. A cladistic-analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping .4. Nested analyses with cladogram uncertainty and recombination. Genetics 134(2): 659- 669.
Templeton, A. R., E. Routman, and C. A. Phillips. 1995. Separating population structure from population history: A cladistic analysis of the geographical distribution of mitochondrial-DNA haplotypes in the Tiger Salamander, Ambystoma tigrinum. Genetics 140: 767-782.
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeaumougin and D. G. Higgins. 1997. The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876- 4882.
Tremblay, N. O. and D. J. Schoen. 1999. Molecular phylogeography of Dryas integrifolia: glacial refugia and postglacial recolonization. Molecular Ecology 8: 1187-1198.
Uhl, Charles H. 1952. Heteroploidy in Sedum rosea (L) Scop. Evolution 6: 81-86
Van Ham, Roeland C. H. J., and Henk T’Hart. 1998. Phylogenetic relationships in the Crassulaceae inferred from chloroplast DNA restriction-site variation. American Journal of Botany. 85(1): 123-134.
Waltari, E., John R. Demboski, David R. Klein and Joseph A. Cook. 2004. A molecular perspective on the historical biogeography of the northern high latitudes. Journal of Mammalogy 85(4): 591-600.
Wang, Q., Xiao Ruan, Zhi-hua Jin, Qi-chuan Yan and Shan-jun Tu. 2005. Identification of Rhodiola species by using RP-HPLC. Journal of Zhejiang University Science 6B(6): 477-482.
Warner, B. G., R. W. Mathewes, and J.J. Clague. 1982. Ice-Free Conditions on the Queen Charlotte Islands, British Columbia, at the Height of Late Wisconsin Glaciation. Science 218(4573): 675-677
Weider, L. J. and A. Hobaek. 2000. Phylogeography and arctic biodiversity: a review. Annales Zoologici Fennici 37(4): 217-231.
99
Welsh, Stanley J. 1974. Anderson’s Flora of Alaska and Adjacent Parts of Canada. Brigham Young University Press, Provo, Utah.
Wendel, J. F., and J. J. Doyle. 1998. Phylogenetic incongruence: Window into genome history and molecular evolution. In Molecular Systematics of Plants II: DNA Sequencing. D. E. Soltis, P. S. Soltis, and J. J. Doyle eds. Kluwer, Norwell, Mass. 265-296.
White, T. J., T. Bruns, S. Lee and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications. M. Innis, D. Gelfand, J. Sninsky and T. White (Eds.), Academic Press, San Diego. 315-322.
Widmer, A. and M. Baltisberger. 1999. Extensive intraspecific chloroplast DNA (cpDNA) variation in the alpine Draba aizoides L. (Brassicaceae): haplotype relationships and population structure. Molecular Ecology 8(9): 1405-1415.
Williams John W., Bryan N. Shuman, Thompson Webb III, Patrick J. Bartlein, and Phillip L. Leduc. 2004. Late-Quaternary vegetation dynamics in North America: scaling from taxa to biomes. Ecological Monographs 74(2): 309-334.
Wyman A. R., and R. White. 1980. A Highly Polymorphic Locus in Human DNA Proceedings of the National Academies of Science 77: 6754-6758.
Xia, T., Shilong Chen, Shengyun Chen and Xuejun Ge. 2005. Genetic variation within and among populations of Rhodiola alsia (Crassulaceae) native to the Tibetan Plateau and detected by ISSR markers. Biochemical Genetics 43(3/4): 87-101.
100
Appendices
Appendix 1: Modifications to CTAB DNA extraction Methods.
The modifications to the CTAB method protocol involved the following:
1. The CTAB isolation buffer was not preheated before it was added to a 1.5 mL
Eppendorf tube in which the plant material had been ground in liquid nitrogen
with a nylon pestle.
2. The buffer/ground plant mixture was incubated at 65°C for 90 minutes (or
overnight) to lyse the cells.
3. Samples were extracted twice with 24:1 chloroform-isoamyl alcohol to separate
the DNA from the supernatant.
4. The nucleic acids were precipitated with 0.08 times the aqueous fraction (X) of
7.5 M ammonium acetate and 0.583(X) of isopropanol.
5. The mixture was left at 4ºC for 1 hour or overnight to allow the nucleic acids to
precipitate out.
6. Samples were washed twice, first with 1ml 70% ethanol, then again with 1ml
85% ethanol and allowed to dry at room temperature overnight.
7. Pellets were resuspended in 50l 1x TE [10mM Tris-HCL (pH 7.4), 1mM EDTA
(ethylenediaminetriacetic acid)].
