bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 A genome-wide CRISPR screen reveals a role for the BRD9-containing non-

2 canonical BAF complex in regulatory T cells

3

4 Chin-San Loo1,3,#, Jovylyn Gatchalian2,#, Yuqiong Liang1, Mathias Leblanc1, Mingjun

5 Xie1, Josephine Ho2, Bhargav Venkatraghavan1, Diana C. Hargreaves2*, and Ye

6 Zheng1*

7

8 1. NOMIS Center for Immunobiology and Microbial Pathogenesis, Salk Institute for

9 Biological Studies

10 2. Molecular and Cellular Biology Laboratory, Salk Institute for Biological Studies

11 3. Division of Biological Sciences, University of California, San Diego

12 # Co-first authors

13 * Co-corresponding authors

14

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

15 Summary

16 Regulatory T cells (Tregs) play a pivotal role in suppressing auto-reactive T cells

17 and maintaining immune homeostasis. Treg development and function are

18 dependent on the transcription factor Foxp3. Here we performed a genome-wide

19 CRISPR/Cas9 knockout screen to identify the regulators of Foxp3 in mouse

20 primary Tregs. The results showed that Foxp3 regulators are highly enriched in

21 genes encoding SWI/SNF and SAGA complex subunits. Among the three

22 SWI/SNF-related complexes, the non-canonical or ncBAF (also called GBAF or

23 BRD9-containing BAF) complex promoted the expression of Foxp3, whereas the

24 PBAF complex repressed its expression. Gene ablation of BRD9 led to

25 compromised Treg function in inflammatory disease and tumor immunity.

26 Functional genomics revealed that BRD9 is required for Foxp3 binding and

27 expression of a subset of Foxp3 target genes. Thus, we provide an unbiased

28 analysis of genes and networks regulating Foxp3, and reveal ncBAF complex as a

29 novel target that could be exploited to manipulate Treg function.

30

31 Introduction

32 Regulatory T cells (Tregs) play a crucial role in maintaining immune system

33 homeostasis by suppressing over-reactive immune responses(Josefowicz et al., 2012;

34 Sakaguchi et al., 2008). Defects in Tregs lead to autoimmune disorders and

35 immunopathology, while certain tumors are enriched with Tregs that suppress anti-

36 tumor immune responses(Tanaka and Sakaguchi, 2017). Foxp3, a member of the

37 Forkhead transcription factor family, is a critical regulator that orchestrates the

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

38 molecular processes involved in Treg differentiation and function(Zheng and Rudensky,

39 2007). Therefore, understanding the regulation of Foxp3 expression could reveal novel

40 therapeutic targets to potentially change Treg numbers or alter their function. It has

41 been established that the T cell receptor (TCR) and IL-2 signaling pathways play critical

42 roles in Foxp3 induction(Chinen et al., 2016; Lee et al., 2012). TGF-β signaling is also

43 essential for Foxp3 induction in periphery-derived Tregs and in vitro induced Tregs,

44 although its role in thymus-derived Treg development is still under debate (Chen et al.,

45 2003; Liu et al., 2008; Ouyang et al., 2010). Accordingly, a number of downstream

46 transcription factors have been identified that regulate Foxp3 induction in vitro or in vivo,

47 including STAT5a/b, CBF-β/RUNX1/3, NFAT1, SMAD3/4, cRel, and CREB (Burchill et

48 al., 2007; Kim and Leonard, 2007; Kitoh et al., 2009; Long et al., 2009; Rudra et al.,

49 2009; Tone et al., 2008; Yang et al., 2008). Compared to the large number of studies

50 focused on the mechanism of Foxp3 induction, relatively less is known about the factors

51 that maintain Foxp3 expression in mature Treg cells. An intronic enhancer in Foxp3

52 named CNS2 (conserved non-coding sequence 2), also known as TSDR (Treg-specific

53 demethylated region), is a key cis-regulatory element required for stable Foxp3

54 expression(Polansky et al., 2008; Zheng et al., 2010). CNS2 is heavily methylated in

55 naive and activated conventional T cells by DNA methyl-transferase 1 (DNMT1), and

56 deletion of Dnmt1 leads to aberrant expression of Foxp3 in conventional T

57 cells(Josefowicz et al., 2009). Once Foxp3 expression is induced during Treg

58 development, the CNS2 region is rapidly demethylated, opening it up for the binding of

59 transcription factors(Polansky et al., 2008). Foxp3 can bind to CNS2, as well as an

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

60 additional upstream enhancer named CNS0(Kitagawa et al., 2017), and stabilize its own

61 expression in a positive feedback loop(Feng et al., 2014; Li et al., 2014b).

