DOCSLIB.ORG

Mouse Sla2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Sla2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Sla2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Sla2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Sla2 gene (NCBI Reference Sequence: NM_029983 ; Ensembl: ENSMUSG00000027636 ) is located on Mouse chromosome 2. 8 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 8 (Transcript: ENSMUST00000029164). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Sla2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-138M2 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit normal B and T cells. Exon 5 starts from about 35.52% of the coding region. The knockout of Exon 5 will result in frameshift of the gene. The size of intron 4 for 5'-loxP site insertion: 634 bp, and the size of intron 5 for 3'-loxP site insertion: 2732 bp. The size of effective cKO region: ~604 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 3 4 5 8 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Sla2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7104bp) | A(25.0% 1776) | C(27.11% 1926) | T(21.97% 1561) | G(25.91% 1841) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 156879058 156882057 3000 browser details YourSeq 289 818 1176 3000 92.4% chr17 + 79878313 79878657 345 browser details YourSeq 278 837 1179 3000 95.2% chr12 + 102036031 102036454 424 browser details YourSeq 272 818 1180 3000 96.7% chr4 + 103271037 103271817 781 browser details YourSeq 262 818 1179 3000 93.2% chr1 + 139345340 139345696 357 browser details YourSeq 258 840 1180 3000 96.2% chr1 + 176945645 177040648 95004 browser details YourSeq 254 843 1180 3000 95.2% chr1 + 24331411 24331764 354 browser details YourSeq 253 834 1180 3000 96.1% chr12 + 82163621 82163982 362 browser details YourSeq 253 854 1181 3000 95.8% chr11 + 4979650 4980054 405 browser details YourSeq 252 842 1180 3000 95.5% chr9 + 101580095 101580587 493 browser details YourSeq 252 818 1166 3000 94.1% chr12 + 102036078 102036488 411 browser details YourSeq 250 819 1172 3000 95.5% chr10 + 81010549 81010997 449 browser details YourSeq 243 820 1180 3000 89.7% chr6 + 87332104 87332448 345 browser details YourSeq 232 866 1180 3000 95.4% chr1 - 55097380 55097786 407 browser details YourSeq 230 838 1180 3000 94.0% chr14 + 116603192 116603553 362 browser details YourSeq 225 842 1180 3000 95.3% chr19 - 9996420 9996767 348 browser details YourSeq 222 817 1178 3000 95.3% chr1 - 55610304 55610791 488 browser details YourSeq 217 818 1180 3000 89.1% chr1 + 24331451 24331718 268 browser details YourSeq 216 916 1180 3000 97.1% chr1 - 9635418 9635852 435 browser details YourSeq 215 904 1178 3000 94.7% chr4 + 103270948 103271335 388 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 156875454 156878453 3000 browser details YourSeq 256 771 1407 3000 96.4% chr2 + 156877047 156877683 637 browser details YourSeq 42 784 901 3000 81.1% chr7 - 109061660 109061775 116 browser details YourSeq 42 983 1040 3000 89.4% chr2 - 141210765 141210821 57 browser details YourSeq 39 966 1046 3000 95.4% chr10 - 61684238 61684341 104 browser details YourSeq 37 979 1025 3000 90.3% chr9 + 48493834 48493879 46 browser details YourSeq 35 980 1046 3000 76.2% chr17 + 74309045 74309111 67 browser details YourSeq 33 1286 1369 3000 88.4% chr5 - 51851763 51851853 91 browser details YourSeq 32 1112 1162 3000 94.5% chr10 + 68054653 68054703 51 browser details YourSeq 30 966 1002 3000 96.9% chr2 - 86623834 86623871 38 browser details YourSeq 30 868 901 3000 94.2% chr9 + 25551175 25551208 34 browser details YourSeq 30 1117 1147 3000 100.0% chr17 + 12377195 12377226 32 browser details YourSeq 29 966 1002 3000 96.8% chr15 - 101106024 101106061 38 browser details YourSeq 28 1137 1170 3000 90.0% chr5 - 34193749 34193781 33 browser details YourSeq 28 1015 1055 3000 85.4% chr1 - 55130206 55130256 51 browser details YourSeq 28 1286 1322 3000 89.2% chr7 + 96000796 96000833 38 browser details YourSeq 28 864 901 3000 