DOCSLIB.ORG

University of Southampton Research Repository Eprints Soton

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Southampton Research Repository Eprints Soton University of Southampton Research Repository ePrints Soton Copyright © and Moral Rights for this thesis are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder/s. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holders. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given e.g. AUTHOR (year of submission) "Full thesis title", University of Southampton, name of the University School or Department, PhD Thesis, pagination http://eprints.soton.ac.uk UNIVERSITY OF SOUTHAMPTON FACULTY OF MEDICINE, HEALTH & LIFE SCIENCES School of Medicine Abnormalities affecting tyrosine kinase signalling in atypical myeloproliferative disorders by Claire Hidalgo-Curtis Thesis for the degree of Doctor of Philosophy May 2009 UNIVERSITY OF SOUTHAMPTON ABSTRACT FACULTY OF MEDICINE, HEALTH & LIFE SCIENCES SCHOOL OF MEDICINE Doctor of Philosophy ABNORMALITIES AFFECTING TYROSINE KINASE SIGNALLING IN ATYPICAL MYELOPROLIFERATIVE DISORDERS By Claire Hidalgo-Curtis The myeloproliferative disorders (MPDs) are a group of haematopoietic stem cell diseases, characterised by proliferation of one or more cells of the myeloid lineage. Several lines of evidence have highlighted the importance of aberrant tyrosine kinase signalling in the pathogenesis of these disorders. Cloning of rare chromosomal translocations and point mutation analysis in the MPDs has identified diverse deregulated tyrosine kinase genes, notably PDGFRA, PDGFRB, FGFR1 and JAK2. However the majority of atypical MPDs still remain to be characterised and identification of patients harbouring fusions, particularly those involving the PDGF receptors is of increasing importance, as they are likely to be responsive to targeted therapy with imatinib. I am investigating MPD patients for abnormalities affecting tyrosine kinase signalling, and have used three approaches, translocation cloning, expression analysis and SNP array analysis to detect regions of loss of heterozygosity (LOH). Thus far, by translocation cloning I have identified a previously undescribed partner gene fused to PDGFRB and two new PDGFRA fusion genes. I have also designed two reverse transcriptase PCR (RT-PCR) assays and a cDNA MLPA assay to detect over-expression of specific tyrosine kinases screening approximately 200 patients. Each assay identified all patients previously diagnosed with known fusions. Additionally, two patients identified with overexpression of PDGFRB have been found to have cryptic ETV6-PDGFRB fusions and overexpression of PDGFRA in one patient lead to the discovery of a previously undescribed fusion involving a novel partner gene (KIF5B). Recent evidence has indicated that acquired isodisomy is a novel mechanism by which mutations in cancer may be reduced to homozygosity. Typically, acquired isodisomy is associated with oncogenic changes rather than tumour suppressor genes, eg. the activating JAK2 V617F mutation and 9p aUPD. I have undertaken a screen using Affymetrix 50K SNP arrays for regions of acquired isodisomy as a means to identify genomic regions that may harbour novel oncogenes in different subgroups of