Translocation Study of Some Zooxanthellae Clade to the Survival and Growth of Goniastrea Aspera After Bleaching

Translocation Study of Some Zooxanthellae Clade to the Survival and Growth of Goniastrea Aspera After Bleaching

Available online at IJMARCC, Website: http://ejournal.undip.ac.id/index.php/ijmarcc International Journal o Marine and Aquatic Resource Conservation and Co-existence Research Article, 1 (1): 50-56, October 2014 ,ranslocation Stud. o Some /ooxanthellae Clade to the Survival and 0ro1th o Goniastrea aspera a ter 2leaching Pujiono W. Purnomo Faculty of Fisheries and Marine Science, Diponegoro University Jl. Prof. Soedarto S). UNDIP, Tembalang, Semarang 027 , Indonesia .-mail / purnomopoed0gmail.com Received/ April 12, 2012, Accepted/ June 13, 2012 A2S,RAC, Inter-host translocation technique of 4ooxanthellae was attempted to prove 6uddemier and Futin7s 81993) theory on adaptation. The recent trend of coral products trading must be anticipated by its mass production through artificial techniques, the alternation of natural resources. Translocation bio-technique of 4ooxanthellae on coral was expected to resolve the problem and the translocation study should provide fundamental answer to coral recovery. The study of 4ooxanthellae translocation was proposed to/ a) .valuate the effect of 4ooxanthellae enrichment on its translocation on coral polyp tissue efter optimum bleaching and b) Investigate the effect of translocation on coral growth. The research was experimental, involving coral species Goneastrea aspera, and purified 4ooxanthellae clade A, 6 and C with circulating incubation condition in 6P66AP Jepara indoor area. The experiment took place for 30 weeks in both model environment waters and natural environment waters of Jepara Panjang Island coral area from March to August 2008. The result showed that/ a) In the artificial waters, translocation 4ooxanthellae to polyp tissue of Goneastrea aspera occured at day 17 and more fast in the natural waters; b) In the controlling of temperature environment on translocation provided positive response of Goneastrea aspera7s normal life, relocation and growth rate of 4ooxanthellae as in nature and c) recognition, resettlement, and growth process of 4ooxanthellae made it possible for Goneastrea aspera to grow normally in natural waters. 5e. 1ords: Clade, bleaching, recognition, resettlement, growth, translocation, zooxanthellae, Goneastrea aspera IN,RO78C,ION 82001) found that Foraminifera is infected especially by Symbiodinium clade type F. 6esides that, it is also found the Symbiosis of 4ooxanthellae and coral in the sea is an nature of hori4ontal infection which is a phenomenon of occasion that preceded the merging of 4ooxanthellae and coral. symbiotic relationship to the host that happens from the According to )oegh-Guldberg and )inde 81983) the external environment 8Coffort and Santos, 200 ). It states that mechanisms of symbiosis occur in ways/ the first is from initially infected by a certain clade probably evolved symbion planula larvae 86aker, 2003; Pochon et al., 2001). The second until adulthood. 6ut in its development when the infection through a chemosensory mechanism, which is a process of occurs openly, then a new clade will devise a new form to infection that is predicated on the attractant such as ammonium enrich the former clade. and nitrate that stimulates 4ooxanthellae to perform symbiotic The phenomenon of coral bleaching as an early indication with coral. The third is called intermediate host. The fourth is of environmental pressures to the reefs and potential of the through predator feces. The fifth is a random contact that enriched clade in the host is alive or survived due to the encounters due to the planktonic nature of 4ooxanthellae. pressure are being the trigger ideas of coral reefs recovery Random contacts resumed the process of .ndocytosis if they in process as a result of degradation. If such limitations either harmony. natural or anthropogenic pressures that occur is associated with DNA diversity of 4ooxanthellae in the coral polyp7s tissues the evidence of such a recovery have been reported by is hinged to the infection process. Infection of 4ooxanthellae Suharsono 81998) in the global after bleaching coral reefs of can occur in vertical and hori4ontal mechanism 8Coffort and the Seribu island, then questions about the reefs form and Santos, 200 ). The vertical mechanism for infections mention structure are still not informed can be supported by the early is through derivative 8Aa Jeunesse et al., 2003). In this expected results of this research. Study of 4ooxanthellae case of 4ooxanthellae C17 type only found on Montipora Spp; translocations aims to/ 8a) evaluate the effects of optimum C22 type only found on Turbinaria Spp and C27 type found on enriched 4ooxanthellae to translocation on the coral polyp the Pavona variants at a depth of 10 meters. Pochon et al. tissues after bleaching and 8b) examine the effect of translocation to the survival and growth of coral. © Copyright by The International Journal of Marine and Aquatic Resources Conservation and Co-existence 0 1 International Journal of Marine and