101
Appendix 2: Genbank ITS Sequences used, accession numbers and locations
Species Genbank Location Accession #
Pseudosedum sp. AB088610 Tajikistan
Rhodiola bupleuroides (Hook. F & Thoms) S. H. Fu AB088592 Nepal
R. chrysanthemifolia (H. Lév) S. H. Fu subsp. AB088604 China chrysanthemifolia
R. chrysanthemifolia (H. Lév) S. H. Fu subsp. sacra AB088606 Nepal (Raym. Hamel) H. Ohba #1
R. cretinii (R. Hamet) H. Ohba AB088588 Nepal
R. dumulosa (Franch.) S. H. Fu AB088595 Bhutan
R. fastigiata (Hook.f. & Thoms) S. H. Fu AB088594 Nepal
R. heterodonta (Hook.f. & Thoms) Boriss AB088596 Nepal
R. humilis (Hook.f. & Thoms) S. H. Fu AB088611 Bhutan
R. ishidae (Miyabe & Kudo) H. Hara AB088600 Japan
R. macrocarpa (Praeger) S.H. Fu AB088590 China
R. nepalica (H. Ohba) H. Ohba AB088598 Nepal
R. nobilis (Franch.) S. H. Fu subsp. atuntsuensis AB088589 China (Praeger) H. Ohba
R. rosea L. AB088599 Japan
R. serrata H. Ohba AB088597 China
R. sinuata (Edgw.) S. H. Fu AB088605 Bhutan
R. wallichiana (Hook.) S. H. Fu AB088607 Nepal
R. yunnanensis (Franch.) S. H. Fu AB088602 China
102
Appendix 3: PsbA-trnH sequences alignments of Rhodiola integrifolia and R. rhodantha. Letter codes in left column denote haplotypes. All sequences are of R. integrifolia, except sequence haplotype AA which includes sequences of both R. integrifolia and R. rhodantha.
B CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA T CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA M CTTGGCTACATCCGCCC------TATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA J CTTGGCTACATCCGCCC------TATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA H CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA N CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA A CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA S CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA F CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTCTCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA D CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTCTCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA I CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA K CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA AB CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA O CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA R CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA Z CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTATTTTCTTATAA AA CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTATTTTCTTATAA Y CTTGGCTACATCCGCCCCTAGTCTATATATAAAAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTATTTTCTTATAA P CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA W CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA X CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTCTCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA E CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA Q CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCAGTTTTTCTTAT------AA G CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA L CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA C CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA U CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTCTCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA V CTTGGCTACATCCGCCCCTAGTCTATATATAACAAAATTTATCAGTTTGAAGTTTGACCGGTTTTTCTTAT------AA ***************** ********* ******* ****************** *********** ** 5’ position 18 23 33 41 60 72 79 102
103
B AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTCAAAAATTATAAACTCTAGCAGTTTCAAAA T AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA M AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA J AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA H AAAAATGCATTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA N AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA A AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA S AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA F GAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA D GAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA I AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA K AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGTATTAAAAAATTATAAACTCTAGCAGTTTCAAAA AB AAAAATGCAGTAAAT------AAAAACTCTTACATTTACAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA O AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA R AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA Z AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA AA AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA Y AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA P AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA W AAAAATGCAGTAAATGTAAATAAAAACTCTTACATTTCCAAAAATTGGATTCAAAAATTATAAACTCTAGCAGTTTCAAAA X AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA E AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA Q AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA G AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTAGAAACTCTAGCAGTTTCAAAA L AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA C AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATGATAAACTCTAGCAGTTTCAAAA U GAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA V AAAAATGCAGTAAAT------AAAAACTCTTACATTTCCAAAAATTGGATTAAAAAATTATAAACTCTAGCAGTTTCAAAA ******** ***** **************** ********* *** ****** * ********************
5’ position 83 91 97 – 102 119 129 133 140 142 103
104
B ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT T ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT M ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT J ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT H ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT N ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACAAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT A ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACAAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT S ACTATTAAGTAAAAGATTACACAATAAAGGAGAAATAACAAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT F ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT D ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACAAATTTCTTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT I ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTTAAAAACTCGTAT K ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTTAAAAACTCGTAT AB ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTATCCTTTATTTTTAAAAACTCGTAT O ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTTAAAAAACTCGTAT R ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAATTTCTTGGTTATTTCTCCTTTATTTAAAAAAACTCGTAT Z ACTATTAAGTAAAAGGTTACACAATAAAGGATAAATAACCAATTTCTTGGTTATTTATCCTTTATTTTCAAAAACTCGTAT AA ACTATTAAGTAAAAGGTTACACAATAAAGGATAAATAACCAAGAAATTGGTTATTTATCCTTTATTTTCAAAAACTCGTAT Y ACTATTAAGTAAAAGGTTACACAATAAAGGATAAATAACCAAGAAATTGGTTATTTATCCTTTATTTTCAAAAACTCGTAT P ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT W ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT X ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTTGTTATTTCTCCTTTATTTTCAAAAACTCGTAT E ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTTGTTATTTCTCCTTTATTTTCAAAAACTCGTAT Q ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTTGTTATTTCTCCTTTATTTTCAAAAACTCGTAT G ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTTGTTATTTCTCCTTTATTTTCAAAAACTCGTAT L ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTAGTTATTTCTCCTTTATTTTCAAAAACTCGTAT C ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT U ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTGGTTATTTCTCCTTTATTTTCAAAAACTCGTAT V ACTATTAAGTAAAAGGTTACACAATAAAGGAGAAATAACCAAGAAATTGGTTATTTCTCCTTTATTTTTAAAAACTCGTAT *************** *************** ******* ** ** ******* ********** ************