MPD patients. Large tracts of homozygosity (defined as >20Mb running to a telomere), strongly suggesting acquired isodisomy, were seen in 40% aMPD patients. The homozygous tracts encompassed diverse genomic regions in aMPD, but two common regions (3 cases for each region) were identified at 7q and 11q. Mutations in the CBL ubiquitin ligase gene were discovered in all three aCML patients with 11q aUPD as well as in an additional 23 MPD patients following further screening. CONTENTS Contents………………………………………………….…………………….….......i List of Figures…………………………………………………………………...…viii List of Tables……………………………………………………………….….......xiii Declaration of Authorship……………………………………………….………...xv Acknowledgments……………………………………………………….……......xvii List of Abbreviations…………………………………………………….………xviii 1 INTRODUCTION 1 1.1 Normal Haematopoiesis 1 1.2 Leukaemia 3 1.2.1 Clonality 4 1.2.2 Classification 4 1.3 The chronic myeloproliferative disorders (CMPD and the myelodysplastic/myeloprolfierative disorders (MDS/MPD) 5 1.4 The paradigm for deregulated tyrosine kinases – Chronic myelogenous leukaemia (CML) 7 1.4.1 Molecular pathogenesis of CML 7 1.4.2 Therapy in CML and the development of Imatinib 9 1.5 The tyrosine kinases 11 1.5.1 Non-receptor tyrosine kinases (NTRKs) 12 1.5.2 Receptor tyrosine kinases (RTKs) 13 1.6 Molecular pathogenesis and deregulated tyrosine kinases 15 1.7 PDGFRA and PDGFRB rearrangements in MPDs 17 1.7.1 Fusions involving PDGFRA 17 1.7.2 Chronic eosinophilic leukaemia (CEL) 18 1.7.3 Fusions involving PDGFRB 19 1.7.4 Chronic myelomonocytic leukaemia (CMML) 21 1.7.5 JAK2 and the myeloproliferative disorders 22 i 1.8 Summary 26 1.9 Statement of aims 26 2 METHODS 28 2.1 Sample processing 28 2.1.1 Preparation of blood and bone marrow samples 28 2.1.2 Enriching cultures for T-cells 29 2.1.3 RNA extraction 30 2.1.4 cDNA synthesis 31 2.1.5 DNA extraction 31 2.1.5.1 DNA extraction from fixed cell suspension 31 2.1.5.2 Extraction from cell pellets 32 2.1.5.3 DNA extraction from Guanidinium thiocyanate 33 2.1.5.4 DNA extraction from mouthbrush samples 34 2.1.5.5 DNA extraction from haematological stained slides 34 2.1.5.6 GenomiPhi V2 DNA amplification kit 35 2.2 Amplification and analysis 35 2.2.1 Reverse transcriptase PCR (RT-PCR) 35 2.2.2 Microsatellite PCR 36 2.2.3 Control gene PCR 36 2.2.4 Powerplex® 16 system 37 2.2.5 Long-range PCR 38 2.2.6 Bubble-PCR 38 2.2.7 Gel Electrophoresis 39 2.2.8 Denaturing high-performance liquid chromatography (dHPLC) 40 2.2.9 Multiplex ligation-dependent probe amplification (MLPA) 41 2.2.10 Exo-SAP and sequencing 42 2.2.10.1 Sequencing of PCR products 43 2.2.10.2 Sequencing following cloning 43 2.2.11 Cloning PCR products 44 2.2.11.1 Ligations 44 ii 2.2.11.2 Transformations 44 2.2.11.3 Qiagen™ Miniprep kit 45 2.2.11.4 Digests and PCR 46 2.2.12 5’Rapid amplification of cDNA ends 46 2.2.13 Pyrosequencing 48 2.3 Fluorescence in situ hybridisation (FISH) 49 2.3.1 Maxiprep DNA isolation from BAC clones 49 2.3.2 Labelling 50 2.3.3 Slide making 51 2.3.4 Probe preparation 51 2.3.5 Slide preparation 51 2.3.6 Post hybridisation and visualisation 52 2.4 Tissue Culture 53 2.4.1 Imatinib sensivity assay 53 2.4.1.1 Thawing of primary haematopoietic cells 53 2.4.1.2 Colony assay 53 2.4.2 Midi prep & nucleotide removal kit 54 2.4.2.1 Midi-prep 54 2.4.2.2 QIAquick nucleotide removal kit 56 2.4.2.3 Transfection by electroporation 56 2.4.2.4 Electroporation 57 2.4.2.5 Antibiotic selection 57 2.4.2.6 IL-3 independent growth 58 2.5 Solutions 58 2.6 List of probes used for FISH 61 3 IDENTIFICATION OF NOVEL FUSION GENES ASSOCIATED WITH VISIBLE CHROMOSOME ABNORMALITIES 62 3.1 Introduction 62 3.2 A novel PDGFRB fusion gene 62 3.2.1 Patient details 62 iii 3.2.2 Two-colour fluorescence in situ hybridisation (FISH) 63 3.2.3 5’Rapid amplification of cDNA ends (5’RACE) 64 3.2.4 Confirmation of the GOLGA4-PDGFRB fusion and cloning of the genomic breakpoints 69 3.2.5 Consequence of the t(3;5) 75 3.2.6 Identification of a second MPD patient with a GOLGA4-PDGFRB fusion 76 3.2.7 Two-colour fluorescence in situ hybridisation (FISH) 78 3.2.8 Imatinib sensitivity assay 79 3.2.9 Discussion 81 3.3 Identification of two novel PDGFRA fusion genes 83 3.3.1 Patient details 83 3.3.2 Bubble PCR 84 3.3.3 Confirming the STRN-PDGFRA fusion 86 3.3.4 Consequence of the STRN-PDGFRA fusion 88 3.3.5 Confirming the ETV6-PDGFRA fusion 89 3.3.6 Two-colour fluorescence in situ hybridisation 91 3.3.7 Consequence of the ETV6-PDGFRA fusion 92 3.3.8 Detection of MRD and the response to imatinib in cases 1 &2 93 3.3.9 Discussion: PDGFRA fusions 93 3.4 A novel FGFR1 fusion gene 96 3.4.1 Patient details 97 3.4.2 Fluorescence in situ hybridisation 97 3.4.3 5’Rapid amplification of cDNA ends (5’RACE) PCR 98 3.4.4 Confirming the CPSF6-FGFR1 fusion 99 3.4.5 Consequence of the t(8;12) 99 3.4.6 Discussion 100 3.5 Discussion 102 4 IDENTIFICATION OF DEREGULATED EXPRESSION OF TYROSINE KINASE GENES 107 iv 4.1 Introduction 107 4.1.1 PDGFRB rearrangements 108 4.1.2 PDGFRA rearrangements 109 4.2 Methods 110 4.2.1 Design of the PDGFRB RT-PCR assay 110 4.2.2 Design of the PDGFRA RT-PCR assay 113 4.3 Results 116 4.3.1 Identification of patients with possible PDGFRB rearrangements 116 4.3.2 Identification of patients with possible PDGFRA rearrangements 120 4.3.3 Over-expression assays – discussion 123 4.4 Multiplex ligation-dependent probe amplification (MLPA) 127 4.4.1 Methods – probe design 128 4.4.2 Methods – Optimisation of the assay 130 4.4.3 Validation of the cDNA MPLA assay 137 4.4.4 Results 138 4.4.4.1 A cryptic ETV6-PDGFRB fusion gene 139 4.4.4.2 Patient details 140 4.4.4.3 cDNA MLPA analysis of patient E1026 141 4.4.4.4 5’RACE PCR to identify the potential PDGFRB fusion in patient E1026 142 4.4.4.5 Confirmation of the ETV6-PDGFRB fusion 144 4.4.4.6 Further ETV6-PDGFRB analysis 146 4.4.4.7 ETV6-PDGFRB – discussion 147 4.4.5 MLPA discussion 149 4.5 Discussion 150 5 SCREENING FOR NEW ONCOGENES MARKED BY ACQUIRED UNIPARENTAL DISOMY 156 5.1 Introduction 156 5.1.1 Loss of heterozygosity (LOH) & acquired uniparental disomy (aUPD) 156 v 5.1.2 aUPD
Load more

Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • CPSF6 Links Alternative Polyadenylation to Metabolism
