DOCSLIB.ORG

Translocation Study of Some Zooxanthellae Clade to the Survival and Growth of Goniastrea Aspera After Bleaching

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Translocation Study of Some Zooxanthellae Clade to the Survival and Growth of Goniastrea Aspera After Bleaching Available online at IJMARCC, Website: http://ejournal.undip.ac.id/index.php/ijmarcc International Journal o Marine and Aquatic Resource Conservation and Co-existence Research Article, 1 (1): 50-56, October 2014 ,ranslocation Stud. o Some /ooxanthellae Clade to the Survival and 0ro1th o Goniastrea aspera a ter 2leaching Pujiono W. Purnomo Faculty of Fisheries and Marine Science, Diponegoro University Jl. Prof. Soedarto S). UNDIP, Tembalang, Semarang 027 , Indonesia .-mail / purnomopoed0gmail.com Received/ April 12, 2012, Accepted/ June 13, 2012 A2S,RAC, Inter-host translocation technique of 4ooxanthellae was attempted to prove 6uddemier and Futin7s 81993) theory on adaptation. The recent trend of coral products trading must be anticipated by its mass production through artificial techniques, the alternation of natural resources. Translocation bio-technique of 4ooxanthellae on coral was expected to resolve the problem and the translocation study should provide fundamental answer to coral recovery. The study of 4ooxanthellae translocation was proposed to/ a) .valuate the effect of 4ooxanthellae enrichment on its translocation on coral polyp tissue efter optimum bleaching and b) Investigate the effect of translocation on coral growth. The research was experimental, involving coral species Goneastrea aspera, and purified 4ooxanthellae clade A, 6 and C with circulating incubation condition in 6P66AP Jepara indoor area. The experiment took place for 30 weeks in both model environment waters and natural environment waters of Jepara Panjang Island coral area from March to August 2008. The result showed that/ a) In the artificial waters, translocation 4ooxanthellae to polyp tissue of Goneastrea aspera occured at day 17 and more fast in the natural waters; b) In the controlling of temperature environment on translocation provided positive response of Goneastrea aspera7s normal life, relocation and growth rate of 4ooxanthellae as in nature and c) recognition, resettlement, and growth process of 4ooxanthellae made it possible for Goneastrea aspera to grow normally in natural waters. 5e. 1ords: Clade, bleaching, recognition, resettlement, growth, translocation, zooxanthellae, Goneastrea aspera IN,RO78C,ION 82001) found that Foraminifera is infected especially by Symbiodinium clade type F. 6esides that, it is also found the Symbiosis of 4ooxanthellae and coral in the sea is an nature of hori4ontal infection which is a phenomenon of occasion that preceded the merging of 4ooxanthellae and coral. symbiotic relationship to the host that happens from the According to )oegh-Guldberg and )inde 81983) the external environment 8Coffort and Santos, 200 ). It states that mechanisms of symbiosis occur in ways/ the first is from initially infected by a certain clade probably evolved symbion planula larvae 86aker, 2003; Pochon et al., 2001). The second until adulthood. 6ut in its development when the infection through a chemosensory mechanism, which is a process of occurs openly, then a new clade will devise a new form to infection that is predicated on the attractant such as ammonium enrich the former clade. and nitrate that stimulates 4ooxanthellae to perform symbiotic The phenomenon of coral bleaching as an early indication with coral. The third is called intermediate host. The fourth is of environmental pressures to the reefs and potential of the through predator feces. The fifth is a random contact that enriched clade in the host is alive or survived due to the encounters due to the planktonic nature of 4ooxanthellae. pressure are being the trigger ideas of coral reefs recovery Random contacts resumed the process of .ndocytosis if they in process as a result of degradation. If such limitations either harmony. natural or anthropogenic pressures that occur is associated with DNA diversity of 4ooxanthellae in the