DOCSLIB.ORG

Mechanisms of Inflammatory Gene Repression by the Glucocorticoid Receptor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanisms of Inflammatory Gene Repression by the Glucocorticoid Receptor TECHNISCHE UNIVERSITÄT MÜNCHEN Institut für Diabetes und Krebs, Helmholtz Zentrum München & Chair for Metabolic Programming, TUM School of Life Sciences Mechanisms of inflammatory gene repression by the Glucocorticoid Receptor Laura Escoter Torres Vollständiger Abdruck der von der Fakultät TUM School of Life Sciences der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigten Dissertation. Vositzende: Prof. Dr. Ilona Grunwald Kadow Prüfende/-r der Dissertation: 1. Prof. Dr. Nina Henriette Uhlenhaut 2. Prof. Dr. Dirk Haller 3. Prof. Dr. Roland Schüle Die Dissertation wurde am 24.06.2020 bei der Technischen Universität München eingereicht und durch die Fakultät TUM School of Life Sciences am 16.11.2020 angenommen. Acknowledgements First, I would like to thank my supervisor, Prof. Dr. N. Henriette Uhlenhaut, for her support and guidance through each stage of this project. I specially appreciate the time, effort, ideas and feedback, which has greatly contributed to my professional and scientific development. Also, I value the generous funding from the ERC grant allocated to Prof. Uhlenhaut. I am grateful to Prof. Dirk Haller for his support and scientific advice during our annual meetings discussing the progress of my PhD project. My special thanks go to Prof. Dr. Matthias Tschöp, director of the Institute for Diabetes and Obesity, and Prof. Dr. Stephan Herzig, director of the Institute for Diabetes and Cancer, for their input on this project as well as for leading two great international dynamic institutes with very talented scientists. I would like to acknowledge Dr. Franziska Greulich for her assistance with NGS analysis and our various scientific discussions that significantly contributed to this work. Also, a strong thank you to Dr. Michael Wierer for the successful collaboration with the proteomics analysis. I am deeply thankful to all the members of the MolEndo group, IDO and IDC for their help and support. I would like to acknowledge Dr. Omar García González, Michaël Hubert and Dr. Céline Jouffe specially for their crucial support and for making my time in the lab an unforgettable experience. Also, I appreciate the valuable scientific remarks from Dr. Manuel Gil Lozano. Similarly, my thanks to all team members: Kostas, Katerina, Teresa, Büsra, Afzal, Ken, Charlotte, Cinzia, Kinga, Kristina, Fabiana, Ashfaq, Suhail, Sybille and Ivonne for creating a vibrant, challenging and interactive professional environment. Also, thank you to Kei, Laurent, Caterina, Isabelle, Serge, Roger and Maria from the Nestlé Institute of Health Sciences in Lausanne to motivate me to pursue a PhD. Lastly, but most important, a big thank you to my husband Christian Kerecsényi, my family and friends for their unconditional love, support and motivation. Thank you for always being there for me. i Table of contents Abstract…………………………………………………………………………………........iv Zusammenfassung……………………………………………………………………….….v Abbreviations……………………………………………………………………….………..vi Index of Tables……………………………………………………………………….……..viii Index of Figures………………………………………………………………...……….......ix 1. Introduction ............................................................................................................ 1 1.1 Glucocorticoid signalling in health and disease ..................................................... 1 1.1.1 HPA axis and physiological roles of glucocorticoids ......................................... 1 1.1.2 Clinical use and side effects of glucocorticoids ................................................ 3 1.2 Immunomodulation by the glucocorticoid receptor ................................................ 5 1.2.1 The glucocorticoid receptor .............................................................................. 5 1.2.2 Mechanisms of GR-mediated gene regulation ................................................. 8 1.2.2.1 Genomic actions of the GR ........................................................................... 8 1.2.2.2 Non-genomic actions of GR ........................................................................ 12 1.2.2.3 Tissue specificity and multimerization of GR ............................................... 12 1.2.3 Glucocorticoid action on macrophages and target genes .............................. 13 1.3 Mechanistic insights into immunomodulation from GR mutants .......................... 14 2. Scope of the thesis .............................................................................................. 17 3. Material and methods .......................................................................................... 18 3.1 Chemicals, commercial kits, antibodies and primers ........................................... 18 3.2 Mice. .................................................................................................................... 23 3.3 Primary cell cultures ............................................................................................ 24 3.3.1 Foetal liver macrophages ................................................................................. 24 3.3.2 Mouse embryonic fibroblasts ............................................................................ 24 3.4 Immortalised cell lines ......................................................................................... 25 3.5 Molecular biology techniques .............................................................................. 25 3.5.1 Chromatin Immunoprecipitation coupled to quantitative PCR ........................ 25 3.5.2 Co-Immunoprecipitation ................................................................................. 