86.9% chr5 + 133924900 133924937 38 browser details YourSeq 25 1115 1145 3000 96.3% chr8 - 94743550 94743581 32 browser details YourSeq 25 1555 1582 3000 84.7% chr3 + 6120466 6120491 26 browser details YourSeq 24 1116 1147 3000 96.2% chr17 + 12759661 12759693 33 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Sla2 Src-like-adaptor 2 [ Mus musculus (house mouse) ] Gene ID: 77799, updated on 24-Oct-2019 Gene summary Official Symbol Sla2 provided by MGI Official Full Name Src-like-adaptor 2 provided by MGI Primary source MGI:MGI:1925049 See related Ensembl:ENSMUSG00000027636 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as SLAP2; SLAP-2; AI430952; A930009E21Rik Expression Ubiquitous expression in thymus adult (RPKM 36.8), placenta adult (RPKM 10.3) and 27 other tissues See more Orthologs human all Genomic context Location: 2; 2 H1 See Sla2 in Genome Data Viewer Exon count: 8 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (156874151..156887250, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (156698658..156712814, complement) Chromosome 2 - NC_000068.7 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 2 transcripts Gene: Sla2 ENSMUSG00000027636 Description Src-like-adaptor 2 [Source:MGI Symbol;Acc:MGI:1925049] Gene Synonyms A930009E21Rik, SLAP-2, SLAP2 Location Chromosome 2: 156,872,457-156,887,192 reverse strand. GRCm38:CM000995.2 About this gene This gene has 2 transcripts (splice variants), 186 orthologues, 8 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Sla2-201 ENSMUST00000029164.8 2973 259aa ENSMUSP00000029164.2 Protein coding CCDS38302 Q8R4L0 TSL:1 GENCODE basic APPRIS P1 Sla2-202 ENSMUST00000109561.3 2634 259aa ENSMUSP00000105189.3 Protein coding CCDS38302 Q8R4L0 TSL:1 GENCODE basic APPRIS P1 34.74 kb Forward strand 156.87Mb 156.88Mb 156.89Mb Genes Rab5if-201 >protein coding Gm14248-201 >processed pseudogene (Comprehensive set... Rab5if-203 >lncRNA Rab5if-204 >retained intron Rab5if-202 >lncRNA Contigs AL935150.10 > Genes (Comprehensive set... < 5430405H02Rik-203lncRNA < Sla2-201protein coding < Gm14278-201unprocessed pseudogene < 5430405H02Rik-202lncRNA < Sla2-202protein coding < Gm14247-201processed pseudogene < 5430405H02Rik-201lncRNA Regulatory Build 156.87Mb 156.88Mb 156.89Mb Reverse strand 34.74 kb Regulation Legend CTCF Enhancer Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene pseudogene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000029164 < Sla2-201protein coding Reverse strand 14.62 kb ENSMUSP00000029... MobiDB lite Low complexity (Seg) Superfamily SH3-like domain superfamily SH2 domain superfamily SMART SH3 domain SH2 domain Prints SH2 domain Pfam SH3 domain SH2 domain PROSITE profiles SH3 domain SH2 domain PANTHER Src-like-adapter 2 PTHR10155 Gene3D 2.30.30.40 SH2 domain superfamily CDD SLAP, SH2 domain All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend inframe insertion missense variant splice region variant synonymous variant Scale bar 0 40 80 120 160 200 259 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Sla2 (NM 029983) Mouse Untagged Clone – MC201875 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201875 Sla2 (NM_029983) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Sla2 (NM_029983) Mouse Untagged Clone Tag: Tag Free Symbol: Sla2 Synonyms: A930009E21Rik; AI430952; SLAP-2; SLAP2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC052655 sequence for NM_029983 AAGAGGTAATCCGGCCACGCTCTTTGTCCCTGCTGTGCTGGGTGGGAGGGCCCAACCTGGTTTCTCTGAG AAGCAAAGGACTGCTGTACTAGTTTCGTGGAGATTGTCTGCTGACAAAGAAGCTTGATCACAGTACCTCA GCCTACTCTGACTCCTTTCTGGTGACCGATCCTCCAGGCTGCTGGGGCCTGAGATGCCGACTACCTTAGG ACCTGCAAAGGCCTGACCTGTCGGGTCAGTGTGCACATTGGCTGACTACCCTCATCAAACGTCTGATGGC AAACCTTTCCCTTTCCAGGTTCAGTGTGCTTGTGAGCGTCTGCTGAGTGATGGGAAGTTTGTCCAGCAGA GGGAAAACCTCCAGCCCCAGCCCCAGCTCCTCTGGTCCAGACCAGGAACCCGTGTCCATGCAACCAGAAA GACGCAAGGTCACAGCTGTGGCCCTGGGCAGTTTCCCAGCAGGTGAACAGGCCAGACTATCTCTGAGACT CGGGGAGCCGCTGACCATCATCTCTGAGGATGGAGATTGGTGGACAGTCCAGTCGGAAGTCTCAGGCAGA GAGTACCACATGCCCAGTGTGTATGTGGCTAAAGTCGCCCACGGGTGGCTGTACGAGGGCCTGAGCCGGG AGAAAGCCGAGGAACTACTCCTGTTACCTGGGAACCCCGGAGGGGCCTTCCTCATCCGGGAGAGCCAGAC CAGGAGAGGCTGCTATTCCCTGTCCGTCCGACTCAGCCGCCCTGCATCTTGGGACCGGATCAGACACTAC AGGATACAGCGTCTTGACAATGGCTGGCTGTACATCTCACCTCGCCTCACCTTCCCCTCACTCCACGCCT TGGTGGAGCATTACTCTGAGCTAGCAGATGGCATCTGCTGTCCCCTCAGGGAGCCGTGTGTCCTGCAGAA GCTTGGGCCACTACCTGGCAAAGATACACCTCCACCTGTGACTGTGCCAACATCATCACTAAATTGGAAA