5’ position 178 193 201 210 218 229 184 204-207 227 230
104
105
B AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- T AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- M AGACTAATACCGAAGTGTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- J AGACTAATACCGAAGTGTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- H AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- N AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- A AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- S AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- F AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- D AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- I AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- K AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- AB AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCTT O AGACTAATACCGAAATTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- R AGACTAATACCGAAATTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- Z AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- AA AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- Y AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- P AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- W AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- X AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- E AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- Q AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- G AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- L AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- C AGACTAATACCGAAATTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- U AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- V AGACTAATACCGAAGTTTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCT- ************** * ****************************************
5’ position 258 260
105
106
Appendix 5: Inference Key for the Nested Haplotype Tree Analysis of Geographical Distances (Templeton, 2004).
Start with haplotypes nested within a 1-step clade and work up to clades nested within the total tree. If the tree is not rooted through an outgroup or if none of the clades nested at the total tree level have the sum of the outgroup probabilities of their haplotypes greater than or equal to 0.95, regard all clades nested at the total tree level as tips. When rooting is deemed reliable, interiors should also refer to the older clades in a nesting category, and tips to their evolutionary descendants.
This key is applied only if there are some significant values for Dc, Dn, or I-T within the nesting clade. If there are no statistically significant distances within the clade, the null hypothesis of no geographical association of haplotypes cannot be rejected (either panmixia in sexual populations, extensive dispersal in non-sexual populations, small sample size, or inadequate geographical sampling). In that case, move on to another clade at the same or higher level.
When performing a single-locus nested clade analysis, the significance of the test results should be corrected for multiple testing with the Dunn-Sidak correction, which is now incorporated into the program. When performing multi-locus nested clade analysis, the Dunn-Sidak correction is not needed, and the original probability values should be used to determine significance. In the case of multi-locus nested clade analysis, the false positive rate is corrected by cross-validation across loci.
1. Are all clades within the nesting clade found in separate areas with no overlap? • NO – Go to step 2. • YES - Go to step 19.
2. Is at least one of the following conditions satisfied? a. The DC’s for one or more tips are significantly small and the DC’s for one or more of the interiors are significantly large or non-significant. b. The DC’s for one or more tips are significantly small or non-significant and the DC’s for some but not all of the interiors are significantly small. c. The DC’s for one or more interiors are significantly large and the DC’s for the tips are either significantly small or non-significant d. The I-T DC is significantly large. • NO - Go to step 11. • YES - Go to step 3. • Tip/Interior Status Cannot be Determined - Inconclusive Outcome.
3. Is at least one of the following conditions satisfied? a. Some DN and/or I-T DN values are significantly reversed from the DC values. b. One or more tip clades show significantly large DN’s. c. One or more interior clades show significantly small DN’s. d. I-T has a significantly small DN with the corresponding DC value non-significant. • NO - Go to step 4. 107
• YES - Go to step 5.
4. Are both of the following conditions satisfied? a. The clades (or 2 or more subsets of them) with significantly small DC or DN values have ranges that are completely or mostly non-overlapping with the other clades in the nested group (particularly interiors). b. The pattern of completely or mostly non-overlapping ranges in the above condition represents a break or reversal from lower level trends within the nested clade series (applicable to higher-level clades only). • NO - Restricted Gene Flow with Isolation by Distance (Restricted Dispersal by Distance in Non-sexual species). This inference is strengthened if the clades with restricted distributions are found in diverse locations, if the union of their ranges roughly corresponds to the range of one or more clades (usually interiors) within the same nested group (applicable only to nesting clades with many clade members or to the highest level clades regardless of number), and if the DC values increase and become more geographically widespread with increasing clade level within a nested series (applicable to lower level clades only). • YES - Go to step 9.