62

63 Post-translational modifications (PTM) of the Foxp3 protein, including phosphorylation,

64 acetylation, and ubiquitination, are also a crucial part of the regulatory circuit that

65 controls Foxp3 function and stability (van Loosdregt and Coffer, 2014). Among the

66 regulators of Foxp3 PTMs, a pair of enzymes, ubiquitin ligase STUB1 and ubiquitin

67 hydrolase USP7, were reported to promote or inhibit degradation of Foxp3 via

68 ubiquitination, respectively (Chen et al., 2013; van Loosdregt et al., 2013). Finally,

69 intracellular metabolism, and specifically the metabolic regulator mTOR (mammalian

70 target of Rapamycin), has emerged as a key regulator of Foxp3 expression and Treg

71 function. Early studies showed that weakened mTOR signaling leads to increased

72 Foxp3 expression in iTregs in vitro (Delgoffe et al., 2009). However, recent studies

73 using genetic models showed that complete ablation of mTOR in Tregs leads to

74 compromised homeostasis and function of effector Tregs (Chapman et al., 2018; Sun et

75 al., 2018). Despite these and other significant advances in understanding the molecular

76 mechanisms regulating Foxp3, we lack a comprehensive picture of the regulatory

77 networks that control Foxp3 expression.

78

79 In this study, we performed a genome-wide CRISPR/Cas9 knockout screen to identify

80 the regulators of Foxp3 in mouse primary natural Treg cells. The screen results not only

81 confirmed a number of known Foxp3 regulators but also revealed many novel factors

82 that control Foxp3 expression. Gene ontology analysis showed that Foxp3 regulators

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

83 are highly enriched in genes encoding subunits of the SAGA and SWI/SNF complexes,

84 which we further validated by single gRNA knockout and flow cytometry analysis. The

85 mammalian SWI/SNF complex is a multi-subunit complex with a core ATPase protein,

86 either SMARCA4 (BRG1) or SMARCA2 (BRM), that uses energy derived from ATP

87 hydrolysis to remodel nucleosomes on chromatin. Mouse genetic studies have

88 demonstrated that conditional knockout of Smarca4 leads to impaired differentiation of T

89 lymphocytes (Gebuhr et al., 2003; Zhao et al., 1998). In addition, a previous report

90 demonstrated that genetic deletion of Smarca4 in Tregs using the Foxp3-Cre driver

91 results in the development of a fatal inflammatory disorder reminiscent of Foxp3 mutant

92 scurfy mice (Chaiyachati et al., 2013). The authors showed that while Treg development

93 and Foxp3 expression was normal in Smarca4 deficient Tregs, Treg function was

94 nevertheless compromised due to impaired activation of TCR target genes, for example

95 chemokine receptor genes in Tregs. This is consistent with the rapid association of

96 SMARCA4-containing SWI/SNF complexes with chromatin following TCR activation in T

97 cells (Zhao et al., 1998).

98

99 Biochemical studies have demonstrated that SMARCA4 is associated with both the

100 canonical BAF complex (BAF) and Polybromo1-associated BAF complex (PBAF) (Xue

101 et al., 2000; Yan et al., 2005). In addition, recent studies in embryonic stem cells

102 (ESCs)(Gatchalian et al., 2018) and cancer cell lines (Alpsoy and Dykhuizen, 2018;

103 Michel et al., 2018; Wang et al., 2019) have identified a BRD9-containing non-canonical

104 complex or ncBAF complex (also referred to as GBAF or BRD9-containing BAF), which

105 contains several shared subunits including SMARCA4, but is distinct from the BAF and

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

106 PBAF complexes. Apart from uniquely incorporating BRD9, the ncBAF complex also

107 contains GLTSCR1 or the paralog GLTSCR1L and lacks BAF- and PBAF-specific

108 subunits ARID1A, ARID1B, ARID2, SMARCE1, SMARCB1, SMARCD2, SMARCD3,

109 DPF1-3, PBRM1, BRD7, and PHF10. The distinct biochemical compositions of these

110 three SWI/SNF complex assemblies suggest functional diversity. However, it is not

111 known which SWI/SNF complex assemblies are expressed in Tregs and the potential

112 roles of specific SWI/SNF variants in regulating Foxp3 expression and Treg

113 development have not been studied in depth.