    [Show full text]
  • A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes
    A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes Deanna Petrochilos A dissertation presented in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2013 Reading Committee: Neil Abernethy, Chair John Gennari, Ali Shojaie Program Authorized to Offer Degree: Biomedical Informatics and Health Education UMI Number: 3588836 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMI 3588836 Published by ProQuest LLC (2013). Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, MI 48106 - 1346 ©Copyright 2013 Deanna Petrochilos University of Washington Abstract Using Graph-Based Methods to Integrate and Analyze Cancer Genomic Data Deanna Petrochilos Chair of the Supervisory Committee: Assistant Professor Neil Abernethy Biomedical Informatics and Health Education Studies of the genetic basis of complex disease present statistical and methodological challenges in the discovery of reliable and high-confidence genes that reveal biological phenomena underlying the etiology of disease or gene signatures prognostic of disease outcomes. This dissertation examines the capacity of graph-theoretical methods to model and analyze genomic information and thus facilitate using prior knowledge to create a more discrete and functionally relevant feature space.
    [Show full text]
  • Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow
    ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication
    [Show full text]
  • Chromatin Accessibility Dynamics of Chlamydia-Infected Epithelial Cells
    Hayward et al. Epigenetics & Chromatin (2020) 13:45 https://doi.org/10.1186/s13072-020-00368-2 Epigenetics & Chromatin RESEARCH Open Access Chromatin accessibility dynamics of Chlamydia-infected epithelial cells Regan J. Hayward1, James W. Marsh2, Michael S. Humphrys3, Wilhelmina M. Huston4 and Garry S. A. Myers1,4* Abstract Chlamydia are Gram-negative, obligate intracellular bacterial pathogens responsible for a broad spectrum of human and animal diseases. In humans, Chlamydia trachomatis is the most prevalent bacterial sexually transmitted infec- tion worldwide and is the causative agent of trachoma (infectious blindness) in disadvantaged populations. Over the course of its developmental cycle, Chlamydia extensively remodels its intracellular niche and parasitises the host cell for nutrients, with substantial resulting changes to the host cell transcriptome and proteome. However, little infor- mation is available on the impact of chlamydial infection on the host cell epigenome and global gene regulation. Regions of open eukaryotic chromatin correspond to nucleosome-depleted regions, which in turn are associated with regulatory functions and transcription factor binding. We applied formaldehyde-assisted isolation of regulatory elements enrichment followed by sequencing (FAIRE-Seq) to generate temporal chromatin maps of C. trachomatis- infected human epithelial cells in vitro over the chlamydial developmental cycle. We detected both conserved and distinct temporal changes to genome-wide chromatin accessibility associated with C. trachomatis infection. The observed diferentially accessible chromatin regions include temporally-enriched sets of transcription factors, which may help shape the host cell response to infection. These regions and motifs were linked to genomic features and genes associated with immune responses, re-direction of host cell nutrients, intracellular signalling, cell–cell adhesion, extracellular matrix, metabolism and apoptosis.