25 3.5.3 Electrophoretic mobility shift assay ................................................................ 26 3.5.4 Immunohistochemistry .................................................................................... 26 3.5.5 Luciferase assays ........................................................................................... 27 3.5.6 RNA isolation, complementary DNA synthesis and real-time-quantitative PCR…………………………………………………………….........................................27 3.5.7 Small interfering RNA knock down ................................................................. 27 3.5.8 Western blot ................................................................................................... 28 3.6 Histology .............................................................................................................. 28 3.7 Chromatin immunoprecipitation coupled to mass spectrometry .......................... 28 3.8 Next generation sequencing techniques ............................................................. 29 3.8.1 Chromatin immunoprecipitation-sequencing and data analysis ..................... 29 3.8.2 RNA-sequencing and data analysis ............................................................... 30 3.9 Statistical analysis ............................................................................................... 31 3.10 Contribution from collaborations ........................................................................ 31 4. Results .................................................................................................................. 32 4.1 DNA binding by GR is required for survival ......................................................... 32 4.1.1 GRΔZn mouse line generation ......................................................................... 32 4.1.2 GRΔZn mice die due to respiratory failure and resemble the GR null phenotype...................................................................................................................34 4.1.3 GRΔZn mRNA, protein and phosphorylation levels are unaffected .................. 35 4.1.4 GR nuclear translocation is unaffected in GRΔZn ............................................ 37 4.2 Non-genomic actions of GR ................................................................................ 38 4.3 Tethered binding sites are found near inflammatory genes in GRΔZn MEFs ....... 39 4.3.1 Genome-wide binding profiles of GR wild type and GRΔZn in MEFs ............... 39 4.3.2 Examples of GR binding nearby target genes in wild type and GRΔZn MEFs . 40 4.3.3 Motif enrichment in GR ChIP-Seq peaks ........................................................ 43 4.3.4 Gene ontology for genes in the vicinity of GR ChIP peaks ............................. 44 4.3.5 Distance distribution of GR ChIP peaks to TSS ............................................. 45 4.3.6 ChIP-Seq validation and co-immunoprecipitation of GR and p65 .................. 46 4.4 Target gene regulation by GR requires DNA binding .......................................... 48 4.4.1 RNA-Seq shows no target gene regulation by GRΔZn in response to Dex ........ 48 4.4.2 Genes in the vicinity of GR tethered sites are not regulated by GRΔZn and are enriched near repressed genes ................................................................................. 51 4.4.3 Basal gene expression profile and PCA analysis ........................................... 52 4.4.4 Validation of GR target genes modulation ...................................................... 53 ii 4.4.5 MEFs treated with TPA show no effect on target gene regulation ................. 54 4.4.6 Time series treatment with Dex alone or LPS and Dex in MEFs .................... 55 4.5 GR tethering can be detected in various Dex concentrations ............................. 56 4.6 GR binding in embryonic liver and
Load more

Recommended publications
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
    [Show full text]
  • The REST/NRSF Pathway As a Central Mechanism in CNS Dysfunction
    The REST/NRSF Pathway as a Central Mechanism in CNS Dysfunction Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Alix Warburton April 2015 Disclaimer The data in this thesis is a result of my own work. The material collected for this thesis has not been presented, nor is currently being presented, either wholly or in part for any other degree or other qualification. All of the research, unless otherwise stated, was performed in the Department of Physiology and Department of Pharmacology, Institute of Translational Medicine, University of Liverpool. All other parties involved in the research presented here, and the nature of their contribution, are listed in the Acknowledgements section of this thesis. i Acknowledgements First and foremost, I would like to express my upmost gratitude to my primary and secondary supervisors Professor John Quinn (a.k.a Prof. Quinny) and Dr Jill Bubb for all of their support, guidance, wisdom (thank you Jill) and encouragement throughout my PhD; I could not have wished for a better pair. I am also extremely grateful to the BBSRC for funding my PhD project. I would also like to extend my thanks to Dr Graeme Sills for providing samples and assistance with my work on the SANAD epilepsy project, Dr Fabio Miyajima for offering his knowledge and knowhow on many occasions, Dr Gerome Breen for being a bioinformatics wizard and providing support on several projects, Dr Minyan Wang’s lab for their help and hospitality during my 3 month visit to Xi'an Jiaotong-Liverpool University, Dr Roshan Koron for assisting with the breast cancer study, Dr Chris Murgatroyd for his invaluable advice on ChIP and Professor Dan Rujescu’s lab for providing clinical samples and support with statistical analyses on the schizophrenia project.