5. Are both of the following conditions satisfied? a. The clades (or 2 or more subsets of them) with significantly small DC values have ranges that are completely or mostly non-overlapping with the other clades in the nested group (particularly interiors). b. The pattern of completely or mostly non-overlapping ranges in the above condition represents a break or reversal from lower level trends within the nested clade series (applicable to higher-level clades only). • NO - Go to step 6. • YES - Go to step 15.
6. Do clades (or haplotypes within them) with significant reversals or significant DN values without significant DC values define two or more geographically concordant subsets. • No - Go to step 7. • YES - Go to step 13. • TOO FEW CLADES (< 2) TO DETERMINE CONCORDANCE - Insufficient Genetic Resolution to Discriminate between Range Expansion/Colonization and Restricted Dispersal/Gene Flow - Proceed to step 7 to determine if the geographical sampling is sufficient to discriminate between short versus long distance movement.
7. Are the clades with significantly large DN’s (or tip clades in general when DN for I-T is significantly small) separated from the other clades by intermediate geographical areas that were sampled? • NO - Go to step 8. • YES - Restricted Gene Flow/Dispersal but with some Long Distance Dispersal.
108
8. Is the species absent in the non-sampled areas? • NO - Sampling Design Inadequate to Discriminate between Isolation by Distance (Short Distance Movements) versus Long Distance Dispersal • YES - Restricted Gene Flow/Dispersal but with some Long Distance Dispersal over Intermediate Areas not Occupied by the Species; or Past Gene Flow Followed by Extinction of Intermediate Populations.
9. Are the different geographical clade ranges identified in step 4 separated by areas that have not been sampled? • NO - Allopatric Fragmentation. (If inferred at a high clade level, additional confirmation occurs if the clades displaying restricted by at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps.) • YES - Go to step 10.
10. Is the species absent in the non-sampled areas? • NO - Geographical Sampling Scheme Inadequate to Discriminate Between Fragmentation and Isolation By Distance. • YES - Allopatric Fragmentation. (If inferred at a high clade level, additional confirmation occurs if the clades displaying restricted by at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps.)
11. Is at least one of the following conditions satisfied? a. The DC value(s) for some tip clade(s) is/are significantly large. b. The DC value(s) for all interior(s) is/are significantly small. c. The I-T DC is significantly small. • NO - Go to step 17 • YES - Range Expansion, go to step 12.
12. Are the DN and/or I-T DN values significantly reversed from the DC values? • NO - Contiguous Range Expansion. • YES - Go to step 13.
13. Are the clades with significantly large DN’s (or tip clades in general when DN for I-T is significantly small) separated from the geographical center of the other clades by intermediate geographical areas that were sampled? • NO - Go to step 14. • YES – 1) Long Distance Colonization, Past Larger Range Coupled with Subsequent Extinction in Some Intermediate Geographical Areas, or Past Range Expansion, All of Which Can Possibly Be Coupled with Subsequent Fragmentation (subsequent fragmentation is indicated if the clades displaying restricted but at least partially non-overlapping distributions are mutationally connected to one another by a larger than average number of steps) or 2) Past Fragmentation Followed by Range Expansion. To see if secondary contact is involved in scenario 2), perform the supplementary tests given in Templeton, 109
Molecular Ecology 10: 779-791, 2001. To discriminate the type of movement leading to this pattern in scenario 1), go to step 21.
14. Is the species present in the intermediate geographical areas that were not sampled? • YES - Sampling Design Inadequate to Discriminate between Contiguous Range Expansion, Long Distance Colonization, and Past Fragmentation. • NO - Long Distance Colonization and/or Past Fragmentation (not necessarily mutually exclusive). If inferred at a high clade level, fragmentation rather than colonization is inferred if the clades displaying restricted but at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps. If the branch lengths are short, a colonization event is inferred, perhaps associated with recent fragmentation. To discriminate the type of movement leading to this pattern, go to step 21.
15. Are the different geographical clade ranges identified in step 5 separated by areas that have not been sampled? • NO - Past Fragmentation and/or Long Distance Colonization (not necessarily mutually exclusive). If inferred at a high clade level, fragmentation rather than colonization is inferred if the clades displaying restricted but at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps. If the branch lengths are short, a colonization event is inferred, perhaps associated with recent fragmentation. To discriminate the type of movement leading to this pattern, go to step 21. • YES - Go to step 16.