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Integration of Protein Binding Interfaces and Abundance
    INTEGRATION OF PROTEIN BINDING INTERFACES AND ABUNDANCE DATA REVEALS EVOLUTIONARY PRESSURES IN PROTEIN NETWORKS by David Orestis Holland A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy. Baltimore, Maryland January, 2018 © David O. Holland 2018 All rights reserved Abstract Networks of protein-protein interactions have received considerable interest in the past two decades for their insights about protein function and evolution. Traditionally, these networks only map the functional partners of proteins; they lack further levels of data such as binding affinity, allosteric regulation, competitive vs noncompetitive binding, and protein abundance. Recent experiments have made such data on a network-wide scale available, and in this thesis I integrate two extra layers of data in particular: the binding sites that proteins use to interact with their partners, and the abundance or “copy numbers” of the proteins. By analyzing the networks for the clathrin-mediated endocytosis (CME) system in yeast and the ErbB signaling pathway in humans, I find that this extra data reveals new insights about the evolution of protein networks. The structure of the binding site or interface interaction network (IIN) is optimized to allow higher binding specificity; that is, a high gap in strength between functional binding and nonfunctional mis-binding. This strongly implies that mis-binding is an evolutionary error-load constraint shaping protein network structure. Another method to limit mis-binding is to balance protein copy numbers so that there are no “leftover” proteins available for mis-binding. By developing a new method to quantify balance in IINs, I show that ii the CME network is significantly balanced when compared to randomly sampled sets of copy numbers.
    [Show full text]
  • High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma
    ANTICANCER RESEARCH 34: 6405-6416 (2014) High-density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma ALINE DAMASCENO SEABRA1,2*, TAÍSSA MAÍRA THOMAZ ARAÚJO1,2*, FERNANDO AUGUSTO RODRIGUES MELLO JUNIOR1,2, DIEGO DI FELIPE ÁVILA ALCÂNTARA1,2, AMANDA PAIVA DE BARROS1,2, PAULO PIMENTEL DE ASSUMPÇÃO2, RAQUEL CARVALHO MONTENEGRO1,2, ADRIANA COSTA GUIMARÃES1,2, SAMIA DEMACHKI2, ROMMEL MARIO RODRÍGUEZ BURBANO1,2 and ANDRÉ SALIM KHAYAT1,2 1Human Cytogenetics Laboratory and 2Oncology Research Center, Federal University of Pará, Belém Pará, Brazil Abstract. Aim: To investigate frequent quantitative alterations gastric cancer is the second most frequent cancer in men and of intestinal-type gastric adenocarcinoma. Materials and the third in women (4). The state of Pará has a high Methods: We analyzed genome-wide DNA copy numbers of 22 incidence of gastric adenocarcinoma and this disease is a samples and using CytoScan® HD Array. Results: We identified public health problem, since mortality rates are above the 22 gene alterations that to the best of our knowledge have not Brazilian average (5). been described for gastric cancer, including of v-erb-b2 avian This tumor can be classified into two histological types, erythroblastic leukemia viral oncogene homolog 4 (ERBB4), intestinal and diffuse, according to Laurén (4, 6, 7). The SRY (sex determining region Y)-box 6 (SOX6), regulator of intestinal type predominates in high-risk areas, such as telomere elongation helicase 1 (RTEL1) and UDP- Brazil, and arises from precursor lesions, whereas the diffuse Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 type has a similar distribution in high- and low-risk areas and (B4GALT5).