    [Show full text]
  • Additional Methods
    Additional Methods Cell Expression Profiles The tissue-dependent gene expression dataset from the Genome Novartis Foundation contains 32 healthy major tissues, and 47 tumour samples and cell lines. The custom- designed whole-genome gene expression microarrays used on each sample targets 44775 human mRNA transcripts. Previous analysis of this dataset identified many chromo- somal regions of correlated transcription that are under the control of both tissue and parental allele-specific expression. The expression levels of TF genes across tissue sam- ples are observed to be lower than non-TF genes. This is coherent with the mechanistic explanation that the effect of a single TF molecule is amplified by transcribing many copies of mRNA from a target gene. Across all samples, the proportion of TFs rel- ative to all expressed genes is remarkably stable at ∼ 6%. In the bootstrap test for highly predictive CRMs, we resampled from this set of TFs to generate the bootstrap replicates. High variance in gene expression profiles are observed between replicates for samples with more heterogeneous composition. Therefore, we treat each replicate as an independent sample in our analysis. When analyzing expression variation in a single sample, we found that a Gaussian distributional assumption for gene expression is more suitable compared to other distributions. Smoothing and Model Fitting Since gene expression response by the target gene varies over different TF expression values in a smooth fashion, a curved function is needed to fit our gene expression data. For additive models, the partial response of the target gene to the expression of each TF is described by a smooth function.
    [Show full text]
  • Alpha Actinin 4: an Intergral Component of Transcriptional
    ALPHA ACTININ 4: AN INTERGRAL COMPONENT OF TRANSCRIPTIONAL PROGRAM REGULATED BY NUCLEAR HORMONE RECEPTORS By SIMRAN KHURANA Submitted in partial fulfillment of the requirements for the degree of doctor of philosophy Thesis Advisor: Dr. Hung-Ying Kao Department of Biochemistry CASE WESTERN RESERVE UNIVERSITY August, 2011 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of SIMRAN KHURANA ______________________________________________________ PhD candidate for the ________________________________degree *. Dr. David Samols (signed)_______________________________________________ (chair of the committee) Dr. Hung-Ying Kao ________________________________________________ Dr. Edward Stavnezer ________________________________________________ Dr. Leslie Bruggeman ________________________________________________ Dr. Colleen Croniger ________________________________________________ ________________________________________________ May 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS LIST OF TABLES vii LIST OF FIGURES viii ACKNOWLEDEMENTS xii LIST OF ABBREVIATIONS xiii ABSTRACT 1 CHAPTER 1: INTRODUCTION Family of Nuclear Receptors 3 Mechanism of transcriptional regulation by co-repressors and co-activators 8 Importance of LXXLL motif of co-activators in NR mediated transcription 12 Cyclic recruitment of co-regulators on the target promoters 15 Actin and actin related proteins (ABPs) in transcription
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal A
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment.
    [Show full text]
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • Variations in Microrna-25 Expression Influence the Severity of Diabetic
    BASIC RESEARCH www.jasn.org Variations in MicroRNA-25 Expression Influence the Severity of Diabetic Kidney Disease † † † Yunshuang Liu,* Hongzhi Li,* Jieting Liu,* Pengfei Han, Xuefeng Li, He Bai,* Chunlei Zhang,* Xuelian Sun,* Yanjie Teng,* Yufei Zhang,* Xiaohuan Yuan,* Yanhui Chu,* and Binghai Zhao* *Heilongjiang Key Laboratory of Anti-Fibrosis Biotherapy, Medical Research Center, Heilongjiang, People’s Republic of China; and †Clinical Laboratory of Hong Qi Hospital, Mudanjiang Medical University, Heilongjiang, People’s Republic of China ABSTRACT Diabetic nephropathy is characterized by persistent albuminuria, progressive decline in GFR, and second- ary hypertension. MicroRNAs are dysregulated in diabetic nephropathy, but identification of the specific microRNAs involved remains incomplete. Here, we show that the peripheral blood from patients with diabetes and the kidneys of animals with type 1 or 2 diabetes have low levels of microRNA-25 (miR-25) compared with those of their nondiabetic counterparts. Furthermore, treatment with high glucose decreased the expression of miR-25 in cultured kidney cells. In db/db mice, systemic administration of an miR-25 agomir repressed glomerular fibrosis and reduced high BP. Notably, knockdown of miR-25 in normal mice by systemic administration of an miR-25 antagomir resulted in increased proteinuria, extracellular matrix accumulation, podocyte foot process effacement, and hypertension with renin-angiotensin system activation. However, excessive miR-25 did not cause kidney dysfunction in wild-type mice. RNA sequencing showed the alteration of miR-25 target genes in antagomir-treated mice, including the Ras-related gene CDC42. In vitro,cotrans- fection with the miR-25 antagomir repressed luciferase activity from a reporter construct containing the CDC42 39 untranslated region.