16. Is the species present in the intermediate geographical areas that were not sampled? • YES - Go to step 18. • NO - Allopatric Fragmentation. If inferred at a high clade level, additional confirmation occurs if the clades displaying restricted by at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps.
17. Are either of the following conditions satisfied? a. The DN values for tip or some (but not all) interior clades are significantly small. b. The DN for one or more interior clades is/are significantly large. c. The I-T DN value is significantly large. • NO - Inconclusive Outcome. • YES - Go to step 4.
18. Are the clades found in the different geographical locations separated by a branch length with a larger than average number of mutational steps. • NO - Geographical Sampling Scheme Inadequate to Discriminate Between Fragmentation, Range Expansion, and Isolation By Distance. • YES - Geographical Sampling Scheme Inadequate to Discriminate Between Fragmentation and Isolation By Distance.
110
19. Is the species present in the areas between the separated clades? • NO – Allopatric Fragmentation. If inferred at a high clade level, additional confirmation occurs if the clades displaying restricted by at least partially non- overlapping distributions are mutationally connected to one another by a larger than average number of steps. • YES - Go to step 20.
20. Was the species sampled in the areas between the separated clades? • NO – Inadequate Geographical Sampling. • YES – Go to step 2.
21. Are all of the following true? a. Is it biologically realistic that the organism could have undergone long-distance movement? b. Are the nested haplotypes that mark a potential long-distance colonization event within a clade that shows evidence of population growth by other methods (such as mismatch distributions)? c. At the level of the entire cladogram, does the clade not inferred to have produced long-distance colonization not show evidence of past population growth with other methods? • YES – Long-distance movement. • NO – Insufficient evidence to discriminate between long-distance movements of the organism and the combined effects of gradual movement during a past range expansion and fragmentation. If the case against long-distance movement is compelling, then the inference is past gradual range expansion followed by fragmentation or a past larger range followed by extinction in intermediate areas.
111
Appendix 6: CLUSTAL X (1.83) multiple sequence alignment of each R. integrifolia and R. rhodantha ITS Haplotype with ITS sequences of 17 other species of Rhodiola and Pseudosedum from Genbank
R. integrifolia a ATCAAGGATGCTCCGTTCGGGTTAT-AATTTTGAGAGAGAGAGACGACGGCAGCAACACG R. integrifolia b ATCAAGGATGCTCCGTTCGGGTTAT-AATTTTGAGAGAGAGAGACGACGGCAGCAACACG R. integrifolia c ATCAAGGATGCTCCGTTCGGGTTAT-AATTTTGAGAGAGAGAGACGACGGCAGCAACACG R. integrifolia d ATCAAGGATGCTCCGTTCGGGTTAT-AATTTTGAGAGAGAGAGACGACGGCAGCAACACG R. integrifolia e ATCAAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACAGCAGCAACACG R. integrifolia f ATCAAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACAGCAGCAACACG R. rhodantha ATCGAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCAACACG R. wallichiana ATCAAGGATGCTCCGTTCGGGTTGT-AATTTCGAGAGAGAGGGACGACGGATGCGACGCG R. serrata ATCAAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACGCG R. nepalica ATCGAGGATGCTCCCTTCGGGTTAT-CATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. bupleuroides ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. cretinii ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. amabilis ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. macrocarpa ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. nobilis ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAAGGACGACGGCAGCGACACG R. fastigiata ATCGAGGATGCTCCCTTCGGGTTATTAATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. dumulosa ATCGAGGATGCTCCCTTCGGGTTATTAATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. rosea Quebec ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. rosea Japan ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. ishidae ATCGAGGACGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. heterodonta ATCGAGGATGCTCCCTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACGGCAGCGACACG R. yunnanensis ATCAAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGAGGGACGACG------ACACG R. chrysanthemifolia ATCGAGGATGCTCCGTTCGGGTTTT-AATTTCGAGAGAGACAGACGAGGGCAGCGACACG R. sinuata ATCGAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGACGGACGACGGCAACGACACG R. chry. ssp. sacra ATGGAGGATGCTCCGTTCGGGTTAT-AATTTCGAGAGAGACATACGACGGCAGCGACACG R. humilis ATCGAGGATGCTCCGTTCGGGTTAT-AATTTCAAAAGAGAGGGGCGACGTCATCAACACG Pseudosedum ATCAAGGATGCTCCGTTTGGGTTAT-AATTTAGAGAGAGACGGACGACGGCAGCGACACG ** **** ***** ** ***** * **** * ***** *** ** ** 3 26 32 5’ Position 4 9 15 18 24 27 33 35 41-44 48 - 55 58
111
112
R. integrifolia a CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. integrifolia b CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. integrifolia c CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. integrifolia d CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. integrifolia e CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. integrifolia f CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGCCTCG R. rhodantha CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGTCTCG R. wallichiana CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGTCTCG R. serrata CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAGCCGTCTCG R. nepalica CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCC R. bupleuroides CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTTTAACAGTCTCG R. cretinii CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. amabilis CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. macrocarpa CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. nobilis CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. fastigiata