MAPK Kinase 3 Is a Tumor Suppressor with Reduced Copy Number in Breast Cancer

Author Manuscript Published OnlineFirst on November 14, 2013; DOI: 10.1158/0008-5472.CAN-13-1310 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

MAPK kinase 3 is a tumor suppressor with reduced copy number in breast cancer

Adam J. MacNeil1,2,3, Shun-Chang Jiao4, Lori A. McEachern5, Yong Jun Yang6, Amanda

Dennis1,2, Haiming Yu4, Zhaolin Xu3,7, Jean S. Marshall1,3, and Tong-Jun Lin1,2,3,7

1 Department of Microbiology & Immunology, Dalhousie University, Halifax, Nova Scotia, B3K

6R8, Canada.

2 Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia, B3K 6R8, Canada.

3 Beatrice Hunter Cancer Research Institute, Suite 2L-A2, Tupper Link, 5850 College Street, PO

Box 15000, Halifax, Nova Scotia, B3H 4R2, Canada.

4 Department of Medical Oncology, General Hospital of the People's Liberation Army, Beijing,

100853, China.

5 Department of Physiology & Biophysics, Dalhousie University, Halifax, Nova Scotia, B3K

6R8, Canada.

6 Institute of Zoonosis, College of Animal Sciences and Veterinary Medicine, Jilin University,

Changchun, Jilin, 130062, China.

7 Department of Pathology, Dalhousie University, Halifax, Nova Scotia, B3K 6R8, Canada.

Correspondence: Shun-Chang Jiao, email:[email protected]; Department of Medical

Oncology, General Hospital of the People's Liberation Army, Beijing, 100853, China. Tong-Jun

Lin, email: [email protected]; phone 902-470-8834; IWK Health Centre, Department of

Pediatrics, Dalhousie University, 5850/5980 University Ave, Halifax, Nova Scotia, B3K 6R8,

Canada.

The authors have declared that no conflict of interest exists.

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2013 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 14, 2013; DOI: 10.1158/0008-5472.CAN-13-1310 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Cancers are initiated as a result of changes that occur in the genome. Identification of

gains and losses in the structure and expression of tumor suppressor genes and oncogenes lies at the root of the understanding of cancer cell biology. Here we show that the MAPK kinase MKK3 suppresses the growth of breast cancer where it varies in copy number. A pervasive loss of

MKK3 gene copy number in breast cancer patients is associated with an impairment of MKK3 expression and protein level in malignant tissues. To assess the functional role of MKK3 in breast cancer, we showed in an animal model that MKK3 activity is required for suppression of tumor growth. Active MKK3 enhanced expression of the cyclin-dependent kinase inhibitors

Cip1/Waf1 Kip1 p21 and p27 , leading to increased cell cycle arrest in G1 phase of the cell cycle. Our

results reveal the functional significance of MKK3 as a tumor suppressor and improve

understanding of the dynamic role of the MAPK pathway in tumor progression.

Precis: Findings reveal the functional significance of a MAPK kinase as a tumor suppressor in

breast cancer and improve our understanding of the dynamic role of the MAPK pathway in

tumor progression.

Introduction

Since its initial description, endogenous suppression of tumorigenesis has been a

cornerstone and topic of intensive investigation in cancer research (1). Today, we appreciate that

cells employ a growing assortment of genes to restrict proliferation and prevent tumor growth,

including those that function in cell cycle checkpoints and mitogenic signalling (2-4).

Identification of changes to the genetic material encoding critical regulators of these processes is

a central theme in efforts toward understanding cancer development, as all cancers carry

tumorigenic somatic mutations (5, 6).

Current thought on tumor suppressor loss suggests a more fluid continuum model, in

which subtle, but critical, changes in tumor suppressor levels can have drastic effects on the

development of cancer, rendering haploinsufficiencies and partial losses just as tumorigenic as

“two hits” (7). Chromosome 17 has emerged as a lightning rod of cancer-associated genetic

mutations and rearrangements, with the 17p arm in particular a noted hotspot for deletions (8-

10). However, the identity of specific genes with tumor suppressive function within these regions

has remained elusive. The MKK3 gene is located on chromosome 17p11.2, and recent proteome- profiling work has highlighted MKK3 as a senescence-promoting and generally downregulated protein in immortalized mammary epithelial cells (11), adding weight to the pursuit of mechanistic insight into the functional role of MKK3 activity in breast cancer.

Breast cancer is the most commonly diagnosed cancer in women and second-leading cause of cancer-related deaths, statistics which strongly advocate for a better understanding of the mechanisms that underlie mammary carcinogenesis (12). In this report, we show that MKK3 expression is impaired in malignant mammary tissues and identify a significant copy number loss of genomic MKK3 in human breast cancer patients. In a model of breast cancer, active

MKK3 significantly restricted tumor growth both in vivo and in an in vitro cell line expression system, while impaired MKK3 signals led to dramatically enhanced tumor growth. Cyclin-

Cip1/Waf1 Kip1 dependent kinase inhibitors p21 and p27 , mediators of G1 cell cycle arrest, were both significantly upregulated in an MKK3 activity-dependent mechanism, resulting in inhibition of cell cycle progression in breast cancer cells. These findings identify new molecular functions for

MKK3-dependent signalling and position MKK3 as a novel tumor suppressor that is altered in human breast cancer.

Materials and Methods

Pathology samples from breast cancer patients

The Ethics Committee of Chinese PLA General Hospital in Beijing approved this study, and

informed consent was obtained from the patients. All pathology samples and clinical information

were collected in accordance with institutional guidelines and regulations.

Animals

Immunodeficient Rag1-/- mice were from Jackson (B6.129S7-Rag1tm1Mom/J). Protocols were

approved by the University Committee on Laboratory Animals, Dalhousie University, in

accordance with the guidelines of the Canadian Council on Animal Care.

Antibodies and Reagents

Antibodies to cyclin-dependent kinase inhibitors p21, p27, p16, p15, p18, and p57 as well as

phospho-ATF2, phospho-p53 (Ser6; Ser9; Ser15; Thr81; Ser20; Ser33; Ser37; Ser46; Ser392),

phospho-Akt, total Akt, and c-Jun were purchased from Cell Signaling Technology, Inc.

(Beverly, MA). Antibodies for MKK3 (C-19), actin, and HRP-linked secondary antibodies were

purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibody for phospho-p21

(Ser130) was from Biorbyt (San Francisco, CA). FITC-conjugated antibodies to Flag were from

Sigma (Oakville, ON). Alexa 594-conjugated goat anti-rabbit secondary was from Invitrogen

(Carlsbad, CA). Recombinant stem cell factor (SCF) was from PeproTech Inc. (Rocky Hill, NJ).