    Tan et al. Journal of Experimental & Clinical Cancer Research (2021) 40:85 https://doi.org/10.1186/s13046-021-01884-z RESEARCH Open Access CPSF6 links alternative polyadenylation to metabolism adaption in hepatocellular carcinoma progression Sheng Tan1†, Ming Zhang2†, Xinglong Shi3†, Keshuo Ding4, Qiang Zhao3, Qianying Guo4, Hao Wang4, Zhengsheng Wu4, Yani Kang3, Tao Zhu5*, Jielin Sun1* and Xiaodong Zhao1* Abstract Background: Alternative polyadenylation (APA) is an important mechanism of gene expression regulation through generation of RNA isoforms with distinct 3′ termini. Increasing evidence has revealed that APA is actively involved in development and disease, including hepatocellular carcinoma (HCC). However, how APA functions in tumor formation and progression remains elusive. In this study, we investigated the role of cleavage factor I (CFIm) subunit CPSF6 in human hepatocellular carcinoma (HCC). Methods: Expression levels of CPSF6 in clinical tissues and cell lines were determined by qRT-PCR and western blot. Functional assays, including the cell number, MTT, colony formation and transwell, were used to determine the oncogenic role of CPSF6 in HCC. Animal experiments were used to determine the role of CPSF6 in HCC tumorigenicity in vivo. Deep sequencing-based 3 T-seq was used to profile the transcriptome-wide APA sites in both HCC cells and CPSF6 knockdown HCC cells. The function of CPSF6-affected target NQO1 with distinct 3′UTRs was characterized by metabolism assays. Results: We observed CPSF6 was upregulated in HCC and the high expression of CPSF6 was associated with poor prognosis in patients. Overexpression of CPSF6 promoted proliferation, migration and invasion of HCC cells in vitro and in vivo.
    [Show full text]
  • Multiple MYO18A-PDGFRB Fusion Transcripts in a Myeloproliferative
    Sheng et al. Molecular Cytogenetics (2017) 10:4 DOI 10.1186/s13039-017-0306-8 CASEREPORT Open Access Multiple MYO18A-PDGFRB fusion transcripts in a myeloproliferative neoplasm patient with t(5;17)(q32;q11) Guangying Sheng1†, Zhao Zeng1†, Jinlan Pan1, Linbing Kou1, Qinrong Wang1, Hong Yao1, Lijun Wen1, Liang Ma1, Depei Wu1,2, Huiying Qiu1 and Suning Chen1,2* Abstract Background: Myeloproliferative neoplasms (MPNs), typically defined by myeloid proliferation and eosinophilia, and are only rarely caused by platelet-derived growth factor receptor beta (PDGFRB) gene rearrangements. Case presentation: Here, we report a unique case of MPN that is negative for eosinophilia and characterized by a novel PDGFRB rearrangement. After cytogenetic analysis revealed a karyotype of t(5;17) (q32;q11), we used fluorescence in situ hybridization to specifically identify the PDGFRB gene at 5q31-q33 as the gene that had been translocated. Subsequently, RNA sequencing identified a new MYO18A-PDGFRB gene fusion. This fusion presented a previously undescribed breakpoint composed of exon 37 of MYO18A and exon 13 of PDGFRB. Furthermore, both RT-PCR and Bi-directional Sanger sequencing confirmed this out-of-frame fusion. Interestingly, we simultaneously identified the presence of another three PDGFRB transcripts, all of which were in-frame fusions. After treating the patient with imatinib, the t(5;17) translocation was no longer detected by conventional cytogenetics or by FISH, and at the time of the last follow-up, the patient had been in complete remission for 26 months. Conclusion: We prove that MYO18A-PDGFRB fusions are recurrent genetic aberrations involved in MPNs, and identify multiple fusion transcripts with novel breakpoints.
