DOCSLIB.ORG

Mouse Sla2 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Sla2 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Sla2 Knockout Project (CRISPR/Cas9) Objective: To create a Sla2 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Sla2 gene (NCBI Reference Sequence: NM_029983 ; Ensembl: ENSMUSG00000027636 ) is located on Mouse chromosome 2. 8 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 8 (Transcript: ENSMUST00000029164). Exon 2~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit normal B and T cells. Exon 2 starts from the coding region. Exon 2~6 covers 68.08% of the coding region. The size of effective KO region: ~7886 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 8 Legends Exon of mouse Sla2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 812 bp section downstream of Exon 6 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(28.0% 560) | C(24.1% 482) | T(21.45% 429) | G(26.45% 529) Note: The 2000 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(812bp) | A(25.12% 204) | C(23.77% 193) | T(25.86% 210) | G(25.25% 205) Note: The 812 bp section downstream of Exon 6 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr2 - 156883677 156885676 2000 browser details YourSeq 609 1 1164 2000 93.3% chr2 - 156924115 156925276 1162 browser details YourSeq 268 1236 1757 2000 85.8% chr10 - 58467810 58468250 441 browser details YourSeq 251 1238 1750 2000 85.9% chr11 + 4811433 4811867 435 browser details YourSeq 250 1238 1742 2000 91.5% chr15 - 79652238 79652764 527 browser details YourSeq 240 1237 1747 2000 90.3% chr15 - 8089095 8089904 810 browser details YourSeq 234 1239 1746 2000 90.9% chr10 - 94016614 94017190 577 browser details YourSeq 233 1241 1738 2000 87.1% chr1 - 153759034 153759391 358 browser details YourSeq 227 1241 1747 2000 87.9% chr16 + 4040863 4041447 585 browser details YourSeq 207 1268 1747 2000 89.6% chr11 + 32633476 32683436 49961 browser details YourSeq 206 1272 1677 2000 92.0% chr10 - 45770062 45770641 580 browser details YourSeq 203 1328 1759 2000 93.2% chr7 + 116348716 116349400 685 browser details YourSeq 199 1265 1747 2000 81.6% chr8 + 106963806 106964119 314 browser details YourSeq 195 1263 1715 2000 86.5% chr4 - 126085604 126085929 326 browser details YourSeq 183 1263 1715 2000 91.1% chr7 - 105680012 105680468 457 browser details YourSeq 182 1241 1696 2000 91.5% chr7 + 75783401 75783857 457 browser details YourSeq 179 1264 1723 2000 81.3% chr17 - 32843234 32843497 264 browser details YourSeq 173 1263 1747 2000 82.5% chr8 + 120212094 120212469 376 browser details YourSeq 166 1280 1758 2000 82.9% chr9 - 55694113 55694414 302 browser details YourSeq 165 1263 1730 2000 82.3% chr3 + 90054247 90054610 364 Note: The 2000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 812 1 812 812 100.0% chr2 - 156875010 156875821 812 browser details YourSeq 109 357 498 812 89.4% chr4 - 150557295 150557441 147 browser details YourSeq 106 357 498 812 91.0% chr6 + 88656605 88656744 140 browser details YourSeq 104 358 498 812 92.0% chr8 + 55882915 55883073 159 browser details YourSeq 103 357 498 812 86.0% chr10 + 81099574 81099713 140 browser details YourSeq 102 357 498 812 88.2% chr7 - 130829751 130829897 147 browser details YourSeq 101 344 481 812 92.5% chrX - 140459541 140459689 149 browser details YourSeq 101 