University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln
Theses, Dissertations, and Student Research in Agronomy and Horticulture Agronomy and Horticulture Department
12-2010
EVALUATION OF NOVEL INPUT OUTPUT TRAITS IN SORGHUM THROUGH BIOTECHNOLOGY
Tejinder K. Mall University of Nebraska-Lincoln
Follow this and additional works at: https://digitalcommons.unl.edu/agronhortdiss
Part of the Agronomy and Crop Sciences Commons, and the Plant Breeding and Genetics Commons
Mall, Tejinder K., "EVALUATION OF NOVEL INPUT OUTPUT TRAITS IN SORGHUM THROUGH BIOTECHNOLOGY" (2010). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 17. https://digitalcommons.unl.edu/agronhortdiss/17
This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln.
EVALUATION OF NOVEL INPUT OUTPUT TRAITS IN SORGHUM THROUGH BIOTECHNOLOGY
By
Tejinder Kumar Mall
A DISSERTATION
Presented to the faculty of
The Graduate College at the University of Nebraska
In Partial Fulfillment of Requirements
For the Degree of Doctor of Philosophy
Major: Agronomy
(Plant Breeding and Genetics)
Under the Supervision of Professors Tom Clemente and Ismail Dweikat
Lincoln, Nebraska
December, 2010
EVALUATION OF NOVEL INPUT OUTPUT TRAITS IN SORGHUM THROUGH BIOTECHNOLOGY
Tejinder Kumar Mall
University of Nebraska, 2010
Advisors: Tom Clemente, Ismail Dweikat
Sorghum [Sorghum bicolor (L.) Moench] is the fifth most important cereal crop world-wide as well as an important source of feed, fiber and biofuel. It is a C4 plant and is well adapted to environments subject to high temperature and water limitation. Despite these agronomic qualities, it suffers from limitations of sensitivity to low temperature and the grain has drawbacks in relation to functionality and digestibility. The objectives of this study are: 1. To promote seed germination at low temperature and to enhance the seedling cold tolerance. 2. To enhance the grain digestibility and functionality. In an attempt to augment cold tolerance, we introduced the glycine rich RNA binding protein gene atRZ-1a from Arabidopsis, Bcl-2 mRNA sequence 725-1428 representing the 3’ non coding region of the gene from humans and rice Ca-dependent protein kinase 7
(OsCDPK7), all of which are known to improve the cold tolerance of plants. None of these genes resulted in the improvement of cold tolerance in sorghum. On the other hand ectopic expression of OsCDPK7 in sorghum led to local lesions formation in leaves. The data generated from this study indicated that constitutive modulation of the CDPK signal transduction pathway in sorghum can trigger a localized cell death response. Further we targeted improving the grain digestibility and functionality. To accomplish this objective we introduced the wheat high-molecular-weight glutenin subunits (HMW-GS) into
sorghum which are known to have significant impact on flour quality. Transgenic events expressing HMW-GS showed improvement in protein digestibility of the uncooked ground grain. In separate complementary set of sorghum transformations we introduced genetic cassettes designed to specifically down-regulate the accumulation of the sorghum alpha and gamma kafirins. Down-regulation of alpha kafirin showed presence of distorted protein bodies in the transgenic seed. The long-term goal of this project is to stack the
HMW-GS trait with the modulated kafirins events, as a means to address both end-use functionality and digestibility.
iv
Acknowledgements
First and above all I praise God, the almighty for all the opportunities in my life and standing by me at every step.
I express my sincere regards to my major advisor Dr. Tom Clemente for providing me this opportunity to work in his lab, for his continuous support, encouragement and belief in me that helped me to complete this degree. I also convey my best regards to my other major advisor Dr. Ismail Dweikat for all the technical, financial and moral support he provided me throughout the degree program. I also sincerely thank
Dr. Michael E Fromm, Dr. Donald Weeks, Dr. David Holding and Dr. Tom Elthon for the critical analysis of my research and for their invaluable suggestions.
My respectful thanks are due to my parents and sisters who always inspired me to work hard. I can never put in words their sacrifice and consistent support for me. I also fall short of words to acknowledge the moral support, sacrifice and charming attitude towards life of my loving wife Gagan.
I can’t forget the most important part of my degree. Thanks to all the members of
Dr. Clemente’s lab Shirley, Natalya, Arlene, Mr. Park, Saadia, Manmeet, Zhengxiang,
Kaimei, Hanh, Scott, James, Karina, Forrest, Blake and all other past and present members of the lab for making my stay wonderful experience in the lab. I am also thankful a lot to Amy and Samantha for their cheerful attitude and all the help I got from them in the greenhouse.
Last but not least, I am thankful to my friends Saleem, Vikas, Fareha, Xing,
Maria, Hardik, Yashi, Kamal, Wilson for their ever available support and cheer. Never forgotten are UP, Sattu and Ajay for their support in all aspects of life.
v
Table of Contents Abstract ii Acknowledgements iv Table of Contents v List of Figures vii List of Tables ix CHAPTER ONE Literature review 1 Sorghum – Introduction 1 Sorghum Seed Storage Proteins 4 High Molecular Weight Glutenin Subunits (HMWGS) of wheat 8 Bcl-2 – Antiapoptotic protein family 11 Calcium Dependent Protein Kinases 15 Glycine Rich RNA Binding Proteins 20 Agrobacterium mediated sorghum transformation 23 References 27 CHAPTER TWO Expression of the rice CDPK-7 in sorghum: Molecular and phenotypic analyses 42 Abstract 43 Introduction 44 Material and Methods 46 Results 51 Disscussion 56 References 62 CHAPTER THREE Sorghum transformation: Overview and Utility 75 Abstract 76 Sorghum transformation 77 Outline of an Agrobacterium-mediated transformation of sorghum using npt II as a selectable marker gene 79
vi
Considerations in designing binary vectors for sorghum transformation 82
Target Input Traits for Sorghum through Transformation 84
Target Output Traits for Sorghum through Transformation 88
Potential of outcrossing to weedy relatives 89
References 92 CHAPTER FOUR Improvement of sorghum seed storage protein quality 103 Summary 104 Introduction 105 Experimental procedures 107 Results 111 Disscussion 114 References 121
vii
LIST OF FIGURES:
Figure 2.1: Alignment of peptide sequences of OsCDPK-7 ORFs that reside in binary vectors pPTN751 and pPTN780. 66
Figure 2.2: Kinase activity assay on the respective OsCDPK-7 ORFs 67
Figure 2.3: Phenotype of transgenic sorghum events 68
Figure 2.4: Southern blot analysis on selected transgenic sorghum events 69
Figure 2.5: RNA hybridization analysis on selected transgenic sorghum events 70
Figure 2.6: Lesion formation under varying conditions 71
Figure 2.7: Two-dimensional gel electrophoresis 72
Figure 3.1: Overview of sorghum transformation steps 100
Figure 3.2: Southern blot analysis of transgenic sorghum events carrying cyanamide hydratase (cah) gene 101
Figure 3.3: GUS expression profile observed in transgenic sorghum 102
Figure 4.1a: Binary plasmid carrying gene cassette for the down-regulation of gamma kafirin gene under the control of gamma kafirin promoter and is terminated by ribozyme. The construct also consists of nptII gene cassette as a selectable marker. 126
Figure 4.1b: Binary plasmid carrying gene cassette for the down-regulation of alpha kafirin gene under the control of alpha kafirin promoter and is terminated by 35S terminator. The construct also consists of nptII gene cassette as a selectable marker. 126 Figure 4.2a: Southern blot analysis of Sorghum events with HMW-GS gene 127
Figure 4.2b: Southern blot analysis of sorghum events with gamma kafirin down- regulation 127 Figure 4.2c: Southern blot analysis of sorghum events with alpha kafirin down- regulation 128 Figure 4.3a: Northern blot analysis of sorghum events with high molecular weight glutenin subunits 128
viii
Figure 4.3b: Northern blot analysis of sorghum events with gamma kafirin down- regulation 129
Figure 4.3c: Northern blot analysis of sorghum events with alpha kafirin down- regulation 129 Figure 4.4a: Two dimensional gel analysis of transgenic event with high molecular weight glutenin subunits 130
Figure 4.4b: Two dimensional gel analysis of transgenic event with gamma kafirin down-regulation 130
Figure 4.4c: Two dimensional gel analysis of transgenic event with alpha kafirin down- regulation 130 Figure 4.5a: Pepsin digestibility of transgenic sorghum events expressing a hybrid HMW-GS 131
Figure 4.5b: RP-HPLC chromatogram of transgenic events (High molecular weight glutenin subunits) and control (Tx-430) 131
Figure 4.5c: Regression line between amount of HMW-GS and digestibility 132
Figure 4.6: Amino acid profile of different transgenic events and wild type sorghum seed 132 Figure 4.7a: Microscopic pictures at 15X magnification; Top panels are of Tx-430 and lower panels are of transgenic events expressing HMW-GS 133
Figure 4.7b: Microscopic pictures at 30X magnification; Top panel are of Tx-430 and lower panels are of transgenic events with down-regulation of alpha kafirin gene 133
Figure 4.7c: Microscopic pictures at 15X magnification; Top panels are of Tx-430 and lower panels are of transgenic events with down-regulation of gamma kafirin gene 134 Figure 4.8a: Opaque phenotype observed in transgenic events with down-regulaiton of gamma kafirin gene (Left) Vs. wild type seed (Right). Top panel: Cut sections of the seed; Lower panel: Whole seed. 134
Figure 4.8b: Opaque phenotype observed in transgenic events with down-regulaiton of alpha kafirin gene (Left) Vs. wild type seed (Right). 135
ix
LIST OF TABLES:
Table 2.1: Transcripts with an observed greater than 2-fold increase in expression in Tx430 pPTN751 transgenic events 73
Table 2.2: qRT-PCR results on selected up-regulated transcripts 74
Table 4.1: Shows the upregulated proteins as the result of down-regulation of alpha kafirin protein (Corresponding Fig-4c) 136
1
CHAPTER ONE
Literature Review
Sorghum - Introduction
Sorghum (chromosome no. 2n=20, 7.35x108 bp of DNA per 1C nucleus) is a C4 crop (Xin et al, 2008) and is the 5th largest grown crop of the world (Chanapamokkhot et al, 2007). In the year of 2009 area planted for grain sorghum in the United States was 6.6 million acres that produced 383 million bushels. State-wise, the maximum area planted was in Kansas followed by Texas
(http://usda.mannlib.cornell.edu/usda/nass/CropProdSu//2010s/2010/CropProdSu-01-12-
2010.pdf). Internationally in 2007 the maximum area planted was in the USA followed by Nigeria and then India (http://faostat.fao.org).
Sorghum is a crop of tropical regions and thrives well in warmer climates
(Anglani C, 1998). It has higher water use efficiency and grows well in marginal soils.
Hence it performs well even in drought susceptible areas and is a good crop for semi arid tropics. A large proportion of the world population in Asia, Africa and in other semi arid tropics uses sorghum as a staple food crop. Sorghum is used for a variety of products like tortillas, couscous, porridges and baked goods (Anglani C, 1998).
Sorghum is an important source of energy, starch, proteins, vitamins and antioxidants (Chanapamokkhot et al, 2007). Starch and protein are the main constituents that affect quality of the grain (Taylor et al, 2006). Starch is mostly used as thickener or gelling agents while protein content is important for structure formation in the foods. It is
2 a good source of the B group of vitamins like thiamin, riboflavin, B6, biotin and niacin.
Whole grain sorghum products are better source of these vitamins as refining leads to loss of these vitamins (Hegedus et al, 1985). Potassium and phosphorus are two major mineral elements present in sorghum (Khalil et al, 1984). Sorghum contains condensed tannins which are polyphenolic compounds and act as antinutritional factors. These bind with dietary protein and digestive enzymes to reduce their digestibility and with some minerals and vitamins to decrease their availability (Wang and Kies, 1991). These polyphenolic compounds are present in sorghums that have a pigmented testa but are absent in other genotypes that lack the pigmented testa (Anglani C, 1994).
Sorghum protein is of relatively low quality because it has low amounts of essential amino acids such as lysine, tryptophan and threonine (Badi et al, 1990). Other limitation associated with sorghum is that the wet cooking of sorghum leads to reduced digestibility which further reduces the nutrition value of the grain (Mertz et al, 1984).
Sorghum proteins (kafirins) are present in the form of protein bodies where alpha kafirin is present in the center and is surrounded by beta and gamma kafirins. These protein bodies are very strong and are not easily disrupted by routine cooking methods. Moreover cooking sorghum in the presence of water results in the formation of strong bonds between beta and alpha kafirins. This prevents accessibility of enzymes to centrally located alpha kafirins, hence further reduces digestibility. Using shear forces and high pressure and temperature leads to breakage of these bodies which gives better functional properties to the dough. Still, the lack of gluten like proteins in the seed prevents attainment of similar functional properties as that of wheat dough (Chanapamokkhot and
3
Thongngam, 2007). Hence, in order to expand the usage of sorghum for various applications, the end use quality of the sorghum needs to be addressed.
Sorghum is also an important energy crop for bio-ethanol production. The juice extracted from sweet sorghum stem consists of sucrose, glucose and fructose and can easily be converted to ethanol at a rate of 3500 liter/hectare to 5600 liter/hectare (Yu et al, 2010). As compared to corn, sorghum has less water requirements but suffers from lower yield and lower market prices for the grain while producing comparable per bushel ethanol yields (Paterson A H, 2008). Moreover, corn is an important food crop being used all over the world. Hence ethanol production from sweet sorghum will have less competition with food crops. Ethanol production from plants should reduce dependence on non-renewable resources of energy and sorghum is one of the candidates for bio- ethanol production.
Various genomic tools for sorghum are available which are helping to enhance the research efforts for the improvement of this crop. The genome of an inbred sorghum line,
BTx623, has been sequenced and is available at http://www.phytozome.net/sorghum. A
TILLING (Targeted Induced Local Lesions in Genomes) population is also available
(Xin et al, 2008). This population is an important reverse genetics tool for functional characterization of the genes. With increasing world population, the water supplies are decreasing day by day. Keeping in mind that sorghum is a low input crop and with the improvement of the end use quality traits, sorghum has the potential to become a primary crop of the future.
4
Sorghum Seed Storage Proteins
Although sorghum is staple food for a large proportion of world population, it suffers from limitations of poor digestibility and poor bread making properties. These limitations are attributed to the molecular structure of its proteins and their assembly in the form of protein bodies. Hence these limitations need to be addressed for its improved usage in various foods and feed products. The major fraction of seed storage proteins of sorghum are known as kafirins which fall under the category of prolamins. The term prolamin was first coined by Osborne and it refers to the high content of proline and amide nitrogen which is derived from glutamine (Osborne, 1924). These two amino acids constitute about 30% of the total amino acids of kafirin fraction (Belton et al, 2006).
Although kafirins are major seed proteins of sorghum, some other proteins in minor fractions are also present. These proteins include albumins (water soluble), globulins
(saline soluble) and glutelins (detergent, reducing agent, alkaline pH soluble)
(Jambunathan et al, 1975).
The kafirins have been classified into three groups in comparison to much studied zein proteins by composition and sequence of their amino acids, molecular weights and extractability. (Mazhar et al, 1993; Shull et al, 1991). These groups are α kafirin
(molecular weights 25000 and 23000), β kafirin (molecular weights 20000, 18000 and
16000) and γ kafirins (molecular weights 28000). These proteins are present in seed in form of endoplasmic reticulum (ER) protein bodies where α kafirin is present at center surrounded by a thin layer of β and γ kafirins (Ioerger et al, 2007; Chandreshekar et al,
1999; Hamaker et al, 1995). α kafirins constitute about 80% of total kafirin and hence is the major seed storage protein of sorghum followed by γ kafirins (15%) and β kafirins
5
(5%). Although sorghum proteins show a high degree of sequence homology with zein proteins of maize, these differ from zeins as kafirins have higher proportion of cross linking than zeins (Hamaker and Bugusu, 2003). Amino acid composition has shown that the β and γ kafirins have higher proportion of amino acid cysteines which is 5% in β kafirins and 7% in γ kafirins.
Shull et al (1992) showed that the α, β and γ kafirins have difference in their extractability because of the differences in their amino acid composition. α kafirins have higher percentage of hydrophobic amino acids phenylalanine, leucine and isoleucine, hence these are easily extracted in higher concentration of alcohol. β kafirins have higher percentage of the hydrophilic amino acid, glycine, and hence is easy to extract in low concentration of alcohols. γ kafirins have higher levels of the hydrophilic amino acids glycine and histidine and hence are easily extractable in further reduced concentration of alcohol.
Sorghum proteins are less digestible than those of most of other cereals (Taylor et al, 2002). MacLean et al (1981) showed that digestibility of cooked sorghum porridge is around 46% while cooked wheat, maize and rice has digestibility of about 81%, 73% and
66% respectively. Sorghum proteins are present in the form of protein bodies which are resistant to digestion. Cooking sorghum in the presence of water further reduces digestibility. It is known that β and γ kafirins have high content of sulfur containing amino acids i.e. methionine and cysteine (Shull et al, 1992). Hence it is hypothesized that when these proteins are cooked in the presence of water, these amino acids are involved in the formation of disulfide bonds between these kafirins (Rom et al, 1992; Oria et al,
1995; Hamaker et al, 1994). This results in formation of resistant protein bodies which
6 sustain themselves during most of cooking methods. The strong network formed on the surface of centrally located α kafirins also prevents accessibility of digestive enzymes to
α kafirins. Hence these protein bodies pass undigested through the body. This hypothesis is further supported by the fact that cooking sorghum proteins in the presence of a reducing agent improves its digestibility as compared to when cooked in water alone
(Hamaker et al, 1995; Oria et al, 1995). However if reduction in digestibility is the result of disulfide bond formation between β and γ kafirins alone, then there should be complete recovery of digestibility when cooked in the presence of reducing agent. But the improvement of digestibility is not complete and still many reduction resistant oligomers can be seen upon electrophoresis (Duodu et al, 2002). Two reasons have been hypothesized for this observation. First is that not all disulfide bonds could be accessible to reducing agent (Oria et al, 1995). Second is that tyrosine residues could oxidatively couple with each other and lead to formation of non disulfide inter chain bonds (Fry S C,
1982; Epstein and Lamport, 1984; Biggs and Fry, 1990). Dry heating of sorghum seed e.g. by popping or dry heating of flour does not lead to decreased digestibility of sorghum. (Duodo et al, 2001; Dahlin and Lorenz, 1993; Parker et al, 1999). This suggests that water is probably acting as a medium to facilitate the formation of indigestible complexes among proteins.
In addition to formation of disulfide bonds, some other factors are also responsible for the reduced digestibility of sorghum flour. These factors can be grouped into two categories – exogenous factors and endogenous factors. The endogenous factors include polyphenol compounds, phytic acid, cell wall components etc. while the
7 exogenous factors include racemization and isopeptide formation and disulfide crosslinking.
Among endogenous factors polyphenols (e.g. tannins) bind strongly to sorghum prolamins by H bonding and hydrophobic interactions and decrease the digestibility
(Butler et al, 1984). Other endogenous factor i.e. phytic acid is a highly charged molecule and it forms insoluble complexes with proteins and hence reduces the digestibility
(Ryden et al, 1993). Proteins are also known to be associated with various cell wall components forming indigestible complexes (Glennie C W, 1984; Bach Knudsen et al,
1985). This decreases their accessibility to digestive enzymes and hence reduces their digestibility.
Among exogenous factors, recemization is a process which converts L form of amino acids to D form of amino acids. D forms are slowly absorbed by animals. Even after absorption most of amino acids in D form are not utilized by humans (Liardon et al,
1983). Very high alkaline or acidic conditions or excessive heat during cooking are the probable reasons for this conversion. The likelihood of racemization in sorghum has not been investigated. Since normal cooking procedures for sorghum do not include above said harsh conditions, hence racemization is not expected to reduce the digestibility of sorghum.
The low proportion of essential amino acids e.g. lysine and tryptophan in the major storage protein type i.e. alpha kafirins leads to poor nutritional quality of grain
(Shewry and Halford, 2003). The other drawback associated with sorghum is the lack of good bread making properties. The reason hypothesized for this is the same that the kafirin proteins are present in form of very rigid protein bodies which maintain
8 themselves through various food preparation methods. Hence these are not available for interaction with other components of the flour. Even if these proteins are released from protein bodies by various methods, the molecular structure of these proteins prevent them from attaining high viscoelastic properties. This reduces the scope of sorghum flour from being used in a variety of products and hence leads to reduced economic value of the crop in comparison to other crops e.g. wheat. Hence in our study, we targeted the improvement of sorghum protein digestibility and its bread making properties by modulation of its endogenous proteins and by heterologous expression of high molecular weight glutenin subunits of wheat.
High Molecular Weight Glutenin Subunits (HMWGS) of wheat
Wheat grain is known for its specific visco-elastic properties that help it to be processed into a variety of foods like leavened and non-leavened breads, cakes, biscuits, pasta, noodles etc. This feature is responsible for its higher economic value as compared to other crops. The presence of these viscoelastic properties in the flour has been attributed to the presence of gluten proteins which are the major seed storage proteins of wheat. Gluten determines baking quality of wheat dough as it helps to improve the water absorption capacity, cohesivity, viscosity and elasticity of the dough (Wieser H, 2007).
The elasticity and extensibility of these proteins result in entrapment of CO2 inside a network of proteins during fermentation process that gives a light porous crumb structure to the loaf.
The gluten proteins of wheat can be divided into three categories – Gliadins, Low
Molecular Weight Glutenin subunits (LMW-GS) and High Molecular Weight Glutenin subunits (HMW-GS). Out of these, the HMW-GS have been attributed for the presence
9 of special viscoelastic properties in the wheat flour. The different HMW-GS are named based on their coding genome (A, B and D), their type (x and y) and the numbers (1-12) based on their mobility in SDS-PAGE gel (Shewry et al, 1992). HMW glutenin subunits are encoded from Glu-1 locus on long arm of chromosomes of the wheat genome i.e. 1A,
1B and 1D (Gupta et al, 1989; Payne et al, 1980). Each locus has two genes (x and y) which are tightly linked and are inherited together (Shewry et al, 1992; Payne P I, 1987).
Although all hexaploid bread wheat cultivars have all 6 HMW-GS (1Ax, 1Ay, 1Bx, 1By,
1Dx, 1Dy) genes, only 3-5 are expressed in different varieties due to silencing of the other subunits. The HMW-GS named 1Ay is always silent in all bread wheat varieties
(Altpeter et al, 1996). These subunits are not only having qualitative but also have quantitative effect on bread making quality of the dough (Shewry et al, 2003,
Uthayakumaran et al, 2002). Payne et al (1987) studied 84 English wheat cultivars and found that better bread making quality of wheat dough is associated with HMW glutenin subunits 5 and 10 encoded by chromosome 1D.
HMW-GS have three structural domains – a non repetitive N-terminal domain, a repetitive central domain and a C-terminal domain (Wieser H, 2007). The x type subunits except Dx-5 have three cysteine residues in the N-terminal domain and a fourth in the C- terminal domain. Out of these four cysteine residues, two form intra-chain disulfide bonds and two are involved in inter-chain interaction. Subunit Dx5 has one extra cysteine residue at the start of central domain and is expected to be involved in inter-chain bonding. The Y type has five cysteines in the N-terminal domain and one in each of central and the C-terminal domain.
10
Initially, it was difficult to investigate the comparative effect of 1Dx5 and 1Dy10 subunits on wheat dough as these are tightly linked and are always inherited together.
However, with developments in wheat transgenic technology, it became possible to genetically engineer appropriate genotypes with specific subunit genes that helped to make this investigation easier (Weeks et al, 1993). Later, various HMW glutenin subunits were studied in detail. Hence in order to investigate the role of different subunits and to improve quality of dough, either the allelic genes from cultivars have been transformed into genotypes (Altpeter et al, 1996; Alvarez et al, 2000; Barro et al, 1997), hybrid genes that translate into mutant, chimeric proteins (Blechl and Anderson, 1996) or endogenous genes in order to improve the content of a particular subunit (Barro et al,
1997) has been transformed into various wheat varieties. Studies have shown that the subunit pair 1Dx5 + 1Dy10 is associated with highest quality while subunit pairs 1Dx2 +
1Dy12, 1Dx3 + 1Dy12 and 1Dx5 + 1Dy12 are associated with poor quality. The presence of subunit 1Ax1 is superior to the null allele. Also the subunit pair 1Bx17 + 1By18 is generally superior to other alleles encoded by chromosome 1B (Shewry et al, 2003)
An appropriate ratio of Dx:Dy subunits is required for better dough quality so that dough can hydrate appropriately and become extensible (Butow et al, 2003). Reducing this ratio leads to production of weaker doughs (Gao et al, 1992; Lindsay and Skerritt,
1999). On the other hand lines expressing 1Dx5 without corresponding increase of y type subunit are not able to hydrate well and lead to production of over-strong dough probably because of increased crosslinking of polymers (Popineau et al 2001).
The different effects of x and y type subunits can be attributed to their different repetitive domain structure and to their different disulfide structure. (Wieser and
11
Zimmermann, 2000). It is suggested that increased amounts of Dx5 subunit lead to tightly crosslinked polymers because of the presence of additional cysteine subunit, as compared to other x type subunits, that help in increased inter molecular crosslinking. This results in limited scope of expansion of dough after absorption of water and leads to over-strong dough (Rakszegi et al, 2005; Darlington et al, 2003; Popineau et al, 2001). On the other hand, expression of subunit 1Dy10 lead to more extensible dough as compared to dough in which 1Dx5 subunit have been overexpressed (Blechl et al, 2007; Butow et al, 2003).
An appropriate ratio of Dx5 and Dy10 subunits help in better interaction that leads to homogeneous protein network, hence better dough quality (Popineau et al, 2001).
Altpeter et al, (2004) expressed hybrid 1Dx5+1Dy10 subunits in rye plant. The resulting rye plants showed an increased polymerization of its seed storage proteins. Our objective is to express the above subunit pair in sorghum. Improvement of polymerization as a result of overexpression of these hybrid subunits may lead to improved bread making quality combined with high water use efficiency and low other input requirements will be a significant step toward sorghum improvement for not only the developing but also for the developed countries.
Bcl-2 – Antiapoptotic protein family
Bcl-2 is a family of proteins whose members are involved in the regulation of programmed cell death (PCD). In addition to PCD, they are also known to improve the stress tolerance of the plants which is one of my research objectives. Various examples are known in literature where PCD is seen when the plant or cell culture were exposed to specific kinds of stress. These examples include exposure of tobacco cell cultures to 5oC
(cold stress) or to 44-48oC (heat stress) (Koukalova et al, 1997); heat shock treatment of
12 cucumber cotyledons to 55oC (Balk et al, 1999); application of high concentration of
NaCl to barley plants (Katsuhara, 1997); exposure of bobwhite wheat to high salt concentrations (Panter et al, 2004); exposure of Arabidopsis plants to high salt concentrations (Huh et al, 2002) and pathogen interactions (Wang et al, 1996). In all the above mentioned examples the exposure to stressful conditions led to death of cells showing the characteristic features of PCD.