    [Show full text]
  • Mouse Anti-Human Testicular Receptor 4
    Catalog Clonality, clone Reactive Reg. Product Name Quantity Applications Number (isotype) species Status mAb clone H0107B WB, ELISA, 434700 Mouse anti-human TR4 100 µg Hu, Ms, Rt RUO (Ms IgG2a) IP, IHC Mouse Anti-Human Testicular Receptor 4 Description Testicular receptor 4 (TR4, TAK1; NR2C2) is a member of the orphan nuclear receptor family. TR4 was originally cloned from lymphoblastoma Raji cells or mouse brain cDNA library. No ligand has been reported. Northern blot shows TR4 is transcribed as a 9kb mRNA in many tissues and as a 2.8kb mRNA in testis, mainly in spermatocytes. TR4 has two isoforms called TR4α1 and TR4-α2, which differ in 19 amino acids coded by two separate exons. Both products translated from 9kb transcript are ubiquitously expressed. Since TR4 binds to the same elements for the RAR-RXR or TR-RXR heterodimers, TR4 may have an inhibitory affect for retinoic-acid mediated transactivation. Nomenclature NR2C2 Genbank L27586 Origin Produced in BALB/c mouse ascites after inoculation with hybridoma of mouse myeloma cells (NS-1) and spleen cells derived from a BALB/c mouse immunized with Baculovirus-expressed recombinant human TR4 (23-52 aa). Specificity This antibody specifically recognizes human TR4 and cross reacts with mouse and rat TR4. Purification Ammonium sulfate fractionation Formulation Concentration is 1 mg/mL in physiological saline with 0.1% sodium azide as a preservative. Application Recommended Concentration* Western Blot 2 μg/mL Non reducing Western Blot Not tested ELISA 0.1 μg/mL Immunoprecipitation Determine by use Electrophoretic Mobility Shift Assay Not tested Chromatin Immunoprecipitation Not tested Immunohistochemistry 10 μg/mL *In order to obtain the best results, optimal working dilutions should be determined by each individual user.
    [Show full text]
  • 1 Canonical BAF Complex in Regulatory T Cells 2 3 Chin
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 A genome-wide CRISPR screen reveals a role for the BRD9-containing non- 2 canonical BAF complex in regulatory T cells 3 4 Chin-San Loo1,3,#, Jovylyn Gatchalian2,#, Yuqiong Liang1, Mathias Leblanc1, Mingjun 5 Xie1, Josephine Ho2, Bhargav Venkatraghavan1, Diana C. Hargreaves2*, and Ye 6 Zheng1* 7 8 1. NOMIS Center for Immunobiology and Microbial Pathogenesis, Salk Institute for 9 Biological Studies 10 2. Molecular and Cellular Biology Laboratory, Salk Institute for Biological Studies 11 3. Division of Biological Sciences, University of California, San Diego 12 # Co-first authors 13 * Co-corresponding authors 14 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 15 Summary 16 Regulatory T cells (Tregs) play a pivotal role in suppressing auto-reactive T cells 17 and maintaining immune homeostasis. Treg development and function are 18 dependent on the transcription factor Foxp3. Here we performed a genome-wide 19 CRISPR/Cas9 knockout screen to identify the regulators of Foxp3 in mouse 20 primary Tregs. The results showed that Foxp3 regulators are highly enriched in 21 genes encoding SWI/SNF and SAGA complex subunits. Among the three 22 SWI/SNF-related complexes, the non-canonical or ncBAF (also called GBAF or 23 BRD9-containing BAF) complex promoted the expression of Foxp3, whereas the 24 PBAF complex repressed its expression.
    [Show full text]
  • Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases
    Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Olivares, Ana Maria, Oscar Andrés Moreno-Ramos, and Neena B. Haider. 2015. “Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases.” Journal of Experimental Neuroscience 9 (Suppl 2): 93-121. doi:10.4137/JEN.S25480. http:// dx.doi.org/10.4137/JEN.S25480. Published Version doi:10.4137/JEN.S25480 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:27320246 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Journal name: Journal of Experimental Neuroscience Journal type: Review Year: 2015 Volume: 9(S2) Role of Nuclear Receptors in Central Nervous System Running head verso: Olivares et al Development and Associated Diseases Running head recto: Nuclear receptors development and associated diseases Supplementary Issue: Molecular and Cellular Mechanisms of Neurodegeneration Ana Maria Olivares1, Oscar Andrés Moreno-Ramos2 and Neena B. Haider1 1Department of Ophthalmology, Schepens Eye Research Institute, Massachusetts Eye and Ear, Harvard Medical School, Boston, MA, USA. 2Departamento de Ciencias Biológicas, Facultad de Ciencias, Universidad de los Andes, Bogotá, Colombia. ABSTRACT: The nuclear hormone receptor (NHR) superfamily is composed of a wide range of receptors involved in a myriad of important biological processes, including development, growth, metabolism, and maintenance.
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]