361 498 812 86.3% chr17 - 23702892 23703027 136 browser details YourSeq 100 357 498 812 91.8% chr5 - 10728097 10728255 159 browser details YourSeq 100 357 482 812 90.4% chr18 - 68037119 68037248 130 browser details YourSeq 100 357 495 812 86.8% chr17 - 24551491 24551633 143 browser details YourSeq 100 357 499 812 89.6% chrX + 153098076 153098222 147 browser details YourSeq 100 361 498 812 92.6% chr1 + 195276507 195276652 146 browser details YourSeq 99 357 496 812 89.6% chr7 - 135690510 135690668 159 browser details YourSeq 99 361 485 812 90.4% chr7 - 102455684 102456170 487 browser details YourSeq 98 357 498 812 87.3% chr2 + 177800851 177800988 138 browser details YourSeq 98 356 498 812 84.8% chr1 + 171093745 171093884 140 browser details YourSeq 97 357 485 812 88.2% chr5 + 89437955 89438086 132 browser details YourSeq 97 361 485 812 93.9% chr11 + 104355250 104355378 129 browser details YourSeq 96 361 498 812 85.1% chr3 - 54428789 54428924 136 Note: The 812 bp section downstream of Exon 6 is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Sla2 Src-like-adaptor 2 [ Mus musculus (house mouse) ] Gene ID: 77799, updated on 24-Oct-2019 Gene summary Official Symbol Sla2 provided by MGI Official Full Name Src-like-adaptor 2 provided by MGI Primary source MGI:MGI:1925049 See related Ensembl:ENSMUSG00000027636 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as SLAP2; SLAP-2; AI430952; A930009E21Rik Expression Ubiquitous expression in thymus adult (RPKM 36.8), placenta adult (RPKM 10.3) and 27 other tissues See more Orthologs human all Genomic context Location: 2; 2 H1 See Sla2 in Genome Data Viewer Exon count: 8 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (156874151..156887250, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (156698658..156712814, complement) Chromosome 2 - NC_000068.7 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 2 transcripts Gene: Sla2 ENSMUSG00000027636 Description Src-like-adaptor 2 [Source:MGI Symbol;Acc:MGI:1925049] Gene Synonyms A930009E21Rik, SLAP-2, SLAP2 Location Chromosome 2: 156,872,457-156,887,192 reverse strand. GRCm38:CM000995.2 About this gene This gene has 2 transcripts (splice variants), 186 orthologues, 8 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Sla2-201 ENSMUST00000029164.8 2973 259aa ENSMUSP00000029164.2 Protein coding CCDS38302 Q8R4L0 TSL:1 GENCODE basic APPRIS P1 Sla2-202 ENSMUST00000109561.3 2634 259aa ENSMUSP00000105189.3 Protein coding CCDS38302 Q8R4L0 TSL:1 GENCODE basic APPRIS P1 34.74 kb Forward strand 156.87Mb 156.88Mb 156.89Mb Genes Rab5if-201 >protein coding Gm14248-201 >processed pseudogene (Comprehensive set... Rab5if-203 >lncRNA Rab5if-204 >retained intron Rab5if-202 >lncRNA Contigs AL935150.10 > Genes (Comprehensive set... < 5430405H02Rik-203lncRNA < Sla2-201protein coding < Gm14278-201unprocessed pseudogene < 5430405H02Rik-202lncRNA < Sla2-202protein coding < Gm14247-201processed pseudogene < 5430405H02Rik-201lncRNA Regulatory Build 156.87Mb 156.88Mb 156.89Mb Reverse strand 34.74 kb Regulation Legend CTCF Enhancer Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene pseudogene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000029164 < Sla2-201protein coding Reverse strand 14.62 kb ENSMUSP00000029... MobiDB lite Low complexity (Seg) Superfamily SH3-like domain superfamily