PCD is a systematic process and cells undergoing PCD show certain hallmark features during death. These features include cell shrinkage, chromatin condensation,
DNA fragmentation, internucleosomal DNA cleavage and formation of structures resembling apoptotic bodies. These features help to differentiate the cells that die because of PCD vs. those dying because of necrosis. The characteristic features of a cell undergoing apoptosis are similar in plant and animal cells although the presence of a cell wall around a plant cell results in certain differences e.g. phagocytosis of dying cells by macrophages is present in animal cells but absent in plant cells (Chen et al, 2004).
Similar to animal cells, PCD in plant cells is associated with DNA fragmentation (DNA ladders) and activation of proteases.
Among the variety of research going on to understand PCD in plants and animals, a family of proteins called Bcl-2 family has been extensively studied in animals. The members of this family have the characteristic of the presence of at least one Bcl-2 homology (BH) domain. Various proteins which fall in this group are divided into three categories – antiapoptotic (typical examples include Bcl-2 and Bcl-xl) which have four
BH domains (BH1 – BH4); pro-apoptotic multi-domain proteins (typical examples include bax and bak) which have three BH domains and pro-apoptotic BH3 only protein
13 family (Levine et al, 2008). These anti and pro apoptotic proteins continuously interact with each other to determine whether the cell should live or die. This interaction occurs by formation of heterodimers among their members which is accomplished by the insertion of BH3 domain of proapoptotic protein into a hydrophobic cleft formed by
BH1, BH2 and BH3 domains of anti-apoptotic proteins. (Tsujimoto et al, 2000)
The antiapoptotic members of Bcl-2 family are known to be associated with the improvement of stress tolerance of organisms. Yeast cells harboring Bcl-2 show enhanced survival compared with wild type when both are exposed to oxidative and high temperature stress (Chen et al, 2003). Bcl-2 is known for reduced paraquat induced apoptotic cell death in mouse cells (Dickman et al, 2001 and reference therein). Although
Bcl-2 did not block the production free radicals, it prevented ROS mediated PCD (Chen et al, 2003).
Although genes involved in PCD have been identified and characterized in animal cells, their homologous genes have not been identified in plant systems. It was suggested that during evolution these genes could have diverged so much that they are not easily identified by comparing their primary sequences (Li and Dickman, 2004). Transkingdom expression of these animal genes in plants caused remarkable improvement in stress tolerance.
Li and Dickman (2004) transformed tobacco with the Bcl-2 gene. The transgenic and wild type tobacco cells were then exposed to various stresses like cold, heat, menadione and hydrogen peroxide (oxidative stress). The viability of cells was evaluated by Evans blue staining. Under similar conditions the transgenic lines expressing Bcl-2 led to inhibition of cell death as compared to wild type cells. In wild type plants, the
14 presence of DNA laddering which is a hallmark feature of PCD indicates that cells undergo PCD rather than necrosis. Further Chen and Dickman (2004) evaluated the reaction of three independent transgenic lines expressing Bcl-2, Bcl-xl and CED-9 to chloroplast targeted herbicides. It was found that all the lines expressing the above said genes were resistant to these herbicides as compared to control lines. These herbicides are known to produce reactive oxygen species (ROS). Hence these antiapoptotic genes are expected to protect the plants from harmful effects of ROS while the exact mechanism of their action is not known. Again the death was through PCD as indicated by the presence of DNA fragmentation. Wang and coworkers (2009) expressed the CED-9 gene from
Caenorhabditis elegans in tobacco plants and showed that it improves the aluminum tolerance of tobacco plants as compared to wild type plants by inhibiting aluminum induced PCD.
D-satellite RNA is a specific strain of cucumber mosaic virus (CMV) that causes disease in tomato plants. The disease development as a result of infection with this virus involves the process of PCD. Xu and coworkers (2004) expressed Bcl-xl and CED-9 genes in tomato and found increased tolerance of transgenic plants to this virus. This shows that these anti-apoptotic genes not only provide resistance against abiotic but also against biotic stress. Qiao and coworkers (2002) overexpressed the Bcl-xl and CED-9 genes in tobacco and found that the transgenic cells are not only resistant to salt, cold, wounding, UV light and paraquat treatment but the transgenics expressing Bcl-xl gene produced more vigorous rooting form the cut end of the stems than wild type plants.
Increased ROS production is one of the causes of PCD induction in plants.
Increased production of ROS makes membranes more permeable to electrolytes,
15 especially K+. The disturbance of potential across membranes leads to cessation of ATP production (Shabala et al, 2007; Reed J C, 1998). Chlorophyll biosynthesis and mitochondrial function depend on proper gradient of these electrolytes across the membranes. Bcl-2 and many of its homologs have a stretch of hydrophobic amino acids at their C termini. This helps these proteins to be inserted into membranes (primarily mitochondrial membranes, nuclear membranes and endoplasmic reticulum) (Reed J C,
1998). When inserted into membranes, these proteins are expected to control the permeability of membranes of these organelles and hence maintain better electrochemical gradient across them. Hence these organelles function better even in the stress conditions and lead to cell survival.
In addition to these genes, a 3’ non coding mRNA region of human Bcl-2 gene is also known to improve the drought tolerance of transgenic tobacco plants (Awada et al,
2004). The transgenic plants containing this fragment showed considerable improvement in drought tolerance and recovery after the stressed plants were watered. We chose this
DNA fragment for its expression in sorghum plant so as to evaluate its effect of stress tolerance improvement of this crop.
Calcium Dependent Protein Kinases
Plants are sessile organisms and their success in growth and development depends on their ability to respond to various environmental stresses. They have developed a very sophisticated signaling mechanism to transfer the environmental message to the downstream genes in order to produce a particular morphogenic response. CDPKs are some of the these important signaling molecules that are known to improve the stress tolerance of the plants. It is estimated that 1-3% of functional eukaryotic genes encode
16 the protein kinases (Sopory and Munshi, 1998). Plants have several classes of calcium binding proteins which include calmodulin (CaM) and CaM related proteins (Zielinski R
E,1998; Luan et al, 2002), Calcineurin B-like (CBL) proteins (Luan et al, 2002) and calcium dependent protein kinase (CDPK) (Harmon et al, 2001; Cheng et al, 2002).
Among these, CDPKs are the best characterized and are responsible for most of the calcium stimulated kinase activities (Harmon et al, 2001; Cheng et al, 2002).
The activity of these calcium dependent protein kinases depends on the presence or absence of calcium ions. Hence calcium is an important signaling ion (Harper et al,
2004). While most ions freely diffuse in cells, calcium does not, providing specificity to
CDPK activation. Plants store calcium in different organelles including apoplast, vacuole, nuclear envelope, endoplasmic reticulum, chloroplast and mitochondria (Bush D S, 1995;
Harper 2001). The concentration of calcium in the cell changes in response to various external stimuli like light, drought, salt, injury, cold, pathogen attack and hormones
(Bush D S, 1995; Poovaiah and Reddy, 1993; Sopory and Munshi, 1998; Sanders et al,
1999). The patterns of changes in calcium in cells vary in amplitude, duration, localization, frequency of calcium oscillations and the source of the influx. These specific changes lead to expression of specific downstream genes for the desired response (Ranty et al, 2006, Evans et al, 2001; Rudd and Franklin-Tong, 2001). There are a large number of CDPK isoforms in plants and each isoform is specific for a particular kind of stimuli leading to expression of precisely controlled responses (Hong et al, 1996; Lee et al,
1998). In addition, it is an important nutrient molecule and is required for proper functioning of various cellular functions and it also plays a structural role in several cellular components. Calcium accumulates as calcium pectate in the cell wall and binds
17 cells together. It is especially required for the growth of root and shoot tips because these tips are actively dividing by mitosis and calcium plays an important role in formation of microtubules that, in turn, plays an important role for anaphasic movement of chromosomes (Tuteja and Mahajan, 2007) as well as deposition of new cell walls in dividing cells.
The first report of CDPK was published in pea buds (Hetherington and Trewavas,
1982). The first CDPK protein was purified later by Harmon et al (1987). After that, a variety of CDPK have been reported from different plant systems including Arabidopsis, soybean, rice carrot, corn, mungbean and potato (Sopory and Munshi, 1998). The
Arabidopsis genome sequence completion revealed that there are 1085 protein kinases
(Hrabak et al, 2003). Among these genes, 34 encode CDPKs (Ludwig et al, 2004). Apart from plants, CDPK genes are also found in protozoans and algae. CDPK are implicated in pollen development, control of cell cycle, phytohormone signaling, light regulated gene expression, gravitropism, thigmotropism, cold acclimation, salinity tolerance, drought tolerance and response to pathogens (Tuteja and Mahajan, 2007). Certain mechanical stresses such as touch, rain and wind are also known to activate such signals.
CDPKs have a conserved structure with four domains. These domains are a variable N-terminal domain, a serine/threonine type kinase domain, an autoinhibitory junction domain and a C-terminal calmodulin-like domain which consists of EF hand calcium binding motifs (Scrase-Field and Knight, 2003; Ludwig et al, 2004; Harper et al,
2004). Each EF hand has 13 amino acids that form a loop which is flanked by two alpha helices. Each EF hand binds to a calcium ion (Cheng et al, 2002). Different CDPK isoforms have different numbers of EF hands varying from one to four. EF hands at
18 position one and two have the most conserved amino acid sequence and those at position four have the least conserved amino acid sequence. Zhao et al (1994) showed that the closer the EF hand is to autoinhibitory domain, the greater is the effect of calcium reglation on its activity. Although the CDPKs display a high degree of sequence conservation, the different members of CDPK family differ from each other in terms of number of EF hands (Ullanat and Jayabaskaran, 2002). At normal cellular levels of calcium, the autoinhibitory domain binds the kinase domain. When calcium levels in the cell rise, calcium binds to an EF hand and this causes a change in the confirmation of
CDPK. This confirmation change removes the inhibitory domain from the kinase domain and leads to activation of CDPK (Harmon et al, 1994; Harper et al, 1994).
The N-terminal domains of CDPK proteins are highly variable with lengths ranging from 21 to 185 amino acids and 27 out of the 34 predicted CDPKs in Arabidopsis have a predicted myristoylation site indicating a membrane association of these CDPKs.
Indeed CDPKs are found to be associated with the plasma membrane (Schaller et al,
1992; Verhey et al, 1993), endoplasmic membrane (Lu and Hrabak. 2002), endosperm storage bodies (Anil et al, 2000), actin cytoskeleton system (Putnam-Evans et al, 1989), mitochondria (Pical et al, 1993) and nuclear membrane (Patharkar and Cushman, 2000).
These specific localizations of these CDPKs indicate that all these different forms of
CDPK may have distinct functions.
There are various reports in the literature in which different CDPKs have been linked to the adaptive processes in response to stress. Yang and coworkers (2003) showed that OsCDPK 13 expression was increased in rice plants in response to cold stress and
GA treatment indicating that it is involved in plant resistance to these stresses. In a
19 different study when tomato plants were exposed to wounding, there was a systemic increase in the amount and activity of LeCDPK1 (Chico et al, 2002). This observation may indicate that this kinase is probably a part of plant defense response. CDPK transcripts are known to increase after exposure of Arabidopsis plants to cold, salt and drought (Urao et al, 1994; Tahtiharju et al, 1997)
CDPKs are not only activated in response to abiotic stress, but are also activated in response to biotic stress stimuli. A maize Ca dependent protein kinase (ZmCPK10) was elicited in response to inoculation of maize plants with either fungal infection or with fungal elicitors (Murillo et al, 2001). Increase in the expression of ZmCPK10 was accompanied with a simultaneous increase of some pathogen induced proteins that indicates that activation of this kinase may be a part of the defense response of the plant.
Monroy et al (1993) showed the importance of calcium in cold acclimation using alfalfa cell suspension cultures. When the culture was exposed to cold stress in the presence of antagonist of calcium dependent protein kinases or in presence of calcium channel blocker, the capacity of cells to adjust to cold stress was markedly reduced.
Saijo et al (2000) showed that overexpression of OsCDPK7 in rice plants improves the cold and salt/drought tolerance. Further, they showed that OsCDPK7 was expressed strongly in vascular tissues of crowns and roots and vascular bundles when plants were exposed to cold and drought stress (Saijo et al, 2001). These are the areas expected to show severe symptoms in response to water stress and thus, indicates a correlation between expression of these genes and increased stress tolerance. Hence, the probable role of increased OsCDPK expression could be to protect these tissues from stress. These kinase genes play an important role in improvement of stress tolerance of
20 plants and potentially can be utilized to improve the agronomically important crops for such traits. We expressed this rice gene in sorghum. We hypothesized that the helerologous expression of this gene could lead to improved stress tolerance of sorghum as well.
Glycine Rich RNA Binding Proteins
The glycine rich RNA binding proteins is an important group of proteins in plants.
Although functions of most of these proteins are not known, some are known to be expressed when plants are exposed to stressful conditions. They are expected to improve the stress tolerance of the plants by controlling expression of other genes. The control of gene expression in living organisms at the post-transcriptional level can be obtained through pre-mRNA splicing; capping; polyadenylation; mRNA transport, stability and translation (Dreyfuss et al, 1993; Higgins, 1991; Simpson and Filipowicz, 1996). Various kinds of RNA binding proteins are required to execute these processes. Such RNA binding proteins have conserved RNA binding motifs such as the RNA recognition motif
(RRM), glycine rich motif, arginine rich motif, RGG box, zinc finger motif, double stranded RNA binding motif, etc. (Burd and Dreyfuss, 1994). Out of these, the RNA binding proteins with RNA recognition motif are the most widely found and best characterized (Kenan et al, 1991; Burd and Dreyfuss, 1994; Alba and Pages, 1998;
Lorkovic and Barta, 2002).
Glycine rich proteins (GRP) are characterized by the presence of high amounts of glycine residues. GRPs have been classified into three categories – structural proteins present in cell wall (Keller et al, 1989; Condit et al, 1990 and Oliveira et al, 1990), RNA binding proteins (Cretin et al, 1990; Nocker and Vierstra, 1993) and cytokeratin like
21 proteins (Rohde et al, 1990). Proteins that contain RRM in the N-terminal half and glycine rich region in C-terminal half are called glycine rich RNA binding proteins (GR-
RBP) and these have been identified in many plants such as maize (Gomez et al, 1988),
Arabidopsis (Carpenter et al, 1994; Nocker et al, 1993), tobacco (Hirose et al, 1993;
Moriguchi et al, 1997), barley (Dunn et al, 1996, Molina et al, 1997), brassica (Bergeron et al, 1993), leafy spurge (Horvath and Olson, 1998) and Alfalfa (Ferullo et al, 1997), white spruce (Richard et al, 1999) and prunus avium (Stephen et al, 2003). The nucleic acid binding properties of some of these proteins have been documented but the functional roles of most of them have not been characterized. Some of these proteins are known to improve the stress tolerance of plants.
The Arabidopsis thaliana genome encodes 196 RRM containing proteins out of which 8 are classified as GR-RBPs (GRRBP-1 to GRRBP-8) (Lorkovic and Barta, 2002;
Lorkovic Z J, 2009). These are known to be induced in response to various environmental stresses (Alba et al, 1994; Moriguchi et al, 1997). In addition, two more nuclear GR-RBP proteins named atRZ-1a and atRZ-1b are known that differ from GR-RBPs by the presence of a zinc finger domain between RRM and C-terminal glycine rich domain. GR-
RBP 1, 2, 3, 4, 7, 8 and atRZ-1a were up-regulated when plants were exposed to cold stress. Salt stress led to high increase in the amount of GR-RBP1 and moderate increase of GR-RBP4 and GR-RBP7.
The mode of action of these GRRBPs is not known. COR6.6, COR 15a, COR47 and COR78, are some of the proteins which are known to increase in abundance when plants are exposed to low temperature stress and are known to be regulated by CBF1
(CRT/DRE (C-repeat/dehydration responsive element) binding factor-1) transcription
22 factors (Thomashow, 1998). Kim and Kang (2006) observed that Arabidopsis lines overexpressing atRZ-1a, it’s T-DNA tagged knock out mutants and wild type plants all have similar levels of the above stress responsive marker proteins when plants are exposed to stress. This indicates that the regulatory pathway involved in the improvement of cold tolerance by expression of atRZ-1a is different than that of CBF protein mediated pathway. Further, comparing the expression profiles using two dimensional gels, they showed that expression profile of some stress related proteins was changed while transcription level of their mRNA and their rate of degradation stayed the same under cold stress and normal conditions. This indicated that atRZ-1a may act as a protective mRNA chaperone and whose action may lead to increased amounts of the target proteins.
RNA chaperones help to prevent the formation of stabilized structures of RNA and keep them in a functional state (Rajkowitsch et al, 2007 and Schroeder et al, 2004). It has been suggested that GR-RBP might act as RNA chaperones so that RNA can maintain an active state for efficient functioning (Lorkovic Z J, 2009)
The functions of most of these GRRBP proteins have not been characterized. The mRNA level of these GR-RBP is found to increase when the plants are exposed to environmental stresses like cold, wounding, water stress, phytohormones, viral infections,
UV radiations and heavy metals (Sahhetto Martins et al, 2000 and references therein). It is known that increased expression of GRRBP leads to improved stress tolerance in plants. Kwak et al (2005) showed that the transcript level of GR-RBP-4 was increased in response to cold stress and decreased in response to salt/dehydration stress. Although its level increased when the plants are exposed to cold, its overexpression did not provide resistance to plants against low temperature. Kim et al, (2007b) reported that
23 overexpressing another GR-RBP (i.e. RBP-2) led to improved germination, seedling growth and freezing tolerance at low temperatures.
Kim et al, 2005 showed that one such GR-RBP named atRZ-1a improves seed germination and seedling growth of Arabidopsis at lower temperatures and also enhances freezing tolerance of Arabidopsis plants. That is, loss of function mutants had retarded growth and germination under cold stress as compared to wild type plants. Kim et al
(2007a) showed that GR-RBPs improve stress tolerance not only in plants but also when expressed in E. coli. Expression of GRPs in the Bx04 strain of E. coli led to better growth and improved viability at low temperature. As these proteins are known to be associated with improved stress tolerance of plants, they are candidates for improving stress tolerance in agronomically important plants.
Agrobacterium-mediated sorghum transformation
Plant transformation refers to the introduction of gene into recipient cells, its integration in the host genome followed by successful regeneration of transgenic plants
(Newell, 2000). It has accelerated the breeding process by the introduction of desired genes into plants while eliminating the transfer of undesired linked genes that otherwise poses a significant challenge when introgression of desired genes is done using traditional breeding methods. Various methods for plant transformation have been developed which include agrobacterium-mediated transformation, protoplast transformation, particle bombardment, tissue electroporation, silicon carbide whiskers, injection of DNA etc.
(Newell, 2000)
The concept of Agrobacterium-mediated gene transfer started with the discovery that agrobacterium is the casual agent of crown gall disease of plants (Newell, 2000).
24
Agrobacterium transfers a T-DNA segment from its plasmid into plant genome. This
DNA segment has genes for the production of various products that are then produced by plants but are used by agrobacterium. After years of research, scientists were able to replace the Ti (Tumor inducing) segment of the T-DNA with other genes of interest and agrobacterium became a vehicle for gene transfer. Later agrobacterium mediated transformation was successfully applied in many monocot species like rice (Chan et al,
1992, 1993; Hiei et al, 1994), maize (Ishida et al, 1996), wheat (Cheng et al, 1997) and barley (Tingay et al, 1997).
The transformation progress of sorghum was initially hindered by the recalcitrance of the explants to be regenerated into viable plants. Battraw and Hall (1991) transformed DNA into protoplasts by electroporation and further selected transgenic cells. Unfortunately, they were not able to regenerate viable plants. Hagio et al (1991) transformed cell suspensions of sorghum using a particle bombardment method. They transformed hygromycin and kanamycin resistance by introducing hygromycin B phosphotransferase and neomycin phosphotransferase genes respectively. Although they we able to transform and express the gene, they were not able to regenerate transformant plants.
The first transgenic sorghum plant was regenerated after particle bombardment of immature zygotic embryos (Casas et al, 1993). Researchers successfully transformed a
GUS reporter gene along with a selectable marker gene (bar) into a sorghum cultivar
P898012. Towards the end of 20th century, significant progress was made in optimizing the sorghum transformation process. The first report of agrobacterium-mediated sorghum transformation accompanied by successful regeneration of transgenic plants was
25 published in 2000 (Zhao et al, 2000). Researchers used agrobacterium strain LBA4404 carrying a ‘Super-binary’ vector having a GUS gene expression cassette along with a bar gene expression cassette as a selectable marker gene. They used immature embryos as explants. They also showed that immature embryos from field grown crops gave better transformation efficiency than embryos from plants grown in the greenhouse. Further, several laboratories focussed their research to the improvement of sorghum transformation by modification of the transformation process itself and enhancing the regeneration frequencies (Tadesse et al, 2003; Carvalho et al, 2004; Gao et al, 2005a, b;
Howe et al, 2006).
Among the first reports of sorghum improvement for an economically important trait was the enhancement of lysine content of the grain (Zhao et al, 2003). Researchers introduced a high lysine protein (HT12 protein) into sorghum that resulted in a 50% increase of lysine content in the seed. Further, Girijashankar et al (2005) improved insect resistance of sorghum by introduction of the Cry1Ac gene from Bacillus thuringiensis under the control of a wound inducible promoter. The resulting plants were resistant to the spotted stem borer of sorghum.
In most cases, the transformation frequencies were between 1-2%. Although
Howe et al, (2006) was able to obtain 4.5% of transformation frequency in one of the experiments. However, other researchers have not been able to reproduce this high frequency. This suggests that there may be further means of improvement for recovery of transgenic plants.
A large number of selectable marker genes have been used in various studies.
These include hygromycin phosphotransferase (hpt) (Hagio et al, 1991), bar gene (Cases
26
1993, Zhao et al, 2000), phosphomannose and xylose isomerase genes which gives metabolic advantage to transgenic cells over non transgenic ones (Penna et al, 2002).
Further use of visual screenable marker genes e.g. green fluorescent protein gene (GFP)
(Sheen et al, 1995) and yellow flouroscent protein gene (YFP) (Nagai et al, 2002) are also reported.
In this study we used agrobacterium tumefaciens strain NTL4 (Luo et al, 2001) that harbors the disarmed Ti plasmid named chry5 (Palanichelvam, 2000) designated pKPSF2. npt-II was used as selectable marker gene. A number of transgenic plants were obtained and were further characterized at the phenotypic level.
27
References
Alba M M, Culianez-Macia F A, Goday A, Freire M A, Nadal B and Pages M (1994) The maize RNA binding protein, MA16 is a nucleolar protein located in the dense fibrillar component. Plant J. 6 : 825-834
Alba M M and Pages M (1998) Plant proteins containing the RNA-recognition motif. Trends Plant Sci. 3 : 15-21
Altpeter F, Popelka J C and Wieser H (2004) Stable expression of 1Dx5 and 1Dy10 high molecular weight glutenin subunit genes in transgenic rye drastically increases the polymeric glutelin fraction in rye flour. Plant Mol. Biol. 54 : 783-792
Altpeter F, Vasil V, Srivastava V and Vasil I K (1996) Integration and expression of the high molecular weight subunit 1Ax1 gene into wheat. Nat. Biotech. 14: 1155-1159
Alvarez M L, Guelman S, Halford N G, Lustig S, Reggiardo M I, Ryabushkina N, Shewry P, Stein J and Vallejos R H (2000) Silencing of HMW glutenins in transgenic wheat expressing extra HMW subunits. Theor. Appl. Genet. 100: 319-327
Anglani C (1994) Digestibility and phenolic substances from meals of sorghum without a pigmented testa. Agr. Med. 124 : 229-237
Anglani C (1998) Sorghum for human food – A review. Plant foods for human nutrition 52: 85-95
Anil V S, Harmon A C and Rao K S (2000) Spatio temporal accumulation and activity of calcium dependent protein kinases during embryogenesis, seed development and germination in sandalwood. Plant Physiol. 122 : 1035-1043
Awada T, Dunigan D D and Dickman M B (2004) Animal anti-apoptotic genes enhance recovery from drought stress in tobacco. Int. J. Agric. Biol. 6 : 943-949
Bach Knudsen K E and Munck L (1985) Dietary fibre contents and composition of sorghum and sorghum based foods. J. Cereal Sci. 3: 153-164
Badi S, Pedersen B, Monowar L and Eggum B O (1990) The nutritive value of new and traditional sorghum and millet foods from Sudan. Plant Foods Hum. Nutr. 40 : 5-19
Balk J, Leaver C J and McCabe P F (1999) Translocation of cotychrome c from the mitochondria to the cytosol occurs during heat induced programmed cell death in cucumber plants. FEBS Lett. 463 : 151-154
28
Barro F, Rooke L, Bekes F, Gras P, Tatham A S, Fido R, Lazzeri P A, Shewry P R and Barcelo P (1997) Transformation of wheat with high molecular weight subunit genes results in improved functional properties, Nat. Biotech. 15: 1295-1299
Battraw M and Hall T C (1991) Stable transformation of sorghum bicolor protoplasts with chimeric neomycin phosphotransferase-II and β-glucuronidase genes. Theor. Appl. Genet. 82 : 161-168
Belton P S, Delgadillo I, Halford N G and Shewry P R (2006) Kafirin structure and functionality. J. Cereal Sci. 44: 272-286.
Bergeron D, Beauseigle D and Bellemare G (1993) Sequence and expression of a gene encoding a protein with RNA binding and glycine rich domains in barassica napus. Biochim Biophys Acta 1216 : 123-125
Biggs K J and Fry S C (1990) Solubilization of covalently bound extension from Capsicum cell wals. Plant Physiol. 92: 197-204
Blechl A E and Anderson O D (1996) Expression of a novel high-molecular-weight glutenin subunit gene in transgenic wheat. Nat. Biotech. 14: 875-879
Blechl A, Lin J, Nguyen S, Chan R, Anderson O D and Dupont F M (2007) Transgenic wheats with elevated levels of Dx5 and/or Dy10 high molecular weight glutenin subunits yield doughs with increased mixing strength and tolerance. J. Cereal Sci. 45:172-183
Burd C G and Dreyfuss G (1994) Conserved structures and diversity of functions of RNA binding proteins. Sci. 265 : 615-621
Bush D S (1995) Calcium regulation in plant cell and its role in signaling. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46 : 95-122
Butler L G, Riedl D J, Lebryk D G and Blytt H J (1984) Interactions of proteins with sorghum tannin: Mechanish specificity and significance. Journal of the American Oil Chemists Society. 61: 916-920
Butow B J, Tatham A S, Savage A W J, Gilbert S M, Shewry P R, Solomon R G and Bekes F (2003) Creating a balance – the incorporatin of a HMW glutenin subunit into transgenic wheat lines. J. Cereal Sci. 38: 181-187
Carpenter C D, Kreps J A and Simon A E (1994) Genes encoding glycine rich Arabidopsis thaliana proteins with RNA binding motifs are influenced by cold treatment and an endogenous circadian rhythm. Plant Physiol. 104 : 1015-1025
29
Carvalho C H S, Zehr U B, Gunaratna N, Anderson J, Kononowicz H H, Hodges T K and Axtell J D (2004) Agrobacterium mediated transformation of sorghum: factors that affect transformation efficiency. Genet Mol Biol. 27 :259-269
Casas A M, Kononowicz A K, Zehr U B, Tomes D T, Axtell J D, Butler L G, Bressan R A and Hasegawa P M (1993) Transgenic sorghum plants via microprojectile bombardment. Proc. Natl. Acad. Sci. USA 90 : 11212-11216
Chan M T, Chang H H, Ho S L, Tong W F and Yu S M (1993) Agrobacterium mediated production of transgenic rice plants expressing a chimeric α-amylase promoter glucuronidase gene. Plant Mol. Biol. 22 : 491-506
Chan M T, Lee T M and Chang H H (1992) Transformation of indica rice (Oryza sativa L.) mediated by agrobacterium. Plant Cell Physiol. 33 : 577-583.