    [Show full text]
  • Genomic Sequence of the Aflatoxigenic Filamentous Fungus Aspergillus Nomius Geromy G
    Moore et al. BMC Genomics (2015) 16:551 DOI 10.1186/s12864-015-1719-6 RESEARCH ARTICLE Open Access Genomic sequence of the aflatoxigenic filamentous fungus Aspergillus nomius Geromy G. Moore*, Brian M. Mack and Shannon B. Beltz Abstract Background: Aspergillus nomius is an opportunistic pathogen and one of the three most important producers of aflatoxins in section Flavi. This fungus has been reported to contaminate agricultural commodities, but it has also been sampled in non-agricultural areas so the host range is not well known. Having a similar mycotoxin profile as A. parasiticus, isolates of A. nomius are capable of secreting B- and G- aflatoxins. Results: In this study we discovered that the A. nomius type strain (NRRL 13137) has a genome size of approximately 36 Mb which is comparable to other Aspergilli whose genomes have been sequenced. Its genome encompasses 11,918 predicted genes, 72 % of which were assigned GO terms using BLAST2GO. More than 1,200 of those predicted genes were identified as unique to A. nomius, and the most significantly enriched GO category among the unique genes was oxidoreducatase activity. Phylogenomic inference shows NRRL 13137 as ancestral to the other aflatoxigenic species examined from section Flavi. This strain contains a single mating-type idiomorph designated as MAT1-1. Conclusions: This study provides a preliminary analysis of the A. nomius genome. Given the recently discovered potential for A. nomius to undergo sexual recombination, and based on our findings, this genome sequence provides an additional evolutionary reference point for studying the genetics and biology of aflatoxin production. Keywords: Aspergillus nomius, Genome sequence, Gene ontology, Phylogenomics, Mating-type locus Background to misidentification.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Milger Et Al. Pulmonary CCR2+CD4+ T Cells Are Immune Regulatory And
    Milger et al. Pulmonary CCR2+CD4+ T cells are immune regulatory and attenuate lung fibrosis development Supplemental Table S1 List of significantly regulated mRNAs between CCR2+ and CCR2- CD4+ Tcells on Affymetrix Mouse Gene ST 1.0 array. Genewise testing for differential expression by limma t-test and Benjamini-Hochberg multiple testing correction (FDR < 10%). Ratio, significant FDR<10% Probeset Gene symbol or ID Gene Title Entrez rawp BH (1680) 10590631 Ccr2 chemokine (C-C motif) receptor 2 12772 3.27E-09 1.33E-05 9.72 10547590 Klrg1 killer cell lectin-like receptor subfamily G, member 1 50928 1.17E-07 1.23E-04 6.57 10450154 H2-Aa histocompatibility 2, class II antigen A, alpha 14960 2.83E-07 1.71E-04 6.31 10590628 Ccr3 chemokine (C-C motif) receptor 3 12771 1.46E-07 1.30E-04 5.93 10519983 Fgl2 fibrinogen-like protein 2 14190 9.18E-08 1.09E-04 5.49 10349603 Il10 interleukin 10 16153 7.67E-06 1.29E-03 5.28 10590635 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10598013 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10475517 AA467197 expressed sequence AA467197 /// microRNA 147 433470 7.32E-04 2.68E-02 4.96 10503098 Lyn Yamaguchi sarcoma viral (v-yes-1) oncogene homolog 17096 3.98E-08 6.65E-05 4.89 10345791 Il1rl1 interleukin 1 receptor-like 1 17082 6.25E-08 8.08E-05 4.78 10580077 Rln3 relaxin 3 212108 7.77E-04 2.81E-02 4.77 10523156 Cxcl2 chemokine (C-X-C motif) ligand 2 20310 6.00E-04 2.35E-02 4.55 10456005 Cd74 CD74 antigen
    [Show full text]