TissueScan cDNA arrays and quantitative PCR

Quantitative PCR cDNA arrays were conducted using cDNA arrays (Origene, Cancer Survey cDNA Array 96 – I, lot number 0312) according to the manufacturer’s instructions. Primer

sequences were: MKK3, For 5’- CTTGGTGACCATCTCAGAACTGG -3’ and Rev 5’-

CTTCTGCTCCTGTGAGTTCACG -3’ and PPIA, For 5’- ACCGCCGAGGAAAACCGTGT -3’ and Rev

5’- CTGTCTTTGGGACCTTGTCTGCAA -3’.

For correlative analysis, total RNA was extracted from clinical tumor sample tissue using

Trizol and reverse transcribed using Reverse Transcriptase M-MLV (TakaRa), according to the

manufacturer’s instructions. The primers used in qPCR for MKK3 and PPIA were as noted

above and for GAPDH were: For 5’- ACATCATCCCTGCCTCTACTG -3’ and Rev 5’-

ACCACCTGGTGCTCAGTGTA -3’. For additional detail see Supplementary Materials and Methods.

Immunohistochemistry

Slides with sections of formalin-fixed paraffin-embedded (FFPE) normal mammary tissues and

patient-derived tumor tissues (Origene and study patients) were incubated in 10 mM citrate-

tween buffer at 97°C for 20 mins for antigen unmasking. Specimens were blocked in 2% goat

serum/5% BSA in PBS-tween for 2 hrs, and incubated overnight at 4°C in rabbit anti-MKK3 (C-

19, Santa Cruz) at 1:100 in 5% BSA PBS-tween. Slides were then washed and incubated with

Alexa 594-conjugated goat anti-rabbit (Invitrogen) at 1:2000 in blocking buffer. Specimens were

mounted in DAPI (Vectasheild) and imaged using equivalent settings on a Nikon E600

microscope equipped with 20X or 40X objective lens using ACT-1 software (Nikon).

Quantitative PCR assessment of genomic MKK3 in clinical tumor samples

Human genomic DNA was isolated from random breast cancer patient tumor samples at

SinoGenoMax Co. (Beijing, China). Normal female genomic DNA samples were from a random

control panel (Sigma, HRC1). Ct values for two distinct genomic sites in the MKK3 gene and

five reference genomic sites (BCMA, SDC4, NUDT6, FGF2, and MYOD1) were determined for

each DNA sample. Seg-1 and NCI-H774 (ATCC, Manassas, VA) cell lines were used as internal

controls as NCI-H774 cells have a previously reported double deletion of the MKK3 gene (13).

A 1:1 mixture of Seg-1 and NCI-H774 is thus expected to have a half level of genomic MKK3.

For additional detail see Supplementary Materials and Methods.

Fluorescence in situ hybridization (FISH)

Slides with sections of formalin-fixed paraffin-embedded (FFPE) patient-derived tumor tissues

(study patients) were analyzed using the Histology FISH kit (Dako, Denmark) according to the

manufacturer’s instructions. Probe with specificity for the MKK3 gene (SureFISH Chr17 CEP,

Red, Human Chr17: 20893971-21327887, Agilent Technologies, Cedar Creek, TX) was used

according to the manufacturer’s instructions (Dako). For additional detail see Supplementary

Materials and Methods.

Generation of stable cell lines

MDA-MB-468 cells were obtained via the ATCC and resuscitated from early passage liquid

Nitrogen vapour stocks as needed and cultured in DMEM supplemented with 10% FBS. Cells

were cultured for less than 3 months before re-initiating cultures and were routinely inspected

microscopically for stable phenotype. A concentration of 0.8 mg/ml G418 was used to generate

stable lines. MDA-MB-468 cells were transfected with Flag-MKK3dn or Flag-MKK3ca plasmids (Addgene, Cambridge, MA) using lipofectamine 2000 (Invitrogen, Carlsbad, CA).

Stable colonies of cells were plated under selection by limiting dilution to isolate stable clones.

Plates were incubated for 3 weeks allowing colonies to form.

Immunofluorescence

Cells were grown on glass coverslips, fixed with 4% paraformaldehyde for 20 min, and

permeabilized with a 0.2% solution of Triton-X in PBS for 10 min. Samples were blocked with

10% BSA (Sigma, Oakville, ON) for 30 mins followed by a 2 hr incubation with anti-Flag

antibody (1:500) in a 3% BSA solution in PBS and finally with Alexa 594-conjugated goat anti-

mouse IgG F(ab)2 (Molecular Probes) at 1:200 for 1 hr. Coverslips were mounted with DAPI-

containing Vectasheild (Vector Laboratories, Burlingame, CA).

Flow cytometry

Cells (5 ×105) were collected using trypsin (Invitrogen), fixed, and permeabilized using

Cytofix/Cytoperm buffer (BD Biosciences) for 20 min. Cells were stained in 100 μl with FITC- conjugated Flag antibody (1:1000 or 1 μg/ml) for 2 hr, washed, and analyzed on a FACS Aria

(BD Biosciences).

Tumor growth in vivo

For xenotransplantation studies, 1 x107 log-phase growing untransfected, MKK3dn, or MKK3ca

MDA-MB-468 cells were trypsinized, washed twice in PBS, and injected into immuno-

comprimised Rag1-deficient mice at the mammary fat pad (200 μl/injection in PBS). At

endpoint, tumors were surgically excised, collected, and imaged using an iPhone 4S (Apple).

Tissue specimens were fixed in 10% buffered formalin, embedded in paraffin, sectioned, and

stained with haematoxylin and eosin (H&E).

Thymidine incorporation and WST-1 assay

5 x103 cells were seeded in quadruplicate in a 96-well plate. 48 hrs later, cells were pulsed with

0.25 μCi of 3H-thymidine for 3 hrs. Incorporation was measured on a Wallac 1409 scintillation

beta counter. For WST-1 assays, cells were cultured as above for 4 days and WST-1 proliferation reagent (Clontech) was added at 1:10 dilution. Plates were read 90 mins later.

Quantitative real-time PCR array

1-2 x106 cells were collected and processed using Trizol (Invitrogen) and purified using RNeasy

(Qiagen). Breast Cancer RT-PCR Arrays (Qiagen) were conducted in triplicate according to the

manufacturer’s protocol and qPCR was performed using an ABI 7000 Sequence detector (PE

Applied Biosystems, Foster City, CA). For additional detail see Supplementary Materials and

Methods.

Western blotting and p53 siRNA

Cells were lysed in RIPA buffer supplemented with a cocktail of protease and phosphatase

inhibitors. For siRNA knockdown of p53, WT MDA-MB-468 and MKK3-mutant cells were

used in reverse transfection (Life Technologies, Ambion, TP53 s607 and s605) according to the

manufacturer’s instructions. For additional detail see Supplementary Materials and Methods.