Chanapamokkhot H and Thongngam M (2007) The chemical and physicochemical properties of sorghum starch and flour. Nat. Sci. 41: 343-349
Chandrashekar A and Mazhar H (1999) The biochemical basis and implications of grain strength in sorghum and maize. J. Cereal Sci. 30: 193-207.
Chen S and Dickman M B (2004) Bcl-2 family members localize to tobacco chloroplasts and inhibit programmed cell death induced by chloroplast targeted herbicides. J. Exp. Bot. 55(408) : 2617-2623
Chen S, Dunigan D D and Dickman M B (2003) Bcl-2 family members inhibit oxidative stress induced programmed cell death in saccharomyces cerevisiae. Free Radical Biol. Med. 34 : 1315-1325
Cheng M, Fry J E, Pang S, Zhou H, Hironaka C M, Duncan D R, Conner T W and Wan Y (1997) Genetic transformation of wheat mediated by agrobacterium tumefaciens. Plant Physiol. 115 : 971-980
Cheng S H, Willmann M R, Chen H C and Sheen J (2002) Calcium signaling through protein kinases: the Arabidopsis calcium dependent protein kinase gene family. Plant Physiol. 129 : 469-485
Chico J M, Raices M, Teresa M, Inon T and Ulloa R M (2002) A calcium dependent protein kinase is systemically induced upon wounding in tomato plants. Plant Physiol. 128 : 256-270.
Condit C M, McLean B G and Meagher R B (1990) Characterization of the expression of the petunia glycine rich protein-1 gene product. Plant Physiol. 93 : 596-602
30
Cretin C and Puigdomenech P (1990) Glycine rich RNA binding proteins from Sorghum vulgare. Plant Mol. Biol.. 15 :783-785
Dahlin K and Lorenz K (1993) Protein digestibility of extruded cereal grains. Food Chemistry 48: 13-18.
Darlington H, Fido R, Tatham A S, Jones H, Salmon S E and Shewry P R (2003) Milling and baking properties of field grown wheat expressing HMW subunit transgenes. J. Cereal Sci. 38: 301-306
Dickman M B, Park Y K, Oltersdorf T, Li W, Clemente T and French R (2001) Abrogation of disease development in plants expressing animal antiapoptotic genes. Proc. Natl. Acad. Sci. USA. 98 : 6957-6962
Dreyfuss G, Matunis M J, Pinol-Roma S and Burd C G (1993) HnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62 : 289-321
Dunn M A, Brown K, Lightowlers R and Hughes M A (1996) A low temperature responsive gene from barley encodes a protein with single stranded nucleic acid binding activity which is phosphorylated in vitro. Plant Mol. Biol. 30 : 947-959
Duodu K G, Tang H, Grant A, Wellner N, Belton P S and Taylor J R N (2001) FTIR and 13C spectroscopy of proteins of wet cooked and popped sorghum and maize. J. Cereal Sci. 33: 261-269.
Duodu K G, Nunes A, Delgadillo I, Parker M L, Mills E N C, Belton P S and Taylor J R N (2002) Effect of grain organizational structure and cooking on sorghum and maize in vitro protein digestibility. J. Cereal Sci. 35: 161-174
Epstein L and Lamport D T A (1984) An intramolecular linkage involving isodityrosine in extension. Phytochemistry 23: 1241-1246
Evans N H, McAinsh M R and Hetherington A M (2001) Calcium oscillations in higher plants. Curr. Opin. Plant Biol. 4 : 415-420
Ferullo J M, Vezina L P, Rail J, Laberge S, Nadeau P and Castonguay Y (1997) Differential accumulation of two glycine rich proteins during cold acclimation alfalfa. Plant Mol. Biol. 33 : 625-633
Fry S C (1982) Isodityrosine, a new cross-linking amino acid from plant cell wall glycoprotein. Biochemical Journal. 204: 449-455.
Gao L, Ng P K W and Bushuk W (1992) Structure of glutenin based on fabrinograph and electrophoretic results. Cereal Chemistry 69:452-455
31
Gao Z, Jayaraj J, Muthukrishnan S, Claflin L and Liang G H (2005a) Efficient genetic transformation of sorghum using a visual screening marker. Genome 48 : 321-333
Gao Z, Xie X, Ling Y, Muthukrishnan S and Liang G H (2005b) Agrobacterium tumefaciens mediated sorghum transformation using a mannose selection system. Plant Biotech. J. 3 : 591-599
Girijashankar V, Sharma H C, Sharma K K, Swathisree V, Prasad L S, Bhat B V, Royer M, Secundo B S, Narasu M L, Altosaar I and Seetharama N (2005) Development of transgenic sorghum for insect resistance against the spotted stem borer (Chilo partellus). Plant Cell Rep. 24 : 513-522
Glennie C W (1984) Endosperm cell wall modification in sorghum grain during germination. Cereal Chemistry 61: 285-289
Gomez J, Sanchez-Martinez D, Stiefel V, Rigau J, Puigdomenech P and Pages M (1988) A gene induced by the plant hormone abscisic acid in response to water stress encodes a glycine rich protein. Nature 344 : 262-264
Gupta R B, Singh N K and Shepherd K W (1989) The cumulative effect of allelic variation in LMW and HMW glutenin subunits on dough properties in the progeny of two bread wheats. Theor. Appl. Genet. 77:57-64
Hagio T, Blowers A D and Earle E D (1991) Stable transformation of sorghum cell cultures after bombardment with DNA-coad microprojectiles. Plant Cell Rep. 10 : 260- 264
Hamaker B R and Bugusu B A (2003) Overview: Sorghum proteins and food quality. In the proceedings the workshop “Workshop on the proteins of sorghum and millets: Enhancing nutritional and functional properties for africs” Eds. Belton P S, Taylor J R N. Paper no. 8
Hamaker B R, Mertz E T and Axtell J D (1994) Effect of extrusion on sorghum kafirin solubility. Cereal Chemistry 71: 515-517
Hamaker B R, Mohamed A A, Habben J E, Huang C P and Larkins B A (1995) Efficient procedure for extracting maize and sorghum kernel proteins reveals higher prolamine contents than the conventional methods. Cereal Chemistry. 72: 583-588.
Harmon A C, Gribskov M, Gubrium E and Harper J F (2001) The CDPK superfamily of protein kinases. New Phytol. 151 : 175-183
Harmon A C, Putnam-Evans C and Cormier M J (1987) A calcium dependent but calmodulin independent protein kinase from soybean. Plant Physiol. 83 : 830-837
32
Harmon A C, Yoo B C and McCaffery C (1994) Pseudosubstrate inhibition of CDPK, a protein kinase with a calmodulin like domain. Biochemistry 33 : 7278-7287
Harper J F (2001) Dissecting calcium oscillators in plant cells. Trends Plant Sci. 6 : 395- 397
Harper J F, Breton G and Harmon A (2004) Decoding Ca2+ signals through plant protein kinases. Annu Rev Plant Physiol Plant Mol. Biol. 55 : 263-288
Harper J F, Huang J F and Lloyd S J (1994) Genetic identification of an autoinhibitor in CDPK, a protein kinase with a calmodulin like domain. Biochemistry 33 : 7267-7277
Hegedus M, Pedersen B and Eggum Bo (1985) The influence of milling on the nutritive value of flour from cereal grains, 7: vitamins and tryptophan. Qual. Plant Foods Hum. Nutr. 35 :175-180
Hetherington A M and Trewavas A (1982) Calcium dependent protein kinase in pea shoot membranes. FEBS Lett. 145 : 67-71
Hiei Y, Ohta S, Komari T and Kumasho T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by agrobacterium and sequence analysis of the boundries of the T- DNA. Plant J. 6 : 271-282
Higgins C F (1991) Stability and degradation of mRNA. Curr. Opin. Cell Biol. 3 :1013- 1018.
Hirose T, Sugita M and Sugiura M (1993) cDNA structure, expression and nucleic acid binding properties of three RNA binding proteins in tobacco: occurrence of tissue alternative splicing. Nucleic Acids Res. 21 : 3981-3987
Horvath D P and Olson P A (1998) Cloning and characterization of cold regulated glycine rich RNA binding protein genes from leafy spurge (Euphorbia esula L) and comparison to heterologous genomic clones. Plant Mol. Biol. 38 : 531-538
Hong Y, Takano M, Liu C M, Gasch A, Chye M L and Chua N H (1996) Expression of three members of the calcium dependent protein kinase gene family in Arabidopsis thaliana. Plant Mol. Biol. 30 : 1259-1275
Howe A, Sato S, Dweikat I, Fromm M and Clemente T (2006) Rapid and reproducible Agrobacterium mediated transformation of sorghum. Plant Cell Rep. 25 : 784-791
Hrabak E M, Chan C W M, Gribskov M, Harper J F, Choi J H, Halford N, Kudla J, Luan S, Nimmo H G, Sussman M R, Thomas M, Simmons K W, Zhu J K and Harmon A C (2003) The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiol. 132 : 666-680
33
Huh G H, Damsz B, Matsumoto T K, Reddy M P, Rus A M, Ibeas J I, Narasimhan M L, Bressan R A and Hasegawa P M (2002) Salt causes ion disequilibrium induced programmed cell death in yeast and plants. Plant J. 29 : 649-659
Ioerger B, Bean S R, Tunistra M R, Pedersen J F, Erpelding J, Lee K M and Herrman T J (2007) Characterization of polymeric proteins from vitreous and floury sorghum endosperm. J. Agric Food Chem. 55: 10232-10239.
Ishida Y, Saito H, Ohta S, Hiei Y, Komari T and Kumashiro T (1996) High efficiency transformation of maize (Zea mays L.) mediated by agrobacterium tumefaciens. Nature Biotech. 14 : 745-750
Jambunathan R,Mertz E T and Axtell J D (1975) Fractionation of soluble proteins of high lysine and normal sorghum grain. Cereal Chemistry. 52: 119-121
Katsuhara M (1997) Apoptosis like cell death in barley roots under salt stress. Plant Cell Physiol. 38 : 1091-1093.
Keller B, Templeton M D and Lamb C J (1989) Specific localization of a plant cell wall glycine rich protein in protoxylem cells of the vascular system. Proc. Natl. Acad. Sci. 86 : 1529-1533
Kenan D J, Query C C and Keene J D (1991) RNA recognition: toward identifying determinants of specificity. Trends Biochem. Sci. 16 : 214-220
Khalil J K, Sawaya W N, Safi W J and Al-Mohammad H M (1984) Chemical composition and nutritional quality of sorghum flour and bread. Qual Plant Plant Foods Hum Nutr. 34 : 141-150
Kim Y O and Kang H (2006) The role of a zinc finger containing glycine rich RNA binding protein during the cold adaptation process in Arabidopsis thaliana. Plant Cell Physiol. 47 : 793-798
Kim Y O, Kim J S and Kang H (2005) Cold inducible zinc finger containing glycine rich RNA binding protein contributing to the enhancement of freezing tolerance in Arabidopsis thaliana. Plant J. 42 : 890-900
Kim J S, Park S J, Kwak K J, Kim Y O, Kim J Y, Song J, Jang B, Jung C H and Kang H (2007a) Cold shock domain proteins and glycine rich RNA binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Excherichis coli. Nucleic Acids Research. 35 : 506-516
Kim J Y, Park S J, Jang B, Jung C H, Ahn S J, Goh C H, Cho K, Han O and Kang J (2007b) Functional characterization of a glycine rich RNA binding protein 2 in Arabidopsis thaliana under abiotic stress conditions. Plant J. 50 : 439-451
34
Koukalova B, Kovarik A, Fajkus J and Siroky J (1997) Chromatin fragmentation associated with apoptotic changes in tobacco cells exposed to cold stress. FEBS Lett. 414 : 289-292
Kwak K J, Kim Y O and Kang H (2005) Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity dehydration, or cold stress. J. Experimental Bot. 56 : 3007-3016
Lee J Y, Yoo B C and Harmon A C (1998) Kinetic and calcium binding properties of three calcium dependent protein kinase isoenzymes from soybean. Biochemistry 37: 6801-6809
Levine B, Sinha S and Kroemer G (2008) Bcl-2 family members. Autophagy 4(5) : 600- 606
Li W and Dickman M B (2004) Abiotic stress induces apoptotic like features in tobacco that is inhibited by expression of human Bcl-2. Biotech. Letters 26 : 87-95
Liardon R and Hurrell R F (1983) Amino acid racemization in heated and alkali treated proteins. J. Agric. Food Chem. 31:432-437
Lindsay M P and Skerritt J H (1999) The glutenin macropolymer of wheat flour doughs: structure-function perspectives. Trends Food Sci. and Tech. 10: 247-253
Lorkovic Z J (2009) Role of plant RNA-binding proteins in development, stress response and genome organization. Trends Plant Sci. 4 : 229-236
Lorkovic Z J and Barta A (2002) Genomic analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30 : 623-625
Lu S X and Hrabak E M (2002) An Arabidopsis calcium dependent protein kinase is associated with the endoplasmic reticulum. Plant Physiol. 128 : 1008-1021
Luan S, Kudla J, Rodrigurz, Rodriguez-Concepcion M, Yalovsky S and Gruissem W (2002) Calmodulins and calcineurin B-like proteins: calcium sensors for specific signal response coupling in plants. Plant Cell (Suppl) 14 : S389-S400
Ludwig A A, Romeis T and Jones J D G (2004) CDPK mediated signaling pathways: specificity and cross talk. J. Exp. Bot. 55 : 181-188
Luo Z Q, Clemente T E and Ferrand S K (2001) Construction of a derivative of agrobacterium tumefaciens C58 that does not mutate to tetracycline resistance. Mol. Plant Microbe Interact. 14 : 98-103
35
MacLean W C, Lopez de Romana G, Placko R P and Graham G G (1981) Protein quality and digestibility of sorghum in preschool children: Balance studies and plasma free amino acids. J. Nutrition. 111: 1928-1036.
Mazhar H, Chandrashekar A and Shetty H S (1993) Isolation and immunochemical characterization of the alcohol extractable proteins (kafirins) of sorghum bicolor (L.) Moench. J. Cereal Sci. 17: 83-93.
Mertz E T, Hassen M M, Cairns-Wittern C, Kirleis A W, Tu L and Axtell J D (1984) Pepsin digestibility of sorghum and other major cereals. Proc. Natl. Acad. Sci. 81 : 1-2
Molina A, Mena M, Carbonero P and Garcia-Olmedo F (1997) Differential expression of pathogen-responsive genes encoding two types of glycine rich proteins in barley. Plant Mol. Biol. 33 : 803-810.
Monroy A F, Sarhan F and Dhindsa R S (1993) Cold induced changes in freezing tolerance , protein phosphorylation and gene expression. Plant Physiol. 102 : 1227-1235
Moriguchi K, Sugita M and Sugiura M (1997) Structure and subcellular localization of a small RNA-binding protein from tobacco. Plant J. 12(1) : 215-221
Murillo I, Jaeck E, Cordero M J and Segundo B S (2001) Transcriptional activation of a maize calcium dependent protein kinase gene in response to fungal elicitors and infection. Plant Mol. Biol. 45 : 145-158
Nagai T, Ibata K, Park E S, Kubota M, Mikoshiba K and Miyawaki A (2002) A variant of yellow fluorescent protein with fast and efficient maturation for cell biological applications. Nat. Biotechnol. 20 : 87-90
Newell C A (2000) Plant transformation technology. Mol. Biotechnol. 16 : 53-65
Nocker-Van S and Vierstra R D (1993) Two cDNA from Arabidopsis thaliana encode putative RNA binding proteins containing glycine rich domains. Plant Mol. Biol. 21 : 695-699
Oliveira D E, Seurinck J, Inze D, Montagu M V and Botterman J (1990) Differential expression of five Arabidopsis genes encoding glycine rich proteins. Plant Cell 2 : 427- 436
Oria M P, Hamaker B R and Shull J M (1995) Resistance of sorghum alpha-, beta- and gamma-kafirins to pepsin digestion. J. Agric. Food Chem. 43: 2148-2153
Osborne T B (1924) The vegetable proteins, second ed. Longmans, Green and Co., London, p. 154
36
Palanichelvam K, Oger P, Clough S J, Cha C, Bent A F and Ferrand S K (2000) A second T-Region of the soybean supervirulent chrysopine type Ti plasmid pTiChry5, and construction of a fully disarmed vir helper plasmid. Molecular Plant Microbe Interactions. 13 : 1081-1091
Parker M L, Grant A, Rigby N M, Belton P S and Taylor J R N (1999) Effect of popping on the endosperm cell walls of sorghum and maize. J. Cereal Sci. 30: 209-216.
Paterson A H (2008) Genomics of sorghum. International journal of plant genomics 2008 : 1-6
Patharkar O R and Cushman J C (2000) A stress induced calcium dependent protein kinase from mesembryanthemum crystallium phosphorylates a two component pseudo response regulator. Plant J. 24 : 679-691
Payne P I (1987) Genetics of wheat storage proteins and the effect of allelic variation on bread making quality. Annu. Rev. Plant Physiol. 38: 141-153
Payne P I, Law C N and Mudd E E (1980) Control by homoeologous group 1 chromosomes of the high-molecular-weight subunits of glutenin, a major protein of wheat endosperm. Theor. Appl. Genet. 58: 113-120
Payne P I, Nightingale M A, Krattiger A F and Holt L M (1987) The relationship between HMW glutenin subunit composition and the bread-making quality of British- grown wheat varieties J. Sci. Food Agric. 40: 51-65
Penna S, Sagi L and Swennen R (2002) Positive selectable marker genes for routine plant transformation. In Vitro Cell Dev. Biol. Plant 38 : 125-128
Pical C, Fredlund K M, Petit P X, Sommarin M and Moller I M (1993) The outer membrane of plant mitochondria contains a calcium dependent protein kinase and multiple phosphoproteins. FEBS Lett. 336 : 347-351
Poovaiah B W and Reddy A S N (1993) Calcium and signal transduction in plant. Crit. Rev. Plant Sci. 12 : 185-211
Popineau Y, Deshayes G, Lefebvre J, Fido R, Tatham A S and Shewry P S (2001) Prolamin aggregation, gluten viscoelasticity and mixing properties of transgenic wheat lines expressing 1Ax and 1Dx high molecular weight glutenin subunit transgenes. J. Agric. Food Chem. 49: 395-401
Putnam-Evans C, Harmon A, Palevitz B A, Fechheimer M and Cormier M J (1989) Calcium dependent protein kinase is localized with F-actin in plant cells. Cell Motil Cytoskelet 12 : 12-22
37
Qiao J, Mitsuhara I, Yazaki Y, Sakano K, Gotoh Y, Miura M and Ohashi Y (2002) Enhanced resistance to salt, cold and wound stresses by overproduction of animal cell death suppressors Bcl-xl and CED-9 in tobacco cells – their possible contribution through improved function of organelle. Plant Cell Physiol. 43(9) : 992-1005.
Rajkowitsch L, Chen D, Stampfl S, Semrad K, Waldsich C, Mayer O, Jantsch M F, Konrat R, Blasi U and Schroeder R (2007) RNA chaperones, RNA annealers and RNA helicases. RNA Biol. 4 : 118-130
Rakszegi M, Bekes F, Lang L, Tamas L, Shewry P R and Bedo Z (2005) Technological quality of transgenic wheat expressing an increased amount of HMW glutenin subunit. J. Cereal Sci. 42: 15-23
Ranty B, Aldon D and Galaud J P (2006) Plant calmodulins and calmodulin related proteins. Plant Signaling and Behavior 1 : 96-104
Reed J C (1998) Bcl-2 family proteins. Oncogene 17 : 3225-3236
Richard S, Drevet C, Jouanin L and Seguin A (1999) Isolation and characterization of a cDNA clone encoding a putative white spruce glycine rich RNA binding protein. Gene 240 : 379-388
Rohde W, Rosch K, Kroger K and Salamini F (1990)Nucleotide sequence of Hordeum vulgare gene encoding a glycine rich protein with homology to vertebrate cytokeratins. Plant Mol. Biol. 14 : 1057-1059.
Rom D L, Shull J M, Chandrashekar A and Kirleis A W (1992) Effects of cooking and treatment with sodium bisulfate on in vitro protein digestibility and microstructure of sorghum flour. Cereal Chem. 69: 178-181
Rudd J J and Franklin-Tong V E (2001) Unravelling response specificity in calcium signaling in plant cells. New Phytol. 151 : 7-33
Ryden P and Selvendran R R (1993) Phytic acid: Properties and determination. In ‘encyclopaedia of food science, Food Technology and Nutrition’ (R Macrae, R K Robinson and M J Sadler, eds), Academic Press, London, UK. Pp 3582-3587
Sachetto Martins G, Franco L O and De Oliveria D E (2000) Plant glycine rich proteins: a family or just proteins with a common motif? Biochim. Biophys. Acta 1492 : 1-14
Saijo Y, Hata S, Kyozuka J, Shimamoto K and Izui K (2000) Over expression of a single calcium dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J. 23(3) : 319-327
38
Saijo Y, Kinoshita N, Ishiyama K, Hata S, Kyozuka J, Hayakawa T, Nakamura T, Shimamoto K, Yamaya T and Izui K (2001) A calcium dependent protein kinase that endows rice plants with cold and salt stress tolerance function in vascular bundles. Plant Cell Physiol. 42 : 1228-1233
Sanders D, Brownlee C and Harper J F (1999) Communicating with calcium. Plant Cell 11 : 691-706
Schaller G E, Harmon A C and Sussman M R (1992) Characterization of a calcium and lipid dependent protein kinase associated with the plasma membrane of oat. Biochemistry 31 : 1721-1727
Schroeder R, Barta A and Semrad K (2004) Strategies for RNA folding and assembly. Nat Rev Mol. Cell Biol. 5 : 908-919
Scrase-Field S A and Knight M R (2003) Calcium: just a chemical switch. Curr. Opin. Plant Biol. 6 : 500-506
Shabala S, Cuin T A, Prismall L and Nemchinov L G (2007) Expression of animal CED- 9 anti-apoptotic gene in tobacco modifies plasma membrane ion fluxes in response to salinity and oxidative stress. Planta 227 : 189-197
Sheen J, Hwang S, Niwa Y, Kobayashi H and Galbraith D W (1995) Green fluorescent protein as a new vital marker in plant cells. Plant J. 8 : 777-784
Shewry P R and Halford N G (2003) The prolamin storage proteins of sorghum and millets. In the proceedings the workshop “Workshop on the proteins of sorghum and millets: Enhancing nutritional and functional properties for africs” Eds. Belton P S, Taylor J R N. Paper no. 3
Shewry P R, Halford N G and Tatham A S (1992) High molecular weight subunits of wheat glutenin proteins. J. Cereal Sci. 15: 105-120
Shewry P R, Halford N G Tatham A S, Popineau Y, Lafiandra D and Belton P (2003) The high molecular weight subunits of wheat glutenin and their role in determining wheat processing properties. Advances in Food and Nutrition Research 45: 219-302
Shull J M, Watterson J J and Kirleis A W (1991) Proposed nomenclature for the alcohol- soluble protein (kafirins) of sorghum bicolor (L. Moench) based on molecular weight, solubility and structure. J. Agric. Food Chem. 39: 83-87.
Shull J M, Watterson J J and Kirleis A W (1992) Purification and immunocytochemical localization of kafirins in sorghum bicolor (L. Moench) endosperm. Protoplasma 171: 64- 74
39
Simpson G G and Filipowicz W (1996) Splicing of precursors to mRNA in higher plants: mechanism, regulation and sub-nuclear organization of the spliceosomal machinery. Plant Mol. Biol. 32: 1-41
Sopory S K and Munshi M (1998) Protein kinases and phosphatases and their role in cellular signaling in plants. Crit. Rev. Plant Sci. 17 : 245-318
Stephen J R, Dent K C and Finch-Savage W E (2003) A cDNA encoding a cold induced glycine rich RNA binding protein from Prunus avium expressed in embryo axes. Gene 320 : 177-183
Tadesse Y, Sagi L, Swennen R and Jacobs M (2003) Optimization of transformation conditions and production of transgenic sorghum (Sorghum bicolor) via microprojectile bombardment. Plant Cell Tissue Organ Cult. 75 : 1-18
Tahtiharju S, Sangwan V, Monroy A F, Dhindsa R S and Borg M (1997) The induction of kin genes in cold acclimating Arabidopsis thaliana. Evidence of a role for calcium. Planta 203 : 442-447
Taylor J and Taylor J R N (2002) Alleviation of the adverse effect of cooking on sorghum protein digestibility through fermentation in traditional African porridges. International journal of food science and technology. 37: 129-137
Taylor J R N, Schober T J and Bean S R (2006) Novel food and non food uses of sorghum and millets. J. Cereal. Sci 44 : 252-271
Thomashow M F (1998) Role of cold responsive genes in plant freezing tolerance. Plant Physiol. 118 : 1-7
Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thornton S and Brettell R (1997) Agrobacterium tumefaciens mediated barley transformation. Plant J. 11 : 1369-1376
Tsujimoto Y and Shimizu S (2000) Bcl-2 family: life or death switch. FEBS Lett. 466 : 6- 10
Tuteja N and Mahajan S (2007) Calcium signaling network in plants. Plant Signaling and Behavior 2 : 79-85
Ullanat R and Jayabaskaran C (2002) Distinct light-, cytokinin- and tissue-specific regulation of calcium dependent protein kinase gene expression in cucumber (Cucumis sativus). Plant Sci. 162 : 153-163
Urao T, Katagiri T, Mizoguchi T, Yamaguchi-Shinozaki K, Hayashida N and Shinozaki K (1994) Two genes that encode calcium dependent protein kinases are induced by drought and high salt stresses in Arabidopsis thaliana. Mol. Gen. Genet. 244 : 331-340
40
Uthayakumaran S, Beasley H L, Stoddard F L, Keentok M, Phan-Thien N, Tanner R I and Bekes F (2002) Synergistic and additive effects of three high molecular weight glutenin subunit loci. I. Effect on wheat dough rheology. Cereal Chem. 79: 294-300
Verhey S D, Gaiser J C and Lomax T L (1993) Protein kinases in zucchini: characterization of calcium requiring plasma membrane kinases. Plant Physiol. 103 : 413- 419
Wang H, Li J, Bostock R M and Gilchrist D G (1996) Apoptosis: a functional paradigm for programmed plant cell death induced by a host selective phytotoxin and invokes during development. Plant Cell. 8 : 375-391
Wang R S and Kies C (1991) Niacin status of humans as affected by heating decorticated and whole ground sorghum (Sorghum gramineae) grain, ready to eat breakfast cereals. Plant Foods Hum. Nutr. 41 : 355-369
Wang W, Pan J, Zheng K, Chen H, Shao H, Guo H, Guo Y, Bian H, Han N, Wang J and Zhu M (2009) CED-9 inhibits Al-induced programmed cell death and promotes Al tolerance in tobacco. Biochemical and Biophysical research communication 383 : 141- 145
Weeks J T, Anderson O D and Blechl A E (1993) Rapid production of multiple independent lines of fertile transgenic wheat (Triticul aestivum). Plant Physiol. 102: 1077-1084
Weiser H (2007) Chemistry of glutenin proteins. Food microbiology 24: 115-119
Weiser H and Zimmermann G (2000) Importance of amounts and proportions of high molecular weight subunits of glutenin for wheat quality. Eur. Food Res. Technol. 210: 324-330
Xin Z, Wang M L, Barkley N A, Burow G, Franks C, Pederson G and Burke J (2008) Applying genotyping (TILLING) and phenotyping analyses to elucidate gene function in a chemically induced sorghum mutant population. BMC Plant Biol. 8 : 103
Xu P, Rogers S J and Roossinck M J (2004) Expression of antiapoptotic genes Bcl-xl and CED-9 in tomato enhances tolerance to viral induced necrosis and abiotic stress. Proc. Natl. Acad. Sci. 101(44) : 15805-15810
Yang G, Shen S, Yang S and Komatsu S (2003) OsCDPK13, a calcium dependent protein kinase gene from rice, is induced in response to cold and gibberellins. Plant Physiol. Biochem. 41 : 369-374.