114

115 Here, we find that the BRD9-containing ncBAF complex promotes the expression of

116 Foxp3, whereas the PBAF complex represses its expression. Furthermore, deletion of

117 Brd9 or PBAF component Pbrm1 in Tregs results in reduced or enhanced suppressor

118 activity, respectively, suggesting divergent regulatory roles of ncBAF and PBAF

119 complexes in controlling Foxp3 expression and Treg function. Consistent with this

120 model, we find that chemically-induced degradation of BRD9 by dBRD9 leads to

121 reduced Foxp3 expression and compromised Treg function. Genome-wide binding

122 studies revealed that BRD9 co-localizes with Foxp3, including at the CNS0 and CNS2

123 enhancers at the Foxp3 locus. Furthermore, targeting BRD9 by sgRNA or dBRD9

124 reduces Foxp3 binding at the Foxp3 locus and a subset of Foxp3 binding sites genome-

125 wide, which results in differential expression of many Foxp3-dependent genes,

126 indicating that BRD9 participates in the regulation of the Foxp3-dependent

127 transcriptional program. Finally, we show that deletion of Brd9 in Tregs reduced

128 suppressor activity in an in vivo model of T cell transfer induced colitis, and improved

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

129 anti-tumor immune responses in an MC38 colorectal cancer cell induced cancer model.

130 In summary, we perform an unbiased genome-wide screen to identify genes and

131 networks regulating Foxp3, and reveal ncBAF complex as a novel target that could be

132 exploited to manipulate Treg function in vitro and in vivo.

133

134 Results

135 Genome-wide CRISPR screen in natural regulatory T cells identifies regulators of

136 Foxp3

137 To screen for genes that regulate Foxp3 expression, we developed a pooled retroviral

138 CRISPR sgRNA library by subcloning an optimized mouse genome-wide lentiviral

139 CRISPR sgRNA library (lentiCRISPRv2-Brie) (Doench et al., 2016) into a newly

140 engineered retroviral vector pSIRG-NGFR, which allowed us to efficiently transduce

141 mouse primary T cells and to perform intracellular staining for Foxp3 without losing the

142 transduction marker NGFR after cell permeabilization (Figure S1). Using this library, we

143 performed CRISPR knockout screens on Tregs to identify genes that regulate Foxp3

144 expression. We activated CD4+Foxp3+ Tregs isolated from Rosa-Cas9/Foxp3Thy1.1

145 knock-in mice (Liston et al., 2008; Platt et al., 2014) with CD3 and CD28 antibodies and

146 IL-2 (Figure 1A). Treg cells were transduced 24 hours post-activation with the pooled

147 retroviral sgRNA library at multiplicity of infection of less than 0.2 to ensure only one

148 sgRNA was transduced per cell. NGFR+ transduced Treg cells were collected on day 3

149 and day 6 to identify genes that are essential for cell proliferation and survival. In

150 addition, the bottom quintile (NGFR+Foxp3Low) and top quintile (NGFR+Foxp3High)

151 populations were collected on day 6 to identify genes that regulate Foxp3 expression.

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

152 We validated the screen conditions by transducing Tregs with sgRNAs targeting Foxp3

153 itself, as well as previously reported positive (Cbfb) (Rudra et al., 2009) and negative

154 (Dnmt1) (Lal et al., 2009) regulators of Foxp3 (Figure 1B-D). Guide RNA sequences

155 integrated within the genomic DNA of sorted cells were recovered by PCR amplification,

156 constructed into amplicon libraries, and sequenced with a NextSeq sequencer.

157

158 The relative enrichment of sgRNAs between samples and hit identification were

159 computed by MAGeCK, which generates a normalized sgRNA read count table for each

160 sample, calculates the fold change of sgRNA read counts between two cell populations,

161 and further aggregates information of four sgRNAs targeting each gene to generate a

162 ranked gene list (Li et al., 2014a). Prior to hit calling, we evaluated the quality of screen

163 samples by measuring the percentage of mapped reads to the sgRNA library and total

164 read coverage, which showed a high mapping rate (79.8-83.4%) with an average of

165 236X coverage and a low number of missing sgRNAs (0.625-2.5%) (Figure S2). With

166 the cutoff criteria of log2 fold change (LFC) >±0.5 and p-value less than 0.01, we

167 identified 254 potential positive Foxp3 regulators enriched in the Foxp3Low population

168 and 490 potential negative Foxp3 regulators enriched in the Foxp3High population

169 (Figure 2A, 2B, and Table S1). In a parallel analysis, we also identified 22 and 1497

170 genes that affect cell expansion and contraction, respectively (p-value < 0.002, LFC>1,

171 Figure S3 and Table S2). As expected, we identified genes belonging to pathways

172 known to regulate Foxp3 expression both transcriptionally (Cbfb, Runx3) (Rudra et al.,

173 2009) and post-transcriptionally through the regulation of Foxp3 protein stability (Usp7,