SH2 domain superfamily SMART SH3 domain SH2 domain Prints SH2 domain Pfam SH3 domain SH2 domain PROSITE profiles SH3 domain SH2 domain PANTHER Src-like-adapter 2 PTHR10155 Gene3D 2.30.30.40 SH2 domain superfamily CDD SLAP, SH2 domain All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend inframe insertion missense variant splice region variant synonymous variant Scale bar 0 40 80 120 160 200 259 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Sla2 (NM 029983) Mouse Untagged Clone – MC201875 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201875 Sla2 (NM_029983) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Sla2 (NM_029983) Mouse Untagged Clone Tag: Tag Free Symbol: Sla2 Synonyms: A930009E21Rik; AI430952; SLAP-2; SLAP2 Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >BC052655 sequence for NM_029983 AAGAGGTAATCCGGCCACGCTCTTTGTCCCTGCTGTGCTGGGTGGGAGGGCCCAACCTGGTTTCTCTGAG AAGCAAAGGACTGCTGTACTAGTTTCGTGGAGATTGTCTGCTGACAAAGAAGCTTGATCACAGTACCTCA GCCTACTCTGACTCCTTTCTGGTGACCGATCCTCCAGGCTGCTGGGGCCTGAGATGCCGACTACCTTAGG ACCTGCAAAGGCCTGACCTGTCGGGTCAGTGTGCACATTGGCTGACTACCCTCATCAAACGTCTGATGGC AAACCTTTCCCTTTCCAGGTTCAGTGTGCTTGTGAGCGTCTGCTGAGTGATGGGAAGTTTGTCCAGCAGA GGGAAAACCTCCAGCCCCAGCCCCAGCTCCTCTGGTCCAGACCAGGAACCCGTGTCCATGCAACCAGAAA GACGCAAGGTCACAGCTGTGGCCCTGGGCAGTTTCCCAGCAGGTGAACAGGCCAGACTATCTCTGAGACT CGGGGAGCCGCTGACCATCATCTCTGAGGATGGAGATTGGTGGACAGTCCAGTCGGAAGTCTCAGGCAGA GAGTACCACATGCCCAGTGTGTATGTGGCTAAAGTCGCCCACGGGTGGCTGTACGAGGGCCTGAGCCGGG AGAAAGCCGAGGAACTACTCCTGTTACCTGGGAACCCCGGAGGGGCCTTCCTCATCCGGGAGAGCCAGAC CAGGAGAGGCTGCTATTCCCTGTCCGTCCGACTCAGCCGCCCTGCATCTTGGGACCGGATCAGACACTAC AGGATACAGCGTCTTGACAATGGCTGGCTGTACATCTCACCTCGCCTCACCTTCCCCTCACTCCACGCCT TGGTGGAGCATTACTCTGAGCTAGCAGATGGCATCTGCTGTCCCCTCAGGGAGCCGTGTGTCCTGCAGAA GCTTGGGCCACTACCTGGCAAAGATACACCTCCACCTGTGACTGTGCCAACATCATCACTAAATTGGAAA
    [Show full text]
  • A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes
    A Graph-Theoretic Approach to Model Genomic Data and Identify Biological Modules Asscociated with Cancer Outcomes Deanna Petrochilos A dissertation presented in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2013 Reading Committee: Neil Abernethy, Chair John Gennari, Ali Shojaie Program Authorized to Offer Degree: Biomedical Informatics and Health Education UMI Number: 3588836 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMI 3588836 Published by ProQuest LLC (2013). Copyright in the Dissertation held by the Author. Microform Edition © ProQuest LLC. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, MI 48106 - 1346 ©Copyright 2013 Deanna Petrochilos University of Washington Abstract Using Graph-Based Methods to Integrate and Analyze Cancer Genomic Data Deanna Petrochilos Chair of the Supervisory Committee: Assistant Professor Neil Abernethy Biomedical Informatics and Health Education Studies of the genetic basis of complex disease present statistical and methodological challenges in the discovery of reliable and high-confidence genes that reveal biological phenomena underlying the etiology of disease or gene signatures prognostic of disease outcomes. This dissertation examines the capacity of graph-theoretical methods to model and analyze genomic information and thus facilitate using prior knowledge to create a more discrete and functionally relevant feature space.