41
Yu J, Zhong J, Zhang X and Tan Tianwei (2010) Ethanol production from H2So3-steam- pretreated fresh sweet sorghum stem by simultaneous saccharification and fermentation. Appl. Biochem. Biotechnol. 160: 401-409
Zhao X S, Pokutta S, Maurer P, Lindt M, Franklin R M and Kappes B (1994) Calcium binding properties of a calcium dependent protein kinases from Plasmodium falciparum and the significance of individual calcium binding sites for kinase activation. Biochemistry 33 : 3714-3721
Zhao Z Y, Cai T, Tagliani L, Miller M, Wang N, Pang H, Rudert M, Schroeder S, Hondred D, Seltzer J and Pierce D (2000) Agrobacterium mediated sorghum transformation. Plant Mol. Biol. 44 : 789-798
Zhao Z Y, Glassman K, Sewalt V, Wang N, Miller M, Chang S, Thompson T, Catron S, Wu E, Bidney Y and Jung R (2003) Nutritionally improved transgenic sorghum. In: Vasil I K (ed) Plant biotechnology 2002 and beyond. Kluwer Academic Publishers. Dordrecht, pp 413-416
Zielinski R E (1998) Calmodulin and calmodulin binding proteins in plants. Annu Rev Plant Physiol. Plant Mol. Biol. 49 : 697-725
42
CHAPTER 2
Expression of the rice CDPK-7 in sorghum: Molecular and phenotypic analyses
Tejinder Kumar • Ismail Dweikat • Shirley J. Sato • Natalya Neresian • Kaimei Xu • Zhengxiang Ge • Dong Wang • Thomas Elthon • Tom Clemente
T. Kumar • I. Dweikat• N. Neresian • K. Xu • T. Elthon • T. Clemente Department of Agronomy & Horticulture, University of Nebraska-Lincoln, Lincoln, NE, USA 68583
S. J. Sato • Z. Ge • T. Elthon • T. Clemente Center for Biotechnology, University of Nebraska-Lincoln, Lincoln, NE, USA 68588
D. Wang Department of Statistics, University of Nebraska-Lincoln, Lincoln, NE USA 68583
T. Clemente (✉) Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln, NE USA 68588 e-mail: [email protected]
43
Abstract
Sorghum (Sorghum bicolor (L.) Moench) is an important source for food, feed, and possesses many agronomic attributes attractive for a biofuels feedstock. A warm season crop originating from the semi-arid tropics, sorghum is relatively susceptible to both cold and freezing stress. Enhancing the ability of sorghum to tolerate cold and freezing offers a route to expand the acreage for production, and provides a potential drought avoidance strategy during flowering, an important parameter for protection of yield. Targeted perturbation of the signal transduction pathway, that is triggered by exposure to abiotic stress in plants, has been demonstrated in model systems as an avenue to augment tolerance. Calcium-dependent protein kinases (CDPKs) are key players in a plant’s response to environmental assaults. To test the impact of modulating CDPK activity in sorghum as a means to enhance abiotic stress tolerance, we introduced a constitutively expressed rice CDPK-7 (OsCDPK-7) gene construct. Sorghum transformants carrying this cassette displayed lesions on their leaves and up-regulation of a number of pathogen related proteins, along with transcripts linked to photosynthesis.
These results demonstrate that modulating the Ca signaling cascade in planta via constitutively expressed CDPK can lead to off-target effects likely due to the broadly integrated nature of these enzymes in signaling.
44
Introduction
Based on production sorghum (Sorghum bicolor (L.) Moench) is the fifth most important cereal crop in the world following rice, maize, wheat and barley. Annual production is estimated at 60 million tons with Mexico, India, Nigeria and USA accounting for the majority of the harvest (Dicko et al., 2006). Recently grain and sweet sorghum have garnered the attention of the plant science community as a potential feedstock for biofuels due to its relatively low input requirements, C4 photosynthesis, and superior water use efficiency. A wealth of genomics resources (Paterson, 2008) and recent completion of the genome sequence (Paterson et al., 2009) make sorghum an attractive species for research and facilitate translational efforts to improve agronomics and output traits of the crop.
Originating in the tropics sorghum is susceptible to cold and freezing stress during early development, which can negatively impact productivity in cooler environments
(Ercoli et al., 2004; Staggenborg and Vanderlip, 1996; Yu et al., 2004). Improving sorghum’s ability to withstand both chilling and freezing conditions would not only provide a means to protect yield following exposure to these stresses, but also permit earlier planting, which would extend the growing season and avoid drought conditions during flowering in the mid-summer, a common environmental pattern in the cooler climates where sorghum is grown (Ercoli et al., 2004).
Intracellular levels of calcium ions are significantly increased following a plant’s exposure to either abiotic or biotic stresses (Ludwig et al., 2004; Ma and Berkowitz,
2007). Translation of intracellular calcium signatures leading to a plethora of signaling cascades is mediated by various calcium binding proteins including calmodulins,
45 calmodulin-like proteins (Snedden and Fromm, 1998), calcineurin B-like (Zhu, 2002), and calcium-dependent protein kinases (CDPKs) (Cheng et al., 2002). The latter comprise the largest family of the calcium sensors. CDPKs are monomeric proteins, ranging in size from 40 to 90 kDa, that harbor both calmodulin-like, and kinase domains
(Cheng et al., 2002; Klimecka and Muszynska, 2007). Hence, CDPKs can sense modulations in cellular Ca signatures without direct interactions with calmodulins
(Ludwig et al., 2004). CDPKs play a significant role in relaying information following a spike in cytosolic calcium levels triggered by abiotic stress, with previous reports demonstrating CDPKs induction at both the transcriptional and post-transcription levels
(Xiong et al., 2002). The rice genome harbors 31 CDPKs, of which six that are up- regulated at the transcription level following exposure to cold (Ray et al., 2007). Among these is OsCDPK-7 (OsCPK13), previously shown to be up-regulated in rice approximately 2-fold in rice following 3-hour, 4°C exposure of 7 day-old seedlings (Ray et al., 2007). Saijo et al (2000) demonstrated that ectopic expression of OsCDPK-7 in transgenic rice imparts enhanced tolerance towards salt, drought and cold stresses, while suppression of endogenous OsCDPK-7 transcripts led to an increased sensitivity to these stresses. Importantly, the ectopic expression produced no apparent phenotypic effects in regards to growth and development under greenhouse conditions. These data suggest that
OsCDPK-7 is a good candidate to impart tolerance towards these stresses, since it is assumed that post-translational activation is required for the signal transduction cascade to ensue (Saijo et al., 2000).
This study was designed to test whether the phenotypic benefits associated with ectopic expression of OsCDPK-7 in rice (Saijo et al., 2000) for cold tolerance can be
46 translated to grain sorghum. We assembled constitutive expression cassettes carrying either a sorghum codon-optimized version of the OsCDPK-7 open reading frame (ORF), or a mutated, inactive, version of OsCDPK-7 ORF and introduced these two cassettes into sorghum via Agrobacterium-mediated transformation. We report here on the molecular and phenotypic evaluation of the derived transgenic sorghum events.
Materials and methods
Plasmid Constructions
The OsCDPK-7 ORF was isolated from rice (genotype Nipponbare) by RT-PCR using primers, Os7-F: ATGGGCAACGCATGCGGCGGTTCC and Os7-R:
GTCTAGAGTGCACCAGGTGCGTCCCTC, based on the genbank accession number
AB042550. Attempts to isolate the ORF from genotype Nipponbare resulted in several point mutations (Fig 2.1), even with high fidelity Taq polymerase. We used this mutant version of OsCDPK-7 as a control in subsequent experiments, and synthesized
(GenScript, Pisctaway, NJ) a codon-optimized OsCDPK-7 ORF based on the deposited sequence. The two derived ORFs were fused to the tobacco etch virus (TEV) translational enhancer element (Carrington and Freed, 1990), and subcloned downstream to the maize ubiquitin promoter coupled with its first intron (Christensen et al., 1992).
The resultant cassettes were cloned into the binary plasmid pPZP212 (Hajdukiewicz et al., 1994), and designated pPTN751, and pPTN780, for the synthetic and mutant
OsCDPK-7 versions, respectively. The final binary vectors were mobilized into A. tumefaciens strain NTL4 carrying the disarmed Ti plasmid pKPSF2 (Luo et al., 2001) via tri-parental mating. Sorghum transformations were conducted with genotypes Tx430 and
C2-97 as previously described (Howe et al., 2006).
47
Bacterial OsCDPK7 expression vectors for protein purification
To assay in vitro kinase activity of the respective OsCDPK-7 genes harbored in the binary vectors pPTN751 and pPTN780, the ORFs were cloned into the bacterial glutathione S-transferase expression vector pGEX-5X-1 (Amersham Biosciences). The resultant plasmids, designated pPTN874 and pPTN875, for the synthetic and mutated
OsCDPK-7 ORFs, respectively, were introduced into E. coli strain DH5 . Cell cultures were grown to an OD600 0.5 expression induced by the addition of IPTG and L-arabinose and cells allowed to grow for an additional 4 hours. Cells were harvested by centrifugation at 9,000 rpm (Beckman JLA-10.5 rotor) for 15 min. Bacterial pellets were suspended in GST binding buffer (10 mM NaH2PO4, 150 mM NaCl, 1 mM DTT, pH7.3).
Lysozyme nuclease (25 U/ml) was added and the suspension was sonicated for 30 s.
Following the sonication step the suspension was incubated at 4°C for 20 min with mild agitation and subsequently centrifuged for 10 min at 4,350 x g in a Beckman JA-20 rotor.
The supernatant was loaded onto a 50 ml Superloop™ (GE Healthcare, cat # 19-7850-01) fitted on a FPLC. A one-ml GSTrap FF™ column (GE Healthcare, cat # 17-513-02) was washed with 5 ml GST binding buffer, and purified protein preparation was loaded at a flow rate of 0.2 ml per min. The column was subsequently washed with GST binding buffer to remove unbound protein. Following the wash step, the GSTrapFF™ column was removed from the FPLC and injected with 1 ml Factor Xa cleavage buffer (50 mM
Tris HCL, 150 mM NaCl, 1 mM CaCl2, pH 7.5) supplemented with 25 µg Factor Xa
(New England Biolabs, cat # P8010L) to cleave the GST tag from the target protein. The column was incubated for 5 hours at room temperature, placed back onto the FPLC and washed with 5 ml GST binding buffer to elute the protein, and followed by a wash with 5
48 ml GST elution buffer (50 mM Tris HCl, 10 mM reduced glutathione, 1 mM DTT, pH
8.0) to elute the GST tag.
Kinase activity assay
Monitoring of in vitro kinase activity was performed using a modified protocol described by Saijo et al. (1997). The reaction mixture (40 µl final volume) was
32 composed of 25 µM [ - P]ATP (8 µCi), 50 mM Tris HCl, 5 mM MgCl2, 0.1 mM CaCl2
20 µg casein (Sigma cat # C8032-100) and recombinant purified proteins (0.75 µg) +/- 10 mM EGTA. The reaction was incubated overnight at room temperature and the proteins resolved by 14% SDS-PAGE.
Molecular characterization of transgenic sorghum
Total genomic DNA was isolated from sorghum leaves following a modification of the protocol described by Dellaporta et al (1983). Southern blot analysis of transgenic events was conducted as previously reported (Howe et al., 2006). Membranes were hybridized with either dCT32P labeled synthetic OsCDPK-7 ORF or the 35S CaMV promoter derived from the npt II selectable marker cassette used for selection. For RNA gel blot analysis, total RNA was extracted from 200 mg of ground leaf tissue in 1.5 ml of
TRIzol® LS reagent (Invitrogen). RNA sample separation and hybridizations were carried out as previously described (Buhr et al., 2002). Membranes were hybridized with either dCT32P labeled 882-bp region of the synthetic OsCDPK-7 ORF or 764-bp fragment from the OsCDPK-7 mutated ORF.
Leaf protein extracts
Leaf samples from greenhouse grown plants were ground in liquid nitrogen.
Ground tissue was mixed with protein extraction buffer composed of 0.1 M Trizma base,
49
10 mM EDTA, 0.9 M sucrose, 0.4% (v/v) ß-mercaptotehanol, pH 8.0. The mixture was subsequently extracted for 30 min at 4° C, with slight agitation, in equal volume Tris- saturated phenol. Following the 30 min extraction step, the suspension was centrifuged at 4,350 x g in a Beckman JA-20 rotor for 10 min. The upper phenol phase was collected and precipitated overnight at -20°C, using 5X volume of 0.1M ammonium acetate in
100% methanol. Precipitated proteins were pelleted at 17,400 x g in a Beckman JA-20 rotor for 10 min. The protein pellet was subsequently washed with 0.1M ammonium acetate in 100% methanol, followed by washings in 80% (v/v) acetone, and finally 70%
(v/v) ethanol. The washed protein pellets were suspended in 8 M urea, 2M thiourea, 2%
(w/v) CHAPS, and 2% (v/v) Triton X-100. Protein concentrations were quantified using the Bradford assay.
Two-dimensional gel electrophoresis
A total of 300 µg of protein was loaded onto each 7 cm pH 3.0-10.0 Ready Strip
IPG strips (Bio-Rad, cat # 163-2000). Following focusing in the first dimension, the strips were run in the second dimension using 14% SDS-PAGE and the gel was subsequently stained with Coomaissie G-250. Differential spots observed in transgenic samples as compared to control samples, were picked and analyzed using tandem mass spectrometry.
RNA sample preparation and microarray analysis
Transgenic and control plants were grown side-by-side under greenhouse conditions. Same staged leaf samples were immediately frozen in liquid nitrogen. Each sample was composed of a pool of total RNA isolated from a single leaf across three plants. Three such RNA pools were used for transgenics and corresponding control
50 samples. Total RNA was isolated using TRIzol ® reagent (Invitrogen cat. # 10296-028) as described by the manufacturer. Following the TRIzol extraction step the preps were purified using RNeasy columns (Qiagen cat# 74204). cDNAs were generated from 15 µg of total RNA using Affymetrix on-cycle cDNA synthesis kit (Cat # 900493) following the manufacturer’s protocol. Hybridizations were performed with the Affymetrix
GeneChip® Maize Genome Array (cat # 900614). Following the hybridization step the
GeneChips were stained with streptavidin phycoerythrin conjugate on an Affymetrix
Fludics Station 450. Images were acquired using GeneChip® 3000.
Microarray data analysis
GeneChip® Maize Genome Arrays (Affymetrix cat# 900614) were utilized for transcript profiling studies. The maize chip has 17,555 probe sets to integrate approximately 14,850 maize transcripts, which translate to 13,339 genes. Probes were mapped to genes using Netaffx Support Center from Affymetrix
(http://www.affymetrix.com/analysis/index.affx). Only signals from perfect match probes were used in the analysis (Irizarry et al., 2003). Data from all Affymetrix
GeneChips were normalized using the Robust Multichip Average (RMA) method
(Bolstad et al., 2003; Irizarry et al., 2003) with Bioconductor’s (Gentleman et al., 2004) affy package (Gautier et al., 2004). The empirical Bayes moderated t-test was conducted on the background corrected, normalized and log2-transformed expression values using the limma package (Smyth, 2004). The corresponding P-values for transcripts represented on the GeneChips were converted to q-values to obtain approximate control of the false discovery rate at specified values (Storey and Tibshirani, 2003). Estimates of
51 fold change for each transcript was obtained by converting the mean treatment difference estimated as part of the test.
Quantitative PCR
A subset of three significantly upregulated genes were selected and primers designed based on their corresponding sorghum homologs identified from the sorghum genome (http://www.phytozome.net/sorghum). RNA isolations were conducted as described above. First stand cDNA synthesis was carried out with 1 µg RNA using
SuperScriptII Platinum Two-Step qRT-PCR kit (InVitrogen cat # 11735). Concentration of cDNAs was ascertained spectrophotometrically. The qRT-PCR reactions were conducted using a BioRad iCycler using SYBERgreenER™ qPCR SuperMix (Invitrogen cat# 11761). Each reaction was carried out in a 10 µl total volume, with 50 ng cDNA,
200 nM of each primer and 5 µl SYBRgreen. The sorghum actin gene was used as the internal reference. Following the reaction, dissociation curves were derived to test for probability of primer dimmers and secondary products. The cycling conditions used were 50°C for 2 min, 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec and the respective annealing temperatures for 30 sec. Following the 40 cycle regime, a final
95°C for 1 min and 55°C for 13 min were run. The corresponding fold change in the expression of the respective genes was calculated as described by Dussault and Pouliot.
(2006)
Results
OsCDPK-7 gene isolation and kinase activity
The working hypothesis driving this project was that expression of OsCDPK-7 in sorghum would improve abiotic (cold) stress tolerance in the crop. During isolation of the
52 native gene from rice the cDNA from rice genotype Nipponbare displayed a number of point mutations in the OsCDPK-7 ORF (Fig 2.1). The mutated sequence predicted a translational product with seven residue changes, including two changes in the N- terminal variable domain, A33G and D51E, three changes in the kinase domain, L143P,
K147M and H204Y, and two residue changes in the C-terminal region downstream of the calmodulin-like, calcium binding domain, N538S and I542T (Fig 2.1). We therefore elected to have the OsCDPK-7 ORF synthesized, with codons optimized for sorghum.
The two derived ORFs, synthetic OsCDPK-7 and mutated OsCDPK-7 were cloned into a bacterial expression vector to monitor kinase activity and designated pPTN874 and pPTN875, for the synthetic and mutated OsCDPK-7 versions, respectively. Kinase assays performed with casein as the substrate (Fig 2.2) showed the synthetic OsCDPK-7 active in autophosphorylation, as well as the ability to phosphorylate casein (Fig 2.2A).
Successful inhibition of activity by the addition of EGTA or the removal of Mg++ ions in the reaction is characteristic of CDPKs. Parallel experiments conducted with the mutant form of OsCDPK-7 showed this form of the gene product to be inactive (Fig 2.2B).
Sorghum transformation
Binary vectors pPTN751 and pPTN780 harbor constitutively active cassettes of the OsCDPK-7 synthetic and mutated ORFs respectively. Sorghum transformations were conducted with two genotypes, Tx430 and C2-97. Primary pPTN751 transformants in the Tx430 genetic background, established in the greenhouse, displayed lesions on mature leaves, and we were able to recover seed from only three independent events.
Primary pPTN751 transformants in the C2-97 genetic background, and pPTN780 transformants in either Tx430 or C2-97, displayed normal development patterns (Fig 2.3).
53
Sorghum leaves displaying lesions were analyzed at the University of Nebraska’s Plant and Pest Diagnostic clinic to determine if the lesions represented pathogen infection sites.
No pathogens were identified, suggesting that the induction of local lesions was a direct consequence of transgene expression. We selected two independent events of pPTN751 in both Tx430 and C2-97 genetic backgrounds, and two independent events from pPTN780 in Tx430 genetic background for further characterization.
The two pPTN751 lead events in Tx430 background were designated 133-3-5-1 and 137-3-5-1, and the pPTN751 lead events in C2-97 background were designated 24-1-
1 and 49-2-5b. The pPTN780 lead events in Tx430 background are 18-4-1a and 39-1-1a.
Figure 2.4 shows DNA gel blot analysis results with the respective events.
Hybridizations involved total genomic DNA digested by an enzyme for which there is a single restriction enzyme recognition site within the T-DNA element to produce a single hybridization signal for each transgenic locus. Although multiple copies per insertion may be present, copy number in each insertion event was not determined. Genomic
DNA hybridization results suggested that both the pPTN751 Tx430 events (133-3-5-1 and 137-3-5-1) harbored a single transgenic locus (Fig 2.4A), as did the pPTN780 event
18-4-1a (Fig 2.4C). The C2-97 pPTN751 events, 24-1-1 and 49-2-5b contained three and two loci, respectively (Fig 2.4B), while the other selected pPTN780 event, 39-1-1a contained two loci (Fig 2.4C).
Relative expression levels of OsCDPK-7 transgenes were monitored via RNA gel blot analysis with results shown in Fig 2.5. Among selected pPTN751 events, the two
C2-97 events (24-1-1 and 49-2-5b) along with one of the Tx430 events, 137-5-1-1, showed relatively high expression of the synthetic OsCDPK-7 (Fig 2.5A&B). The second
54
Tx430 event, 133-3-5-1, displayed relatively low expression (Fig 2.5A). The two pPTN780 events in Tx430 background, 18-4-1a and 39-1-1a, displayed similar expression levels of the mutated OsCDPK-7 transgene, but also showed a smaller sized transcript, in addition to the predicted size (Fig 2.5C). Additional independent transgenic sorghum pPTN780 events analyzed showed the same signal pattern on RNA blots, which we did not investigate further.
We tested a number of parameters to monitor their impact on lesion formation in the Tx430 OsCDPK-7 transgenic events. These included light, axenic culture conditions, and wounding. To evaluate the effect of light on lesion formation under greenhouse conditions, fully expanded leaves, from both wildtype and Tx430 pPTN751 transgenic events, not displaying lesions, were covered with aluminum foil for a period of 15 days.
The covered leaf sections from transgenic events still developed lesions, while those from control leaves were chlorotic, but lesion free (Fig 2.6A). To confirm that development of lesions on the Tx430 pPTN751 events was not the result of enhanced pathogen susceptibility, we grew surfaced-sterilized seed of control and transgenic events on MS- based germination medium supplemented with 1% sucrose in doubled stacked
Magenta™ vessels. As shown in Fig 2.6B, lesion development occurred in the transgenic pPTN751 Tx430 events grown in an axenic environment, reflecting a physiological, rather than biotic, elicitation of the localized cell death response. We also addressed whether wounding could trigger the observed cell death response in the transgenic pPTN751 Tx430 events by subjecting fully expanded leaves to a needle prick, prior to lesion induction. The plants were subsequently allowed to grow under greenhouse conditions for two weeks following the wounding treatment, and lesion formation was
55 monitored. As shown in Fig 2.6C, the site of wounding was not associated with lesion formation on leaves of the transgenic event. These data suggest that OsCDPK-7, expressed constitutively in Tx430 background mimics signaling associated with apoptotic cell death response.
Two-dimensional gel electrophoresis and Microarray analysis
To investigate transcript and protein changes in vegetative tissues of the Tx430 pPTN751 events, both microarray analysis and two-dimensional (2-D) gel electrophoresis were conducted. With respect to the latter, protein samples from wildtype Tx430 and selected pPTN751 Tx430 transgenic events showing lesions on leaves grown under greenhouse conditions, were separated on 2-D gels and imaged. Three major protein differences were detected (Fig 2.7), and protein spots were analyzed via tandem mass spectrometry. The three differentially expressed proteins selected from pPTN751 Tx430 samples were identified as pathogen-related class 10 (PR-10) family proteins (Liu and
Ekramoddoullah, 2006).
Alteration in the transcript profile of the Tx430 pPTN751 transgenics was monitored using microarray analysis. No publicly available sorghum gene chip is currently available, so we used the Maize Genome Array Chips, followed by gene confirmation of selected up-regulated transcripts by qRT-PCR. Transcripts displaying up-regulation greater than 2-fold or down-regulation greater than 50% were identified using Affymetrix Netflex Data Analysis Center and BLAST analysis. Only a portion of the responsive genes was identified due to incomplete annotation. Genes that were identified to be responsive in the transgenic event were classified as having cell maintenance, membrane transport, and biotic and abiotic stress-related functions. Table
56
1 shows the list of identifiable genes that were up-regulated in the Tx430 pPTN751 transgenics. From this list three transcripts were selected to confirm via qRT-PCR. The selected transcripts were Zm.2321.4.A1_a_at with the sorghum homolog, Sb01g023750.1 that is predicted to encode an alanine aminotransferase, Zm385.1A1 with the sorghum homolog Sb01g036030.1 that encodes uroporphyrinogen decardoxylase (UROD), and
Zm10293.S1 with the sorghum homolog Sb10g026450.1 containing the basic-leucine zipper domain, cprf-2, that is associated with light regulated genes (Table 2). The means of the normalized expression ratio calculated from the qRT-PCR analysis of selected transcripts were consistent with their up-regulation (Table 1 & 2).
Discussion
Our working hypothesis was expression of OsCDPK-7 would enhance cold tolerance to sorghum, under the assumption that what was observed in rice (Saijo et al.,
2000) would be translatable to other grains. The introduction of OsCDPK-7 in one genetic background of sorghum, Tx430, led to a lesion mimic phenotype, while in second genotype, C2-97, normal development under greenhouse conditions were observed.
Moreover, an isolated OsCDPK-7 ORF with a series of mutations (Fig 2.1) was phenotypically neutral in both genotypes. Our data suggest that the induction of lesions was not likely due to an increased susceptibility to a biotic agent, given that the lesion formation was observed under axenic growth conditions (Fig 2.6C). Thus taken together the data indicates that with the Tx430 genetic background an environmental cue to alter the cellular calcium signature is not required to activate OsCDPK-7. Such post- translational regulation is important to avoid negative agronomic impacts under non- stress conditions. We have shown that indeed OsCDPK-7 requires Ca++ for activity, and
57 apparently Mg++ as well (Fig 2.2). Hence, the apparent constitutive nature of the enzymatic activity in the Tx430 background under environmental conditions that should not alter the calcium signature is confounding.
Due to the dual signaling nature of CDPKs, transduction towards a biotic or abiotic response may occur. The phenotype per se, lesion mimic, would imply the induction is more likely towards a biotic response, given that a hypersensitive response is a hallmark resistance strategy employed in plant systems as a means to block pathogen ingress. Differential protein accumulation monitored in the 2-D gel analysis (Fig 2.3) revealed the transduction response triggered in the transgenic events led to the accumulation of a number of PR-10s proteins. There are over 100 proteins that fall in the
PR-10 family and these are modulated in expression over development, upon challenge with pathogens or exposure to abiotic stresses (Liu and Ekramoddoullah, 2006). Hence, the identification of PR-10 proteins differentially expressed in the Tx430 transgenics with the lesion mimic phenotype was not surprising.