174 Stub1) (Chen et al., 2013; van Loosdregt et al., 2013) (Figure 2C).

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

175

176 We next compared the potential positive and negative regulators with genes involved in

177 cell contraction and expansion to exclude hits that might affect Foxp3 expression

178 indirectly by affecting cellular fitness in general, leaving 197 positive Foxp3 regulators

179 and 327 negative Foxp3 regulators (Figure 2D and Table S3). Gene ontology analysis

180 of positive Foxp3 regulators revealed a number of notable functional clusters including

181 SAGA-type complex, negative regulation of T cell activation, RNA Polymerase II

182 holoenzyme, positive regulation of histone modification, and SWI/SNF complex (Figure

183 2E, Table S4). Among negative Foxp3 regulators, genes are highly enriched in clusters

184 related to negative regulation of TOR signaling, transcriptional repressor complex,

185 mRNA decay and metabolism, and hypusine synthesis from eIF5A-lysine (Figure 2F,

186 Table S4). Several of these pathways, including mTOR signaling, Foxp3

187 ubiquitination/deubiquitination, and transcriptional regulation, have been implicated in

188 Foxp3 regulation previously, suggesting that our screen is robust for the validation of

189 known pathways and the discovery of novel regulators of Foxp3. Among novel

190 regulators, we identified many genes encoding subunits of the SAGA (Ccdc101, Tada2b,

191 Tada3, Usp22, Tada1, Taf6l, Supt5, Supt20) and SWI/SNF (Arid1a, Brd9, Smarcd1)

192 complexes (Table S4), strongly suggesting that these complexes could have

193 indispensable roles for Foxp3 expression. We thus further validated and characterized

194 the SAGA and SWI/SNF related complexes to understand their roles in Foxp3

195 expression and Treg function.

196

9 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

197 Validation of the SAGA complex as a novel regulator of Foxp3 expression and

198 Treg suppressor activity

199 The SAGA complex possesses histone acetyltransferase (HAT) and histone

200 deubiquitinase (DUB) activity, and functions as a transcriptional co-activator through

201 interactions with transcription factors and the general transcriptional

202 machinery(Helmlinger and Tora, 2017; Koutelou et al., 2010). We identified Ccdc101,

203 Tada2b, and Tada3 in the HAT module, Usp22 in the DUB module, and Tada1, Taf6l,

204 Supt5, and Supt20 from the core structural module among positive Foxp3 regulators

205 that do not affect cell expansion or contraction (Figure S4A). We sought to validate the

206 potential regulatory function of SAGA complex subunits by using sgRNAs to knock out

207 individual subunits in Tregs and measure Foxp3 expression (Figure S4B, S4C). We

208 found that deletion of every subunit tested resulted in a significant and 19-29%

209 reduction in Foxp3 mean fluorescence intensity (MFI). We then further tested the

210 function of SAGA subunit Usp22 in an in vitro suppression assay, which measures the

211 suppression of T cell proliferation when conventional T cells are co-cultured with Tregs

212 at increasing ratios. We found that Tregs transduced with sgRNAs targeting Usp22 had

213 compromised Treg suppressor activity compared with Tregs transduced with a non-

214 targeting control sgRNA, with significantly more proliferation of T effector cells (Teff) at

215 every ratio of Treg to Teff ratio tested (Figure S4D). These results provide independent

216 validation of our genome-wide screen analyses for this class of chromatin regulators

217 and demonstrate that the SAGA complex is essential for normal Foxp3 expression and

218 that disrupting the SAGA complex by sgUsp22 reduces Treg suppressor function.

219

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

220 Identification of the BRD9-containing ncBAF complex as a specific regulator of

221 Foxp3 expression

222 We next wanted to characterize the role of SWI/SNF complex variants (BAF, ncBAF,

223 and PBAF complexes) in Foxp3 expression. While these complexes share certain core

224 subunits, such as the ATPase SMARCA4, each complex also contains specific subunits,

225 for example the selective incorporation of the bromodomain containing protein BRD9 in

226 ncBAF complexes (Figure 3A). Since the tissue-specific distribution and functional

227 requirement for ncBAF complexes in primary T cells is not known, we performed co-

228 immunoprecipitation assays to probe the composition of SWI/SNF-related complexes in

229 Tregs. As expected, immunoprecipitation of SMARCA4, a core component of all three

230 SWI/SNF complexes, revealed association of common subunits SMARCC1 and

231 SMARCB1, as well as specific subunits ARID1A, BRD9, and PBRM1.

232 Immunoprecipitations against ARID1A, BRD9, and PHF10 revealed the specific

233 association of these subunits with BAF, ncBAF, and PBAF complexes, respectively

234 (Figure 3A). These results established that all three SWI/SNF complexes are present

235 with the expected composition in Tregs.