coral polyp7s tissues the evidence of such a recovery have been reported by is hinged to the infection process. Infection of 4ooxanthellae Suharsono 81998) in the global after bleaching coral reefs of can occur in vertical and hori4ontal mechanism 8Coffort and the Seribu island, then questions about the reefs form and Santos, 200 ). The vertical mechanism for infections mention structure are still not informed can be supported by the early is through derivative 8Aa Jeunesse et al., 2003). In this expected results of this research. Study of 4ooxanthellae case of 4ooxanthellae C17 type only found on Montipora Spp; translocations aims to/ 8a) evaluate the effects of optimum C22 type only found on Turbinaria Spp and C27 type found on enriched 4ooxanthellae to translocation on the coral polyp the Pavona variants at a depth of 10 meters. Pochon et al. tissues after bleaching and 8b) examine the effect of translocation to the survival and growth of coral. © Copyright by The International Journal of Marine and Aquatic Resources Conservation and Co-existence 0 1 International Journal of Marine and Aquatic Resource Conservation and Co-existence 1 81)/ 0- 3, 2012 Pujiono B. Purnomo MA,ERIAL AN7 ME,HO7 sorbitan); Sigma Chemical CoJ, of 10 mA. Eooxanthellae cells be rinsed again with a DNA isolation buffers 8DNA6 / 0.2 M The material is 4ooxanthellae A, 6 and C clades, as well as NaCl; 0 mM .DTA, p) 8.0) in a microcentrifuge tubes and coral Gonistrea aspera. be resuspention in 0.2 ml DNA6 with sodium dodecyl sulfat 8SDS) as final consentration 1F 8vIv). The liquid is then heated Setup Equipment at 3 CC for 30 minutes, then be incubated by adding Proteinase K 86oehringer Mannheim 6iochemicals) 0. mg ml- Incubation container which irrigated with the results of 1 on the temperature of 37-2 CC for 3 hours. Nucleic acids of mass growth and genetic diversity of 4ooxanthellae type A, 6 such material be precipitated with the addition of 100 LA 0.3 M and C clades. The maintained media are temperature less than sodium asetat, and be precipitated again by ethanol. The 2 CC and green lighting with the mass growth technique residue is resuspention with 0 Ll of pure water and stored in following the way of Purnomo 8in progress). 1 ton mass temperature -20 CC. After that DNA amplification is done 4ooxanthellae tank that has been purified is connected to the according to techniques of Rowan dan Power 81991) using coral incubation tank of tons. In the coral incubation tank is universal primer ss 8 7GGGTTGATCCTGCCAGTAGT made a collecting tab of a half ton. From the collecting tab is CATATGCT TG-37) and ss3 8 7GGCAGTTATA- pumped back to the mass tank. ATTTATTTGATGGTCACTGCTAC- 37). Reagent to analise PCR containing 2 Ll DNA template 8target), 10 LA 10 x buffer Execution o the Translocations Research solution PCR 81 M Tris-)Cl, p) / 8.3); 3 LA of 2 mM MgCl2; 1. mM total dNTPs, 30 pmol from each primary and 0. LA The research starts with acclimati4ation, subsequently Taqpolymerase 8 unit LA-1); overall is 100 LA. The process of shock temperature application, 4ooxanthellae enrichment and amplification using the DNA thermal cycler 8express PCR, growth experiment. Acclimati4ation is done in 10 tons tank for )ybaid) follows the setting temperature profile/ 92 CC for 1 2 days. The acclimati4ed number of Goneastreaa aspera minute; 3 CC for 2 minutes and 72 CC for 3 minutes. Overall, colonies as many as 37. Shock temperatures impose to the the treatment was implemented in 30 cycles. The en4yme used specimen of Goneastrea aspera on 33 CC for 3 hours 8Purnomo in bond termination of base on the tested sample using )aelll et al., 2010). Initial 4ooxanthellae used as an enrichment factor types. The result of restriction using )aelll en4yme obtained are/ 8a) A Clade of 18.23 x 10 ind A-1, 8b) 6 Clade of 21.19 x DNA ribbons with polymorphic DNA si4e to measure the base 10 ind l-1, and 8c) C Clade of 19,82 x 10 ind l-1. In the pair 8bp) value of tested Eooxanthellae. The value of base pair estimated 4ooxanthellae infection to the coral polyp tissues has is then tested its similarity to the base pair value obtained from