CAACGCTCAAA-GGCACAAGTCCTTGCAACCACCACTTATCGCGACGTCTAACAGTCTCG R. dumulosa CAACGCTCAAA-GGCACAAGTCCTTGCAACCACCACTTATCGCGACGTCTAACAGTCTCG R. rosea Quebec CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. rosea Japan CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. ishidae CAACGCTCAAA-GGCACAAGGCCTTGCAACCACCACTTATCGCGACGTCTAACAGTCTCG R. heterodonta CAACGCTCAAA-GGCACAAGGCCTTGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. yunnanensis CAACGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTATCGCGACGTCTAACAGTCTCG R. chrysanthemifolia CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAAACGTCTCG R. sinuata CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACGTCTAACCGTCTCG R. chry ssp. sacra CAAAGCTCAAA-GGCACAAGGCCTCGTAACCACCACTTGTCGCGACATCTAAT-GTCTCG R. humilis CAAAGCTCAAA-GGCACAAGGCCTCGTGACCACCACTTGTCGCGACGTCATACCGTCTCG Pseudosedum CAAAGCTCAAAAGGCACAAGGCCTTGTAACCACCACTTGTCGCGACGTCTATCCGTCTCG *** **** ** ******** *** * ********** ******* * * *** 87 107 116 5’ Position 64 69 72 81 85 88 99 109- 114 120
112
113
R. integrifolia a AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCCCCAA R. integrifolia b AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCCCCAA R. integrifolia c AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCTCCAA R. integrifolia d AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCCCCAA R. integrifolia e AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCCCCAA R. integrifolia f AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGACCAAGCTTCACCCCCAA R. rhodantha AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCCCACGGGAGGCCAAGCTTCACCCCCAA R. wallichiana AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCGCCCC-AA R. serrata AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCACCCCCAA R. nepalica AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. bupleuroides AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. cretinii AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. amabilis AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. macrocarpa AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. nobilis AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. fastigiata AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. dumulosa AGGCTCGTTTTTAAGCCATCCGCCAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. rosea Quebec AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. rosea Japan AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCGA R. ishidae AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. heterodonta AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGTAGGCCAAGCTTCACCCCCAA R. yunnanensis AGGCTCGTTTTTAAGCCATCCGTAAGTTTGGGCTCACGGGAGGCCAAGCTTCACCCCCAA R. chrysanthemifolia AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCGCCCCGAA R. sinuata AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCACCCCCAA R. chry ssp. sacra AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCACCCCCAA R. humilis AGGCTCGTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCGCCCCCAA Pseudosedum AGGCTCTTTTTTAAGCCATCCGCGAGTTTGGGCTCACGGGAGGCCAAGCTTCACCCCCAA ****** *************** ********* ***** ** ********* ** * * 143 160 173 178 5’ Position 127 144 154 163 176 179 113
114
R. integrifolia a TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. integrifolia b TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. integrifolia c TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. integrifolia d TACATGTATGGGGGGCAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. integrifolia e TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. integrifolia f TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. rhodantha TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. wallichiana TACATGTATGGGGG-CAACACGATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. serrata TACATGTATGGGGG-CAACACGATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. nepalica TACAAGAATGGGGA-CATCACACTATGTGACGCCCAGGCAGACGTGCCCTAGGCCTAATG R. bupleuroides TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. cretinii TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. amabilis TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. macrocarpa TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. nobilis TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. fastigiata TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. dumulosa TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. rosea Quebec TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. rosea Japan TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. ishidae TACATGTATGGGGG-CAACACAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. heterodonta TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. yunnanensis TACATGTATGGGGG-CAACATAATATGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. chrysanthemifolia TACATGTATGGGGGGCAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. sinuata TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. chry. ssp. sacra TATATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG R. humilis TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG Pseudosedum TACATGTATGGGGG-CAACACAATACGTGACGCCCAGGCAGACGTGCCCTCGGCCTAATG ** * * ****** ** ** ** ************************ ********* 183 186 193 200- 5’ Position 185 194 197 202 205 231
114
115