Due to the lack of a publicly available sorghum Chip, we relied upon the
Affymetrix maize genome array to gain insight on the alteration in the transcriptome in
Tx430 events carrying the pPTN751 OsCDPK-7 cassette. Of the modulated transcripts that were annotated many were associated with general cell maintenance and membrane transport, photosynthesis capacity, or stress response (Table 1). For example, transcript
Zm2321.4A1_a_at is annotated as an alanine aminotransferase (AlaAT). This transcript was significantly up-regulated in the transgenic Tx430 events displaying lesion mimic phenotype (Table 1 & 2). AlaAT uses glutamate and pyruvate to form 2-oxoglutarate and alanine. Under a hypoxic environment, alanine accumulates in root tissues, although in
58 soybean it has been shown that AlaAT activity is maximum following the accumulation of alanine, which indicates that a role of AlaAt is to aid in the maintenance of the nitrogen and carbon status of the cell following exposure to low oxygen stress, and not accumulation of alanine per se (de Sousa and Sodek, 2003; Miyashita et al., 2007).
A second transcript observed to be up-regulated in the microarray and confirmed via qRT-PCR was Zm385.1.A1_at, sorghum homolog Sb01g036030.1 (Table 1 & 2), which was annotated as a UROD. UROD is involved in the metabolism of tetrapyrrole, generating the required building blocks for the light harvesting machinery of a plant cell
(Tanaka and Tanaka, 2007). Down regulation of UROD in tobacco led to the induction of overall stunting, crinkling and necrosis in leaves of transgenic tobacco (Mock and
Grimm, 1997). The UORD silenced transgenics were shown to have accumulated the metabolite, uroporphyrinogen III, along with a reduction in chlorophyll level in older leaves, as well as a decrease heme level over leaf development. These phenotypes correlated well with the light-dependent induction of cell death (Mock and Grimm,
1997). In maize, a number of lesion mimic mutants have been characterized, which most are inherited in a dominant fashion (Johal et al., 1995). One such mutant designated as les22, phenotypically develops defined necrotic lesions on the leaf blade. This mutation was found to reside in UROD (Hu et al., 1998). However, lesion development in les22 maize and the down-regulated UROD tobacco events are light-dependent (Hu et al.,
1998; Mock and Grimm, 1997). In the case of the latter, accumulation of tetrapyrroles metabolites in silenced UROD tobacco events also resulted in the build-up of phenolic compounds which in turn triggered the pathogen defense response, and this translated to an enhanced tolerance towards tobacco mosaic virus (Mock et al., 1999).
59
With respect to the lesion mimic phenotype that develops in the OsCDPK-7
Tx430 events, it is developmentally regulated, in that lesions appear following the two leaf stage, and only on fully expanded leaves. However, unlike lesion mimics induced upon mutations and/or down-regulation of UROD in plants, the lesion mimic observed in the transgenic Tx430 sorghum events are light-independent (Fig 2.6A), with an up- regulation of UROD (Table 1). Nonetheless, a number of lesion mimic mutants in plants have been linked to various genes associated with chlorophyll metabolism. Degradation of chlorophyll upon leaf senescence requires the action of accelerated cell death 1 gene
(Acd1) which encodes for pheophorbide a oxygenase (PaO) (Pruzinská et al., 2003). The maize lesion mimic lethal leaf spot-1 (lls1) (Gray et al., 2002), was shown to be homologous to Acd1(Pruzinská et al., 2003; Yang et al., 2004). The lls1 phenotype in maize is a progressive cell death in that once triggered, i.e. by wounding (Gray et al.,
2002), necrosis expands through the leaf, reminiscent of the pattern of cell death observed here in sorghum, with the exception that lesion formation is not triggered by wounding in the sorghum events described here (Fig 2.6C). While initial reports classified the lls1 lesion mimic as light dependent, more recently, it has been shown that down-regulation of Acd1 in Arabidopsis induces local lesions in a light-independent fashion (Hirashima et al., 2009). Arabidopsis silenced Acd1 events, when placed in the dark, display significant water loss, enhanced electrolyte leakage, and plastid degradation, reflecting a light-independent nature of the cell death response in the silenced events (Hirashima et al., 2009). Hence, phenotypically the Tx430 pPTN751 events display some of the hallmarks of the classic lesion mimics, yet were induced through expression of a Ca-dependent protein kinase, OsCDPK-7, not via
60 insertional/point mutations or down-regulation of a target gene (Johal et al., 1995;
Lorrain et al., 2003). The observed cell death response in the Tx430 was not likely due to a T-DNA insertional mutation, since the same phenotype occurred in two independent transgenic events (Fig 2.4A).
Experiments were designed to attempt to block the cell death response in planta, by stacking of an antiapoptotic gene with the OsCDPK-7 allele in the Tx430 background.
For this study we chose Bcl-2, because we had the transgenic sorghum events in hand, and the gene has been previously shown to impede cell ingress of necrotrophic fungi in plants (Dickman et al., 2001) and ameliorate tolerance towards abiotic stress through slowing of the cell death response in plants (Awada et al., 2003; Awada et al., 2004).
The Bcl-2 transgenic sorghum events carry a cassette under control of the maize ubiquitin promoter, with the binary vector designated as pPTN396. The pPTN396 events were characterized at the molecular level, and were found to be highly expressing Bcl-2 (data not shown). We stacked the Bcl-2 with OsCDPK-7 allele via crossing and F1 plants, which were confirmed crosses, the plants were monitored for lesion development under greenhouse conditions. The lesion mimic phenotype was not blocked by the expression of Bcl-2 (data not shown), suggesting either the signal transduction cascade triggered by
OsCDPK-7 does not intersect with the action of Bcl-2, or Bcl-2 per se does not possess sufficient antiapoptotic affects to block the cell death response triggered by OsCDPK-7 in planta.
Phenotyping for cold tolerance in the Tx430 background was complicated by the onset of lesion mimics. However, we did, conduct a series of abiotic stress evaluations with the C2-97 events, 24-1-1 and 49-2-5b (Fig 2.2B), investigating cold, at both
61 germination and seedlings stages along with salt tolerance at the seedling stage. These studies did not indicate a significant enhanced tolerance towards these two stresses in the
C2-97 OsCDPK-7 events (data not shown).
The studies outlined herein clearly demonstrate that translating phenotypic effects of a transgene across plant species is not straightforward. Case in point, ectopic expression of OsCDPK-7 in rice led to improved abiotic stress tolerance, without observed developmental abnormalities (Saijo et al., 2000; Saijo et al., 2001), while translation of this approach to grain sorghum, failed to enhance abiotic stress tolerance, and induced a lesion mimic phenotype, that was genotype specific.
Acknowledgments This work was partially supported through funds provided by the Nebraska Sorghum Board, and the Nebraska Research Initiative. TK was supported through a USDA-NRI graduate training grant award number USDA 2007-55100-17788. The authors wish to thank Amy Hilske for greenhouse care of plants and Yuannan Xia for assistance with the microarray study.
62
References Awada T, Dunigan DD and Dickman MB (2003) Animal anti-apoptotic genes ameliorate the loss of turgor in water-stressed trasgenic tobacco. Can J Plant Sci 83:499-506. Awada T, Dunigan DD and Dickman MB (2004) Animal anti-apoptotic genes enhance recovery from drought stress in tobacco. Int J Agric Biol 6:943-949. Bolstad BM, Irizarry RA, Astrand M and Speed TP (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics19:185-193. Buhr T, Sato S, Ebrahim F, Xing A, Zhou Y, Mathiesen M, Schweiger B, Kinney AJ, Staswick P and Clemente T (2002) Ribozyme termination of RNA transcripts down-regulate seed fatty acid genes in transgenic soybean. Plant J 30:155-163. Carrington JC and Freed DD (1990) Cap-independent enhancement of translation by a plant potyvirus 5' nontranslated region. J Virol 64:1590-1597. Cheng SH, Willmann MR, Chen HC and Sheen J (2002) Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol 129:469-485. Christensen AH, Sharrock RA and Quail PH (1992) Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18:675-689. de Sousa CAF and Sodek L (2003) Alanine metabolism and alanine aminotransferase activity in soybean (Glycine max) during hypoxia of the root system and subsequent return to normoxia. Environ Exp Bot 50:1-8. Dellaporta SL, Wood J and Hicks JB (1983) A plant DNA minipreparation: Version II. Plant Mol Biol Reptr 1:19-21. Dickman MB, Park YK, Oltersdorf T, Li W, Clemente T and French R (2001) Abrogation of disease development in plants expressing animal antiapoptotic genes. Proc Natl Acad Sci USA 98:6957-6962. Dicko MH, Gruppen H, Traoré AS, Voragen AGJ and van Berkel WJH (2006) Sorghum grain as human food in Africa: relevance of content of starch and amylase activities. Afr J Biotechnol 5:384-395. Dussault A-A and Pouliot M (2006) Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol Proced 8:1-10. Ercoli L, Mariotti M, Masoni A and Arduini I (2004) Growth responses of sorghum plants to chiling temperature and duration of exposure. European J Agron 21:93- 103. Gautier L, Cope L, Bolstad BM and Irizarry RA (2004) affy-analysis of Affymetrix GeneChips data at the probe level. Bioinformatics 20:307-315. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry RA, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L,
63
Yang YJ and Zhang J (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5:R80. Gray J, Janick-Buckner D, Buckner B, Close PS and Johal GS (2002) Light-dependent death of maize lls1 cells is mediated by mature chloroplasts. Plant Physiol 130:1894-1907. Hajdukiewicz P, Svab Z and Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989- 994. Hirashima M, Tanaka R and Tanaka A (2009) Light-independent cell death induced by accumulation of pheophorbide a in Arabidopsis thaliana. Plant Cell Physiol 50:719-729. Howe A, Sato S, Dweikat I, Fromm M and Clemente T (2006) Rapid and reproducible Agrobacterium-mediated transformation of sorghum. Plant Cell Rep 25:784-791. Hu G, Yalpani N, Briggs SP and Johal GS (1998) A porphyrin pathway impairment is responsible for the phenotype of a dominant disease lesion mimic mutant of maize. Plant Cell 10:1095-1105. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U and Speed TP (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4:249-264. Johal GS, Hulbert SH and Briggs SP (1995) Disease lesion mimics of maize: A model for the cell death in plants. Bioessays 17:685-692. Klimecka M and Muszynska G (2007) Structure and functions of plant calcium- dependent protein kinases. Acta Biochim Pol 54:219-233. Liu J-J and Ekramoddoullah AKM (2006) The family 10 of plant pathogenesis-related proteins: Their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Path 68:3-13. Lorrain S, Vailleau F, Balagué C and Roby D (2003) Lesion mimic mutants: keys for deciphering cell death and defense pathways in plants? Trends Plant Sci 8:263- 271. Ludwig AA, Romeis T and Jones JDG (2004) CDPK-mediated signalling pathways: specificity and cross-talk. J Exp Bot 55:181-188. Luo Z-Q, Clemente T and Farrand SK (2001) Construction of a derivative of Agrobacterium tumefaciens C58 that does not mutate to tetracycline resistance. Mol Plant Micro Int 14:98-103. Ma W and Berkowitz GA (2007) The grateful dead: calcium and cell death in plant innate immunity. Cellular Microbiol 9:2571-2585. Miyashita Y, Dolferus R, Ismond KP and Good AG (2007) Alanine aminotransferase catalyses the breakdown of alanine after hypoxia in Arabidopsis thaliana. Plant J 49:1108-1121.
64
Mock H-P and Grimm B (1997) Reduction of uroporphyrinogen decarboxylase by antisense RNA expression affects activities of other enzymes involved in tetrapyrrole biosynthesis and leads to light-dependent necrosis. Plant Physiol 113:1101-1112. Mock HP, Heller W, Molina A, Neubohn B, Sandermann Jr. H and Grimm B (1999) Expression of uroporphyrinogen decarboxylase or coproporphyrinogen oxidase antisense RNA in tobacco induces pathogen defense response conferring increased resistance to tobacco mosaic virus. J Biol Chem 274:4231-4238. Paterson AH (2008) Genomics of sorghum. Int J Plant Genomics Article ID 362451:1-6. Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapmann J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Narechania A, Otillar RP, Penning BW, Salamov AA, Wang Y, Zhang L, Carpita NC, Freeling M, Ginggle AR, Hash CT, Keller B, Klein P, Kresovich S, McCann MC, Ming R, Peterson DG, Rahman M, Ware D, Westhoff P, Mayer KFX, Messing J and Rokhsar DS (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457:551-556. Pruzinská A, Taner G, Anders I, Roca M and Hörtensteiner S (2003) Chlotophyll breakdown: Pheophorbide a oxygenase is a Rieske-type iron-sulfur protein, encoded by the accelerated cell death 1 gene. Proc Natl Acad Sci U S A 100:15259-15264. Ray S, Agarwal P, Arora R, Kapoor S and Taygi AK (2007) Expression analysis of calcium-dependent protein kinase gene family during reproductive development and abiotic stress conditions in rice (Oryza sativa L. spp. indica). Mol Gen Genet 278:493-505. Saijo Y, Hata S, Kyozuka J, Shimamoto K and Izui K (2000) Over-expression of a single Ca2+-dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J 23:319-327. Saijo Y, Hata S, Sheen J and Izui K (1997) cDNA cloning and prokaryotic expression of maize calcium-dependent protein kinases. Biochim Biophys Acta 1350:109-114. Saijo Y, Kinoshita N, Ishiyama K, Hata S, Kyozuka J, Hayakawa T, Nakamura T, Shimamoto K, Yamaya T and Izui K (2001) A Ca+2-dependent protein kinase that endows rice plants with cold- and salt-stress tolerance functions in vascular bundles. Plant Cell Physiol 42:1228-1233. Smyth GK (2004) Linear models and emprical Bayes methods for assessing differential expression in microarray experiments. Statistical Applications in Genet and Mol Biol 3:Article 3. Snedden WA and Fromm H (1998) Calmodulin, calmodulin-related proteins and plant repsonses to the environment. Trends Plant Sci 3:299-304.
65
Staggenborg SA and Vanderlip RL (1996) Sorghum grain yield reductions caused by duration and timing of freezing temperatures. Agron J 88:473-477. Storey JD and Tibshirani R (2003) Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100:9440-9445. Tanaka R and Tanaka A (2007) Tetrapyrrole biosynthesis in higher plants. Ann Rev Plant Biol 58:321-346. Xiong L, Schumaker KS and Zhu J-K (2002) Cell signaling during cold, drought, and salt stress. Plant Cell Supp 2002:165-183. Yu J, Tuinstra MR, Claassen MM, Gordon WB and Witt MD (2004) Analysis of cold tolerance in sorghum under controlled environment conditions. Field Crops Res 85:21-30. Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:247-273.
66
Figure 2.1: Alignment of peptide sequences of OsCDPK-7 ORFs that reside in binary vectors pPTN751 and pPTN780.
Residue changes between the two ORFs are indicated by purple font. Blue residues (shown in pPTN751) reflect the kinase domain, and purple residues represent the EF hand domain of CDPKs. Those residues highlighted in orange were previously reported to be critical for kinase activity of CDPKs.
67
Figure 2.2: Kinase activity assay on the respective OsCDPK-7 ORFs
2.2A: Top panel: Coomassie stained SDS PAGE gel OsCDPK-7 synthetic ORF. Lane 1 purified synthetic OsCDPK-7, lane 2 OsCDPK-7 complete reaction mix, lane 3 casein alone, lane 4 blank, lane 5 OsCDPK-7 complete reaction plus EGTA, and lane OsCDPK-
7 complete reaction minus MgCl2. Bottom panel: Autoradiographic image of corresponding kinase activity assay. 2.2B: Top panel: Coomassie stained SDS PAGE gel OsCDPK-7 mutated ORF. Lane 1 purified mutated OsCDPK-7, lane 2 mutated OsCDPK-7 complete reaction mix, lane 3 mutated OsCDPK-7 complete reaction plus EGTA, and lane 5 casein alone. Bottom panel: Autoradiographic image of corresponding kinase activity assay.
68
Figure 2.3: Phenotype of transgenic sorghum events
2.3A: Progeny derived from Tx430 pPTN751 events 137-5-1-1 and 133-3-5-1, along with C2-97 event 24-1-1. Insert, close-up lesion on leaf blade from event 137-5-1-1 2.3B: Leaves from progeny derived events 24-1-1 (C2-97/pPTN751), C2-97 wild-type, 133-3-5-1 (Tx430/pPTN751), Tx430 wild-type, and 18-4-1a (Tx430/pPTN780).
69
Figure 2.4: Southern blot analysis on selected transgenic sorghum events
2.4A: Tx430 events 133-3-5-1 and 137-5-1-1. Membrane was hybridized with synthetic OsCDPK-7 probe. Lanes Tx430, and pPTN751 refer to wildtype DNA and 50 pg of plasmid, respectively. 2.4B: C2-97 events 24-1-1 and 49-2-5b. Membrane was hybridized with synthetic OsCDPK-7 probe. Lanes C2-97, and pPTN751 refer to wildtype DNA and 50 pg of plasmid, respectively. 2.4C: Tx430 events 18-4-1a and 39- 1-1a. Membrane was hybridized with 35S CaMV promoter probe. Lanes Tx430, and pPTN780 refer to wildtype DNA and 50 pg of plasmid, respectively.
70
Figure 2.5: RNA hybridization analysis on selected transgenic sorghum events
2.5A: Tx430 events 133-3-5-1 and 137-5-1-1. Lane Tx430 refers to control total RNA from Tx430. Probe used in analysis was synthetic OsCDPK-7. Bottom panel is ethidium stained gel. 2.5B: C2-97 events 24-1-1 and 49-2-5b. Lane C2-97 refers to control total RNA from C2-97. Probe used in analysis was synthetic OsCDPK-7. Bottom panel is ethidium stained gel. 2.5C: Tx430 events 18-4-1a and 39-1-1a. . Lane Tx430 refers to control total RNA from Tx430. Probe used in analysis was mutated OsCDPK-7. Bottom panel is ethidium stained gel.
71
Figure 2.6: Lesion formation under varying conditions
2.6A: Left, leaf blade of transgenic event 133-3-5-1, after covering with foil, showing lesion formation occurs in a light-independent fashion. Right, leaf blade of Tx430 wild- type, displaying only chlorosis due to coverage of foil. 2.6B: Leaf blade of transgenic event 133-3-5-1 displaying lesion formation under axenic growth conditions. 2.6C: Tx430 wild-type following wounding treatment, 2.6D: transgenic event 133-5-1 following wounding treatment showing formation of lesion does not emanate from wound site.
72
Figure 2.7: Two-dimensional gel electrophoresis
2.7A: 2-D gel of control Tx430 wild-type protein samples. 2.7B: 2-D gel of transgenic event 133-3-51 protein samples. Arrows indicate differential spots analyzed by tandem mass spectrometry, which indicated the differential proteins were members of the PR-10 family of pathogen related proteins.
Table 2.1: Transcripts with an observed greater than 2-fold increase in expression in Tx 430 pPTN751 transgenic events Probe ID Category Fold q-value Gene Function ∆ Zm.2321.4.A.1_a_at Cell 5.12 0.00023 Alanine aminotransferase Reversible transfer of amino group from maintenance ala to 2-oxoglutarate to form pyruvate and glutamate Zm.4684.1.A1_at Cell 2.3 0.00689 NADH-dependent glutamate Ammonium assimilation maintenance synthase Zm.264.1.S1_a_at Cell 2.12 0.008 Acetyl-coenzyme A Acetyl-CoA carboxylase. First step in maintenance carboxylase ACC1B fatty acid biosynthesis Zm.13934.1.S1_at Membrane 2.82 0.0078 Plasma membrane H+ ATPase Generates an electrochemical gradient transport across plasma membrane, aids in maintaining cell turgor Zm.17243.1.S1_at Membrane 2.12 0.008 CBL-interacting protein kinase Activates the potassium channel for K+ transport 23 uptake Zm.9197.1.A1_at Abiotic stress 2.8 0.0194 Tonoplast aquaporin Aquaporin expressed in zones of cell division and elongation Zm.16907.1S1_at Abiotic stress 2.72 0.0013 Phosphoethanolamine N- Key step in choline biosynthesis leading metyltransfersae to the production of glycine betaine Zm.13775.1S1._at Abiotic stress 2.02 0.0057 betaine aldehyde BADH1: involved glycine betaine dehydrogenase synthesis Zm.385.1.A1_at photosynthesis 4.0 0.0207 Uroporphyrinogen Involved in the porphyrin pathway decarboxylase, plastid precursor Zm.7091.2.S1_a_at photosynthesis 2.5 0.0146 Chlorophyll a/b binding protein Chlorophyll a/b binding apoprotein precursor Zm.247.1.A1_a_at Signal 2.1 0.0856 Adenosine kinase mRNA for adenosine kinase transduction Zm.4270.2.A1_a_at Defense related 5.7 0.0708 Bowman-Birk serine protease Involved in pathogen defense response inhibitor Zm.10293.1.S1_at Transcription 2.9 0.0143 Cprf-2 Phosphorylated in response to light, factor regulates other light responsive genes
73
74
Table 2.2: qRT-PCR results on selected up-regulated transcripts Affymetrix ID/Sorghum gene Normalized expression ratio mean (±SD) Zm2321.4.A1_a_at/Sb01g023750.1 3.74±1.03 Zm385.1.A1_at/Sb01g036030.1 2.65±1.4 Zm10293.S1_at/Sb10g026450.1 2.3±1.5
75
CHAPTER 3
Sorghum transformation: overview and utility
Tejinder Kumar1, Arlene Howe3,†, Shirley Sato3, Ismail Dweikat1, and Tom Clemente1,2,3
1-Department of Agronomy & Horticulture, University of Nebraska-Lincoln, Lincoln, Nebraska 68583 2-Center for Plant Science Innovation, University of Nebraska-Lincoln, Lincoln Nebraska 68588 3-Center for Biotechnology, University of Nebraska-Lincoln, Lincoln Nebraska 68588 †-Current address, Monsanto Company, Chesterfield, Missouri 63017
76
Abstract
Over the past decade genomics resources available for sorghum have rapidly expanded (Paterson 2008), these resources, coupled with the recent completion of the genome sequence which is relatively small in size (730 Mb) (Paterson et al. 2009) makes sorghum a rather attractive species to study. Moreover, the USDA germplasm system maintains 42,614 accessions, of which more than 800 exotic landraces have been converted to day length-insensitive lines to facilitate their use in breeding programs. In addition, a set of EMS mutation stocks developed by the USDA Plant Stress and
Germplasm Development Unit in Lubbock, TX (Xin et al. 2009) will be a valuable resource for functional genomics studies in sorghum. However, in order to be a robust system for study, a suite of functional genomics tools are necessary to complement these other resources to aid in down-stream hypothesis testing. A key functional genomics tool is the ability to modulate gene expression through the introduction of transgenic genetic elements. This is exemplified by recent work (Cook et al. 2010) in which RNAi experiments were employed to specifically reduced expression of two alkylresorcinol synthases to demonstrate their role in the synthesis of the allelopathic molecule sorgoleone. In addition to its value as a functional genomics tool, plant transformation offers a route to broaden access to novel input and output traits for sorghum breeding programs.
77
Sorghum Transformation
In general plant transformation can be partitioned into two components, competence of a cell for culture regeneration into a whole plant and receptiveness of that same cell for foreign DNA integration. In sorghum, like most monocotyledonous plants, in vitro culture regimes are primarily somatic embryogenesis based systems (Elkonin and
Pakhomova 2000; Jogeswar et al. 2007; Kaeppler and Pedersen 1996; Pola et al. 2008;
Pola and Mani 2006; Sato et al. 2004a). As per the second component of plant transformation, integration of genetic elements, sorghum has been successfully transformed using both direct DNA delivery methods (Battraw and Hall 1991) and
Agrobacterium-mediated transformation protocols (Cai et al. 2002; Gao et al. 2005a; Gao et al. 2005b; Gurel et al. 2009; Howe et al. 2006; Nguyen et al. 2007; Zhao et al. 2000).
While both DNA delivery systems are proven technologies for recovery of stable sorghum transformants, more laboratories are moving towards implementing the latter due to the tendency of Agrobacterium-mediated transformants to carry lower copy number insertions and/or have a higher frequency of co-expression of the non-selected transgenic cassette (Dai et al. 2001; Gao et al. 2008; Zhao et al. 1998).
While multiple explants have been evaluated as the starting material for sorghum transformation, clearly the primary explant reported on is immature embryos. One of the factors that have hampered transformation efficiencies of sorghum with the immature embryo explant is the rapid production of phenolic compounds. Phenolics are produced during the in vitro culturing of sorghum immature embryos, but the production of these secondary metabolites is enhanced upon inoculation with A. tumefaciens. To alleviate the negative effects of phenolics on sorghum transformation media supplements such as
78 polyvinylpolypyrrolidone (PVPP) (Cai et al. 1987), and elevation of potassium phosphate levels (Elkonin and Pakhomova 2000; Sato et al. 2004a), or the exposure of explants to reduced temperature (Nguyen et al. 2007) have been shown to be able to reduce, but not totally eliminate the negative impact of these compounds. Triggering of the plant’s defense response upon challenge with A. tumefaciens may lead not only to the production of secondary metabolites, but also to cell death, which can further hamper the efficiency of recovery of transgenic plants. For example in banana the triggering of apoptosis by A. tumefaciens can be effectively countered by the expression of anti-apoptotic genes
(Khanna et al. 2007). While such a strategy has not been evaluated in sorghum, a heat shock pre-treatment, which was previously reported to counter apoptosis in banana embryogenic callus, leading to improved transformation efficiency (Khanna et al. 2004), was recently shown to be a translatable technique using sorghum immature embryos
(Gurel et al. 2009).
Key to any transformation system is the ability to rapidly, and efficiently distinguish transgenic differentiating cells from non-transgenic cell lineages. Two means typically used to differentiate transgenic from non-transgenic cell lineages are the use of visual or selectable marker genes. In sorghum the visual marker genes green fluorescent protein (gfp) and ß-glucuronidase (GUS) are each effective in monitoring for transgenic cells (Jeoung et al. 2002). Using the former visual marker Gao et al (Gao et al. 2005a) reported a 3.0% transformation efficiency as means to monitor for transgenic differentiating cell lineages from immature embryos of sorghum.
79
Selectable marker genes used to provide a competitive edge in culture for plant transformation systems typically rely upon providing resistance to antibiotics, such as hygromycin (Gritz and Davies 1983), and the aminoglycoside kanamycin, or various derivatives thereof (Fraley et al. 1983) or tolerance towards herbicidal agents glyphosate
(Barry et al. 1992) and glufosinate (Thompson et al. 1987). In addition the positive selectable marker gene phosphomannose isomerase (PMI) (Joersbo and Okkels 1996) has been shown to be a rather robust selection system for the identification of transgenic plants (Negrotto et al. 2000), including sorghum (Gao et al. 2005b).
Outline of an Agrobacterium-mediated transformation of sorghum using npt II as a selectable marker gene
As indicated above, there have been multiple reports of successful transformation of sorghum following the communicated success in 1993 (Casas et al. 1993). Outlined below is the system reported on by Howe et al (Howe et al. 2006) that utilizes npt II as the selectable marker gene, coupled with G418, as the selection agent. While the overall transformation efficiency with this system is relatively low, typically ranging from 1% to
3%, the system is consistent, and importantly, teachable with minimal training.