happened 8phase I in 10 days and phase II in 17 days), Gen6ank through phylogenic analysis using SAS 9.1 program. separation be conducted for coral sample of Goneastrea aspera from the incubation media into natural environment of )ater quality Analysis the southern of Panjang Island Jepara to examine its growth. The growth study was done using pigmentation the technique Bater quality variables measured are temperature, salinity, of Alyzarin Red 8Sya7rani, 1993). dissolved oxygen and p) which measured on a daily based for the incubation tank and a weekly based at the sea, while The Independent Test ammonia and nitrite are measured either in the tank or at the sea weekly. Measurement of the colony growth was done by measuring the length of CaCO3 deposit on each corralite of 1 specimen Data Evaluation Goniastrea aspera. Measurement of Eooxanthellae consentration was .valuation of 4ooxanthellae translocation in the coral polyp conducted in three weeks period. Initially decalcification was tissue are tracing by the growth, survival, density development performed by taking some specimen to be dissolved in a of 4ooxanthellae, infection of 4ooxanthellae, replacement solution of F )Cl concentrate for 28 hours 8Nordemar et al., profile of 4ooxanthellae hystologically. Synergisme among 2003). After decalcification, the tissue rinsed and homogeni4ed collected data will be a benchmarks for the success of in 10 mA distillated water for 10-1 minutes with speed 3,000 translocation. rpm. Supernatant containing 4ooxanthellae then analy4ed using Sedgwick rafter. RES8L, AN7 7ISC8SSION DNA Diversity Results Test of 4ooxanthellae DNA diversity using PCRGRFAP *ooxanthellae Diversity and its Replacement on Polyp+ tissues 8Restriction Fragment Length Poloymorphisme) method. .ach Eooxanthellae DNA testing is done in two incubation clade of Eooxanthellae is bred up to 1 liter with high density stages, i.e. 10 days incubation 8Test phase 1) and days 8Test and be filtrated gradually with the speed of 3,000 rpm for 10 phase II).
Load more

Recommended publications
  • Platyhelminthes, Nemertea, and "Aschelminthes" - A
    BIOLOGICAL SCIENCE FUNDAMENTALS AND SYSTEMATICS – Vol. III - Platyhelminthes, Nemertea, and "Aschelminthes" - A. Schmidt-Rhaesa PLATYHELMINTHES, NEMERTEA, AND “ASCHELMINTHES” A. Schmidt-Rhaesa University of Bielefeld, Germany Keywords: Platyhelminthes, Nemertea, Gnathifera, Gnathostomulida, Micrognathozoa, Rotifera, Acanthocephala, Cycliophora, Nemathelminthes, Gastrotricha, Nematoda, Nematomorpha, Priapulida, Kinorhyncha, Loricifera Contents 1. Introduction 2. General Morphology 3. Platyhelminthes, the Flatworms 4. Nemertea (Nemertini), the Ribbon Worms 5. “Aschelminthes” 5.1. Gnathifera 5.1.1. Gnathostomulida 5.1.2. Micrognathozoa (Limnognathia maerski) 5.1.3. Rotifera 5.1.4. Acanthocephala 5.1.5. Cycliophora (Symbion pandora) 5.2. Nemathelminthes 5.2.1. Gastrotricha 5.2.2. Nematoda, the Roundworms 5.2.3. Nematomorpha, the Horsehair Worms 5.2.4. Priapulida 5.2.5. Kinorhyncha 5.2.6. Loricifera Acknowledgements Glossary Bibliography Biographical Sketch Summary UNESCO – EOLSS This chapter provides information on several basal bilaterian groups: flatworms, nemerteans, Gnathifera,SAMPLE and Nemathelminthes. CHAPTERS These include species-rich taxa such as Nematoda and Platyhelminthes, and as taxa with few or even only one species, such as Micrognathozoa (Limnognathia maerski) and Cycliophora (Symbion pandora). All Acanthocephala and subgroups of Platyhelminthes and Nematoda, are parasites that often exhibit complex life cycles. Most of the taxa described are marine, but some have also invaded freshwater or the terrestrial environment. “Aschelminthes” are not a natural group, instead, two taxa have been recognized that were earlier summarized under this name. Gnathifera include taxa with a conspicuous jaw apparatus such as Gnathostomulida, Micrognathozoa, and Rotifera. Although they do not possess a jaw apparatus, Acanthocephala also belong to Gnathifera due to their epidermal structure. ©Encyclopedia of Life Support Systems (EOLSS) BIOLOGICAL SCIENCE FUNDAMENTALS AND SYSTEMATICS – Vol.