236

237 In our screen, we identified Brd9, Smarcd1, Arid1a and Actl6a among positive

238 regulators of Foxp3, whereas SWI/SNF shared subunits Smarca4, Smarcb1, Smarce1,

239 and Actl6a were identified in cell contraction (Table S3). This suggests a potential

240 regulatory role for ncBAF and/or BAF complexes. To explore the specific function of

241 BAF, ncBAF, and PBAF complexes in Foxp3 expression, we cloned independent

242 sgRNAs to knockout unique subunits for each complex, and measured Foxp3 MFI in

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

243 sgRNA transduced Tregs. We observed an essential role for the ncBAF complex in

244 Foxp3 expression in Tregs. Specifically, knockdown of ncBAF specific subunits,

245 including Brd9 and Smarcd1, significantly diminished Foxp3 expression by nearly 40%

246 in Tregs (Figure 3B, 3C). Knockdown of ncBAF-specific paralogs Gltscr1 and Gltscr1l

247 individually resulted in a slight reduction in Foxp3 expression, which was further

248 reduced in the Gltscr1/Gltscr1l double knockout, suggesting that these two paralogs can

249 compensate in the regulation of Foxp3 expression (Figure 3C). In contrast, knockdown

250 of PBAF specific subunits, including Pbrm1, Arid2, Brd7, and Phf10, significantly

251 enhanced Foxp3 expression by as much as 17% (Figure 3C, green). Knockdown of

252 BAF specific subunits Arid1a, Arid1b, Dpf1, or Dpf2 did not significantly affect Foxp3

253 expression (Figure 3C, blue). To determine if ARID1A and ARID1B could be

254 compensating for one another, we performed Arid1a/Arid1b double deletion and found

255 that deletion of either or both ARID paralogs resulted in slight, but non-significant

256 reduction in Foxp3 MFI (Figure 3C, blue). These data suggest that ncBAF and PBAF

257 have opposing roles in the regulation of Foxp3 expression. To further explore the role of

258 different SWI/SNF complexes in Treg genome-wide transcription, we performed RNA

259 sequencing from Tregs with knockdown of variant-specific subunits with one or two

260 independent guide RNAs and conducted principal component analysis, which showed

261 that the ncBAF, PBAF, and BAF also have distinct effects at whole transcriptome level

262 in Tregs (Figure 3D).

263

264 We then made use of a recently developed chemical BRD9 protein degrader

265 (dBRD9)(Remillard et al., 2017) as an orthogonal method to probe BRD9 function.

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

266 dBRD9 is a bifunctional molecule that links a small molecule that specifically binds to

267 the bromodomain of BRD9 and another ligand that recruits the cereblon E3 ubiquitin

268 ligase. We confirmed that treatment of Tregs with dBRD9 resulted in reduced BRD9

269 protein levels (Figure S5A). Similar to sgRNA depletion of Brd9, dBRD9 treatment

270 significantly decreased Foxp3 expression in Treg cells in a concentration-dependent

271 manner, without affecting cell viability or proliferation (Figure 3E, Figure S5B). These

272 data demonstrate the requirement for BRD9 in maintenance of Foxp3 expression using

273 both genetic and chemically-induced proteolysis methods.

274

275 BRD9 regulates Foxp3 binding at the CNS0 and CNS2 enhancers and a subset of

276 Foxp3 target sites

277 To dissect the molecular mechanism of how ncBAF and PBAF complexes regulate

278 Foxp3 expression in Treg cells, we performed chromatin immunoprecipitation followed

279 by genome-wide sequencing (ChIP-seq) in Tregs using antibodies against the ncBAF-

280 specific subunit BRD9, the PBAF-specific subunit PHF10 and the shared enzymatic

281 subunit SMARCA4. Data generated from these ChIP-seq experiments revealed that

282 BRD9, SMARCA4, and PHF10 co-localize at CNS2 in the Foxp3 gene locus and at

283 CNS0 found within the Ppp1r3f gene immediately upstream of Foxp3 (Figure 4A). Since

284 CNS2 was previously shown to regulate stable Foxp3 expression through a positive

285 feedback loop involving Foxp3 binding(Feng et al., 2014; Li et al., 2014b), and Foxp3 is

286 additionally bound at CNS0 in Tregs(Kitagawa et al., 2017), we rationalized that ncBAF

287 and/or PBAF complexes might affect Foxp3 expression by regulating Foxp3 binding at