This sorghum transformation system relies upon immature embryos as the starting material. One of the disadvantages of using this explant is the need for continual plantings of stock plants to ensure a constant supply of immature embryos, adding labor and cost to the system. Nonetheless, the stock plants used to supply immature embryos are maintained under greenhouse conditions. Heads are harvested when 70% of the head have embryos ranging in size from 1.2 to 2.2 mm in length. Each head is then excised from the plant and placed in a 1000 ml graduated cylinder filled with 500ml of 50%
80 commercial bleach plus 250 ml of Tween 20. The cylinder containing the sorghum head submerged in the bleach solution is mixed with a stir bar for 20 min. Following the 20 min surface sterilization with bleach the heads are washed three times with sterile water and allowed to air dry in laminar flow hood. Seeds are isolated and subjected to a secondary sterilization process consisting of a 1 min soak with agitation in 70% ethanol, followed by a single wash with sterile water, proceeded by a soak with agitation in 10% bleach solution, with a subsequent triple wash in sterile water.
Immature embryos are isolated from 50 sterilized seeds and placed in a 35X10mm
Petri plate containing 1 ml of co-culture medium supplemented with 300 µM of acetosyringone. The co-culture medium is composed of 0.5X MS major and minor salts
(Murashige and Skoog 1962), 0.5 mg/l each of nicotinic acid and pyridoxine HCl, plus 1 mg/l each of thiamine HCl and casamino acids. The carbohydrate sources are 2% sucrose and 1% glucose and growth regulator, 2,4-D, at 2 mg/l. The medium is buffered with 3 mM MES (pH 5.2). The medium is filter sterilized, with no components being autoclaved.
Once 50 immature embryos have been isolated the co-culture medium is removed and replaced with 1 ml of A. tumefaciens inoculum. The inoculum is an A. tumefaciens strain NTL4/pTiPKPSF2 (Palanichelvam et al. 2000), suspension in co-cultivation medium (OD660 0.3-0.5). Inoculation time is 5 min. Following the co-cultivation step the explants are placed scutellum side up on 100X20 mm Petri plates containing four sterile
Whatman™ filter papers saturated with 4.2 mls of co-cultivation medium. The plates are incubated for 2 days at 24°C in the dark.
81
Following the co-cultivation period the explants are cultured on delay medium which is composed of Elkonin’s major salts (Elkonin and Pakhomova 2000), MS minor salts and vitamin mix, 2 g proline, and 1 g asparagine. The carbohydrate source is 3% sucrose, the medium is buffered with 3mM MES (pH 5.7) and solidified with 2% phytagel. To counter select against A. tumefcaiens the medium is supplemented with 100 mg/l carbenicillin. The growth regulator 2,4-D is used at a level of 1.5 mg/l. Cultures are incubated at 28°C in the dark for 3 days.
The selection phase is immediately implemented following the delay period. A total of 20 embryos are placed on to 100X20 mm Petri plates containing the delay medium supplemented with 20 mg/L G418. The tissue is transferred to fresh selection medium every 2-3 weeks. As coleoptiles develop they are systematically removed from the explants. As the embryogenic callus begins to form about the explants the tissue is broken up into 1-3 mm pieces, with care being taken to ensure tracking of tissue from the original explant, given the fact that most transformants derived from the same initial immature embryo tend to be clones, hence, the best way to track transformation efficiencies. The callus tissue remains in the selection phase for a period of 6 to 9 weeks.
Following the selection phase proliferating embryogenic tissue is transferred to regeneration medium composed of MS major/minor salts and vitamins, supplemented with 0.5 mg/l kinetin and 1.0 mg/l IAA. The medium is solidified with 2% phytagel, carbohydrate level was 3% sucrose, and buffered with 3 mM MES (pH 5.7). The selection pressure is reduced to 10 mg/l G418, and the carbenicillin level remains at 100 mg/l. The cultures are placed under a 16/8 light regime at 24°C. Typically after 4 weeks
82 on regeneration, with one subculture at the two-week period, shoots with well established roots will form, that are ready to be acclimated to soil (Fig 3.1).
Once acclimated, the primary transformants are confirmed using a commercial
ELISA kit to monitor npt II expression (Agdia Corp.). Primary transformants are screened to identify a minimum of two lead events for down-stream characterizations. A lead event is selected based on simple integration pattern of the transgenic element(s), and expression of the target phenotype(s) of interest.
Considerations in designing binary vectors for sorghum transformation
An attribute of Agrobacterium-mediated transformation is that T-DNAs can be integrated, albeit relatively infrequently, at unlinked positions. This ability of A. tumefaciens can be exploited to derive marker-free transgenic events through the simultaneous delivery of two T-DNAs, where one of the T-DNA elements carries the marker gene, and the other carries gene(s) of interest. If integrated at unlinked positions, the T-DNAs, will segregate in the progeny. This strategy has been successfully used to derived marker-free transgenic plants in a number of systems (Daley et al. 1998; Jacob and Veluthambi 2002; Komari et al. 1996; Sato et al. 2004b; Xing et al. 2000), including sorghum (Zhao et al. 2003). The integration of unlinked T-DNA alleles in sorghum is exemplified in Fig 3.2. Transgenic sorghum events were generated that harbored a transgenic cassette with the cyanamide hydratase (cah) gene (Maier-Greiner et al. 1991), under control of the sugarcane polyubiquitin promoter ubi4 (Wei et al. 2003), housed within a single T-DNA binary vector designated pPTN181 (not shown). A Southern blot analysis is performed using a restriction enzyme wherein one recognition site resides within the T-DNA element, hence each hybridization signal will reflect a single
83 integration locus, on a subset of primary transformants derived from pPTN181 as shown in Fig 3.2A. As can be seen the event 168 carries one locus, while events 165 and 166 harbor two loci, and event 164 contains 3 loci. Monitoring segregation of the transgenic alleles in progeny derived from these events revealed a 15:1 pattern for events 165 and
166, and a 3:1 pattern for events 164 and 168 (Data not shown). Southern analysis on a subset of the derived progeny is in agreement with the observed segregation patterns (Fig
3.2B&C). It can be seen in the T1 individuals derived from events 165 and 166 that some individuals display the genotype of the parent, while others only carry one of the transgenic alleles. On the other hand all T1 derived from event 164 had the same genotype as the parent, hence all alleles appear to be linked. However the single locus event, 168, segregated as expected, with T1 individuals genotyped the same as the parent.
When implementing the tool of plant transformation for targeted output and input traits in sorghum such as improvement in grain quality or stress tolerance, respective, it is critical to have promoter elements with the desired specificity so to limit the probability of negatively impacting agronomic performance that may arise if the phenotype is mis- expressed in non-target tissues. To this end it is prudent to verify promoter specificity if using a promoter known to be tissue specific in other species, before assembling cassettes for use in sorghum. For example interest in modifying seed components of sorghum may require specific expression in the embryo. A logical candidate promoter for desired embryo-specific expression would be the maize globulin-1 promoter (Belanger and Kriz
1991). To evaluate whether the glob-1 promoter specificity would translate to sorghum a
GUSPlus™(www.cambia.org) cassette under control of the glob-1 promoter was assembled and introduced into sorghum. As a constitutive control transgenic sorghum
84 carrying a GUSPlus™ cassette under control of the maize polyubiquitin promoter
(Christensen et al. 1992) was used for comparison. Tissue samples were assayed over development in T1 or T2 individuals, looking at GUS expression within root, leaf, stem, glume, scutellum and embryos. As can be seen in Fig 3.3, embryo-specificity of the maize glob-1 promoter effectively translates to sorghum. While this result is not surprising, these are data that need to be gathered to fully exploit sorghum transformation as a translational genomics tool.
Target Input Traits for Sorghum through Transformation
A critical trait for any breeding program is yield. Addressing yield directly through transgenic approaches is a considerable challenge. A more practical and obtainable goal in the short term is protection of yield through control of biotic and abiotic stresses. In sorghum, like most crops, key stresses that compromise yield will vary across regions. Sorghum production can be severely impacted by a number of insect pests. Not only can insects impact production directly, but in some cases they can also provide an entry for secondary pathogen attack at the site of insect feeding. The success of the Bt technology in maize (Armstrong et al. 1995; Barry et al. 2000), and cotton
(Cattaneo et al. 2006), is a strong rationale for the evaluation of this technology in sorghum as a means to combat specific target insect pests. Importantly, in addition to
Bt’s direct impact in impeding insect pest feeding damage, a positive secondary effect observed with the use of this technology is a significant reduction in accumulation of various mycotoxins in plant tissues (Abbas et al. 2008; Bakan et al. 2002; Hammond et al. 2004). This secondary attribute of the Bt technology may serve as a valuable mechanism to limit quality issues of sorghum related to contamination of these toxins
85 that may occur under certain conditions and fungal infestation levels (Ghali et al. 2009;
Reddy and Raghavender 2008; Reddy et al. 2010). However, like all disease resistance traits, the Bt technology needs to be used in conjunction with proper integrated pest management practices to maximize its durability over time (Kumar and Pandey 2008;
Sharma and Ortiz 2000).
A number of viral agents have been shown to be capable of replication in sorghum (Jensen and Giorda 2002), including members of the potyvirus family including sugarcane mosaic virus, maize dwarf mosaic virus, and sorghum mosaic virus. Limited resistance towards these viral agents have been identified within sorghum germplasm, although some reports have been communicated (Henzell et al. 1982). The seminal work which demonstrated introduction of viral coat protein genes in transgenic plants to confer virus resistance (Abel et al. 1986; Nelson et al. 1987; Stark and Beachy 1989), has opened the door for the translation of this technology to other plant systems, implementing various genetic constructs that target silencing of critical gene products required for the replication of the virus of interest (Beachy et al. 2003; Prins 2003), including known pathogens of sorghum (Gilbert et al. 2005). Hence, such strategies offer great potential for the introduction of durable virus resistance for sorghum.
Striga, commonly referred to as witch weed, contains two species, S. hermonthica and S. asiatica, that are parasitic on sorghum and other cereals (Aly 2007). Parasitic plant species infest nearly 50 million hectares crop plants on an annual basis, and great strides have been made in developing resistance in sorghum through conventional breeding approaches (Ejeta 2007). More recently Tuinstra et al (Tuinstra et al. 2009) communicated a herbicide seed treatment strategy, that exploits the introgression of
86 acetolactate synthase (ALS) herbicide resistance from shattercane into elite sorghum genotypes (Hennigh et al. 2010). Implementing this seed-coating approach significantly reduced Striga emergence under both greenhouse and field tests (Tuinstra et al. 2009).
While this is a very promising tool to combat this devastating parasite, given that ALS inhibiting herbicides are typically classified as high risk for development of resistance, the durability of such a strategy may be limited without proper management. Hence, other approaches are needed to ensure long-term control towards Stiga. To this end, there has been a report looking at targeting critical genes in parasitic plant’s life cycle by expression of hair-pin constructs in the host plant which resulted in an enhanced tolerance phenotype in the Orobanche aegyptiaca/tomato host parasite interaction (Aly et al. 2009). However, this approach was not successfully translated as a means to control to the Striga/maize parasite interaction (Yoder and Scholes 2010). Clearly additional research is required to further our understanding of the underlying biology involved during the early stages of parasitism by these plants. More efforts around the assembly of
‘omics’ databases that carry this information (Torres et al. 2005) are needed to facilitate the development of alternative control strategies towards Striga, that may serve as a complement to the herbicide seed coating approach (Tuinstra et al. 2009).
Addressing a plant’s response to stresses that are governed in a multigenic fashion is more challenging than single gene traits. In order to investigate multigenic abiotic stress response traits such as drought and heat, researchers are evaluating a coordinated expression of a suite of genes triggered by exposure to the targeted stress by the introduction of a single transcription factor (Karaba et al. 2007; Nelson et al. 2007;
Suzuki et al. 2005). Theses transcription-factor based technologies hold great promise as
87 a means to reduce multigenic expressed phenotypes to a single transgene fashion
(Century et al. 2008), however, the transcription factor based strategy undoubtedly will require tight regulation, necessitating the need for tissue-specific and/or inducible promoter systems.
With respect to adaptation to low nitrogen environments, Yanagisawa et al
(Yanagisawa et al. 2004) demonstrated that expression of the maize Dof1 transcription factor improved nitrogen assimilation in transgenic plants. However, it is feasible to directly perturb nitrogen flux in plants. Nitrogen assimilation and metabolism in plants occurs through coordinated action of a variety of enzymes acting upon a variety of substrates. Two key enzymes involved in nitrogen metabolism in plants are glutamine synthetase (GS) and glutamate synthase (GOGAT). Previous studies have shown that enhancing GS or GOGAT activities can impact nitrogen metabolism in plant species (Cai et al. 2009; Good et al. 2004). Enhancing activity of another enzyme that impacts nitrogen flux in plants, alanine aminotransferease (Ala-AT), that catalyzes the production of alanine and 2-oxoglutarate from pyruvate and glutamate, has been shown to augment nitrogen use efficiency in both rape seed and rice (Good et al. 2007; Shrawat et al. 2008).
A caveat to these studies communicating enhancing nitrogen use efficiency through transgenic approaches is that most reports used data sets gathered from greenhouse or growth chamber studies, with minimal information on the impact of the respective transgenes on yield under field conditions (Brauer and Shelp 2010).
Moreover, no data sets have been communicated to date on the impact of gene stacking strategies on nitrogen use efficiencies with these selected genes.
88
Target Output Traits for Sorghum through Transformation
Digestibility of sorghum limits protein availability, and ultimately impacts the nutritional quality of the grain (Duodu et al. 2003). The major sorghum proteins, prolamins, found in sorghum reside in the endosperm. The prolamin storage proteins found in sorghum and maize are designated kafirins and zeins, respectively. The prolamins are assembled into protein bodies, with a very defined pattern, where the α class reside in the core along with the class, albeit to a lower extent, while the β and γ classes decorate the periphery of the protein body (Wu and Messing 2010). A number of parameters can influence digestibility of sorghum protein, including structure and shape of the protein body (Duodu et al. 2003). Reduction of the zein proteins found in the maize mutants opaque-2 (Hartings et al. 1989) and floury-2 (Coleman et al. 1995) leads to a concomitant increase in lysine and tryptophan due to a compensation mechanism in seeds resulting in an increase in non-zein proteins (Coleman and Larkins 1999).
Deliberate reduction in the 19 kDa α-zeins in maize manifests the opaque kernel phenotype, and enhances levels of lysine and tryptophan in the grain (Huang et al. 2004).
Similarly, reduction in the level of both the β- and γ- zeins resulted in drastic changes protein bodies, and triggered the opaque kernel phenotype (Wu and Messing 2010).
Hence, modulation of the prolamins is a target that could be pursued in sorghum as a means to simultaneously address digestibility, and nutritional quality.
Oria et al (Oria et al. 2000) described a highly digestible, enhanced lysine sorghum mutant. The protein bodies observed within this mutant are highly folded, with a redistribution of the γ-kafirin about the body. These factors lead to increased exposure
89 of the core α-kafirins, which translates to the increased digestibility phenotype (Duodu et al. 2003).
Like the maize floury-2 and opaque-2 mutants, the highly digestible, enhanced lysine mutant of sorghum has value in both food and feed applications. However, translation of these traits to application has yet to be realized, undoubtedly due to the tendency of these altered prolamin grains to have reduced agronomic properties, and negative post harvest issues (Huang et al. 2004). However, these drawbacks may not be insurmountable. Breeding efforts are making progress in addressing the issues blocking deployment of the high digestible, enhanced lysine mutant of sorghum (Tesso et al. 2006;
Tesso et al. 2008a). Further understanding of the underlying biology governing protein deposition in these mutants and the influence of the various genetic modifiers, coupled with better breeding strategies, will help to utilize this mutant, without negatively altering the endosperm characteristics. Hence, in the end, the successful deployment of a high quality grain sorghum will require an interdisciplinary approach that brings together the expertise of plant breeding, biotechnology, molecular biology/genetics and food science.
Potential of outcrossing to weedy relatives
One of the concerns raised about release of transgenic sorghum is the potential for outcrossing to its weedy relatives Johnsongrass and Shattercane. This can result in transfer of transgene into these weedy species and can improve their adaptive capabilities. Hence it can lead to altered balance in the ecosystem, changes in the plant community structure, and persistence of weeds in agricultural lands (Tesso et al. 2008b).
A number of parameters must be met for a successful sorghum outcross event to occur. First, the crop and weed species must be in close proximity, and flowering times
90 synchronized. Hybrids derived from outcrosses between grain sorghum and shattercane
(S. bicolor subsp. drummondii) do not appear to be compromised in fitness (Sahoo et al.
2010). This lack of fitness drag in sorghum X shattercane hybrids has a benefit when introgressing desirable alleles from the shattercane into the cultivated genotypes, for example ALS resistance gene (Hennigh et al. 2010). However, this attribute that benefits conventional breeding strategies used to broaden diversity of cultivated sorghum, negatively impacts the use of transformation as a tool for introduction of novel traits into the crop, given there will undoubtedly be a call for more extensive regulatory testing addressing the potential ecological impact of a given transgenic sorghum event, which in turn will lead to higher costs and delay in release, with getting a transgenic sorghum event on the market.
One approach that may limit the concern of transgenic sorghum impacting the ecosystem above what is already occurring with production of conventional cultivars is the use of a male sterility system that may effectively limit pollen flow of transgenic sorghum under field conditions (Pedersen et al. 2003). However, such containment systems in many cases may not be required. The current regulatory system has a ‘one size fit all approach’, in that regardless of the trait developed through transgenic approaches, a series of laborious and costly studies must be conducted. While it is very reasonable to assume that deployment of a transgenic sorghum event will eventually be followed by outcross to a wild relative, this must not be the only deciding factor to block production. Rather than a ‘one size fits all’ model, perhaps a more adaptable, scientific regulatory process, in which decisions are made on a case-by-case model is more appropriate. Recently, Hokanson et al (Hokanson et al. 2010) communicated a
91 straightforward and scientific-fact based risk assessment process that hopefully will open the door for more dialog in this area, and ultimately will allow for advances in transgenic technologies to enter the marketplace expeditiously in a safe and effective manner.
92
References
Abbas HK, Accinelli C, Zablotowicz RM, Abel CA, Bruns HA, Dong Y, Shier WT (2008)Dynamics of mycotoxin and Aspergillus flavus levels in aging Bt and non-Bt corn residues under Mississippi no-till conditions. J Agric Food Chem 56:7578-7585 Abel PP, Nelson RS, De B, Hoffmann N, Rogers SG, Fraley RT, Beachy RN (1986) Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232:738-743 Aly R (2007) Conventional and biotechnological approaches for control of parasitic weeds. In Vitro Cell Dev Biol 43:304-317 Aly R, Cholakh H, Joel DM, Leibman D, Steinitz B, Zelcer A, Naglis A, Yarden O, Gal- On A (2009) Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant. Plant Biotechnology Journal 7:487-498 Armstrong CL, Parker GB, Pershing JC, Brown SM, Sanders PR, Duncan DR, Stone T, Dean DA, DeBoer DL, Hart J, Howe AR, Morrish FM, Pajeau ME, Peterson WL, Reich BJ, Rodriguez R, Santino CG, Sato SJ, Schuler W, Sims SR, Stehling S, Tarochione LJ, Fromm ME (1995) Field evaluation of european corn borer control in progeny of 173 transgenic corn events expressing an insecticidal protein from Bacillus thuringiensis. Crop Sci 35:550-557 Bakan B, Melcion D, Richard-Molard D, Cahagnier B (2002) Fungal growth and fusarium mycotoxin content in isogenic traditional maize and genetically modified maize grown in France and Spain. J Agric Food Chem 50:728-731 Barry BD, Darrah LL, Huckla DL, Antonio AQ, Smith GS, O'Day MH (2000) Performance of transgenic corn hybrids in Missouri for insect control and yield. J Econ Entomol 93:993-999 Barry G, Kishore G, Padgette S, Taylor M, Kolacz K, Weldon M, Re D, Eichholtz D, Fincher K, Hallas L (1992) Inhibitors of amino acid biosynthesis: Strategies for imparting glyphosate tolerance to crop plants. Biosynthesis and molecular recognition of amino acids in plants:139-145 Battraw M, Hall TC (1991) Stable transformation of Sorghum bicolor protoplasts with chimeric neomycin phosphotransferase-II and ß-glucuronidase genes. Theor Appl Genet 82:161-168 Beachy RN, Fraley RT, Rogers SG (2003) Protection of plants against viral infection. Monsanto Technology LLC/ Washington University, United States Patent No. 6,608,421 Belanger FC, Kriz AL (1991) Molecular basis for allelic polymorphism of the maize Globulin-1 gene. Genetics 129:863-872 Brauer EK, Shelp BJ (2010) Nitrogen use efficiency: re-consideration of the bioengineering approach. Botany 88:103-109 Cai H, Zhou Y, Xiao J, Li X, Zhang Q, Lian X (2009) Overexpressed glutamine
93
synthetase gene modifies nitrogen metabolism and abiotic stress responses in rice. Plant Cell Rep 28:527-537 Cai T, Daly B, Butler L (1987) Callus induction and plant regeneration from shoot portions of mature embryos of high tannin sorghum. Plant Cell Tiss Org Cult 9:245-252 Cai T, Pierce DA, Tagliani LA, Zhao Z-Y (2002) Agrobacterium mediated transformation of sorghum. Pioneer Hi-Bred International, Inc, United States Patent No. 6,396,298 Casas AM, Kononowicz AK, Zehr UB, Tomes DT, Axtell JD, Butler LG, Bressan RA, Hasegawa PM (1993) Transgenic sorghum plants via microprojectile bombardment. Proc Natl Acad Sci U S A 90:11212-11216 Cattaneo MG, Yafuso C, Schmidt CW, Huang C-Y, Rahman M, Olson C, Ellers-Kirk C, Orr BJ, Matsh SE, Antilla L, Dutilleul P, Carriére Y (2006) Farm-scale evaluation of the impacts of transgenic cotton on biodiversity, pesticide use, and yield. Proc Natl Acad Sci U S A 103:7571-7576 Century K, Reuber TL, Ratcliffe OJ (2008) Regulating the regulators: the future prospects for transcription-factor-based agricultural biotechnology products. Plant Physiol 147:20-29 Christensen AH, Sharrock RA, Quail PH (1992) Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18:675-689 Coleman CE, Larkins BA (1999) The prolamins of maize. In: Shewry PR, Casey R (eds) Seed Proteins. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 109-139 Coleman CE, Lopes MA, Gillikin JW, Boston RS, Larkins BA (1995) A defective signal peptide in the maize high-lysine mutant floury 2. Proc Natl Acad Sci U S A 92:6828-6831 Cook D, Rimando AM, Clemente TE, Schroder J, Dayan FE, Nanayakkara D, Pan Z, Noonan BP, Fishbein M, Abe I, Duke SO, Baerson SR (2010) Alkylresorcinol synthases expressed in Sorghum bicolor root hairs play an essential role in the biosynthesis of the allelopathic benzoquinone soroleone. Plant Cell 22:867-887 Dai S, Zheng P, Marmey P, Zhang S, Tian W, Chen S, Beachy RN, Fauquet C (2001) Comparative analysis of transgenic rice plants obtained by Agrobacterium- mediated transformation and particle bombardment. Mol Breeding 7:25-33 Daley M, Knauf VC, Summerfelt KR, Turner JC (1998) Co-transformation with one Agrobacterium tumefaciens strain containing two binary plasmids as a method for producing marker-free transgenic plants. Plant Cell Rep 17:489-496 Duodu KG, Taylor JRN, Belton PS, Hamaker BR (2003) Factors affecting sorghum protein digestibility. J Cereal Science 38:117-131
94
Ejeta G (2007) Breeding for striga resistance in sorghum: Exploitation of an intricate host-parasite biology. Crop Sci 47 Suppl. 3:216-227 Elkonin LA, Pakhomova NV (2000) Influence of nitrogen and phosphorus on induction embryogenic callus of sorghum. Plant Cell Tiss Org Cult 61:115-123 Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner ML, Brand LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL, Woo SC (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U S A 80:4803- 4807 Gao C, Long D, Lenk I, Nielsen KK (2008) Comparative analysis of transgenic tall fescue (Festuca arundinacea Schreb.) plants obtained by Agrobacterium-mediated transformation and particle bombardment. Plant Cell Rep 27:1601-1609 Gao Z, Jayaraj J, Muthukrishnan S, Claflin L, Liang GH (2005a) Efficient genetic transformation of sorghum using a visual screening marker. Genome 48:321- 333 Gao Z, Xie X, Ling Y, Muthukrishnan S, Liang GH (2005b) Agrobacterium tumefaciens-mediated sorghum transformation using a mannose selection system. Plant Biotechnol J 3:591-599 Ghali R, Ghorbel H, Hedilli A (2009) Fumonisin determination in Tunisian foods and feeds. ELISA and HPLC methods and comparison. J Agric Food Chem 57:3955- 3960 Gilbert RA, Gallo-Meagher M, Comstock JC, Miller JD, Jain M, Abouzid A (2005) Agronomic evaluation of sugarcane lines transformed for resistance to sugarcane mosic virus strain E. Crop Sci 45:2060-2067 Good AG, Johnson SJ, De Pauw M, Carroll RT, Savidov N, Vidmar J, Lu Z, Taylor GJ, Stroeher V (2007) Engineering nitrogen use efficiency with alanine aminotransferase. Can J Bot 85:252-262 Good AG, Shrawat AK, Muench DG (2004) Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends Plant Sci 9:597-605 Gritz L, Davies J (1983) Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccaromyces cerevisiae. Gene 26:179-188 Gurel S, Gurel E, Kaur R, Wong J, Meng L, Tan H-Q, Lemaux PG (2009) Efficient, reproducible Agrobacterium-mediated transformation of sorghum using heat treatment of immature embryos. Plant Cell Rep 28:429-444 Hammond BG, Campbell KW, Pilcher CD, Degooyer TA, Robinson AE, McMillen BL, Spangler SM, Riordan SG, Rice LG, Richard JL (2004) Lower fumonisin mycotoxin levels in the grain of Bt corn grown in the United States in 2000-2002. J Agric Food Chem 52:1390-1397 Hartings H, Maddaloni M, Lazzaroni N, Di Fonzo N, Motto M, Salamini F, Thompson R