    [Show full text]
  • A Case of Acute Myeloid Leukemia with Promyelocytic Features Characterized by Expression of a Novel RARG-CPSF6 Fusion Christopher A
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 A case of acute myeloid leukemia with promyelocytic features characterized by expression of a novel RARG-CPSF6 fusion Christopher A. Miller Washington University School of Medicine in St. Louis Christopher Tricarico Washington University School of Medicine in St. Louis Zachary L. Skidmore Washington University School of Medicine in St. Louis Geoffrey L. Uy Washington University School of Medicine in St. Louis Yi-Shan Lee Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Miller, Christopher A.; Tricarico, Christopher; Skidmore, Zachary L.; Uy, Geoffrey L.; Lee, Yi-Shan; Hassan, Anjum; O'Laughlin, Michelle D.; Schmidt, Heather; Tian, Ling; Duncavage, Eric J.; Griffith,al M achi; Griffith, Obi L.; Welch, John S.; and Wartman, Lukas D., ,"A case of acute myeloid leukemia with promyelocytic features characterized by expression of a novel RARG-CPSF6 fusion." Blood Advances.2,11. 1295-1299. (2018). https://digitalcommons.wustl.edu/open_access_pubs/7234 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Christopher A. Miller, Christopher Tricarico, Zachary L. Skidmore, Geoffrey L. Uy, Yi-Shan Lee, Anjum Hassan, Michelle D. O'Laughlin, Heather Schmidt, Ling Tian, Eric J. Duncavage, Malachi Griffith, Obi L. Griffith,o J hn S. Welch, and Lukas D. Wartman This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/7234 EXCEPTIONAL CASE REPORT A case of acute myeloid leukemia with promyelocytic features characterized by expression of a novel RARG-CPSF6 fusion Christopher A.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • A Novel Resveratrol Analog: Its Cell Cycle Inhibitory, Pro-Apoptotic and Anti-Inflammatory Activities on Human Tumor Cells
    A NOVEL RESVERATROL ANALOG : ITS CELL CYCLE INHIBITORY, PRO-APOPTOTIC AND ANTI-INFLAMMATORY ACTIVITIES ON HUMAN TUMOR CELLS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Boren Lin May 2006 Dissertation written by Boren Lin B.S., Tunghai University, 1996 M.S., Kent State University, 2003 Ph. D., Kent State University, 2006 Approved by Dr. Chun-che Tsai , Chair, Doctoral Dissertation Committee Dr. Bryan R. G. Williams , Co-chair, Doctoral Dissertation Committee Dr. Johnnie W. Baker , Members, Doctoral Dissertation Committee Dr. James L. Blank , Dr. Bansidhar Datta , Dr. Gail C. Fraizer , Accepted by Dr. Robert V. Dorman , Director, School of Biomedical Sciences Dr. John R. Stalvey , Dean, College of Arts and Sciences ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………….………v LIST OF TABLES……………………………………………………………………….vii ACKNOWLEDGEMENTS….………………………………………………………….viii I INTRODUCTION….………………………………………………….1 Background and Significance……………………………………………………..1 Specific Aims………………………………………………………………………12 II MATERIALS AND METHODS.…………………………………………….16 Cell Culture and Compounds…….……………….…………………………….….16 MTT Cell Viability Assay………………………………………………………….16 Trypan Blue Exclusive Assay……………………………………………………...18 Flow Cytometry for Cell Cycle Analysis……………..……………....……………19 DNA Fragmentation Assay……………………………………………...…………23 Caspase-3 Activity Assay………………………………...……….….…….………24 Annexin V-FITC Staining Assay…………………………………..…...….………28 NF-kappa B p65 Activity Assay……………………………………..………….…29
    [Show full text]
  • Changing the Name of the NBPF/DUF1220 Domain to the Olduvai Domain [Version 2; Peer Review: 3 Approved]