R. integrifolia a GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. integrifolia b GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. integrifolia c GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. integrifolia d GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. integrifolia e GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. integrifolia f GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. rhodantha GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. wallichiana GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. serrata GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. nepalica GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. bupleuroides GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. cretinii GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. amabilis GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. macrocarpa GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. nobilis GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. fastigiata GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. dumulosa GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. rosea Quebec GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. rosea Japan GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. ishidae GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. heterodonta GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. yunnanensis GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. chrysanthemifolia GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. sinuata GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. chry. ssp. sacra GCTTCGAGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC R. humilis GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC Pseudosedum GCTTCGGGCGCAACTTGCGTTCAAAAACTCGATGGTTCACGGGATTCTGCAATTCACACC ****** *****************************************************
5’ Position 247
115
116
R. integrifolia a AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. integrifolia b AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. integrifolia c AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. integrifolia d AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. integrifolia e AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. integrifolia f AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. rhodantha AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. wallichiana AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. serrata AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. nepalica AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. bupleuroides AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. cretinii AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. amabilis AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. macrocarpa AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. nobilis AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. fastigiata AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. dumulosa AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. rosea Quebec AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. rosea Japan AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. ishidae AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. heterodonta AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. yunnanensis AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCAAGATATCCGTTGCCGAGA R. chrysanthemifolia AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. sinuata AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. chry. ssp. sacra AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA R. humilis AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCAAGATATCCGTTGCCGAGA Pseudosedum AAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGA ***************************************** ******************
5’ Position 342
116
117
R. integrifolia a GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. integrifolia b GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. integrifolia c GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. integrifolia d GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. integrifolia e GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. integrifolia f GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. rhodantha GTCGTTATGGTATTTT-GAATAGACCTATGACCTTGGAAGCCCGAGAACGGGCCACCGAG R. wallichiana GTCGTTATGGTATTTT-GAATAGACCTAAGGCCTTGGCAGCCCGAGAACGGGCCACCGAC R. serrata GTCGTTATGGTATTTT-GAATAGACCTAAGGCCTTGGCAGCCCGAGAACGGGCCACCGAG R. nepalica GTCATTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. bupleuroides GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. cretinii GTCGTTATGGTATTTC-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. amabilis GTCGTTATGGTATTTC-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. macrocarpa GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. nobilis GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. fastigiata GTCGTTATGGTATTTTTGAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. dumulosa GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGAACGGGCCACCGAG R. rosea Quebec GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGATCGGGCCACCGAA R. rosea Japan GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGATCGGGCCACCGAG R. ishidae GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAGATCGGGCCACCGAG R. heterodonta GTCGTCATTGTATTTT-GAATAGACCTATGGCCCTGGCACCCCGAGAACGGGCCACCGAG R. yunnanensis GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAACCCAAAAATGGGCCACCGAG R. chrysanthemifolia GTCGTTATGGTATTTC-GAATAGACCTATGGCCCTGGCAGCCCGAGAACGAGCCACCGAG R. sinuata GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGCCAGCCCGAGAACGAGCCACCGAG R. chry. ssp. sacra GTCGTTATGGTATTTT-GAATAGACCTATGGCCCTGGCAGCCCGAGAATGGGACACCGAA R. humilis GTCGTTATAGTATTTT-GAATAGACCTATGGCCCTAGCAACCCGAGGACGAGCCACTGAG Pseudosedum GTCGTTATGGTTTTTT-GAATAGACCTATGGCCCAAGCAACCCGAGAACGGGCCGCCGAG *** * ** ** *** *********** * ** * *** * * * * * ** 364 369 376 389 394- 400 406- 411 415 420 5’ Position 366 372 377 391 398 404 409 413 417 117
118