95
(1989) The O2 gene which regulates zein deposition in maize endosperm encodes a protein with structural homologies to transcriptional activators. Embo J 8:2795-2801 Hennigh DS, Al-Khatib K, Currie RS, Tuinstra MR, Geier PW, Stahlman PW, Claassen MM (2010) Weed control with selected herbicides in acetolactate synthase- resistant sorghum. Crop Pro 29:879-883 Henzell RG, Persley DM, Greber RS, Fletcher DS, Van Slobbe L (1982) Development of grain sorghum lines with resistance to sugarcane mosaic and other sorghum diseases. Plant Dis 66:900-901 Hokanson KE, Ellstrand NC, Ouedraogo JT, Olweny PA, Schaal PA, Raybould AF (2010) Biofortified sorghum in Africa: using problem formulation to inform risk assessment. Nat Biotechnol 28:900-903 Howe A, Sato S, Dweikat I, Fromm M, Clemente T (2006) Rapid and reproducible Agrobacterium-mediated transformation of sorghum. Plant Cell Rep 25:784-791 Huang S, Adams WR, Zhou Q, Malloy KP, Voyles DA, Anthony J, Kriz AL, Luethy MH (2004) Improving nutritional quality of maize proteins by expressing sense and antisense zein genes. J Agric Food Chem 52:1958-1964 Jacob SS, Veluthambi K (2002) Generation of selection marker-free transgenic plants by cotransformation of a cointegrate vector T-DNA and a binary vector T-DNA in one Agrobacterium tumefaciens strain. Plant Sci 163:801-806 Jensen SG, Giorda LM (2002) Virus diseases of sorghum and millet in the Americas and Australia. In: Leslie JF (ed) Sorghum and Millets Diseases. Iowa State Press, Ames, IA, pp 403-410 Jeoung JM, Krishnaveni S, Muthukrishnan S, Trick HN, Liang GH (2002) Optimization of sorghum transformation parameters using genes for green fluorescent protein and ß-glucuronidase as visual markers. Hereditas 137:20-28 Joersbo M, Okkels FT (1996) A novel principle for selection of transgenic plant cells: positive selection. Plant Cell Rep 16:219-221 Jogeswar G, Ranadheer D, Anjaniah V, Kishor PBK (2007) High frequency somatic embryogenesis and regeneration in different genotypes of Sorghum bicolor (L.) Moench from immature explants. In Vitro Cell Dev Biol-Plant 43:159-166 Kaeppler HF, Pedersen JF (1996) Media effects on phenotype of callus cultures initiated from photoperiod-insensitive, elite inbred sorghum lines. Maydica 41:83-89 Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko KR, Marsch-Martinez N, Nataraja K, Udayakumar M, Pereira A (2007) Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt gene. Proc Natl Acad Sci U S A 104:15270-15275 Khanna H, Becker D, Kleidon J, Dale J (2004) Centrifugation assisted Agrobacterium tumefaciens-mediated transformation (CAAT) of embryogenic cell suspensions
96
of banana (Musa spp. Cavendish AAA and Lady finger AAB). Mol Breeding 14:239-252 Khanna HK, Paul J-Y, Harding RM, Dickman MB, Dale JL (2007) Inhibition of Agrobacterium-induced cell death by antiapoptotic gene expression leads to very high transformation efficiency of banana. Mol Plant Micro Int 20:1048-1054 Komari T, Hiei Y, Saito Y, Murai N, Kumashiro T (1996) Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J 10:165-174 Kumar S, Pandey KC (2008) Bacillus thuringiensis (Bt) transgenic crop: An environment friendly insect-pest management strategy. J Environ Biol 29:641- 653 Maier-Greiner UH, Obermaier-Skrobranek BM, Estermaier LM, Kammerloher W, Freund C, Wulfing C, Burkert UI, Matern DH, Breuer M, Eulitz M, et al. (1991) Isolation and properties of a nitrile hydratase from the soil fungus Myrothecium verrucaria that is highly specific for the fertilizer cyanamide and cloning of its gene. Proc Natl Acad Sci USA 88:4260-4264 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473-497 Negrotto D, Jolley M, Beer S, Wenck AR, Hansen G (2000) The use of phosphomannose-isomerase as a selectable marker to recover transgenic maize plants (Zea mays L.) via Agrobacterium transformation. Plant Cell Rep 19:798-803 Nelson DE, Repetti PP, Adams TR, Creelman RA, Wu J, Warner DC, Anstrom DC, Bensen RJ, Castiglioni PP, Donnarummo MG, Hinchey BS, Kumimoto RW, Maszle DR, Canales RD, Krolikowski KA, Dotson SB, Gutterson N, Ratcliffe OJ, Heard JE (2007) Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance and lead to improved corn yields on water-limited acres. Proc Natl Acad Sci U S A 104:16450-16455 Nelson RS, Abel PP, Beachy RN (1987) Lesions and virus accumulation in inoculated transgenic tobaco plants expressing the coat protein gene of tobacco mosaic virus. Virology 158:126-132 Nguyen T-V, Thu TT, Claeys M, Angenon G (2007) Agrobacterium-mediated transformation of sorghum (Sorghum bicolor (L.) Moench) using an improved in vitro regeneration system. Plant Cell Tiss Org Cult 91:155-164 Oria MP, Hamaker BR, Axtell JD, Huang C-P (2000) A highly digestible sorghum mutant cultivar exhibits a unique folded structure of endosperm protein bodies. Proc Natl Acad Sci U S A 97:5065-5070 Palanichelvam K, Oger P, Clough SJ, Cha C, Bent AF, Farrand SK (2000) A second T- region of the soybean-supervirulent chrysopine-type Ti plasmid pTiChry5, and
97
construction of a fully disarmed vir helper plasmid. Mol Plant Microbe Inter 13:1081-1091 Paterson AH (2008) Genomics of sorghum. Int J Plant Genomics 2008:6 Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapmann J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Narechania A, Otillar RP, Penning BW, Salamov AA, Wang Y, Zhang L, Carpita NC, Freeling M, Ginggle AR, Hash CT, Keller B, Klein P, Kresovich S, McCann MC, Ming R, Peterson DG, Rahman M, Ware D, Westhoff P, Mayer KFX, Messing J, Rokhsar DS (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457:551-556 Pedersen JF, Marx DB, Funnell DL (2003) Use of A3 cytoplasm to reduce risk of gene flow through sorghum pollen. Crop Sci 43:1506-1509 Pola S, Mani NS, Ramana T (2008) Plant tissue culture studies in Sorghum bicolor: immature embryo explants as the source material. Intern J Plant Prod 2:1-14 Pola SR, Mani NS (2006) Somatic embryogenesis and plantlet regeneration in Sorghum bicolor (L.) Moench, from leaf explants. J Cell Mol Biol 5:99-107 Prins M (2003) Broad virus resistance in transgenic plants. Trends Biotechnol 21:373-375 Reddy BN, Raghavender C (2008) Outbreaks of Fusarial-toxicoses in India. Cereal Res Comm 36 Suppl B:321-325 Reddy KRN, Raghavender CR, Reddy BN, Salleh B (2010) Biological control of
Aspergillus flavus growth and subsequent aflatoxin B1 production in sorghum grains. African J Biotechnol 9:4247-4250 Sahoo L, Schmidt JJ, Pedersen JF, Lee DJ, Lindquist JL (2010) Growth and fitness components of wild X cultivated Sorghum bicolor (Poacheae) hybrids in Nebraska. Amer J Bot 97:1610-1617 Sato S, Clemente T, Dweikat I (2004a) Identification of an elite sorghum genotype with high in vitro performance capacity. In Vitro Cell Dev Biol 40:57-60 Sato S, Xing A, Ye X, Schweiger B, Kinney A, Graef G, Clemente T (2004b) Production of g-linolenic acid and stearidonic acid in seeds of marker-free transgenic soybean. Crop Sci 44:646-652 Sharma HC, Ortiz R (2000) Transgenics, pest management, and the environment. Curr Sci 79:421-437 Shrawat AK, Carroll RT, DePauw M, Taylor GJ, Good AG (2008) Genetic engineering of improved nitrogen use efficiency in rice by the tissue-specific expression of alanine aminotransferase. Plant biotechnology journal 6:722-732 Stark DM, Beachy RN (1989) Protection against potyvirus infection in transgenic plants: Evidence for broad spectrum resistance. Nat Biotechnol 7:1257-1262 Suzuki N, Rizhsky L, Liang H, Shuman J, Shulaev V, Mittler R (2005) Enhanced
98
tolerance to environmental stress in transgenic plants expressing the transcriptional coactivator multiprotein bridging factor 1c1[w]. Plant Physiol 139:1313-1322 Tesso T, Ejeta G, Chandrashekar A, Huang C-P, Tandjung A, Lewamy M, Axtell JD, Hamaker BR (2006) A novel modified endosperm texture in a mutant high- protein digestibility/high-lysine grain sorghum (Sorghum bicolor (L.) Moench). Cereal Chem 83:194-201 Tesso T, Hamaker BR, Ejeta G (2008a) Sorghum protein digestibility is affected by dosage of mutant alleles in endosperm cells. Plant Breeding 127:579-586 Tesso T, Kapran I, Grenier C, Snow AA, Sweeney P, Pedersen JF, Marx DB, Bothma G, Ejeta G (2008b) The potential for crop-to-wild gene flow in sorghum in Ethiopia and Niger: A geographic survey. Crop Sci 48:1425-1431 Thompson CJ, Movva NR, Tizard R, Crameri R, Davies JE, Lauwereys M, Botterman J (1987) Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. EMBO 6:2519-2523 Torres MJ, Tomilov AA, Tomilova N, Reagan RL, Yoder JI (2005) Psroph, a parasitic plant EST database enriched for parasite associated transcripts. BMC Plant Biol 5:24-33 Tuinstra MR, Soumana S, Al-Khatib K, Kapran I, Toure A, van Ast A, Bastiaans L, Ochanda NW, Salami I, Kayentao M, Dembele S (2009) Efficacy of herbicide seed treatments for controlling Striga infestation of sorghum. Crop Sci 49:923-929 Wei H, Moore PH, Albert HH (2003) Comparative expression analysis of two sugarcane polyubiquitin promoters and flanking sequences in transgenic plants. J Plant Physiol 160:1241-1251 Wu Y, Messing J (2010) RNA interference-mediated change in protein body morphology and seed opacity through loss of different zein proteins. Plant Physiol 153:337-347 Xin Z, Wang M-L, Burow G, Burke J (2009) An induced sorghum mutant population suitable for bioenergy research. Bioenerg Res 2:10-16 Xing A, Zhang Z, Sato S, Staswick P, Clemente T (2000) The use of the two T-DNA binary system to derive marker-free transgenic soybeans. In Vitro Cell Dev Biol 36:456-463 Yanagisawa S, Akiyama A, Kisaka H, Uchimiya H, Miwa T (2004) Metabolic engineering with Dof1 transcription factor in plants: Improved nitrogen assimilation and growth under low-nitrogen conditions. Proc Natl Acad Sci U S A 101:7833-7838 Yoder JI, Scholes JD (2010) Host plant resistance to parasitic weeds; recent progress and bottlenecks. Curr Opin Plant Biol 13:478-484 Zhao Z-Y, Glassman K, Sewalt V, Wang N, Miller M, Chang S, Thompson T, Catron S, Wu E, Bidney D, Kedebe Y, Jung R (2003) Nutritionally improved transgenic
99
sorghum. Kluwer Academic Publishers, Dordrecht Zhao Z-Y, Gu W, Cai T, Tagliani LA, Hondred D, Bond D, Krell S, Rudert ML, Bruce WB, Pierce DA (1998) Molecular analysis of T0 plants transformed by Agrobacterium and comparison of Agrobacterium-mediated transformation with bombardment transformation in maize. Maize Genetics Cooperation News Letter 72:1-4 Zhao ZY, Cai T, Tagliani L, Miller M, Wang N, Pang H, Rudert M, Schroeder S, Hondred D, Seltzer J, Pierce D (2000) Agrobacterium-mediated sorghum transformation. Plant Molec Biol 44:789-798
100
Figure 3.1: Overview of sorghum transformation steps
3.1A: Sterilization step of immature seeds, 3.1B: Inoculation step of immature embryos 3.1C: Somatic embryogeneic tissue 3.1D: partitioning of somatic embryogenic tissue to ensure lineage tracking 3.1E&F: Regeneration steps 3.1G: Acclimation of plants 3.1H: Transgenic sorghum in greenhouse
101
Figure 3.2: Southern blot analysis of transgenic sorghum events carrying cyanamide hydratase (cah) gene
3.2A: Primary transformation events designated 164, 165, 166, and 168 probed with cah ORF. + lane indicates 50 pg linear binary vector pPTN181. Tx430 lane is 10 µg of wild type DNA
3.2B: Southern blot analysis of T1 progeny derived from events 164 and 165, highlighting segregating transgenic alleles in event 165, and linked alleles in 164. WT lane indicates 10 µg genomic DNA from Tx430. + lane is 50 pg of linear binary vector pPTN181.
3.2C: Southern blot analysis of T1 progeny derived from events 166 and 168, highlighting segregating transgenic alleles in event 166, and linked locus in 168. WT lane indicates 10 µg genomic DNA from Tx430. + lane is 50 pg of linear binary vector pPTN181
102
Figure 3.3: GUS expression profile observed in transgenic sorghum
3A-3F: Transgenic sorghum event carrying the glob-1-GUS cassette showing embryo specific expression. 3A: stem section, 3B root section, 3C: glume, 3D leaf, 3E root, and 3F seed, endosperm and embryo (blue). 3G-3L: Transgenic sorghum event carrying the ubiquitin-1-GUS cassette showing constitutive GUS expression. 3A: stem section, 3B root section, 3C: glume, 3D leaf, 3E root, and 3F seed, endosperm and embryo.
103
CHAPTER 4
Modulation of kernel storage proteins in grain sorghum (Sorghum bicolor (L.) Moench)
104
Summary
Grain sorghum (Sorghum bicolor (L.) Moench) ranks fifth among the cereals world-wide with respect to its importance for food and feed applications. The grain is approximately 13% protein, of which the kafirins comprise over 80% of the protein component of the grain endosperm. The kafirins are categorized into subgroups α-, β-, and γ. The kafirins are co-translationally translocated to the ER where they are assembled into discrete protein bodies that tend to be poorly digestible with low functionality in baking applications. As a means to address these two issues in sorghum we employed a biotechnology approach that is designed to simultaneously alter the protein body structure, along with synthesis of a co-protein in the endosperm fraction of the grain. To this end, we report here on the molecular and phenotypic characterizations of transgenic sorghum events that are down-regulated in γ- and the 24 kDa α-kafirins, and the expression of a high molecular weight glutenin protein from wheat, and the creation of various gene stacks with the derived transgenic alleles.
105
Introduction
Grain sorghum (Sorghum bicolor (L.) Moench) is a staple food for a large proportion of world population. Grain harvested from sorghum and the millets provides an important source for dietary calories and protein for approximately one billion people in the semi-arid regions of the world (Belton and Taylor, 2004). However, grain sorghum products are known to have relatively poor digestibility, only approximately
46%, in comparison other grains such as wheat and maize, which tend to have digestibility percentages over 80 and 70, respectively (MacLean et al., 1981). Protein with high digestibility is by definition nutritionally superior due to the increased availability of amino acids. Digestibility can be impacted by both protein-protein and/or protein-non-protein interactions (Duodu et al., 2003; Taylor et al., 2007). However, with respect to grain sorghum it is expected that the major factor influencing digestibility is the protein-protein interactions leading to high protein cross-linking around the protein body (Duodu et al., 2003).
Protein content of grain sorghum is approximately 13% (Beta et al., 1995), of which the kafirins comprise over 80% of the protein component of the grain endosperm
(Hamaker et al., 1995). The kafirins are categorized into α-, β- and γ- groupings, with α1 and α2 approximately 24 kDa and 26 kDa, respectively, and β- and γ- having molecular masses of 18.7 kDa and 20 kDa, respectively (Belton et al., 2006). The kafirins are assembled into discrete protein bodies (PB) in the ER, whereby the α-kafirins compose the core and the β- and γ- decorate the periphery of the PB. It is thought that the organizational structure of the PB has a major impact on protein digestibility of sorghum food and feed products (Hicks et al., 2001). As mentioned above, cooking leads to the
106 increased cross-linking of the β- and γ-kafirins that blocks the access to the more digestible α-kafirin core (Hamaker et al., 1994; Oria et al., 1995; Oria et al., 2000). This model is supported by the observation that the addition of reducing agents during cooking improves the in vitro digestibility of sorghum (Hamaker et al., 1987; Arbab and El Tinay,
1997). Moreover, studies evaluating highly digestible sorghum mutants further support the structural role of the PB on this parameter (Weaver et al., 1998). Furthermore in the sorghum mutant with high digestible high lysine (HDHL) phenotype, the PB are highly folded, with reduction of the γ-kafirin about the periphery (Oria et al., 2000).
In addition to digestibility, the bread making properties of sorghum flour are also relatively poor. As with digestibility, functionality is also influenced by protein/protein and protein/non-protein interactions. Therefore, to mirror the viscoelastic properties of wheat dough, it is necessary to functionalize the kafirins in such a fashion to allow them to mimic polymeric structures formed during processing between high molecular glutenins and gliadins. Recently it has been reported that blending of co-proteins, such as casein, with sorghum flour in a baking process can stabilize the β-sheet over time, thereby mirroring the functionality of wheat gluten (de Mesa-Stonestreet et al., 2010).
We describe here the generation and characterization of novel sorghum genotypes in which deliberate perturbation of both γ-kafirin, and the 24 kDa α-kafirin have been achieved, in addition to sorghum grain in which high levels of the wheat high molecular weight glutenin protein is produced.
107
Experimental procedures
Plasmid Constructions
To down-regulate the alpha kafirin, an RNAi approach was used. The alpha kafirin ORF was isolated from the sorghum genotype Tx-430 by RT-PCR on mRNA from immature seed using primers, Kaf-5: ATGGCTACCAAGATATTTGTCCTCCTTGCG and Kaf-3:
AATCTAGAAGATGGCACTTCCAACGATGGG, based on the genbank accession number EU424175. Further a 500bp region from 5’ end of this ORF was amplified and restriction sites were designed at its ends using primers
GTTAACGGGTTGGATGCAAGTAGCTGTTGT to add Hpa1 at 5’ end and
TCTAGAGCCCTTATGGCTACCAAGATATTTGT to add Xba1 at 3’ end. Again the same region was amplified to add different restriction sites at its end using primers
GAGCTCGGGTTGGATGCAAGTAGCTGTTGT to add sst1 at 5’ end and
CTCGAGGCCCTTATGGCTACCAAGATATTTGT to add Xho1 at 3’ end. These amplified fragments were cloned in opposite orientation and put under the control of alpha kafirin promoter. Alpha kafirin promoter was cloned using primers palphaKaf-1:
AGACCTCCCAACCCATGCTCGCCACGTTTG and palphaKaf-2:
TTGGAAGGACGTTGCTAGTTCGTTTCAC to amplify 832bp upstream sequence from translation start site based on gene bank accession number X16104. The gene expression cassette was terminated with 35s terminator. The resultant cassettes were cloned into the binary plasmid pPZP212 (Hajdukiewicz et al., 1994), and designated pPTN1017.
To down-regulate gamma kafirin, a ribozyme mediated RNAi approach was used. To amplify the gamma kafirin promoter, primers were designed as per sequence from gene bank accession number X62480. Primers gKaf2-5:
108
CCGTGTACAACGAAGTGGTGAGTCATGAG and gKaf2-3:
GGTGTCGAGTTCTTGTCTGCTCTTG were used to amplify the 493bp region upstream to translation start site of this gene by PCR on sorghum (Genotype Tx430) genomic DNA. The gamma kafirin ORF was amplified using primers gKaf5:
ATGAAAGGTGTTGCTCGTTGCCCTCGCTC and gKaf3:
TCTTTAATAGTGGACACCACCGGCAAAAGG by RT-PCR on sorghum (Genotype
Tx430) mRNA from immature seed based on gene bank accession number X62480.
Further the gamma kafirin gene was cloned under the control of gamma kafirin promoter and terminated by ribozyme (Buhr et al., 2002). Ribozyme is a self cleaving RNA molecule that cleaves itself and leads to the production of aberrant RNA. Further this
RNA along with the targeting endogenous gene are silenced through RNAi mechanism.
(Buhr et al., 2002; Haseloff et al, 1988). The resultant cassettes were cloned into the binary plasmid pPZP212 (Hajdukiewicz et al., 1994), and designated pPTN915. The binary vector designated pPTN883 was prepared as described by Blechl et al. (1996). The final binary vectors were mobilized into A. tumefaciens strain NTL4 carrying the disarmed Ti plasmid pKPSF2 (Luo et al., 2001) via tri-parental mating. Sorghum transformations were conducted with genotypes Tx430 as previously described (Howe et al., 2006).
Molecular characterization of transgenic sorghum
Total genomic DNA was isolated from sorghum leaves following a modification of the protocol described by Dellaporta et al. (1983). Southern blot analysis of transgenic events was conducted as previously reported (Howe et al., 2006). Membranes were hybridized with either dCT32P labeled HMW-GS ORF or gamma kafirin ORF or the
109 spacer fragment separating the two RNAi arms of the alpha kafirin down-regulation cassette. For RNA gel blot analysis, total RNA was extracted from ground individual seeds (20 days after anthesis) in 1 ml of TRIzol® LS reagent (Invitrogen). RNA sample separation and hybridizations were carried out as previously described (Buhr et al.,
2002). Membranes were hybridized with either dCT32P labeled 2288-bp region of the
HMW-GS ORF or 502-bp fragment from the alpha kafirin ORF or 819-bp fragment from the gamma kafirin ORF.
Seed protein extracts
Individual seeds were ground in liquid nitrogen. Ground tissue was mixed with protein extraction buffer composed of 0.1 M Trizma base, 10 mM EDTA, 0.9 M sucrose,
0.4% (v/v) ß-mercaptotehanol, pH 8.0. The mixture was subsequently extracted for 30 min at 4° C, with slight agitation, in equal volume Tris-saturated phenol. Following the
30 min extraction step, the suspension was centrifuged at 4,350 x g in a Beckman JA-20 rotor for 10 min. The upper phenol phase was collected and precipitated overnight at -
20°C, using 5X volume of 0.1M ammonium acetate in 100% methanol. Precipitated proteins were pelleted at 17,400 x g in a Beckman JA-20 rotor for 10 min. The protein pellet was subsequently washed with 0.1M ammonium acetate in 100% methanol, followed by washings in 80% (v/v) acetone, and finally with 70% (v/v) ethanol. The washed protein pellets were suspended in 8 M urea, 2M thiourea, 2% (w/v) CHAPS, and
2% (v/v) Triton X-100. Protein concentrations were quantified using the Bradford assay.
Two-dimensional gel electrophoresis
A total of 300 µg of protein was loaded onto each 7 cm pH 3.0-10.0 gradient
Ready Strip IPG (Bio-Rad, cat # 163-2000). Following the run in the first dimension, the
110 protein was run in the second dimension using 14% SDS-PAGE and the gel was subsequently stained with Coomaissie G-250. Differential spots observed in transgenic samples as compared to control samples, were picked and analyzed using tandem mass spectrometry.
Microscopy
Immature seeds 12 days after anthesis were sliced transversely into 1–2-mm pieces with a razor blade and fixed in 4% (vol/vol) paraformaldehyde and 1% (vol/vol) glutaraldehyde in 0.05M potassium phosphate buffer (pH 6.8) at 4°C for 16 h. For microstructural analysis, the specimens were stained with 2% osmium tetroxide in 0.05
M potassium phosphate buffer (pH 6.8). After washing with the same buffer, the specimens were dehydrated in a graded ethanol series (15 min each in 10, 30, 50, 70, 90, and 95% aqueous ethanol, and in 100% ethanol). After gradual dehydration in the ethanol series, samples were infiltrated for 2 h each in 20, 40, 60, and 80% LR White resin in ethanol, and then for overnight in 100% LR White resin. The infiltration with 100% LR
White resin continued for 2 more days with several changes of fresh resin. The samples were placed in plastic molds and polymerized for 2 days in an oven at 55°C. Prepared specimens were sectioned with a diamond knife on an ultramicrotome (LKB Ultrotome
III, Stockholm, Sweden). Copper grids coated with formvar membrane and carbon were used. Sections were post stained for 5 min with 2.5% (wt/vol) uranyl acetate and for 3 min with 0.1% (wt/vol) lead citrate and examined with a Hitachi H7500 transmission electron microscope (Hitachi, Tokyo, Japan) at 80 kV at the University of Nebraska-
Lincoln Microscopy Core Facility.
111
Digestibility and amino acid analysis
In vitro pepsin digestibility was carried out on seed derived from a subset of the transgenic sorghum events expressing the HMW-GS. Seed samples were uniformly ground using a Udy mill equipped with a 0.5 mm screen. The in vitro digestibility was ascertained following the procedure described by Mertz et al (Mertz et al, 1984). For amino acid analysis the seed samples were sent to Eurofins, Iowa.
Results
Molecular analysis of transgenics
Binary vector designated pPTN883 harbors gene expression cassette for the expression of high molecular weight glutenin subunits (HMW-GS) under the control of seed specific promoter. Binary vector designated pPTN915 and pPTN1017 contained gene expression cassettes for the down-regulation of gamma (Fig 4.1a) and alpha kafirin
(Fig 4.1b) genes under the control of gamma and alpha gene promoters respectively.
More than ten independent events were obtained with each binary vector. Southern blot analyses were conducted on all the transgenic events to check the integration of the transgene in the host genome (Fig 4.2a, 4.2b, 4.2c). Total genomic DNA was digested with an enzyme for which there is a single recognition site within the T-DNA element to produce a single hybridization signal for each transgenic locus. Although multiple copies per insertion may be present, copy number in each insertion event was not determined.
Genomic DNA hybridization suggested the presence of varying number of inserts in different events. Northern blot analyses were conducted to evaluate the expression of these genes at the mRNA level. The Dx5 promoter from wheat resulted in very high expression of the HMW-GS in the sorghum seed (Fig 4.3a). Furthermore, the expression
112 of the genes at the protein level was evaluated by two dimensional SDS-PAGE (Fig 4.4a,
4.4b, 4.4c). Mass spectrometry was used to confirm the expression of HMW-GS or down-regulation of alpha or gamma kafirin proteins. Lead events showing high expression of HMW-GS and efficient down-regulation of the endogenous alpha or gamma kafirin genes were selected for further assays. The lead events i.e. 127-1-1-1
(pPTN883) is a single insert event while 128-2-1-1 (pPTN883) has three inserts in it (Fig
4.2a). These showed high expression levels of HMW-GS as indicated by Northern analysis (Fig 4.3a) and the two dimensional gels (Fig 4.4a). Events 133-3-1-1 9
(pPTN915), 288-1-1-2 (pPTN1017) and 285-1-2-1 (pPTN1017) have single insert in them (Fig 4.2b, 4.2c) and showed efficient down-regulation of the endogenous genes (Fig
4.3b, 4.3c).
Digestibility assay
Digestibility of the transgenic seeds was evaluated as mentioned in the material and methods section. For HMW-GS, five independent events were used for the evaluation of the digestibility assay and all of them showed an improvement of digestibility of the transgenic flour over the wild type flour (Fig 4.5a). These five independent events were evaluated further using RP-HPLC to determine the relative amount of HMW-GS in these events (Fig 4.5b). A novel peak was observed at 3.8 minute of retention time which is the area where HMW-GS are known to elute using RP-HPLC separations. This peak appeared in all of the five transgenic events and was absent in the wild type seed. The area of this peak indicates the relative amount of HMW-GS in the respective events. A regression analysis showed a strong correlation between the area of the peak and digestibility (Fig 4.5c). Cooked flour from the events expressing HMW-GS
113 and cooked/uncooked flour from events showing down-regulation of gamma kafirin did not show any improvement in flour digestibility.
Amino acid analysis
Amino acid content of various lead events was evaluated. The down-regulation of gamma kafirin protein resulted in decreased amounts of proline, glutamate and leucine
(Fig 4.6). The amino acid content of all other amino acids was largely unchanged. Down- regulation of alpha kafirin protein led to a large increase in the amounts of lysine, arginine and aspartate. In addition a slight decrease in glutamate and leucine content was observed. Expression of HMW-GS in the sorghum seed did not lead to any significant change in the amino acid profile of the transgenic seed.