Chromatin immunoprecipitation (ChIP)

WT MDA-MB-468 and MKK3dn, or MKK3ca transfected cells were plated in 10 cm dishes.

The following day, chromatin-protein complexes were prepared according to the manufacturer’s

instruction (ChIP-IT Express Enzymatic, Active Motif). For additional detail see Supplementary

Materials and Methods.

Cell cycle analysis

Cell cycle staging was conducted using Vybrant DyeCycle Green (Invitrogen) by flow cytometry according to the manufacturer's instructions. Data was analyzed using WinList 5.0 software.

Nuclear protein preparation and electrophoretic mobility shift assay (EMSA)

Nuclear protein extracts were isolated using a nuclear extract kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. EMSA was performed as previously described (14).

Double-stranded oligonucleotides for AP-1 and SP-1 consensus binding sequences were from

Promega.

Statistical Analysis

The paired Student’s t test was used for statistical evaluation of data. Results were considered significant when p < 0.05. Data are expressed as means ± SEM unless otherwise indicated.

Results

MKK3 expression and genomic copy number is reduced in human breast cancer. To assess

the mRNA expression level of MKK3 in primary tumor tissues compared to normal tissues, a cDNA array with 9 tumor and 3 normal tissues from eight types of cancer was employed in a quantitative PCR (qPCR) assay. MKK3 gene expression was significantly downregulated in the tumor tissue in five of eight cancers examined, including breast, colon, liver, lung, and thyroid cancer, and was decreased in kidney cancer, while prostate and ovary tumor tissues showed normal MKK3 expression (Fig. 1A). This is the first report of widespread MKK3 expression loss as a feature in several types of cancer, most notably in breast and liver cancers. Following up on this, we examined MKK3 protein levels in cancerous versus normal mammary tissue by immunohistochemistry. A similar remarkable impairment in MKK3 protein expression in cells of the ductal walls was detected in breast tumor tissues (Fig. 1B).

Genomic copy number variation has emerged as a pervasive phenomenon and an important consideration in a broad range of disease causality including breast cancer (15, 16), resulting in gene copy number imbalances or loss of heterozygosity (LOH) that can ultimately lead to altered gene expression and protein function (8). To investigate the copy number status of

MKK3 in clinical samples from breast cancer patients, we designed a qPCR assay to assess relative genomic MKK3 content in patient-derived samples. DNA from the NCI-H774 cell line was used to evaluate specificity and create an internal assay control as NCI-H774 cells have a natural double deletion of the MKK3 gene (13). Remarkably, our analysis revealed a significantly decreased genomic MKK3 level in eight of ten breast cancer patients (Fig. 1C).

Additional patient tumor data from clinical evaluation of common relevant breast cancer markers is provided (Supplementary Table S1). Comparison of genomic and mRNA levels for MKK3 in

patients, suggests a positive correlation between gene loss and gene expression level

(Supplementary Fig. S1). Further evaluation of tissues from these patients by fluorescence in

situ hybridization (FISH) confirmed that MKK3 copy number was heterogeneously reduced,

reflecting intra-tumoral genomic heterogeneity at the MKK3 locus (Fig. 1D). These results are

the first to identify a specific MKK3 copy number deficiency and strongly suggest that copy

number loss may contribute to reduced MKK3 expression in breast cancer. These findings

prompted us to pursue the functional role of MKK3 activity in breast cancer.

MKK3 activity regulates tumor growth in vivo via differential regulation of cell

proliferation. To determine the function of MKK3 signalling activity in breast cancer, we employed the human breast cancer cell line, MDA-MB-468, which had a relative genomic

MKK3 level of 1.44 by qPCR, similar to those patients who displayed genomic loss in Fig 1C.

This cell line was transfected plasmids encoding either a dominant negative (MKK3dn) or constitutively active (MKK3ca) Flag-tagged mutant MKK3 gene, in which the activation site is mutated at two amino acids, rendering the resulting protein either permanently inactive or active

(17). Colonies were selected and assessed for degree of expression and purity by immunofluorescence and flow cytometry and were monitored weekly for stable expression

(Supplementary Fig. S2). To assess the role of MKK3 activity on tumor growth in vivo, we

employed an immunodeficient (Rag1-/-) mouse model permitting xenotransplantation studies

with our human cell lines. MKK3dn, MKK3ca, and untransfected MDA-MB-468 breast cancer

cell lines were transplanted subcutaneously at the mammary fat pad of female Rag1-deficient

mice. Interestingly, a significant and opposing effect on tumor growth was observed in MKK3-

mutant tumors. While MKK3ca tumors grew significantly slower than those resulting from

untransfected MDA-MB-468 cells, MKK3dn tumors grew significantly faster (Fig. 2A). Also noteworthy, was that while all mice that received MDA-MB-468 cells and MKK3dn cells developed tumors, only 50% (p = 0.049) of mice receiving MKK3ca cells developed a palpable tumor. At experimental endpoint, tumor tissues were surgically excised and three representatives from each group are shown (Fig. 2B). Following the trend in tumor growth, a remarkable MKK3 activity-dependent difference in the density of intratumoral MDA-MB-468 cells was observable by histological staining (Fig. 2C). These results indicate that MKK3 activity is suppressive of breast cancer tumor growth, and conversely, that impaired MKK3 signals lead to significantly enhanced breast cancer tumor growth.

To directly determine the role of MKK3 activity on tumor cell proliferation, in vitro studies were conducted using five independently derived MKK3dn and MKK3ca cell lines.

MKK3 activity had a significant impact on basal proliferation, with MKK3ca cells at 64% and

MKK3dn cells at 229% of the proliferative rate of untransfected cells (Fig. 3A). These results were further confirmed using a WST-1 proliferation assay (Fig. 3B) and by counting equivalently seeded cells in culture (Fig. 3C-D). In accordance with our observations on in vivo tumor growth, these findings indicate that MKK3 activity inhibits tumor cell proliferation, and conversely, that a lack of MKK3 signalling may enhance breast cancer tumor growth via enhanced tumor cell proliferation.

MKK3 activity promotes p21 and p27 expression in breast cancer cells. To investigate the mechanism of MKK3 activity-dependent impairment of cell proliferation, a qPCR array was used to assess the expression of 84 breast cancer-related genes in these cells. Of the nine genes found to be differentially/oppositely regulated in MKK3dn and MKK3ca cells, the most

significantly oppositely regulated was cyclin-dependent kinase inhibitor 1A (CDKN1A), the gene encoding the inhibitor of cell cycle progression p21Cip1/Waf1 (Fig. 4A). Quantitative analysis

showed that CDKN1A expression in MKK3ca was 2.56-fold while that of MKK3dn cells was

0.66-fold compared to control cells (Fig. 4A). The full array data set is presented in

Supplementary Table S2.