Aquatic Resource Conservation and Co-existence 1 81)/ 0- 3, 2012 Pujiono B. Purnomo MA,ERIAL AN7 ME,HO7 sorbitan); Sigma Chemical CoJ, of 10 mA. Eooxanthellae cells be rinsed again with a DNA isolation buffers 8DNA6 / 0.2 M The material is 4ooxanthellae A, 6 and C clades, as well as NaCl; 0 mM .DTA, p) 8.0) in a microcentrifuge tubes and coral Gonistrea aspera. be resuspention in 0.2 ml DNA6 with sodium dodecyl sulfat 8SDS) as final consentration 1F 8vIv). The liquid is then heated Setup Equipment at 3 CC for 30 minutes, then be incubated by adding Proteinase K 86oehringer Mannheim 6iochemicals) 0. mg ml- Incubation container which irrigated with the results of 1 on the temperature of 37-2 CC for 3 hours. Nucleic acids of mass growth and genetic diversity of 4ooxanthellae type A, 6 such material be precipitated with the addition of 100 LA 0.3 M and C clades. The maintained media are temperature less than sodium asetat, and be precipitated again by ethanol. The 2 CC and green lighting with the mass growth technique residue is resuspention with 0 Ll of pure water and stored in following the way of Purnomo 8in progress). 1 ton mass temperature -20 CC. After that DNA amplification is done 4ooxanthellae tank that has been purified is connected to the according to techniques of Rowan dan Power 81991) using coral incubation tank of tons. In the coral incubation tank is universal primer ss 8 7GGGTTGATCCTGCCAGTAGT made a collecting tab of a half ton. From the collecting tab is CATATGCT TG-37) and ss3 8 7GGCAGTTATA- pumped back to the mass tank. ATTTATTTGATGGTCACTGCTAC- 37). Reagent to analise PCR containing 2 Ll DNA template 8target), 10 LA 10 x buffer Execution o the Translocations Research solution PCR 81 M Tris-)Cl, p) / 8.3); 3 LA of 2 mM MgCl2; 1. mM total dNTPs, 30 pmol from each primary and 0. LA The research starts with acclimati4ation, subsequently Taqpolymerase 8 unit LA-1); overall is 100 LA. The process of shock temperature application, 4ooxanthellae enrichment and amplification using the DNA thermal cycler 8express PCR, growth experiment. Acclimati4ation is done in 10 tons tank for )ybaid) follows the setting temperature profile/ 92 CC for 1 2 days. The acclimati4ed number of Goneastreaa aspera minute; 3 CC for 2 minutes and 72 CC for 3 minutes. Overall, colonies as many as 37. Shock temperatures impose to the the treatment was implemented in 30 cycles. The en4yme used specimen of Goneastrea aspera on 33 CC for 3 hours 8Purnomo in bond termination of base on the tested sample using )aelll et al., 2010). Initial 4ooxanthellae used as an enrichment factor types. The result of restriction using )aelll en4yme obtained are/ 8a) A Clade of 18.23 x 10 ind A-1, 8b) 6 Clade of 21.19 x DNA ribbons with polymorphic DNA si4e to measure the base 10 ind l-1, and 8c) C Clade of 19,82 x 10 ind l-1. In the pair 8bp) value of tested Eooxanthellae. The value of base pair estimated 4ooxanthellae infection to the coral polyp tissues has is then tested its similarity to the base pair value obtained from happened 8phase I in 10 days and phase II in 17 days), Gen6ank through phylogenic analysis using SAS 9.1 program. separation be conducted for coral sample of Goneastrea aspera from the incubation media into natural environment of )ater quality Analysis the southern of Panjang Island Jepara to examine its growth. The growth study was done using pigmentation the technique Bater quality variables measured are temperature, salinity, of Alyzarin Red 8Sya7rani, 1993). dissolved oxygen and p) which measured on a daily based for the incubation tank and a weekly based at the sea, while The Independent Test ammonia and nitrite are measured either in the tank or at the sea weekly. Measurement of the colony growth was done by measuring the length of CaCO3 deposit on each corralite of 1 specimen Data Evaluation Goniastrea aspera. Measurement of Eooxanthellae consentration was .valuation of 4ooxanthellae translocation in the coral polyp conducted in three weeks period. Initially decalcification was tissue are tracing by the growth, survival, density development performed by taking some specimen to be dissolved in a of 4ooxanthellae, infection of 4ooxanthellae, replacement solution of F )Cl concentrate for 28 hours 8Nordemar et al., profile of 4ooxanthellae hystologically. Synergisme among 2003). After decalcification, the tissue rinsed and homogeni4ed collected data will be a benchmarks for the success of in 10 mA distillated water for 10-1 minutes with speed 3,000 translocation. rpm. Supernatant containing 4ooxanthellae then analy4ed using Sedgwick rafter. RES8L, AN7 7ISC8SSION DNA Diversity Results Test of 4ooxanthellae DNA diversity using PCRGRFAP *ooxanthellae Diversity and its Replacement on Polyp+ tissues 8Restriction Fragment Length Poloymorphisme) method. .ach Eooxanthellae DNA testing is done in two incubation clade of Eooxanthellae is bred up to 1 liter with high density stages, i.e. 10 days incubation 8Test phase 1) and days 8Test and be filtrated gradually with the speed of 3,000 rpm for 10 phase II).

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    7 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us