288 CNS2/CNS0. We therefore performed Foxp3 ChIP-seq in Tregs transduced with sgNT,

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

289 sgFoxp3, sgBrd9 or sgPbrm1. We observed a dramatic reduction in Foxp3 binding at

290 CNS2/CNS0 in sgFoxp3 transduced cells, as expected, and there was also marked

291 reduction of Foxp3 binding at CNS2/CNS0 in Brd9-depleted Tregs (Figure 4A). In

292 contrast, we observed a subtle increase in Foxp3 binding at CNS2/CNS0 in Pbrm1

293 sgRNA transduced Tregs, which could explain why Pbrm1 emerged as a negative

294 regulator of Foxp3 expression in our validation studies (Figure 4A). These data suggest

295 that BRD9 positively regulates Foxp3 expression by promoting Foxp3 binding to its own

296 enhancers.

297

298 We then extended this analysis to examine the cooperation between BRD9 and Foxp3

299 genome-wide. Notably, we find co-binding of BRD9, SMARCA4, and PHF10 with Foxp3

300 at a subset of Foxp3-bound sites (Figure 4B, 4C). All four factors localize to promoters,

301 intronic, and intergenic regions of the genome and their binding correlates well with

302 chromatin accessibility as measured by assay of transposase-accessible chromatin with

303 sequencing (ATAC-seq) (Figure 4B, S6A). Motif analysis of Foxp3-bound sites revealed

304 an enrichment for motifs recognized by ETS and RUNX transcription factors consistent

305 with what has been previously shown(Samstein et al., 2012). ETS and RUNX motifs

306 were also among the most significant motifs at both BRD9-bound sites, along with an

307 enrichment of the CTCF motif as we and others previously reported(Gatchalian et al.,

308 2018; Michel et al., 2018) (Figure S6B). These results demonstrate that ncBAF and

309 PBAF complexes are co-localized with Foxp3 at Foxp3 binding sites genome-wide.

310

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

311 To assess the requirement for BRD9 or PBRM1 in Foxp3 targeting genome-wide, we

312 analyzed Foxp3 binding in Tregs transduced with sgNT, sgFoxp3, sgBrd9, or sgPbrm1

313 at all Foxp3 binding sites (Figure 4D). As expected, we find that Foxp3 binding is lost at

314 over 85% of its binding sites in sgFoxp3-transduced Treg cells (Figure 4E). Foxp3

315 binding at a subset of these sites is also significantly reduced in sgBrd9-transduced

316 Tregs (FC 1.5, Poisson p < 0.0001), suggesting that BRD9 is required for Foxp3 binding

317 at a subset of its target sites (Figure 4E). This is a specific function of BRD9, as Foxp3

318 binding does not change in Pbrm1-depleted Tregs at these BRD9-dependent sites

319 (Figure 4F). ChIP-seq for the active histone mark H3 lysine27 acetylation (H3K27ac)

320 revealed that BRD9 and Foxp3 cooperate to maintain H3K27ac at over 1,800 shared

321 sites (Figure 4G). At BRD9-dependent Foxp3 sites, for example, we observed a

322 reduction in H3K27ac in sgFoxp3 and sgBrd9-transduced Tregs, but not in sgPbrm1-

323 transduced Tregs (Figure 4H). Using dBRD9, we confirmed that BRD9 binding to

324 chromatin is reduced (Figure S6C). We further recapitulated our observation that BRD9

325 loss results in diminished Foxp3 binding to chromatin at a subset of Foxp3 target sites

326 (Figure 4I, 4J, S6D), including at CNS2 and CNS0 (Figure 4A). These data demonstrate

327 that BRD9 co-binds with Foxp3 at the Foxp3 locus to positively reinforce its expression.

328 BRD9 additionally promotes Foxp3 binding and H3K27ac levels at a subset of Foxp3

329 target sites both by potentiating Foxp3 expression and through direct epigenetic

330 regulation at BRD9/Foxp3 co-bound sites.

331

332 BRD9 co-regulates the expression of Foxp3 and a subset of Foxp3 target genes

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

333 Based on co-binding of BRD9 and Foxp3 at Foxp3 target sites, we assessed the effects

334 of BRD9 ablation on the transcription of Foxp3 target genes. We performed RNA-seq in

335 Tregs transduced with sgFoxp3, sgBrd9, or sgNT. Consistent with Foxp3's role as both

336 transcriptional activator and repressor, we observed down-regulation and up-regulation

337 of 793 and 532 genes, respectively, in Foxp3 sgRNA transduced Tregs, which are

338 enriched in ‘cytokine production’, ‘regulation of defense response’, and ‘regulation of cell

339 adhesion’ (Figure 5A, 5B). Of these, 67% are directly bound by Foxp3 in our ChIP-seq