To confirm our gene expression analysis at the protein level, Western blots were

conducted to analyze the expression of a panel of cyclin-dependent kinase (CDK) inhibitors.

Indeed, opposing expression of p21 protein was detected in MKK3-mutant cell lines in

accordance with mRNA levels detected by qPCR (Fig. 4B). Notably, another CDK inhibitor,

p27Kip1 (CDKN1B), was similarly oppositely deregulated in mutant MKK3 cell lines (Fig. 4B).

Expression of family member p16 (CDKN2A) was in accordance with qPCR data and, as in the

case of p15 (CDKN2B), was not significantly oppositely regulated by MKK3 (Fig. 4B), while

remaining members p18 and p57 were not detectable (data not shown). Phosphorylation of p21

in a p38-dependent mechanism has been reported to stabilize p21 protein (18). We analyzed p21

at Ser130 in our cell lines and could not detect any phosphorylation at this site, suggesting that

this mechanism is not playing a role in our system.

MKK3 activity regulates CDK inhibitors independently of p53 and AP-1. These results

prompted an investigation into the mechanism of MKK3 activity-dependent expression of p21

and p27. It is well-established that MKK3 signalling through the p38 MAPK protein family

culminates in the activation of downstream transcription factors, including activating

transcription factor 2 (ATF2) (19). Monitoring of ATF2 phosphorylation confirmed constitutive

activity in MKK3ca cells and impaired signalling in MKK3dn cells, detectable in cells

stimulated for activation of the MAPK pathway through the stem cell factor receptor c-kit (Fig.

5A). The tumor suppressor p53 is a major regulator of p21 and p27 gene expression, however

p53-dependent and p53-independent mechanisms are known (20-22). Notably however, MDA-

MB-468 cells express a mutant p53 protein with the R273H mutation which results in defective

DNA contact and binding, suggesting that the MKK3 activity-dependent effect is unlikely to be

mediated by p53 (23), but to confirm this was case, we conducted further analysis of p53

activation. To determine if MKK3 signaling activity modifies p53 phosphorylation and activation in MKK3ca cells, Western blotting for activation of the p53 protein was conducted.

No MKK3-dependent activation of p53 consistent with activation of p21 and p27 was detectable.

In fact, MKK3 signals led to dephosphorylation of p53 at Ser9, and in general, inconsistent with a p53-dependent mechanism, total p53 protein expression was slightly enhanced in MKK3dn cells (Fig. 5B). In addition to those shown in Figure 5B, phosphorylation analysis was also conducted at Ser6 and Thr81, but no phosphorylation was detected at these sites. These results suggest that MKK3-activity regulates p21 and p27 expression independently of p53 phosphorylation.

We then further examined the role of p53 in our MKK3 transfected cell lines by siRNA- mediated knockdown of p53. Knockdown of p53 resulted in enhanced expression of both p21 and p27 in all cell lines, and did not impair the enhanced p21 and p27 expression in MKK3ca cells (Fig. 5C). Overall enhanced expression in the knockdowns is likely an effect of removal of the dominant negative and/or gain-of-function effects exerted by the mutant protein on basal p53 target gene expression. These results suggest that in our cell lines, mutant p53 is inhibitory to basal expression of p21 and p27, and that MKK3 can direct p21 and p27 expression in the absence of functional p53. Finally, we examined our cell lines by chromatin

immunoprecipitation to determine if MKK3ca cells might yet have enhanced p53 association

with the p21 promoter via another mechanism. However, our findings show similar p21

promoter binding in in WT and MKK3ca cells, and an enhancement in binding in the MKK3dn

cells. It worth noting however, that the level of binding to the p21 promoter in this assay was

between 0.03 - 0.06% of input DNA, an extremely low overall level that indicates considerably weak interactions between p53 and the p21 promoter, which is not surprising given a functionally defective p53. Altogether, these results suggest that MKK3 activity driven expression of p21 and p27 is occurring via p53-independent mechanism in our model.

The AP-1 transcription factor can also control p21 gene expression through activation of

SP-1 promoter binding (24). Gene expression array data indicated that c-Jun, a component of

AP-1, was oppositely regulated in MKK3-mutant cells, consistent with p21 (Fig. 4A). MKK3-

dependent protein expression of c-Jun was confirmed by Western blotting (Fig. 6B). However,

investigation of the DNA-binding activity of AP-1 and SP-1 revealed that their activities were

not notably altered in the MKK3-mutant cells (Fig. 6C), suggesting that this mechanism is

unlikely to be contributing to MKK3-directed p21 expression.

MKK3 activity promotes p21/p27-mediated G1 cell cycle arrest, inhibiting tumor growth.

Cell cycle regulators p21 and p27 inhibit cell cycle progression at the G1 checkpoint (25), a

considerably attractive mechanism to target in cancer (26-30). Recent studies in glioblastoma

proliferation have shown that a natural plant product, β-elemene, inhibits tumor growth by

arresting cells in the G0/G1 phase through a mechanism dependent on MKK3 activation (31). To

determine if MKK3-mutant cells indeed have deregulated cell cycle progression, flow cytometric

analysis of cell cycle staging was conducted. Consistent with enhanced p21 and p27 expression,

MKK3ca cells showed significant cell cycle arrest at the G1 phase, while MKK3dn cells had

significantly reduced numbers in G1 indicating a more rapid entry into the S phase. Accordingly,

MKK3ca cells had significantly fewer numbers in the G2/M mitotic phase, while MKK3dn cells

had enhanced numbers in S and G2/M (Fig. 7A). Collectively, these results identify MKK3 as a

novel tumor suppressor in breast cancer that is downregulated in a range of cancer types, and

suggest that active MKK3 promotes G1 cell cycle arrest and restricts tumor cell proliferation by

enhancing p21 and p27 expression, resulting in suppressed tumor growth, while impaired MKK3

signals have the opposing effect on both gene expression and tumor growth (Fig. 7B).

Discussion

Addressing the significance of MKK3 in breast and other types of cancer has garnered

increasing interest in recent years as efforts continue to decipher the elusive role of the MAPK pathway in carcinogenesis and tumor suppression (3). In this study, we have identified a new

tumor suppressive role for the mitogenic signalling protein MKK3 in the regulation of breast cancer tumor growth. We have characterized this function mechanistically to be mediated by

MKK3 signalling activity-dependent regulation of the expression of cell cycle inhibitors, p21 and p27, and subsequent restriction of cell cycle progression, as shown in our proposed model

(Fig. 7B). Importantly, we demonstrate that MKK3 expression is significantly impaired in breast cancer tissues, and describe a novel loss of MKK3 genomic copy number in breast cancer patients. This is the first specific detection of MKK3 copy number variation in human cancer and suggests that MKK3 is a suppressor of mammary carcinogenesis with potential prognostic, predictive, and/or therapeutic value.