    [Show full text]
  • Spongejaspis Sp-Associated Bacteria Producing Protease Inhibitor
    ORIGINAL ARTICLE Spongejaspis sp-Associated Bacteria Producing Protease Inhibitor DEDE MAHDIYAH1,2, ARIS TRI WAHYUDI3, WIDANARNI3, HELMIA FARIDA4 1 Sari Mulia University, Banjarmasin, Indonesia 2Doctoral Programm, Faculty of Medicine, Diponegoro University, Semarang, Indonesia 3Bogor Agricultural University, Bogor, Indonesia 4Faculty of Medicine, Diponegoro University, Semarang, Indonesia Correspondence to Dr. Dede Mahdiyah, Email :[email protected], Telp: +62-82250812565 ABSTRACT Background: Proteaseinhibitors are important in medicine, particularly in disabling proteases in the pathogenic processes of human diseases such as arthritis, cancer,HIV/AIDS and other infections. Sponges are excellent sources forbioactive compounds such as enzyme inhibitors, antiviral, antimicrobial. Aim: To explore sponge-associated bacteria as sources of protease inhibitors. Methods:This was an explorative descriptive study. Bacteria isolated from sponge Jaspis sp were screened using sea water complete and skim-milk double-layer plate. When the screening test positive, the activity of protease inhibitors was assessed using three substrates i.e proteinase-K, crude extract of protease (CEP) from Staphylococcus aureus, Pseudomonasaeruginosa, Enteropathogenic Escherichiacoli(EPEC) K11, and subtilisin. Optimum incubation time, temperature, and pH were determined to measure the activity ofthe protease inhibitors. Phenotypical characterization was performed using Gram and Microbact-kit. 16S-rRNA sequencing was done for identification. Results: Out of 136 isolates screened, three were positive for their potency as protease inhibitor producers, including oneGram-negative coccus and two Gram-positive cocci. The isolates showed protease inhibitor activity up to 90% toward the three substrates. The optimum time incubation toward three substratesranged 12-24 hours. The optimum temperatures for the three isolates were 30Co-60oC, 20o-30oC, and 30oC respectively.
    [Show full text]
  • Metabarcoding Analysis on European Coastal Samples Reveals New
    1 A research a rticle submitted to Scientific Reports 2 3 Metabarcoding analysis on European coastal samples 4 reveals new molecular metazoan diversity 5 6 David López -Escardó 1, Jordi Paps 2, Colomban de Vargas 3,4 , Ramon Massana 5, Iñaki 7 Ruiz -Trillo 1,6,7* , Javier del Campo 1,8* 8 Supplementary Figure Legends and Table s 9 Fig. S 1: Box plot distribution of relative metazoan abundance compar ed with all 10 eukaryotes. Relative abundance of metazoans compared to all eukaryotes in (a) 11 different oxic pelagic fractions, (b) different sites and in ( c) different depths. Note that 12 data is provided from just one sample in the anoxic sediments. 13 Fig. S2: Rarefaction curves . Rarefaction curves calculated with vegan from the 14 samples divided (a) by template (RNA or DNA) or (b) by env ironment keepig as well 15 divided the samples from RNA ( discontinuous line) or DNA ( continuous line ). Both 16 plots show the rarefaction curve of all the samples. 17 Fig. S3: Jackknife clustering analysis of phylogenetic composition of the samples . 18 The chart repr esents the relative abundance within metazoan phyla in each sample. 19 Samples from extracellular DNA and the ones with less than 100 reads (DNA+RNA) 20 were removed from the analysis. Sample characteristics are expressed in colors. On 21 the right site there is th e legend. RNA and DNA are expressed in white and black 22 respectively. Picoplanktonic, nanoplanktonic, micromesoplanktonic samples and the 23 samples from the sediments are representedwith yellow, green, dark red and purple 24 respectively.