340 dataset and 60% are co-bound by Foxp3 and BRD9 (Figure 5C). Deletion of BRD9

341 resulted in transcriptional changes that strongly correlated with the transcriptional

342 changes in sgFoxp3 transduced Tregs (r2 = 0.534, Linear regression analysis; Figure

343 5D). Indeed, gene set enrichment analysis (GSEA) demonstrated that the sgBrd9 up-

344 regulated genes are significantly enriched among genes that increase upon Foxp3

345 knockdown, while the sgBrd9 down-regulated genes are enriched among genes that

346 decrease in sgFoxp3 Tregs (Figure 5E). We also performed RNA-seq for Tregs treated

347 with either vehicle or the dBRD9 degrader and observed a similar significant enrichment

348 for dBRD9 affected genes among the Foxp3 up- and down-regulated genes (Figure 5F).

349 Notably, the BRD9-dependent target gene sets generated from our RNA-seq data were

350 among the most significantly enriched dataset of 9,229 immunological, gene ontology

351 and curated gene sets when analyzed against the sgFoxp3 transduced Treg expression

352 data (Figure 5G). In addition, both datasets were significantly enriched for genes that

353 are differentially expressed between Tregs and conventional T cells(Feuerer et al.,

354 2010), and between Foxp3 mutant Tregs from scurfy mice and wild-type Tregs(Hill et al.,

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

355 2007). These data define a role for BRD9 in Tregs through specifically regulating the

356 expression of Foxp3 itself and a subset of Foxp3 target genes.

357

358 ncBAF complex is required for normal Treg suppressor activity in vitro and in

359 vivo.

360 The divergent roles of ncBAF and PBAF complexes in regulating Foxp3 expression

361 suggested that these complexes might also differentially affect Treg suppressor function.

362 We performed sgRNA knockdown of ncBAF-specific Brd9 and Smarcd1 or PBAF-

363 specific Pbrm1 and Phf10 in Tregs and measured their function by conducting an in

364 vitro suppression assay. Tregs depleted of Brd9 or Smarcd1 exhibited significantly

365 reduced suppressor function, whereas depletion of Pbrm1 or Phf10 resulted in

366 significantly enhanced suppressor function (Figure 6A, S7A). These data demonstrate

367 that the opposing regulation of Foxp3 expression by ncBAF and PBAF complexes

368 results in decreased/increased Treg suppressor activity upon ncBAF or PBAF subunit

369 deletion, respectively. Similar to sgRNA depletion of Brd9, Tregs treated with dBRD9

370 also showed significantly and specifically compromised Treg suppressor function in vitro

371 (Figure S7B). These results underscore the requirement for BRD9 in Foxp3 expression

372 maintenance and Treg suppressor activity, and further demonstrate that dBRD9

373 reduces Treg suppressor activity without impairing T effector responses in vitro.

374

375 To test if BRD9 also affects Treg function in vivo, we utilized a T cell transfer-induced

376 colitis model. In this model, Rag1 knockout mice were either transferred with CD45.1+

377 CD4+ CD25-CD45RBHigh effector T cell (Teff) only, or co-transferred with Teff along with

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

378 CD45.2+ Tregs transduced with Brd9 sgRNA (sgBrd9) or control sgRNA (sgNT) (Figure

379 6B). Mice transferred with Teff cells alone lost body weight progressively due to

380 development of colitis. Co-transfer of Tregs transduced with sgNT protected recipient

381 mice from weight loss, whereas co-transfer of sgBrd9 transduced Tregs failed to protect

382 recipients from losing weight (Figure 6C). The mice transferred with Brd9-depleted

383 Tregs showed significant colitis pathology at seven weeks compared to mice that

384 received control Tregs (Figure 6D). Furthermore, Brd9 depletion also led to

385 compromised Treg stability after transfer, manifested by reduced Foxp3+ cell

386 frequencies within the CD45.2+CD4+ transferred Treg population (Figure 6E). These

387 results demonstrate that BRD9 is an essential regulator of normal Foxp3 expression

388 and Treg function in a model of inflammatory bowel disease in vivo.