In breast cancer, inactivation of the MAPK phosphatase Wip1 inhibits mammary

carcinogenesis. Wip1 functions to inactivate signals mediated by MKK3 through the p38 MAPK

pathway, supporting a suppressive role for MKK3 signalling in breast cancer pathogenesis (32,

33). Our mechanistic results expand significantly on how MKK3 activity inhibits carcinogenesis,

through promotion of cell cycle arrest. Inhibition of cell cycle progression is clearly an attractive

mechanism to target and promote in the development of anti-cancer therapies, and the

significance of p21 and p27 expression in this mechanism has not been understated in the

literature (26-28, 34). In breast cancer, p21 and p27 have received considerable attention as

clinical indicators and potential targets in therapeutic development (28-30). In agreement with

the findings we present here, previous work in leukemia showed that impaired MKK3 signals

enhanced prostaglandin PGJ2-induced proliferation, and described impaired p21 and p27 expression in treated THP-1 cells (35). Additionally, a natural fungal product (FTY720) induced

MKK3 activity and p21 expression in prostate cancer cells, leading to cell cycle arrest (36), while studies in muscle cell differentiation have shown that dominant negative MKK3 inhibits p21 and p27 expression (37). Downstream of MKK3, p38 MAPK activity is linked to p27

expression, leading to contact inhibition in mouse embryonic stem cells (38, 39), and it is also

well-known that p38 can activate p53-dependent p21 expression (40), and further stabilize p21

protein by direct phosphorylation (18). While these reports suggest MKK3 signals are linked to

p21 and p27 expression, we report the first direct evidence that active MKK3 is a vital regulator

of these two cycle cell inhibitors, independent of p53 activation, with ramifications in tumor

progression, and may represent a novel approach to targeting cell cycle inhibition in cancer.

Induction of p21 transcription and resultant cell cycle arrest is associated with both p53-

dependent and p53-indpednent mechanisms (20, 22, 34). The DNA damage response is known to

activate p21 expression in a p53-dependent manner inducing transient senescence preceding

DNA repair or apoptosis (41), whereas p53-independent p21 induction is more associated with

the induction of cellular senescence, differentiation, and development (20). The p38 MAPK, a

direct substrate of MKK3, can itself activate p53 at Ser15, Ser33, and Ser46, leading to p21

transcription (3, 42, 43). To determine if MKK3 activity-dependent p21 expression was

regulated by p53, we examined p53 phosphorylation at a range of sites, including Ser46, Ser15,

and Ser392, which are known to lead to p53-dependent p21 transcription (44-46), and found no

altered p53 activation. Notably, total p53 protein was actually slightly enhanced in MKK3dn

cells. We also examined the contribution of p53 by knockdown and by ChIP analysis of

promoter-association. Altogether, these results support a p53-indpendent transcriptional

regulation of p21 by MKK3 activity. Interestingly, our results may have additional relevance in cases of p53 mutation, which occur in up to 50% of cancers, given that our results describe a

scenario of p53 mutation in which p21 and p27 expression is actively repressed by the R273H

mutant p53.

Interestingly, p21 and p27 expression are known to be upregulated by inhibition of the

PI3K/Akt signalling pathway leading to G1 cell cycle arrest (47), and indeed MKK3ca MDA-

MB-468 cells had impaired activation of this pathway when Akt phosphorylation was examined

(Supplementary Fig. S3), suggesting that MKK3 signals can inhibit Akt activation thereby supporting p21 and p27 expression. Aside from a transcription factor activation-mediated mechanism acting directly on the p21 and p27 promoters, an alternative mode of action could be through mRNA stability. MKK3 signalling is associated with increased mRNA stability of transcripts with adenosine/uridine-rich elements in the 3'UTR in breast cancer cells (48), and p21 and p27 expression are known to be regulated through RNA stabilization mechanisms (49-51). It

remains unclear precisely how MKK3 activity can direct p21 and p27 expression leading to cell

cycle arrest.

Despite extensive interest in a tumor suppressive role for MAPK signalling, this study is,

to our knowledge, the first direct assessment of MKK3 activity on tumor growth in an in vivo

xenograft model. We report a novel p53-independent mechanistic regulation of cell cycle

inhibitors p21 and p27, dependent on MKK3 activity, leading to cell cycle arrest at G1 and significantly impaired tumor growth in vivo. Moreover, we identify a prevalent loss of MKK3 genomic copy number in breast cancer patients, and significantly impaired gene and protein expression in malignant mammary tissues. Collectively, these results position MKK3 as a novel tumor suppressor that is altered in human breast cancer.

Acknowledgements: We would like to thank Dr. David Hoskin and Dr. Paul Murphy for contribution of materials. A.J.M. is supported by a fellowship from The Beatrice Hunter Cancer

Research Institute with funds provided by the Cancer Research Training Program through the

Terry Fox Foundation Strategic Health Research Training Program in Cancer Research at CIHR and grant to T-J.L. from the Canadian Institutes of Health Research.

References

1. Harris, H, Miller, OJ, Klein, G, Worst, P, Tachibana, T. Suppression of malignancy by cell fusion. Nature 1969;223:363-8.

2. Sherr, CJ. Principles of tumor suppression. Cell 2004;116:235-46.

3. Han, J, Sun, P. The pathways to tumor suppression via route p38. Trends Biochem Sci 2007;32:364-71.

4. Schramek, D, Kotsinas, A, Meixner, A, Wada, T, Elling, U, Pospisilik, JA, et al. The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression. Nat Genet 2011;43:212-9.

5. Chin, K, DeVries, S, Fridlyand, J, Spellman, PT, Roydasgupta, R, Kuo, WL, et al. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies. Cancer Cell 2006;10:529-41.

6. Stratton, MR, Campbell, PJ, Futreal, PA. The cancer genome. Nature 2009;458:719-24.

7. Berger, AH, Knudson, AG, Pandolfi, PP. A continuum model for tumour suppression. Nature 2011;476:163-9.

8. Orsetti, B, Nugoli, M, Cervera, N, Lasorsa, L, Chuchana, P, Ursule, L, et al. Genomic and expression profiling of chromosome 17 in breast cancer reveals complex patterns of alterations and novel candidate genes. Cancer Res 2004;64:6453-60.

9. Lin, K, Lane, B, Carter, A, Johnson, GG, Onwuazor, O, Oates, M, et al. The gene expression signature associated with TP53 mutation/deletion in chronic lymphocytic leukaemia is dominated by the under-expression of TP53 and other genes on chromosome 17p. Br J Haematol 2012;160:53-62.