    [Show full text]
  • The Evolutionary Pathways of Photoreceptors by Paul Nethercott
    The Evolutionary Pathways Of Photoreceptors By Paul Nethercott August 2014 www.CreationismOnline.com www.wikipedia.com Evolution Of Photoreceptors And Eyes Sorted By Phyletic Group Phylum Meaning Common name Eyes Species Acanthocephala Thorny headed worms Thorny‐headed worms None 756 Acoelomorpha Without gut Acoels None 1 Annelida Little ring Segmented worms Ocelli, Compound Eyes 17,000 Arthropoda Jointed foot Arthropods Ocelli, Compound Eyes 1,134,000 Brachiopoda Arm foot Lamp shells None 400 Bryozoa Moss animals Moss animals, sea mats None 5,000 Chaetognatha Longhair jaw Arrow worms Compound Eyes 100 Chordata With a cord Chordates Single Lense 100,000 Cnidaria Stinging nettle Coelenterates Ocelli, Single Lense 11,000 Ctenophora Comb bearer Comb jellies None 100 Cycliophora Wheel carrying Symbion None 3 Echinodermata Spiny skin Echinoderms Ocelli 7,000 Entoprocta Inside anus Goblet worm Ocelli 150 Gastrotricha Hair stomach Meiofauna Ocelli 690 Gnathostomulida Jaw orifice Jaw worms None 100 Hemichordata Half cord Acorn worms None 100 Kinorhyncha Motion snout Mud dragons Ocelli 150 Loricifera Corset bearer Brush heads None 122 Micrognathozoa Tiny jaw animals — None 1 Mollusca Soft Mollusks Ocelli 112,000 Nematoda Thread like Round worms Ocelli 100,000 Nematomorpha Thread form Horsehair worms None 320 Nemertea A sea nymph Ribbon worms Ocelli 1,200 Onychophora Claw bearer Velvet worms Ocelli 200 Orthonectida Straight swim None 20 Phoronida Zeus's mistress Horseshoe worms None 11 Placozoa Plate animals None 1 Platyhelminthes Flat worms Flat
    [Show full text]
  • Sulphur Oxidising Bacteria in Mangrove Ecosystem: a Review
    Vol. 13(29), pp. 2897-2907, 16 July, 2014 DOI: 10.5897/AJB2013.13327 Article Number: D2A2A3546087 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2014 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB Review Sulphur oxidising bacteria in mangrove ecosystem: A review B. C. Behera1, R. R. Mishra2, S. K. Dutta3 and H. N. Thatoi4* 1Department of Biotechnology, North Odisha University, Baripada -757003, Odisha, India. 2Department of Biotechnology, MITS School of Biotechnology, Bhubaneswar-751024, Odisha, India. 3Centre for Ecological Sciences, Indian Institute of Science, Bangalore - 560012, India. 4Department of Biotechnology, College of Engineering and Technology, Biju Pattnaik University of Technology, Bhubaneswar -751003, Odisha, India. Received 29 September, 2013; Accepted 16 June, 2014 Mangrove soils are anoxic, sulphidic and variable since their chemistry is regulated by a variety of factors such as texture, tidal range and elevation, redox state, bioturbation intensity, forest type, temperature and rainfall. Sulphur-oxidizing bacteria such as photoautotrophs, chemolithotrophs and heterotrophs play an important role in the mangrove environment for the oxidation of the toxic sulphide produced by sulphur reducing bacteria and act as a key driving force behind all sulphur transformations in the mangrove ecosystem which is most essential to maintain the sulphur cycle as well as eco health. These overviews summarizes the current state of knowledge of diversity and important biotechnological contributions of these microorganisms in agriculture, bio fertility, reduction of environmental pollution, maintenance of the productivity of ecosystems and also highlight areas in which further research is needed to increase our basic understanding of physiology, genomics and proteomics of these microorganisms which is most essential.