    F1000Research 2018, 6:2185 Last updated: 31 AUG 2021 OPINION ARTICLE Changing the name of the NBPF/DUF1220 domain to the Olduvai domain [version 2; peer review: 3 approved] Previously titled: A proposal to change the name of the NBPF/DUF1220 domain to the Olduvai domain James M. Sikela 1, Frans van Roy2,3 1Department of Biochemistry and Molecular Genetics, Human Medical Genetics and Neuroscience Programs, University of Colorado School of Medicine, Aurora, CO, 80045, USA 2Department of Biomedical Molecular Biology, Ghent University, Ghent, 9052, Belgium 3VIB-UGent Center for Inflammation Research, Ghent, 9052, Belgium v2 First published: 28 Dec 2017, 6:2185 Open Peer Review https://doi.org/10.12688/f1000research.13586.1 Latest published: 17 Jul 2018, 6:2185 https://doi.org/10.12688/f1000research.13586.2 Reviewer Status Invited Reviewers Abstract We are jointly proposing a new name for a protein domain of 1 2 3 approximately 65 amino acids that has been previously termed NBPF or DUF1220. Our two labs independently reported the initial studies of version 2 this domain, which is encoded almost entirely within a single gene (revision) report report family. The name Neuroblastoma Breakpoint Family (NBPF) was 17 Jul 2018 applied to this gene family when the first identified member of the family was found to be interrupted in an individual with version 1 neuroblastoma. 28 Dec 2017 report report report Prior to this discovery, the Pfam database had termed the domain DUF1220, denoting it as one of many protein domains of unknown f unction. It has been Pfam’s intention to use “DUF” nomenclature to 1.
    [Show full text]
  • A Newly Identified Myomegalin Isoform Functions in Golgi Microtubule Organization and ER–Golgi Transport
    ß 2014. Published by The Company of Biologists Ltd | Journal of Cell Science (2014) 127, 4904–4917 doi:10.1242/jcs.155408 RESEARCH ARTICLE A newly identified myomegalin isoform functions in Golgi microtubule organization and ER–Golgi transport Zhe Wang, Chao Zhang and Robert Z. Qi* ABSTRACT the formation of ER–Golgi cargo carriers that associate with dynein–dynactin to move along microtubules towards the Golgi The Golgi of mammalian cells is known to be a major microtubule- (Presley et al., 1997; Scales et al., 1997; Watson et al., 2005). organizing site that requires microtubules for its organization and The Golgi serves as a major microtubule-organizing center protein trafficking. However, the mechanisms underlying the (Chabin-Brion et al., 2001; Efimov et al., 2007; Miller et al., 2009; microtubule organization of the Golgi remain obscure. We used Rivero et al., 2009). For example, almost half of all cellular immunoprecipitation coupled with mass spectrometry to identify a microtubules originate from the Golgi in human retinal pigment widely expressed isoform of the poorly characterized muscle protein epithelial RPE1 cells (Efimov et al., 2007). Moreover, microtubule myomegalin. This newly identified isoform, myomegalin variant 8 nucleation at the Golgi does not require centrosomes, and it (MMG8), localized predominantly to cis-Golgi networks by interacting depends instead on c-tubulin (Efimov et al., 2007), the principal with AKAP450 (also known as AKAP9), and this interaction with microtubule nucleator in cells, which exists in the form of c-tubulin AKAP450 was required for the stability of both proteins. Disrupting complexes (cTuCs). The cis-Golgi proteins AKAP450 (also known MMG8 expression affected endoplasmic reticulum (ER)-to-Golgi as AKAP9, AKAP350, CG-NAP and hyperion) and GMAP210 trafficking and caused Golgi fragmentation.