10. Hicks, J, Krasnitz, A, Lakshmi, B, Navin, NE, Riggs, M, Leibu, E, et al. Novel patterns of genome rearrangement and their association with survival in breast cancer. Genome Res 2006;16:1465-79.

11. Jia, M, Souchelnytskyi, N, Hellman, U, O'Hare, M, Jat, PS, Souchelnytskyi, S. Proteome profiling of immortalization-to-senescence transition of human breast epithelial cells identified MAP2K3 as a senescence-promoting protein which is downregulated in human breast cancer. Proteomics. Clinical Applications 2010;4:816-28.

12. Siegel, R, Naishadham, D, Jemal, A. Cancer statistics, 2012. CA Cancer J Clin 2012;62:10-29.

13. Teng, DH, Chen, Y, Lian, L, Ha, PC, Tavtigian, SV, Wong, AK. Mutation analyses of 268 candidate genes in human tumor cell lines. Genomics 2001;74:352-64.

14. Li, B, Power, MR, Lin, TJ. De novo synthesis of early growth response factor-1 is required for the full responsiveness of mast cells to produce TNF and IL-13 by IgE and antigen stimulation. Blood 2006;107:2814-20.

15. Pollack, JR, Sorlie, T, Perou, CM, Rees, CA, Jeffrey, SS, Lonning, PE, et al. Microarray analysis reveals a major direct role of DNA copy number alteration in the transcriptional program of human breast tumors. Proc Natl Acad Sci U S A 2002;99:12963-8.

16. Redon, R, Ishikawa, S, Fitch, KR, Feuk, L, Perry, GH, Andrews, TD, et al. Global variation in copy number in the human genome. Nature 2006;444:444-54.

17. Raingeaud, J, Whitmarsh, AJ, Barrett, T, Derijard, B, Davis, RJ. MKK3- and MKK6- regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol Cell Biol 1996;16:1247-55.

18. Kim, GY, Mercer, SE, Ewton, DZ, Yan, Z, Jin, K, Friedman, E. The stress-activated protein kinases p38 alpha and JNK1 stabilize p21(Cip1) by phosphorylation. J Biol Chem 2002;277:29792-802.

19. Waas, WF, Lo, HH, Dalby, KN. The kinetic mechanism of the dual phosphorylation of the ATF2 transcription factor by p38 mitogen-activated protein (MAP) kinase alpha. Implications for signal/response profiles of MAP kinase pathways. J Biol Chem 2001;276:5676-84.

20. Macleod, KF, Sherry, N, Hannon, G, Beach, D, Tokino, T, Kinzler, K, et al. p53- dependent and independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dev 1995;9:935-44.

21. Sherr, CJ. Cancer cell cycles. Science 1996;274:1672-7.

22. Jung, YS, Qian, Y, Chen, X. Examination of the expanding pathways for the regulation of p21 expression and activity. Cell Signal 2010;22:1003-12.

23. Wong, KB, DeDecker, BS, Freund, SM, Proctor, MR, Bycroft, M, Fersht, AR. Hot-spot mutants of p53 core domain evince characteristic local structural changes. Proc Natl Acad Sci U S A 1999;96:8438-42.

24. Kardassis, D, Papakosta, P, Pardali, K, Moustakas, A. c-Jun transactivates the promoter of the human p21(WAF1/Cip1) gene by acting as a superactivator of the ubiquitous transcription factor Sp1. J Biol Chem 1999;274:29572-81.

25. Vermeulen, K, Van Bockstaele, DR, Berneman, ZN. The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif 2003;36:131-49.

26. Borriello, A, Bencivenga, D, Criscuolo, M, Caldarelli, I, Cucciolla, V, Tramontano, A, et al. Targeting p27Kip1 protein: its relevance in the therapy of human cancer. Expert Opinion on Therapeutic Targets 2011;15:677-93.

27. Abbas, T, Dutta, A. p21 in cancer: intricate networks and multiple activities. Nature Reviews. Cancer 2009;9:400-14.

28. Abukhdeir, AM, Park, BH. P21 and p27: roles in carcinogenesis and drug resistance. Expert Reviews in Molecular Medicine 2008;10:e19.

29. Pellikainen, MJ, Pekola, TT, Ropponen, KM, Kataja, VV, Kellokoski, JK, Eskelinen, MJ, et al. p21WAF1 expression in invasive breast cancer and its association with p53, AP-2, cell proliferation, and prognosis. J Clin Pathol 2003;56:214-20.

30. Alkarain, A, Jordan, R, Slingerland, J. p27 deregulation in breast cancer: prognostic significance and implications for therapy. J Mammary Gland Biol Neoplasia 2004;9:67- 80.

31. Zhu, T, Zhao, Y, Zhang, J, Li, L, Zou, L, Yao, Y, et al. ss-Elemene inhibits proliferation of human glioblastoma cells and causes cell-cycle G0/G1 arrest via mutually compensatory activation of MKK3 and MKK6. Int J Oncol 2011;38:419-26.

32. Bulavin, DV, Phillips, C, Nannenga, B, Timofeev, O, Donehower, LA, Anderson, CW, et al. Inactivation of the Wip1 phosphatase inhibits mammary tumorigenesis through p38 MAPK-mediated activation of the p16(Ink4a)-p19(Arf) pathway. Nat Genet 2004;36:343-50.

33. Demidov, ON, Kek, C, Shreeram, S, Timofeev, O, Fornace, AJ, Appella, E, et al. The role of the MKK6/p38 MAPK pathway in Wip1-dependent regulation of ErbB2-driven mammary gland tumorigenesis. Oncogene 2007;26:2502-6.

34. Stivala, LA, Cazzalini, O, Prosperi, E. The cyclin-dependent kinase inhibitor p21CDKN1A as a target of anti-cancer drugs. Current Cancer Drug Targets 2012;12:85- 96.

35. Azuma, Y, Watanabe, K, Date, M, Daito, M, Ohura, K. Possible involvement of p38 in mechanisms underlying acceleration of proliferation by 15-deoxy-Delta(12,14)- prostaglandin J2 and the precursors in leukemia cell line THP-1. J Pharmacol Sci 2004;94:261-70.

36. Permpongkosol, S, Wang, JD, Takahara, S, Matsumiya, K, Nonomura, N, Nishimura, K, et al. Anticarcinogenic effect of FTY720 in human prostate carcinoma DU145 cells: modulation of mitogenic signaling, FAK, cell-cycle entry and apoptosis. Int J Cancer 2002;98:167-72.

37. Cabane, C, Englaro, W, Yeow, K, Ragno, M, Derijard, B. Regulation of C2C12 myogenic terminal differentiation by MKK3/p38alpha pathway. Am J Physiol Cell Physiol 2003;284:C658-66.