R. integrifolia a CCAAGCTCTTTCGATTACGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. integrifolia b CCAAGCTCTTTCGATTACGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. integrifolia c CCAAGCTCTTTCGATTACGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. integrifolia d CCAAGCTCTTTCGATTACGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. integrifolia e CCAAGCTCTTTCGATTACGATTCCTTGGCGCAATCCGCGCCGGGGTTCATTCGTTTCGAT R. integrifolia f CCAAGCTCTTTCGATTACGATTCCTTGGCGCAATCCGCGCCGGGGTTCATTCGTTTCGAT R. rhodantha CCAAGCTCTTTCGATTACGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. wallichiana CCAAGCTCTTCCGGTTTCGATTCCTTGGCGCGATCCGCGCCGGGATTCATTCGTTTCAAT R. serrata CCAAGCTCTTCCGGTTTCGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCTAT R. nepalica CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. bupleuroides CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. cretinii CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. amabilis CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. macrocarpa CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. nobilis CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. fastigiata CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. dumulosa CCAAGCTCTTTCAGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. rosea Quebec CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. rosea Japan CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. ishidae CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. heterodonta CCAAGCTCTTTCGGTTTGGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. yunnanensis CCAAGCTCTTTCGGTTTTGATTCCTTGGCGCGGATCGCGCCGGGGTTCATTTGTTTCGAT R. chrysanthemifolia CCAGGCTCTTTCGGTTTCGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. sinuata CCAAGCTCTTTCGGTTTCGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. chry. ssp. sacra CCAAGCTCTTTCGATTTCAATTCCTTGGCGCGATCCGCGCCGGGGTTCATTCGTTTCGAT R. humilis CCAAGCCCTTTCGATTTCGATTCCTTGGCGCAATCCGCGCCGGGGTTCATTCGTTTCGAT Pseudosedum CCAAGCTCTTTCGATTTCGATTCCTTGGCGCGATCCGCGCCGGGGTTCATTTGTTTCGAT *** ** *** * ** ************ ********* ****** ***** ** 424 433 437- 452- 5’ Position 427 431 434 439 455 465 472 478
118
119
R. integrifolia a TAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGAAAATGGA-GTACCC-GAAG R. integrifolia b CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGAAAATGGA-GTACCC-GAAG R. integrifolia c CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGAAAATGGA-GTACCC-GAAG R. integrifolia d CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGAAAATGGA-GTACCC-GAAG R. integrifolia e CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGAAAATGGA-GTACCC-GAAG R. integrifolia f CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAAGAAAATGGA-GTACCC-GAAG R. rhodantha CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGCAAATGGA-GTACCC-GAAG R. wallichiana CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGCAAATGGAAGTACCCCGAAG R. serrata CAGCGATGGGCGCAAGGCTCATCACCGACCGAGTGGAAGGCAAATGGA-GTACCCCGAAG R. nepalica CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAGTGGA-GTACCC-GAAG R. bupleuroides CAGCAATGGGCGCGAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. cretinii CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. amabilis CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. macrocarpa CAGCAATGGGCACAAGGCTCATCACCGACCGAGGGGGACGCAAATGGA-GTACCC-GAAG R. nobilis CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. fastigiata CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. dumulosa CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. rosea Quebec CAGCAACGAGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. rosea Japan CAGCAACGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. ishidae CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. heterodonta CAGCGATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. yunnanensis CAGCAATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-TGAG R. chrysanthemifolia CAGCGAGGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. sinuata CAGCGATGGGCGCAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. chry. ssp. sacra CAGCGATGGGCACAAGGCTCATCACCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG R. humilis CAGCGATGGGCACAAGGCTCATCTCCGACCGAGGGGAAGGCAAATGGA-GTACCC-GAAG Pseudosedum CAGCGATGGGCGCAAGGCTCATCATTGATCGGTGGGAAGGCAAATGGA-GTTCCC-TAAG *** * * ** * ********* ** ** ** * * ** **** ** *** ** 485 489 494 504- 509 512 517 521 532 536- 5’ Position 481 487 492 506 -514 519 524 529 538
119
120
R. integrifolia a GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. integrifolia b GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. integrifolia c GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. integrifolia d GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. integrifolia e GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. integrifolia f GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. rhodantha GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. wallichiana GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. serrata GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. nepalica GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. bupleuroides GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. cretinii GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. amabilis GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. macrocarpa GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. nobilis GATCCAAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. fastigiata GATCCGAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. dumulosa GATCCGAGTGCATCCACGATTAACAACTTGTCCGCGGTCATGCTTTCTAGGCTTCGACAA R. rosea Quebec GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. rosea Japan GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. ishidae GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. heterodonta GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. yunnanensis GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. chrysanthemifolia GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. sinuata GATCCAAGTGCATCCACGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA R. chry. ssp. sacra GATCCAAGTGCATCCACGATTAACAACTTATCCACGGTCATGCTTTCTAGGCTTCGACAA R. humilis GGTCCAAGTGCATCCACAATTAACAACTTATCCACGGTCATGCTTTCTAGGCTTCGACAA Pseudosedum GATCCAAGAGCATCCGCGATTAACAACTTGTCCACGGTCATGCTTTCTAGGCTTCGACAA * *** ** ****** * *********** *** ************************** 546 526 5’ Position 542 549 528 540 544
120