    [Show full text]
  • Evolutionary History of Nickel-Dependent Enzymes
    Evolutionary History of Nickel-Dependent Enzymes: Implications for the Origins of Life. Reem Hallak Degree project in biology, Master of science (2 years), 2020 Examensarbete i biologi 60 hp till masterexamen, 2020 Biology Education Centre and Department of Earth Sciences, Palaeobiology, Uppsala University Supervisors: Aodhán Butler and Anna Neubeck External opponent: Brenda Irene Medina Jimenez Table of Contents ABSTRACT .................................................................................................................................................. 5 INTRODUCTION ...................................................................................................................................... 6 METHODOLOGY ................................................................................................................................... 11 ▪ Brief Summary .................................................................................................................................................... 11 ▪ Operating Principle of HMMER ................................................................................................................. 11 ▪ Detailed Summary - Collecting Query Sequences ............................................................................ 13 a. From Published Study: ............................................................................................................................... 13 b. From Databases:..........................................................................................................................................
    [Show full text]
  • Host-Microbe Interactions in Octocoral Holobionts - Recent Advances and Perspectives Jeroen A
    van de Water et al. Microbiome (2018) 6:64 https://doi.org/10.1186/s40168-018-0431-6 REVIEW Open Access Host-microbe interactions in octocoral holobionts - recent advances and perspectives Jeroen A. J. M. van de Water* , Denis Allemand and Christine Ferrier-Pagès Abstract Octocorals are one of the most ubiquitous benthic organisms in marine ecosystems from the shallow tropics to the Antarctic deep sea, providing habitat for numerous organisms as well as ecosystem services for humans. In contrast to the holobionts of reef-building scleractinian corals, the holobionts of octocorals have received relatively little attention, despite the devastating effects of disease outbreaks on many populations. Recent advances have shown that octocorals possess remarkably stable bacterial communities on geographical and temporal scales as well as under environmental stress. This may be the result of their high capacity to regulate their microbiome through the production of antimicrobial and quorum-sensing interfering compounds. Despite decades of research relating to octocoral-microbe interactions, a synthesis of this expanding field has not been conducted to date. We therefore provide an urgently needed review on our current knowledge about octocoral holobionts. Specifically, we briefly introduce the ecological role of octocorals and the concept of holobiont before providing detailed overviews of (I) the symbiosis between octocorals and the algal symbiont Symbiodinium; (II) the main fungal, viral, and bacterial taxa associated with octocorals; (III) the dominance of the microbial assemblages by a few microbial species, the stability of these associations, and their evolutionary history with the host organism; (IV) octocoral diseases; (V) how octocorals use their immune system to fight pathogens; (VI) microbiome regulation by the octocoral and its associated microbes; and (VII) the discovery of natural products with microbiome regulatory activities.
    [Show full text]
  • Phylogenomic Methods Assessing the Root of Bilaterian Animals with Scalable
    Downloaded from rspb.royalsocietypublishing.org on 10 November 2009 Assessing the root of bilaterian animals with scalable phylogenomic methods Andreas Hejnol, Matthias Obst, Alexandros Stamatakis, Michael Ott, Greg W. Rouse, Gregory D. Edgecombe, Pedro Martinez, Jaume Baguñà, Xavier Bailly, Ulf Jondelius, Matthias Wiens, Werner E. G. Müller, Elaine Seaver, Ward C. Wheeler, Mark Q. Martindale, Gonzalo Giribet and Casey W. Dunn Proc. R. Soc. B 2009 276, 4261-4270 first published online 16 September 2009 doi: 10.1098/rspb.2009.0896 Supplementary data "Data Supplement" http://rspb.royalsocietypublishing.org/content/suppl/2009/09/15/rspb.2009.0896.DC1.h tml References This article cites 40 articles, 6 of which can be accessed free http://rspb.royalsocietypublishing.org/content/276/1677/4261.full.html#ref-list-1 Subject collections Articles on similar topics can be found in the following collections taxonomy and systematics (160 articles) bioinformatics (66 articles) evolution (1169 articles) Receive free email alerts when new articles cite this article - sign up in the box at the top Email alerting service right-hand corner of the article or click here To subscribe to Proc. R. Soc. B go to: http://rspb.royalsocietypublishing.org/subscriptions This journal is © 2009 The Royal Society Downloaded from rspb.royalsocietypublishing.org on 10 November 2009 Proc. R. Soc. B (2009) 276, 4261–4270 doi:10.1098/rspb.2009.0896 Published online 16 September 2009 Assessing the root of bilaterian animals with scalable phylogenomic methods Andreas Hejnol1,*, Matthias Obst2, Alexandros Stamatakis3, Michael Ott3,GregW.Rouse4, Gregory D. Edgecombe5, Pedro Martinez6, Jaume Bagun˜ a` 6, Xavier Bailly7, Ulf Jondelius8, Matthias Wiens9, Werner E.