38. Faust, D, Dolado, I, Cuadrado, A, Oesch, F, Weiss, C, Nebreda, AR, et al. p38alpha MAPK is required for contact inhibition. Oncogene 2005;24:7941-5.

39. Cazillis, M, Bringuier, AF, Delautier, D, Buisine, M, Bernuau, D, Gespach, C, et al. Disruption of MKK4 signaling reveals its tumor-suppressor role in embryonic stem cells. Oncogene 2004;23:4735-44.

40. Brugarolas, J, Chandrasekaran, C, Gordon, JI, Beach, D, Jacks, T, Hannon, GJ. Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature 1995;377:552-7.

41. el-Deiry, WS, Tokino, T, Velculescu, VE, Levy, DB, Parsons, R, Trent, JM, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817-25.

42. Bulavin, DV, Saito, S, Hollander, MC, Sakaguchi, K, Anderson, CW, Appella, E, et al. Phosphorylation of human p53 by p38 kinase coordinates N-terminal phosphorylation and apoptosis in response to UV radiation. Embo J 1999;18:6845-54.

43. She, QB, Chen, N, Dong, Z. ERKs and p38 kinase phosphorylate p53 protein at serine 15 in response to UV radiation. J Biol Chem 2000;275:20444-9.

44. Wulf, GM, Liou, YC, Ryo, A, Lee, SW, Lu, KP. Role of Pin1 in the regulation of p53 stability and p21 transactivation, and cell cycle checkpoints in response to DNA damage. J Biol Chem 2002;277:47976-9.

45. Yagi, A, Hasegawa, Y, Xiao, H, Haneda, M, Kojima, E, Nishikimi, A, et al. GADD34 induces p53 phosphorylation and p21/WAF1 transcription. J Cell Biochem 2003;90:1242-9.

46. Zeng, PY, Berger, SL. LKB1 is recruited to the p21/WAF1 promoter by p53 to mediate transcriptional activation. Cancer Res 2006;66:10701-8.

47. Izutani, Y, Yogosawa, S, Sowa, Y, Sakai, T. Brassinin induces G1 phase arrest through increase of p21 and p27 by inhibition of the phosphatidylinositol 3-kinase signaling pathway in human colon cancer cells. Int J Oncol 2012;40:816-24.

48. Han, Q, Leng, J, Bian, D, Mahanivong, C, Carpenter, KA, Pan, ZK, et al. Rac1-MKK3- p38-MAPKAPK2 pathway promotes urokinase plasminogen activator mRNA stability in invasive breast cancer cells. J Biol Chem 2002;277:48379-85.

49. Al-Haj, L, Blackshear, PJ, Khabar, KS. Regulation of p21/CIP1/WAF-1 mediated cell- cycle arrest by RNase L and tristetraprolin, and involvement of AU-rich elements. Nucleic Acids Res 2012.

50. Scoumanne, A, Cho, SJ, Zhang, J, Chen, X. The cyclin-dependent kinase inhibitor p21 is regulated by RNA-binding protein PCBP4 via mRNA stability. Nucleic Acids Res 2010;39:213-24.

51. Ziegeler, G, Ming, J, Koseki, JC, Sevinc, S, Chen, T, Ergun, S, et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. J Biol Chem 2010;285:15408- 19.

Figure Legends

Figure 1. Loss of MKK3 expression in human breast cancer patients. (A) MKK3 gene

expression was evaluated by qPCR of normal tissue and tumor tissue using cDNA arrays. Data

are expressed relative to the 3 normal controls ±SEM for n = 9 tumor samples per tissue type.

Significant p values were as follows: breast p = 0.0008; colon p = 0.029; liver p = 0.000009; lung

p = 0.024; and thyroid p=0.042. (B) Sectioned specimens of normal mammary tissue or tumor

tissue were analyzed for MKK3 protein level by immunohistochemistry using anti-MKK3

antibodies (red) and DAPI (blue) to visualize nuclei. Representative images from n = 4 tumor

specimens and a normal mammary tissue specimen are shown. (C) Human genomic DNA from

breast cancer patient tumor samples and normal female control samples were analyzed by qPCR

to assess copy number. DNA from Seg-1 and NCI-H774 cell lines (alone or mixed 1:1) were

used as an internal assay control. Data is expressed as ±SEM for n = 10 tumor and 9 normal

controls; p = 0.009 between groups. (D) Breast cancer patient-derived tissues were analyzed for

MKK3 gene copy number variation by fluorescence in situ hybridization (FISH). Red

punctuations indicate the presence of a genomic copy of MKK3, while cell nuclei are stained

blue with DAPI. A representative image from patient number 9 in panel C is shown, confirming

patient tumor cells display a heterogeneous loss of MKK3 genomic DNA. Evaluation of five

fields of view had an average of 1.10 copies per nuclei. Boxed area is magnified from the

original 1000× magnification.

Figure 2. MKK3 activity is suppressive of tumor growth in vivo and proliferation in vitro.

(A) Immunodeficient Rag1-/- mice were transplanted with MKK3dn, MKK3ca, or untransfected

MDA-MB-468 cells at the mammary fat pad. Tumor volume was measured over time for n = 7,

5, and 8 respectively, and data are expressed as ± SD. * p < 0.05; ** p < 0.01; *** p < 0.001. (B)

At experimental end point, tumors were surgically removed from mice and 3 representative

tumors are shown for each cell type. (C) Histological staining of tumor tissue with H&E. Images

are representative of n = 5 tumors per group.

Figure 3. MKK3 activity directs proliferation of MDA-MB-468 cells. (A) Untransfected

MDA-MB-468 cells and five independently derived lines for MKK3dn and MKK3ca cells (5

x103) were seeded in 96-well plates in quadruplicate. The following day, cells were pulsed with

3H-thymidine for 4 hours, incorporation was measured, and data were expressed as ±SEM. *** p

< 0.001; n = 5 independently derived clones each. (B) Untransfected MDA-MB-468 cells and

five independently derived lines for MKK3dn and MKK3ca cells (5 x103) were seeded in 96-

well plates in quadruplicate. Four days later proliferation was measured by colorimetric WST-1

assay, expressed as the OD at 440 nm minus background. ** p < 0.01; *** p < 0.001; n = 5

independently derived clones each. (C-D) Untransfected MDA-MB-468, MKK3dn, and

MKK3ca cell lines were seeded at 1 x105 cells per well and on days 2, 4, and 7, three wells per

group were counted by trypan blue exclusion. * p < 0.05; ** p < 0.01 for n = 3. Representative

images of cells in culture at 48 and 96 hrs are shown.