Microscoscopy assay
Microscopic studies were conducted at the microscopy facility at University of
Nebraska-Lincoln on the developing seed 12 days after anthesis. The protein bodies present in the selected events expressing HMW-GS and showing down-regulation of gamma kafirin protein did not show any significant changes as compared to protein bodies from wild type seed (Fig 4.7a). All the wild type and transgenic seeds showed protein bodies of varying sizes indicating the presence of protein bodies at different stages of development or it could be the result of dissection blade cutting through protein bodies at different positions. Though they were of varying sizes, all of them were surrounded by a smooth surface and has a clear boundary. The clear appearance of ER membranes and other organelles e.g. mitochondria indicates that the sample was well processed. The events showing down-regulation of alpha kafirin showed the presence of distorted protein bodies that were absent in the wild type seed (Fig 4.7b). These protein
114 bodies in the transgenic events were small in size and showed invaginations on the surface going deep into the protein bodies. This indicates that proper expression of alpha kafirin protein was required for the formation of wild type protein bodies while exclusive down-regulation of gamma kafirin was not able to show significant change in the appearance of protein bodies (Fig 4.7c).
Seed phenotype
Seed from all the genotypes were evaluated for any change in their phenotype.
Transgenic events showing the down-regulation of gamma and alpha kafirins showed an opaque phenotype (Fig 4.8a, 4.8b). Seeds from the segregating head were easy to separate on the light box on the basis of opacity. The cut sections of the seed also showed the change in the opaque region. Cut sections of the vitreous seed showed a small opaque region present at the center of the seed while this region was extended well towards the margins of the seed in opaque seeds. While the seed from down-regulation of gamma kafirin did not show any significant change in seed weight, down-regulation of alpha kafirin led to a 22% decrease in seed weight. Seed with the expression of HMW-GS did not show any change in the phenotype.
Discussion
Sorghum is a staple food and is a source of energy and proteins for many people living in developing countries. Despite this importance, sorghum suffers from limitations of low digestibility and poor bread making properties. In an attempt to improve the digestibility, we followed a transgenic approach to down-regulate various endogenous proteins and to express the high molecular weight glutenin subunits (HMW-GS) in sorghum seed. The poor digestibility of sorghum flour is attributed to the presence of
115 cross-linked proteins in the form of protein bodies that persist through most food preparations. Cooking sorghum in the presence of water further reduces the digestibility.
It is proposed that cooking may lead to the formation of polymeric structures that are less susceptible to digestion and also result in reduced accessibility of digestive enzymes to proteins (Hamaker et al., 1987; Oria et al., 1995). It is known that the beta and gamma kafirins have extensive cysteine residues which is 5% in β kafirins and 7% in γ kafirins
(Hamaker and Bugusu, 2003). These result in formation of strong disulfide bonds upon cooking and in reduced accessibility of digestive enzymes to centrally located alpha kafirins. The digestion of protein bodies initiates at the surface where gamma and beta kafirins are present and then proceeds towards the center (Oria et al., 1995). In order to improve the digestibility of the sorghum flour we down-regulated the gamma kafirin protein that is present in abundance on the surface of the protein bodies. This was expected to improve the accessibility of the digestive enzymes to centrally located alpha kafirin proteins. In addition, down-regulation of cysteine rich gamma kafirin proteins was expected to result in reduced polymeric structure formation that is also expected to lead to improved digestibility. Contrary to what was expected, the elimination of gamma kafirin did not lead to improved digestibility of sorghum flour. Expression of HMW-GS in the sorghum seed did result in improvement of digestibility of uncooked sorghum flour
(Fig 4.5a, 4.5c). We speculated that change in the interaction between various components of the seed could be the reason of this improvement. When the flour containing the endogenously expressed HMW-GS was cooked, it did not show any change in digestibility as compared to wild type flour. We speculated that upon cooking, gelatinization of the starch could have formed a strong network. This could have
116 prevented various protein interactions to take place in the flour and prevented any improvement in the digestibility. Earlier studies conducted by Duodu et al. (2002) have shown that treatment of cooked sorghum with alpha–amylase leads to improved digestibility of proteins. This indicates that not only the protein structure, but also the interactions of protein with sorghum starch could determine the digestibility of sorghum proteins.
The evaluation of amino acid content of the transgenic seed with down-regulation of the gamma kafirin gene showed that there was a decrease in the amount of proline, glutamate and leucine amino acids (Fig 4.6). Gamma kafirin protein has the highest amount of proline and leucine and hence down-regulation of this protein is expected to result in the decreased amount of these amino acids. Reduction in the amount of glutamate could have resulted from the non-specific silencing of some other glutamate rich protein. Down-regulation of alpha kafirin protein led to large increase in the amount of lysine, arginine and aspartate (Fig 4.6). Similar observation is known to result in maize with the down-regulation of zein proteins. o2 is a transcription factor that controls the expression of zein genes (Schmidt et al., 1992). A mutation in this gene results in the decreased synthesis of zein proteins. This nearly doubles the lysine content of the corn seed (Mertz et al., 1964). Reduction in zein synthesis led to increased accumulation of various other non zein proteins that have higher lysine content (Habben et al., 1993) that resulted in the improved nutritional quality of the corn. Further Huang et al. (2006) transgenically silenced the 19- and 22-kD zein proteins using RNAi approach which led to increased expression of other proteins that maintained the total protein content while changing the amino acid composition of the seeds. In our down-regulated alpha kafirin
117 mutants, although there was an increase in the amount of lysine, arginine and aspartate amino acids, the seed weight was reduced. Transgenic seeds showed about 22% reduction in the seed weight. Like other major cereals, sorghum seed contain low amounts of essential amino acids such as lysine, tryptophan and threonine (Badi et al., 1990). An increase in the amount of the essential amino acid lysine in the transgenic sorghum would have a great significance as sorghum is a protein source for a large population worldwide.
Improvement in the nutritional components of the seed would help to meet the nutritional needs of these people. While down-regulation of endogenous kafirin proteins showed a change in the amino acid profile of the seed, expression of HMW-GS in the sorghum seed did not lead to any significant change in the amino acid profile of the transgenic seed (Fig 4.6).
The seeds showing down-regulation of alpha and gamma kafirin proteins showed an opaque phenotype. This opaque phenotype is known to be associated with maize mutants with down-regulated zein proteins (Hunter et al., 2002). Although the exact mechanism for the opaque phenotype is not known, disturbance of correct arrangement of proteins and other components of the seed are hypothesized to be the reasons for the appearance of the opaque phenotype (Wu et al., 2010).
Sorghum proteins are present in the seed in the form of protein bodies that have very organized structures. The alpha kafirin is present at the center and is surrounded by beta and gamma kafirin proteins. It is expected that all these proteins are required for the proper assembly of the protein bodies and elimination of any one fraction of these could lead to change in the structure of the protein bodies. To evaluate the effect of down- regulation of specific protein fraction on the formation of protein bodies, microscopy
118 studies were conducted. In the mutants showing the down-regulation of gamma kafirin
(Fig 4.7c) or expression of high-molecular weight glutenin subunit (Fig 4.7a), no specific difference was observed in the protein bodies of transgenic and wild type events.
Immunolocalization studies on these mutants are needed to determine any changes in the distribution of the endogenous proteins. The down-regulated alpha kafirin protein mutants (Fig 4.7b) showed the presence of distorted protein bodies. These protein bodies have deep invaginations on the surface and were smaller in size as compared to the wild type protein bodies. These protein bodies are similar to mutant protein bodies reported earlier by Oria et al. (2000). They reported that the kafirins were redistributed in the mutant protein bodies. Gamma kafirins were found to be present on the base of the lobes and alpha kafirin was more exposed to the outside. We speculated that similar observation in our studies could be the result of redistribution of various kafirin proteins in the protein bodies. In other study conducted in maize, Wu et al. (2010) down-regulated different zein proteins and analyzed the changes in the protein body structure. They found that when alpha zein is down-regulated, it leads to the formation of small bulges at the surface of the protein bodies. However in our studies shrinken protein bodies with invaginations of various degrees were seen as a result of the down-regulation of alpha kafirin proteins. These observations indicate that although alpha kafirin is present in the center of the protein bodies, it is very important component of the protein bodies for their proper assembly.
The down-regulation of alpha kafirin in the sorghum seed, showed a simultaneous increased expression of various other proteins as shown by the two dimensional SDS-
PAGE gels (Fig 4.4c). In silico analysis of the possible function of these proteins was
119 performed. Spot numbers 21 and 22 gave the highest scoring hit for S-like RNAse (Table
1). It has been reported that the increase in the amount of this protein is associated with leaf senescence (Lers et al., 1998), phosphate starvation (Dodds et al., 1996) and pathogen infection (Wilson, 1975). Hence these S-like RNAse are expected to be associated with phosphate remobilization, plant defense and mRNA decay (Green, 1994).
RNA is a rich source of organic phosphate. Hence increasing the rate of turnover of this molecule could increase the availability of Pi in the plant (Dodds et al., 1996). In our study we down-regulated the alpha kafirin in the seed using RNAi technique. As RNAi leads to breakdown of dsRNA into 21-23 bp fragments, we speculated that the increase in the amount of S-like RNAse could be the result of accumulation of these small RNA fragments and is required for their turnover. Hence while these small RNAs would be eliminated, the remobilized phosphate could be used for other cellular purposes.
The second high-scoring hit for spot number 21 is 2-cys peroxiredoxin. It catalyzes the conversion of hydroperoxides to their corresponding alcohols (Baier et al.,
1999). Hence it protects DNA and other organelle from oxidative damage (Dietz et al.,
2006). Its increased expression in our study indicates a probable increase in the production of reactive oxygen species in the seed. Hence its role could be to protect macromolecules present in seed at various stages of development. Peroxiredoxins are also known to be activated upon pathogen infection (Dietz et al., 2006). The highest scoring hit for spot numbers 23 and 24 showed sequence homology to PCC 13-62. This protein is induced upon dehydration and salt stress in Craterostigma plantagineum (Bernacchia et al., 1996; Smith-Espinoza et al., 2003). Similarly spot number 25 gave highest scoring hit for isoflavone reductase like protein. This protein is known to be induced in response to
120
UV light, wounding and pathogen infection (Lers et al., 1998). Although in this study, no stress was applied to the plants, the accumulation of these proteins indicated that plant is sensing some kind of stress. Spot number 26 gave the highest scoring hit for Glyoxalase
1. This gene is known to be up-regulated by salt stress (Espartero et al., 1995, Veena et al., 1999). Transgenic tobacco plants with increased expression of this gene led to improved salt tolerance (Singla-Pareek et al., 2003). As alpha kafirin is a major fraction of the storage proteins in the sorghum seed, its down-regulation would result in major change in the metabolism in the seed that could result in stressful conditions and activation of stress related proteins.
The highest scoring hit for spot numbers 27, 28, 29 and 30 was identified to be xylanase inhibitor protein (XIP). Fungal and bacterial pathogens produce cell wall degrading enzymes in order to enter the host cells. The inhibitory activity of XIP against such enzymes protects the grain from pathogen attack (Bellincampi et al., 2004). Hence increased expression of this protein indicates its role in defense mechanism. This hypothesis is further supported by the fact that XIP in wheat does not inhibit endogenous xylanase activity but inhibits activity of xylanases from fungal sources (Juge et al., 2004).
The events obtained in this study are being crossed in all possible combinations to obtain double and triple cross events. Seed will be carried to homozygosity and will be evaluated for baking applications. Improvement in the digestibility and functionally of the sorghum flour should lead to its improved usages in various food applications. This will not only have bearing on the nutritional utility of this crop but will also have significant effect on the economic growth of the countries where sorghum is the primary grown crop.
121
References:
Altpeter F, Popelka J C and Wieser H (2004) Stable expression of 1Dx5 and 1Dy10 high molecular weight glutenin subunit genes in transgenic rye drastically increases the polymeric glutelin fraction in rye flour. Plant Mol. Biol. 54 : 783-792
Arbab ME and El Tinay AH (1997) Effect of cooking and treatment with sodium bissulpite or ascorbic acid on the in vitro protein digestibility of two sorghum cultivars. Food Chem. 59: 339-343
Badi S, Pedersen B, Monowar L and Eggum B O (1990) The nutritive value of new and traditional sorghum and millet foods from Sudan. Plant Foods Hum. Nutr. 40 : 5-19
Baier M and Dietz K J (1999) Protective function of chloroplast 2-cysteine peroxiredoxin in photosynthesis. Evidence from transgenic Arabidopsis. Plant Physiol. 119 : 1407-1414
Bellincampi D, Camardella L, Delcour J A, Desseaux V, D’Ovidio R, Durand A, Elliot G, Gebruers K, Giovane A, Juge N, Sorensen J F, Svensson B and Vairo D (2004) Potential physiological role of plant glycosidase inhibitors. Biochim. Biophys. Acta 265- 274
Belton PS, Delgadillo I, Halford NG and Shewry PR (2006) Kafirin structure and functionality. J Cereal Sci. 44: 272-286
Belton PS and Taylor JRN (2004) Sorghum and millets: protein sources for Africa. Trends Food Sci. Technol. 15: 94-98
Bernacchia G, Salamini F and Bartels D (1996) Molecular characterization of the rehydration process in the resurrection plant Craterostigma plantagineum. Plant Physiol. 111 : 1043-1050
Beta T, Rooney LW and Waniska RD (1995) Malting characteristics of sorghum cultivars. Cereal Chem. 72: 533-538
Blechl A E and Anderson O D (1996) Expression of a novel high-molecular-weight glutenin subunit gene in transgenic wheat. Nature Biotech. 14 : 875-879
Buhr T, Sato S, Ebrahim F, Xing A, Zhou Y, Mathiesen M, Schweiger B, Kinney A, Staswick P and Clemente T (2002) Ribozyme terminationof RNA transcripts down- regulate seed fatty acid genes in transgenic soybean. Plant J. 30 : 155-1
Bugusu B A, Campanella O and Hamaker B R (2001) Improvement of sorghum-wheat composite dough rheological properties and breadmaking quality through zein addition. Cereal Chem. 78 : 31-35
122
Chanapamokkhot H and Thongngam M (2007) The chemical and physicochemical properties of sorghum starch and flour. Nat. Sci. 41: 343-349
Chandrashekar A and Mazhar H (1999) The biochemical basis and implications of grain strength in sorghum and maize. J. Cereal Sci. 30: 193-207.
Dahlin K and Lorenz K (1993) Protein digestibility of extruded cereal grains. Food Chem. 48: 13-18.
Dellaporta S L, Wood J and Hicks J B (1983) A plant DNA minipreparation: Version II. Plant Mol. Biol. Reptr. 1:19-21. de Mesa-Stonestreet N J, Alavi S and Bean S R (2010) Sorghum proteins: The concentration, isolation, modification, and food applications of kafirins. J. Food Sci. 75: 90-104
Dietz K J, Jacob S, Oelze M L, Laxa M, Tognetti V, Marina S, Miranda N, Baier M and Finkemeier I (2006) The function of peroxiredoxins in plant organelle redox metabolism. Journal of Experimental Botany 57 : 1697-1709.
Dodds P N, Clarke A E and Newbigin E (1996) Molecular characterization of an S-like RNAse of Nicotiana alata that is induced by phosphate starvation. Plant Mol. Biol. 31 : 227-238
Duodu K G, Nunes A, Delgadillo I, Parker M L, Mills E N C, Belton P S and Taylor J R N (2002) Effect of grain organizational structure and cooking on sorghum and maize in vitro protein digestibility. J. Cereal Sci. 35: 161-174
Duodu K G, Tang H, Grant A, Wellner N, Belton P S and Taylor J R N (2001) FTIR and 13C spectroscopy of proteins of wet cooked and popped sorghum and maize. J. Cereal Sci. 33: 261-269.
Duodu K G, Taylor J R N, Belton P S and Hamaker B R (2003) Factors affecting sorghum protein digestibility. J. Cereal Sci. 38 : 117-131.
Espartero J, Aguayo I S and Pardo J M (1995) Molecular characterization of glyoxalase-I from a higher plant upregulation by stress. Plant Mol. Biol. 29 : 1223-1233
Green P J (1994) The ribonucleases of higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45 : 421-45
Habben J E, Kirlies A W and Larkins B A (1993) The origin of lysine containing proteins in opaque2 maize endosperm. Plant Mol. Biol. 23 : 825-838
123
Hajdukiewicz P, Svab Z and Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25:989-994.
Hamaker B R and Bugusu B A (2003) Overview: Sorghum proteins and food quality. In the proceedings the workshop “Workshop on the proteins of sorghum and millets: Enhancing nutritional and functional properties for africs” Eds. Belton P S, Taylor J R N. Paper no. 8
Hamaker B R, Kirleis A W, Butler L G, Axtell J D and Mertz E T (1987) Improving the in vitro protein digestibility of sorghum with reducing agents. Proc. Natl. Acad. Sci. 84 : 626-628
Hamaker B R, Mertz E T and Axtell J D (1994) Effect of extrusion on sorghum kafirin solubility. Cereal Chem. 71: 515-517
Hamaker B R, Mohamed A A, Habben J E, Huang C P and Larkins B A (1995) Efficient procedure for extracting maize and sorghum kernel proteins reveals higher prolamine contents than the conventional methods. Cereal Chem. 72: 583-588.
Haseloff J and Gerlach W L (1988) Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334 : 585-591
Hicks C, Bean SR, Lookhart GL, Pedersen JF, Kofoid KD and Tuinstra MR (2001) Genetic analysis of kafirins and their phenotypic correlations with feed quality traits, in vitro digestibility and seed weight in grain sorghum. Cereal Chem. 78: 412-416
Howe A, Sato S, Dweikat I, Fromm M and Clemente T (2006) Rapid and reproducible Agrobacterium-mediated transformation of sorghum. Plant Cell Rep. 25:784-791.
Huang S, Frizzi A, Florida C A, Kruger D E and Luethy M H (2006) High lysine and high tryptophan transgenic maize resulting from the reduction of both 19- and 22-kD zeins. Plant Mol. Biol. 61 : 525-535
Hunter B G, Beatty M K, Singletary G W, Hamaker B R, Dilkes B P, Larkins B A and Jung R (2002) Maize opaque endosperm mutations create extensive changes in patterns of gene expression. Plant Cell 14 (10) : 2591-2612
Ioerger B, Bean S R, Tunistra M R, Pedersen J F, Erpelding J, Lee K M and Herrman T J (2007) Characterization of polymeric proteins from vitreous and floury sorghum endosperm. J. Agric Food Chem. 55: 10232-10239.
Juge N, Payan F and Williamson G (2004) XIP-I, a xylanase inhibitor protein from wheat: a novel protein function. Biochim. Biophys. Acta 203-211
124
Lers A, Burd S, Lomaniec E, Droby S and Chalutz E (1998) The expression of a grapefruit gene encoding an isoflavone reductase like protein is induced in response to UV irradiation. Plant Mol. Biol. 36 : 847-856
Lers A, Khalchitski A, Lomaniec E, Burd S and Green P J (1998) Senescence induced RNAse in tomato. Plant Mol. Biol.. 36 : 439-449.
Luo Z-Q, Clemente T and Farrand SK (2001) Construction of a derivative of Agrobacterium tumefaciens C58 that does not mutate to tetracycline resistance. Mol. Plant Micro. Int. 14:98-103.
MacLean W C, Lopez de Romana G, Placko R P and Graham G G (1981) Protein quality and digestibility of sorghum in preschool children: Balance studies and plasma free amino acids. J. Nutr. 111: 1928-1036.
Mazhar H, Chandrashekar A and Shetty H S (1993) Isolation and immunochemical characterization of the alcohol extractable proteins (kafirins) of sorghum bicolor (L.) Moench. J. Cereal Sci. 17: 83-93.
Mejia C D, Mauer L J and Hamaker B R (2007) Similarities and differences in secondary structure of viscoelastic polymers of maize α-zein and wheat gluten proteins. J. Cereal Sci. 45 : 353-359
Mertz E T, Bates L S and Nelson O E (1964) Mutant gene that changes protein composition and increases lysine content of maize endosperm. Science 145 : 279
Mertz E T, Hassen N M, Cairns-Whittern C, Kirleis A W, Tu L and Axtell J D (1984) Pepsin digestibility of proteins in sorghum and other major cereals. Proc. Natl. Acad. Sci. 81 : 1-2
Oria M P, Hamaker B R, Axtell J D and Huang C P (2000) A highly digestible sorghum mutant cultivar exhibits a unique folded structure of endosperm protein bodies. Proc. Natl. Acad. Sci. 97 : 5065-5070
Oria M P, Hamaker B R and Shull J M (1995) Resistance of sorghum α-, β- and γ- kafirins to pepsin digestion. J. Agric. Food Chem. 43 : 2148-2153
Parker M L, Grant A, Rigby N M, Belton P S and Taylor J R N (1999) Effect of popping on the endosperm cell walls of sorghum and maize. J. Cereal Sci. 30: 209-216.
Rom D L, Shull J M, Chandrashekar A and Kirleis A W (1992) Effects of cooking and treatment with sodium bisulfate on in vitro protein digestibility and microstructure of sorghum flour. Cereal Chem. 69: 178-181
125
Schmidt R J, Ketudat M, Aukerman M J and Hoschek G (1992) Opaque-2 is a transcription activator that recognizes a specific target site in 22-kD zein genes. Plant Cell 4 : 689-700
Shull J M, Watterson J J and Kirleis A W (1991) Proposed nomenclature for the alcohol- soluble protein (kafirins) of sorghum bicolor (L. Moench) based on molecular weight, solubility and structure. J. Agric. Food Chem. 39: 83-87.
Singla-Pareek S L, Reddy M K and Sopory S K (2003) Genetic engineering of the glyoxalase pathway in tobacco leads to enhanced salinity tolerance. Proc. Natl. Acad. Sci. 100 : 14672-14677
Smith-Espinoza C J, Richter A, Salamini F and Bartels D (2003) Dissecting the response to dehydration and salt (NaCl) in the resurrection plant Craterostigma plantagineum. Plant Cell and Environment 26 : 1307-1315
Taylor J, Bean S R, Ioerger B P and Taylor J R N (2007) Preferential binding of sorghum tannins with gamma-kafirin and the influnece of tannin binding on kafirin digestibility and biodegradation. J Cereal Sci. 46: 22-31
Veena, Reddy V S and Sopory S K (1999) Glyoxalase I from Brassica juncea: molecular cloning, regulation and its over expression confer tolerance in transgenic tobacco under stress. Plant J. 17 : 385-395
Weaver C A, Hamaker B R and Axtell J D(1998) Discovery of grain sorghum germplasm with high uncooked and cooked in vitro digestibility. Cereal Chem. 75: 665-670
Wilson C M (1975) Plant nucleases. Annu. Rev. Plant Physiol. 26 : 187-208
Wu Y and Messing J (2010) RNA interference mediated change in protein body morphology and seed opacity through loss of different zein proteins. Plant Physiol. 153 : 337-347
126
Figure 4.1a: Binary plasmid carrying gene cassette for the down-regulation of gamma kafirin gene under the control of gamma kafirin promoter and is terminated by ribozyme. The construct also consists of nptII gene cassette as a selectable marker.
Figure 4.1b: Binary plasmid carrying gene cassette for the down-regulation of alpha kafirin gene under the control of alpha kafirin promoter and is terminated by 35S terminator. The construct also consists of nptII gene cassette as a selectable marker.
127
Figure 4.2a: Southern blot analysis of sorghum (Tx-430) events with HMW-GS gene. Lane 1-2, transgenic events; Lane3, negative control (Tx-430); Lane 4 is a positive control (pPTN883).
Figure 4.2b: Southern blot analysis of sorghum (Tx-430) events with gamma kafirin down-regulation. Lane 1-3, transgenic events; lane 4, negative control (Tx-430); lane 5 is a positive control (pPTN908).
128
Figure 4.2c: Southern blot analysis of sorghum (Tx-430) events with alpha kafirin down- regulation. Lane 1-3, transgenic events; lane 4, negative control (Tx-430); lane 5 is a positive control (pPTN-1017).
Figure 4.3a: Northern blot analysis of sorghum (Tx-430) events with high molecular weight glutenin subunits. Lane 1-12, transgenic events; lane 13 is a negative control (Tx- 430).
129
Figure 4.3b: Northern blot analysis of sorghum (Tx-430) events with gamma kafirin down-regulation. Lane 2-8, transgenic event; lane 1,9,10 is a negative control (Tx-430).
Figure 4.3c: Northern blot analysis of sorghum (Tx-430) events with alpha kafirin down- regulation. Lanes 1-8, 12-19, transgenic events; lanes 9-11 are negative control (Tx-430).
130
Figure 4.4a: Two dimensional gel analysis of transgenic event with high molecular weight glutenin subunits (left panel) and control event Tx-430 (right).
Figure 4.4b: Two dimensional gel analysis of control event Tx-430 (left panel) and transgenic event with gamma kafirin down-regulation (right).
Figure 4.4c: Two dimensional gel analysis of control event Tx-430 (left panel) and transgenic event with Alpha kafirin down-regulation (right).
131
Figure 4.5a: Pepsin digestibility of transgenic sorghum events expressing a hybrid HMW-GS
Figure 4.5b: RP-HPLC chromatogram of transgenic events (High molecular weight glutenin subunits) and control (Tx-430). A novel peak at 3.8 min (arrow) determined to be HMW-GS.
132
Figure 4.5c: Regression line between amount of HMW-GS and digestibility
Figure 4.6: Amino acid profile of different transgenic events and wild type sorghum seed.
133
Figure 4.7a: Microscopic pictures at 15X magnification. Top panels are of Tx-430 and lower panels are of transgenic events expressing HMW-GS
Figure 4.7b: Microscopic pictures at 30X magnification. Top panels are of Tx-430 and lower panels are of transgenic events with down-regulation of alpha kafirin gene
134
Figure 4.7c: Microscopic pictures at 15X magnification; Top panels are of Tx-430 and lower panels are of transgenic events with down-regulation of gamma kafirin gene
Figure 4.8a: Opaque phenotype observed in transgenic events with down-regulaiton of gamma kafirin gene (left) Vs. wild type seed (right). Top panel: Cut sections of the seed; Lower panel: whole seed.
135
Figure 4.8b: Opaque phenotype observed in transgenic events with down-regulaiton of alpha kafirin gene (left) Vs. wild type seed (right).
136
Table 4.1: The upregulated proteins as the result of down-regulation of alpha kafirin protein (Corresponding Fig-4c) Gel-Spot Protein ID and function Molecular Isoelectric Percentage Score Number Weight point Coverage
21 gi242081561 25112 5.32 72 722 Homologous to S-like RNAse gi195626524 28302 5.81 27 394 2-Cysteine peroxiredoxins 22 gi242081561 25112 5.32 65 762 Homologous to S-like RNAse 23 gi242075650 34492 5.06 37 619 Homologous to dessication related protein PCC 13-62 24 gi242075650 34492 5.06 32 535 Homologous to dessication related protein PCC 13-62 25 gi242052385 33034 5.38 66 1197 Homologous to Isoflavone reductase IRL 26 gi1808684 32151 5.73 24 404 Homologous to Glyoxalase 1 27 gi242047612 33854 6.59 56 785 Homologous to Xylanase inhibitor protein 28 gi242047612 33854 6.59 53 724 Homologous to Xylanase inhibitor protein 29 gi242047612 33854 6.59 38 491 Homologous to Xylanase inhibitor protein 30 gi242047612 33854 6.59 63 794 Homologous to Xylanase inhibitor protein