    [Show full text]
  • Supplementary Data
    Supplementary Fig. 1 A B Responder_Xenograft_ Responder_Xenograft_ NON- NON- Lu7336, Vehicle vs Lu7466, Vehicle vs Responder_Xenograft_ Responder_Xenograft_ Sagopilone, Welch- Sagopilone, Welch- Lu7187, Vehicle vs Lu7406, Vehicle vs Test: 638 Test: 600 Sagopilone, Welch- Sagopilone, Welch- Test: 468 Test: 482 Responder_Xenograft_ NON- Lu7860, Vehicle vs Responder_Xenograft_ Sagopilone, Welch - Lu7558, Vehicle vs Test: 605 Sagopilone, Welch- Test: 333 Supplementary Fig. 2 Supplementary Fig. 3 Supplementary Figure S1. Venn diagrams comparing probe sets regulated by Sagopilone treatment (10mg/kg for 24h) between individual models (Welsh Test ellipse p-value<0.001 or 5-fold change). A Sagopilone responder models, B Sagopilone non-responder models. Supplementary Figure S2. Pathway analysis of genes regulated by Sagopilone treatment in responder xenograft models 24h after Sagopilone treatment by GeneGo Metacore; the most significant pathway map representing cell cycle/spindle assembly and chromosome separation is shown, genes upregulated by Sagopilone treatment are marked with red thermometers. Supplementary Figure S3. GeneGo Metacore pathway analysis of genes differentially expressed between Sagopilone Responder and Non-Responder models displaying –log(p-Values) of most significant pathway maps. Supplementary Tables Supplementary Table 1. Response and activity in 22 non-small-cell lung cancer (NSCLC) xenograft models after treatment with Sagopilone and other cytotoxic agents commonly used in the management of NSCLC Tumor Model Response type
    [Show full text]
  • Sla2 (NM 029983) Mouse Untagged Clone – MC201875 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201875 Sla2 (NM_029983) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Sla2 (NM_029983) Mouse Untagged Clone Tag: Tag Free Symbol: Sla2 Synonyms: A930009E21Rik; AI430952; SLAP-2; SLAP2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC052655 sequence for NM_029983 AAGAGGTAATCCGGCCACGCTCTTTGTCCCTGCTGTGCTGGGTGGGAGGGCCCAACCTGGTTTCTCTGAG AAGCAAAGGACTGCTGTACTAGTTTCGTGGAGATTGTCTGCTGACAAAGAAGCTTGATCACAGTACCTCA GCCTACTCTGACTCCTTTCTGGTGACCGATCCTCCAGGCTGCTGGGGCCTGAGATGCCGACTACCTTAGG ACCTGCAAAGGCCTGACCTGTCGGGTCAGTGTGCACATTGGCTGACTACCCTCATCAAACGTCTGATGGC AAACCTTTCCCTTTCCAGGTTCAGTGTGCTTGTGAGCGTCTGCTGAGTGATGGGAAGTTTGTCCAGCAGA GGGAAAACCTCCAGCCCCAGCCCCAGCTCCTCTGGTCCAGACCAGGAACCCGTGTCCATGCAACCAGAAA GACGCAAGGTCACAGCTGTGGCCCTGGGCAGTTTCCCAGCAGGTGAACAGGCCAGACTATCTCTGAGACT CGGGGAGCCGCTGACCATCATCTCTGAGGATGGAGATTGGTGGACAGTCCAGTCGGAAGTCTCAGGCAGA GAGTACCACATGCCCAGTGTGTATGTGGCTAAAGTCGCCCACGGGTGGCTGTACGAGGGCCTGAGCCGGG AGAAAGCCGAGGAACTACTCCTGTTACCTGGGAACCCCGGAGGGGCCTTCCTCATCCGGGAGAGCCAGAC CAGGAGAGGCTGCTATTCCCTGTCCGTCCGACTCAGCCGCCCTGCATCTTGGGACCGGATCAGACACTAC AGGATACAGCGTCTTGACAATGGCTGGCTGTACATCTCACCTCGCCTCACCTTCCCCTCACTCCACGCCT TGGTGGAGCATTACTCTGAGCTAGCAGATGGCATCTGCTGTCCCCTCAGGGAGCCGTGTGTCCTGCAGAA GCTTGGGCCACTACCTGGCAAAGATACACCTCCACCTGTGACTGTGCCAACATCATCACTAAATTGGAAA
    [Show full text]
  • Gene Ontology Functional Annotations and Pleiotropy
    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
    [Show full text]