    [Show full text]
  • Animal Phylogeny and the Ancestry of Bilaterians: Inferences from Morphology and 18S Rdna Gene Sequences
    EVOLUTION & DEVELOPMENT 3:3, 170–205 (2001) Animal phylogeny and the ancestry of bilaterians: inferences from morphology and 18S rDNA gene sequences Kevin J. Peterson and Douglas J. Eernisse* Department of Biological Sciences, Dartmouth College, Hanover NH 03755, USA; and *Department of Biological Science, California State University, Fullerton CA 92834-6850, USA *Author for correspondence (email: [email protected]) SUMMARY Insight into the origin and early evolution of the and protostomes, with ctenophores the bilaterian sister- animal phyla requires an understanding of how animal group, whereas 18S rDNA suggests that the root is within the groups are related to one another. Thus, we set out to explore Lophotrochozoa with acoel flatworms and gnathostomulids animal phylogeny by analyzing with maximum parsimony 138 as basal bilaterians, and with cnidarians the bilaterian sister- morphological characters from 40 metazoan groups, and 304 group. We suggest that this basal position of acoels and gna- 18S rDNA sequences, both separately and together. Both thostomulids is artifactal because for 1000 replicate phyloge- types of data agree that arthropods are not closely related to netic analyses with one random sequence as outgroup, the annelids: the former group with nematodes and other molting majority root with an acoel flatworm or gnathostomulid as the animals (Ecdysozoa), and the latter group with molluscs and basal ingroup lineage. When these problematic taxa are elim- other taxa with spiral cleavage. Furthermore, neither brachi- inated from the matrix, the combined analysis suggests that opods nor chaetognaths group with deuterostomes; brachiopods the root lies between the deuterostomes and protostomes, are allied with the molluscs and annelids (Lophotrochozoa), and Ctenophora is the bilaterian sister-group.
    [Show full text]
  • Ultrastructural Studies on the Blue-Green Algal Symbiont in Korschikoff
    ULTRASTRUCTURAL STUDIES ON THE BLUE-GREEN ALGAL SYMBIONT IN CYANOPHORA PARADOXA KORSCHIKOFF WILLIAM T. HALL, Ph.D., and GEORGE CLAUS, D.Se. From The Rockefeller Institute and New York University Medical Center, New York ABSTRACT Studies conducted on the ultrastructurc of Cyanophoraparadoxa Korschikoff (a cryptomonad) have shown that its intracellular symbiont is closely related to unicellular blue-green algae. Due to its peculiar habitat, the intracellular symbiont lacks the characteristic cyanophyccan double-layered cell wall, but is surrounded by a thin protoplasmic membrane. The proto- plasm itself is differentiated into a lamellated chromatoplasm containing photosynthetic pigments, polyphosphate granules, and possible oil droplets, and a non-lamellar centro- plasm with a large centrally located electron-opaque body surrounded by a fibril-containing halo. 2-his halo-central body complex may be nuclear in nature. Binary fission of the or- ganism is described. Since this cyanelle has not yet been classified, we name it Cyano- cyta korschikofftana nov. gen. nov. sp.; and because of its structural peculiarities, we find it necessary to create a new family for it, Cyanocytaceae, in the order Chroococcales. INTRODUCTION With the term "Syncyanosen," Pascher (1914) that organism found within the flagellate Cyano- described the general phenomenon of a blue-green phora paradoxa Korschikoff (Fig. 1). Although this alga living symbiotically with a colorless protist. intracellular symbiont is one of the most In his paper, he reported cases in which the cyano- thoroughly studied of the cyanelles ("Cyanellen"-- phyte was attached on the external surface of the Pascher, 1929), its nature still remains a paradox. host organism. In 1924, Korschikoff published a Investigators since Korschikoff point out the great description of a flagellate containing in its proto- similarity of the organism to blue-green algae.