    [Show full text]
  • Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow
    ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication
    [Show full text]
  • Chromatin Accessibility Dynamics of Chlamydia-Infected Epithelial Cells
    Hayward et al. Epigenetics & Chromatin (2020) 13:45 https://doi.org/10.1186/s13072-020-00368-2 Epigenetics & Chromatin RESEARCH Open Access Chromatin accessibility dynamics of Chlamydia-infected epithelial cells Regan J. Hayward1, James W. Marsh2, Michael S. Humphrys3, Wilhelmina M. Huston4 and Garry S. A. Myers1,4* Abstract Chlamydia are Gram-negative, obligate intracellular bacterial pathogens responsible for a broad spectrum of human and animal diseases. In humans, Chlamydia trachomatis is the most prevalent bacterial sexually transmitted infec- tion worldwide and is the causative agent of trachoma (infectious blindness) in disadvantaged populations. Over the course of its developmental cycle, Chlamydia extensively remodels its intracellular niche and parasitises the host cell for nutrients, with substantial resulting changes to the host cell transcriptome and proteome. However, little infor- mation is available on the impact of chlamydial infection on the host cell epigenome and global gene regulation. Regions of open eukaryotic chromatin correspond to nucleosome-depleted regions, which in turn are associated with regulatory functions and transcription factor binding. We applied formaldehyde-assisted isolation of regulatory elements enrichment followed by sequencing (FAIRE-Seq) to generate temporal chromatin maps of C. trachomatis- infected human epithelial cells in vitro over the chlamydial developmental cycle. We detected both conserved and distinct temporal changes to genome-wide chromatin accessibility associated with C. trachomatis infection. The observed diferentially accessible chromatin regions include temporally-enriched sets of transcription factors, which may help shape the host cell response to infection. These regions and motifs were linked to genomic features and genes associated with immune responses, re-direction of host cell nutrients, intracellular signalling, cell–cell adhesion, extracellular matrix, metabolism and apoptosis.
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Integration of Protein Binding Interfaces and Abundance
    INTEGRATION OF PROTEIN BINDING INTERFACES AND ABUNDANCE DATA REVEALS EVOLUTIONARY PRESSURES IN PROTEIN NETWORKS by David Orestis Holland A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy. Baltimore, Maryland January, 2018 © David O. Holland 2018 All rights reserved Abstract Networks of protein-protein interactions have received considerable interest in the past two decades for their insights about protein function and evolution. Traditionally, these networks only map the functional partners of proteins; they lack further levels of data such as binding affinity, allosteric regulation, competitive vs noncompetitive binding, and protein abundance. Recent experiments have made such data on a network-wide scale available, and in this thesis I integrate two extra layers of data in particular: the binding sites that proteins use to interact with their partners, and the abundance or “copy numbers” of the proteins. By analyzing the networks for the clathrin-mediated endocytosis (CME) system in yeast and the ErbB signaling pathway in humans, I find that this extra data reveals new insights about the evolution of protein networks. The structure of the binding site or interface interaction network (IIN) is optimized to allow higher binding specificity; that is, a high gap in strength between functional binding and nonfunctional mis-binding. This strongly implies that mis-binding is an evolutionary error-load constraint shaping protein network structure. Another method to limit mis-binding is to balance protein copy numbers so that there are no “leftover” proteins available for mis-binding. By developing a new method to quantify balance in IINs, I show that ii the CME network is significantly balanced when compared to randomly sampled sets of copy numbers.
    [Show full text]
  • High-Density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma
    ANTICANCER RESEARCH 34: 6405-6416 (2014) High-density Array Comparative Genomic Hybridization Detects Novel Copy Number Alterations in Gastric Adenocarcinoma ALINE DAMASCENO SEABRA1,2*, TAÍSSA MAÍRA THOMAZ ARAÚJO1,2*, FERNANDO AUGUSTO RODRIGUES MELLO JUNIOR1,2, DIEGO DI FELIPE ÁVILA ALCÂNTARA1,2, AMANDA PAIVA DE BARROS1,2, PAULO PIMENTEL DE ASSUMPÇÃO2, RAQUEL CARVALHO MONTENEGRO1,2, ADRIANA COSTA GUIMARÃES1,2, SAMIA DEMACHKI2, ROMMEL MARIO RODRÍGUEZ BURBANO1,2 and ANDRÉ SALIM KHAYAT1,2 1Human Cytogenetics Laboratory and 2Oncology Research Center, Federal University of Pará, Belém Pará, Brazil Abstract. Aim: To investigate frequent quantitative alterations gastric cancer is the second most frequent cancer in men and of intestinal-type gastric adenocarcinoma. Materials and the third in women (4). The state of Pará has a high Methods: We analyzed genome-wide DNA copy numbers of 22 incidence of gastric adenocarcinoma and this disease is a samples and using CytoScan® HD Array. Results: We identified public health problem, since mortality rates are above the 22 gene alterations that to the best of our knowledge have not Brazilian average (5). been described for gastric cancer, including of v-erb-b2 avian This tumor can be classified into two histological types, erythroblastic leukemia viral oncogene homolog 4 (ERBB4), intestinal and diffuse, according to Laurén (4, 6, 7). The SRY (sex determining region Y)-box 6 (SOX6), regulator of intestinal type predominates in high-risk areas, such as telomere elongation helicase 1 (RTEL1) and UDP- Brazil, and arises from precursor lesions, whereas the diffuse Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 type has a similar distribution in high- and low-risk areas and (B4GALT5).