Figure 4. MKK3 activity differentially regulates p21 and p27 cyclin-dependent kinase

inhibitor expression in MDA-MB-468 cells. A quantitative real-time PCR array was used to

examine cell lines for the expression of 84 breast cancer markers. (A) List of all breast cancer

array genes oppositely regulated by MKK3dn and MKK3ca mutant proteins. * p < 0.05; ** p <

0.01; *** p < 0.001. Green indicates >1.5 fold decrease and blue indicates 1.5 fold increase

compared to WT. Data is expressed as a summary of n = 3 experiments. *** p < 0.001. Aside

from CDKN1A/p21, additional analysis was conducted on Jun (c-Jun; Fig. 6), IL-6, and CST6.

MKK3-dependent IL-6 production (48 hr) was measured by ELISA and was consistent with mRNA, however MKK3-dependent IL-6 production did not remarkably alter cell-free culture supernatent levels (not shown), while CST6 protein was undetectable by Western blot. (B) Cell

lines were examined for expression of a panel of cyclin-dependent kinase inhibitors by Western

blotting. CDK inhibitors p21 and p27 were similarly differentially regulated. Actin is shown as

a loading control and MKK3 mutant protein expression is shown using a Flag antibody.

Representative blots from n = 4 experiments are shown.

Figure 5. MKK3-directed proliferation in MDA-MB-468 is p53-independent. (A) Western

blot analysis of MKK3 activity-dependent ATF-2 phosphorylation in MDA-MB-468 cells with

actin as a total protein loading control. Cells were untreated (NT) or stimulated with SCF for 120

min to monitor downstream activation of the p38 MAPK pathway via ATF-2 activation. A

representative of n = 4 experiments is shown. (B) Western blot analysis of MKK3 activity-

dependent p53 activation by phosphorylation at Ser 9, Ser 15, Ser 20, Ser 33, Ser 37, Ser 46, and

Ser 392 and total MKK3 activity-dependent p53 protein expression in MDA-MB-468 cells with

actin as a loading control. Representative blots from n = 4 experiments are shown. (C)

Knockdown of p53 by siRNA in WT, MKK3ca, and MKK3dn cells and subsequent Western blot

analysis of p21 and p27 expression. Representative blots (p53 siRNA s607) from n = 4

experiments with two different p53 siRNAs showing similar results is shown with detection of

p53 to confirm knockdown and actin as a loading control. (D) Chromatin immunoprecipitation

was used to measure relative binding of p53 to the promoter of p21 in WT, MKK3dn, and

MKK3ca cells. Data were calculated as % input and expressed as relative p21 promoter binding

±SEM for n = 3 independent experiments; * p < 0.05.

Figure 6. MKK3 activity regulates c-Jun expression, but not AP-1 or SP-1 transcription

factor activity. (A) Western blot analysis of MKK3-directed c-Jun protein expression with actin

as a total protein loading control in cell untreated (NT) or stimulated with stem cell factor (SCF)

for 120 mins; WT = untransfected MDA-MB-468 cells. A representative blot from n = 4

experiments is shown. (B) EMSA analysis of MKK3 activity-dependent AP-1 and SP-1

transcription factor activity in MDA-MB-468 cells.

Figure 7. MKK3 activity is tumor suppressive in MDA-MB-468 cells by enhancing p21 and

p27-mediated G1 cell cycle arrest. (A) MKK3 activity enhances cell cycle arrest.

Untransfected (control) MDA-MB-468, MKK3dn, and MKK3ca cells were analyzed for cell cycle progression staging by flow cytometry following Vybrant DyeCycle Green staining. Data is expressed at % of total cells ±SEM for n = 3 experiments. * p < 0.05; ** p < 0.01. (B) Model of MKK3 activity as a p53-independent tumor suppressor regulating p21 and p27 expression and subsequently leading to G1 cell cycle arrest and inhibited breast cancer tumor growth.

1.8 Normal A 1.6 evel evel Tumour 1.4 1.2 mRNA l mRNA mRNA l mRNA 1.0 3 3 3 3 * 0.8 * 0.6 * 0.4 *** *** 0.2 relative MKK relative relative MKK relative 0.0 breast colon kidney liver lung ovary prostate thyroid B 20X 40X normal tumour normal tumour MKK3 dapi/merge

C 3.0 **

2.0 nomicnomic MKK3 MKK3 levellevel e e e e 1.0 relative g relative g 0.0

1 4 1 2 3 4 5 6 7 8 9 1 2 4 5 6 9 10 C C C3 C C C C7 C8 C Seg- H77 tumour normal control Seg-1/H774 D

Figure 1

B WT

MKK3dn

MKK3ca

C WT MKK3dn MKK3ca

20X

40X

Figure 2

AC5000 *** 4500 ** 4000 n (CPM) o o 3500 3000 2500 2000 * 1500 ** ***

midine incorporati midine 1000 y y ** 500 H-th 3 0 WT MKK3dn MKK3ca B D 48 hrs 96 hrs 0.35 ) *** m m 0.30

0.25

0.20 ** KK3dn WT (OD 440 - 650n - 440 (OD 0.15 e e M 0.10

0.05 Absorbanc

0.00 MKK3ca WT MKK3dn MKK3ca

Figure 3

A n = 3 MKK3dn MKK3ca Fold Δ p Fold Δ p

↓ in DN, ↑ in CA CCNA1 0.69 ** 1.26 * CDKN1A 0660.66 *** 2562.56 *** CST6 0.43 ** 1.88 *** IL6 0.81 * 2.72 ** JUN 0.40 ** 2.04 * MGMT 0.65 *** 1.37 **

Differential ↑ in DN, ↓ in CA CSF1 1.60 * 0.57 *** CDKN2A 1.26 * 0.80 ** RARB 1.79 ** 0.71 **

Figure 4

A C NT SCF 120 mins

p-ATF2

Actin

p-p53 (Ser9) D

ites p-p53 (Ser15) s

p-p53 (Ser20)

p-p53 (Ser33) osphorylation osphorylation h p-p53 (Ser37) p53 p p-p53 (Ser46)

p-p53 (Ser392)

p53

actin

Figure 5

A NT SCF 120 mins

Jun

Actin

Figure 6

100 * WT A 90 ** MKK3dn 80 MKK3ca 70 * 60 * 50 ** of cells 40 % 30 * 20 10 0 G0/G1 S G2/M CllCell cycl e ph ase

Stress signal / growth factor

p MKK3

x p p p53 p38

p ATF2 tumour growth

p21 CDKN1A G1 cell cycle arrest p27 } CDKN1B

Figure 7

MAPK kinase 3 is a tumor suppressor with reduced copy number in breast cancer

Adam J MacNeil, Shun-Chang Jiao, Lori A McEachern, et al.

Cancer Res Published OnlineFirst November 14, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-13-1310

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2013/11/14/0008-5472.CAN-13-1310.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2013/11/14/0008-5472.CAN-13-1310. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.