    [Show full text]
  • Marine Pharmacognosy Semester(S) in Which the II Module Is Taught Person Responsible for the Prof
    MODULE 5 Module name Natural Medicine Module level, if Bachelor applicable Code, if applicable 336N1122 Subtitle, if applicable - Courses, if applicable Marine Pharmacognosy Semester(s) in which the II module is taught Person responsible for the Prof. Dr. Gemini Alam, Apt module Prof. Dr. Gemini Alam, Apt Lecturer Dr. rer-nat, Elmi Nurhaidah Zainuddin, DES. Language Bahasa Compulsory in semester II for Bachelor degree in Relation curriculum Pharmacy Lectures (2 hours) Type of teaching, contact Group Discussions/Group Discussions/Tutorial (1 hr) hours Practical Sessions (3 hours) Contact hours: 16 weeks x 3 hours Workload Independent study: 15 weeks x 3 hours Practical sessions: 15 weeks x 3 hours Credit points 2 SKS OR 3.4 CP (ECTS) Requirements according Attendance policy: Absence greater than 20% of the to the examination material are not eligible for final and/or practical exam. regulations Recommended Completion of modules: prerequisites After the completion of this module, participants will gain knowledge, skill and competence as follows: Knowledge: Participants will be able to: • Be able to describe and identify natural product including bacterial symbiont, plants, animal from marines Module • Be able to describe the synthesis of objective/intended secondary metabolites from marine Learning outcomes organisme • Be able to describe how the chemichal pattern primary and secondary metabolites from marine organisme and their medicinal purposes. Skill: • Participant will be able to present their opinion/argument sistematically based
    [Show full text]
  • A Comparative Study of Symbion Pandora and S. Americanus
    Helgol Mar Res (2010) 64:257–262 DOI 10.1007/s10152-010-0204-5 SHORT COMMUNICATION External morphology of the cycliophoran dwarf male: a comparative study of Symbion pandora and S. americanus Ricardo Cardoso Neves • Marina Ribeiro da Cunha • Peter Funch • Andreas Wanninger • Reinhardt Møbjerg Kristensen Received: 29 January 2010 / Revised: 26 April 2010 / Accepted: 27 April 2010 / Published online: 15 May 2010 Ó Springer-Verlag and AWI 2010 Abstract Cycliophora is a recently described phylum to pouch that encloses the penis. We compare our findings on which only two species have been assigned so far, Symbion both Symbion species with the data currently available on pandora and S. americanus. The cycliophoran life cycle is other metazoan dwarf males. complex and alternates between asexual and sexual stages. Although not recognized as an entirely independent free- Keywords Sexual reproduction Á Life cycle Á swimming stage when the phylum was first described, the Scanning electron microscopy Á Spiralia Á Lophotrochozoa Á dwarf male has a remarkably complex bodyplan albeit its Cycliophora very small size (approx. 30–40 lm in length). Aiming to increase the knowledge on the gross morphology of the cycliophoran dwarf male, specimens from S. pandora and Introduction S. americanus were analyzed by scanning electron microscopy. In both species, anterior and ventral ciliated Cycliophora is a metazoan phylum recently erected to fields, as well as paired lateral sensorial organs, were accommodate minute marine invertebrates that live com- identified, thus confirming previous observations. How- mensally on clawed lobsters. So far, only two species have ever, new details are described herein such as the penial been described, Symbion pandora Funch and Kristensen, 1995 and Symbion americanus Obst, Funch & Kristensen, 2006, which live on the mouthparts of the Norwegian lobster Communicated by H.-D.
    [Show full text]