    [Show full text]
  • Genomic Sequence of the Aflatoxigenic Filamentous Fungus Aspergillus Nomius Geromy G
    Moore et al. BMC Genomics (2015) 16:551 DOI 10.1186/s12864-015-1719-6 RESEARCH ARTICLE Open Access Genomic sequence of the aflatoxigenic filamentous fungus Aspergillus nomius Geromy G. Moore*, Brian M. Mack and Shannon B. Beltz Abstract Background: Aspergillus nomius is an opportunistic pathogen and one of the three most important producers of aflatoxins in section Flavi. This fungus has been reported to contaminate agricultural commodities, but it has also been sampled in non-agricultural areas so the host range is not well known. Having a similar mycotoxin profile as A. parasiticus, isolates of A. nomius are capable of secreting B- and G- aflatoxins. Results: In this study we discovered that the A. nomius type strain (NRRL 13137) has a genome size of approximately 36 Mb which is comparable to other Aspergilli whose genomes have been sequenced. Its genome encompasses 11,918 predicted genes, 72 % of which were assigned GO terms using BLAST2GO. More than 1,200 of those predicted genes were identified as unique to A. nomius, and the most significantly enriched GO category among the unique genes was oxidoreducatase activity. Phylogenomic inference shows NRRL 13137 as ancestral to the other aflatoxigenic species examined from section Flavi. This strain contains a single mating-type idiomorph designated as MAT1-1. Conclusions: This study provides a preliminary analysis of the A. nomius genome. Given the recently discovered potential for A. nomius to undergo sexual recombination, and based on our findings, this genome sequence provides an additional evolutionary reference point for studying the genetics and biology of aflatoxin production. Keywords: Aspergillus nomius, Genome sequence, Gene ontology, Phylogenomics, Mating-type locus Background to misidentification.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Milger Et Al. Pulmonary CCR2+CD4+ T Cells Are Immune Regulatory And
    Milger et al. Pulmonary CCR2+CD4+ T cells are immune regulatory and attenuate lung fibrosis development Supplemental Table S1 List of significantly regulated mRNAs between CCR2+ and CCR2- CD4+ Tcells on Affymetrix Mouse Gene ST 1.0 array. Genewise testing for differential expression by limma t-test and Benjamini-Hochberg multiple testing correction (FDR < 10%). Ratio, significant FDR<10% Probeset Gene symbol or ID Gene Title Entrez rawp BH (1680) 10590631 Ccr2 chemokine (C-C motif) receptor 2 12772 3.27E-09 1.33E-05 9.72 10547590 Klrg1 killer cell lectin-like receptor subfamily G, member 1 50928 1.17E-07 1.23E-04 6.57 10450154 H2-Aa histocompatibility 2, class II antigen A, alpha 14960 2.83E-07 1.71E-04 6.31 10590628 Ccr3 chemokine (C-C motif) receptor 3 12771 1.46E-07 1.30E-04 5.93 10519983 Fgl2 fibrinogen-like protein 2 14190 9.18E-08 1.09E-04 5.49 10349603 Il10 interleukin 10 16153 7.67E-06 1.29E-03 5.28 10590635 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10598013 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10475517 AA467197 expressed sequence AA467197 /// microRNA 147 433470 7.32E-04 2.68E-02 4.96 10503098 Lyn Yamaguchi sarcoma viral (v-yes-1) oncogene homolog 17096 3.98E-08 6.65E-05 4.89 10345791 Il1rl1 interleukin 1 receptor-like 1 17082 6.25E-08 8.08E-05 4.78 10580077 Rln3 relaxin 3 212108 7.77E-04 2.81E-02 4.77 10523156 Cxcl2 chemokine (C-X-C motif) ligand 2 20310 6.00E-04 2.35E-02 4.55 10456005 Cd74 CD74 antigen
    [Show full text]