389

390 In addition to their beneficial role in preventing autoimmune diseases, Tregs have also

391 been shown to be a barrier to anti-tumor immunity. We therefore wondered whether we

392 could exploit the compromised suppressor function shown in Brd9 deficient Tregs to

393 disrupt Treg-mediated immune suppression in tumors. We used the MC38 colorectal

394 tumor cell line to induce cancer due to the prominent role Tregs play in this cancer

395 model(Delgoffe et al., 2013). Rag1 knockout mice were used as recipients for adoptive

396 transfer of Treg depleted-CD4 and CD8 T cells (Teff) only, or co-transfer of Teff with

397 Tregs transduced with either sgBrd9 or control sgNT. MC38 tumor cells were implanted

398 subcutaneously on the following day (Figure 7A). Transfer of sgNT Tregs allowed for

399 significantly faster tumor growth compared to mice that received Teff cells only (“No

400 Treg”) due to suppression of the anti-tumor immune response by Tregs (Figure 7B, 7C).

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

401 Furthermore, tumor growth in mice that received sgBrd9 transduced Tregs was

402 significantly slower than mice that received sgNT Tregs consistent with our findings that

403 Brd9 knockdown reduces Treg suppressor activity (Figure 7B, 7C). Both CD4 and CD8

404 T cell tumor infiltration significantly increased in mice that received sgBrd9 transduced

405 Tregs compared to sgNT Tregs (Figure 7D, 7E). Additionally, the percent of IFN-γ

406 producing intra-tumor CD4 and CD8 T cells in mice that received sgBrd9 transduced

407 Tregs was significantly greater than the sgNT Treg condition, and comparable to the

408 transfer of Teff alone (“No Treg”) (Figure 7F, 7G). Consistent with our findings that

409 BRD9 is required for Treg persistence in vivo (Figure 6E), the percentage of transferred

410 Treg cells was reduced in mice that received sgBrd9 transduced Tregs relative to sgNT

411 Tregs (Figure 7H). Overall, a 2-3 fold increase in the ratio of CD8 T cells to Tregs in

412 tumor and spleen was observed in the sgBrd9 versus the sgNT condition, consistent

413 with the enhanced anti-tumor immune response in mice that received sgBrd9

414 transduced Tregs (Figure 7I). This experiment demonstrates that BRD9 promotes stable

415 Treg function in MC38 tumors and knockdown of Brd9 in Tregs improves anti-tumor

416 immunity in this context.

417

418 Discussion

419 In this study, we performed a genome-wide CRISPR screen to identify positive and

420 negative regulators of Foxp3 expression in mouse natural Tregs. Among positive

421 regulators, we identified Cbfb and Runx3, consistent with previous reports showing a

422 requirement for CBF-β/Runx3 in Foxp3 expression and Foxp3-dependent target gene

423 expression(Kitoh et al., 2009; Rudra et al., 2009). Among the novel positive regulators,

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

424 we discovered subunits from two chromatin remodeling complexes, the BRD9-

425 containing ncBAF and SAGA complexes. Independent validation and functional assays

426 demonstrated an essential role for the ncBAF complex and SAGA complex in Foxp3

427 expression and Treg suppressor function.

428

429 Our screens also confirmed several known negative regulators of Foxp3, including DNA

430 methyl-transferase Dnmt1 and the ubiquitin ligase Stub1. Additionally, we identified

431 multiple negative regulators of the mTOR pathway as Foxp3 negative regulators (Tsc2,

432 Flcn, Ddit4, Sesn2, Nprl2), confirming an essential role for mTOR in homeostasis and

433 function of activated Tregs(Chapman et al., 2018; Sun et al., 2018). Among novel

434 negative Foxp3 regulators, we uncovered genes encoding regulators of RNA

435 metabolism, which have no previously reported function in Foxp3 expression. For

436 example, Mettl3 and Mettl14 form a methyltransferase complex that is essential for the

437 m6A methylation of RNA, which is recognized as an important regulatory mechanism for

438 a wide range of biological processes, including RNA stability, protein translation, stem

439 cell self-renewal, cell lineage determination, and oncogenesis(Yue et al., 2015). Our

440 screen suggests a potentially novel role for RNA m6A methylation in post-transcriptional

441 regulation of Foxp3. Together, our genome-wide screens provide the first

442 comprehensive picture of the complex regulatory network controlling Foxp3 expression

443 levels, and reveal previously unknown pathways and factors that warrant further

444 investigation.

445

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

446 Following the identification of SWI/SNF subunit genes among Foxp3 regulators, we

447 endeavored to characterize the roles of the three SWI/SNF-related complexes by

448 deleting subunits unique to each of the ncBAF, BAF, and PBAF complexes. We

449 observed specific and divergent roles of ncBAF and PBAF complexes in regulating

450 Foxp3 expression in Tregs. In contrast, deletion of BAF-specific subunits had a slight,

451 but non-significant effect on Foxp3 expression. Nevertheless, several SWI/SNF core

452 subunits were recovered in our screen among genes that regulate Treg cell contraction,

453 suggesting that BAF complexes may regulate Treg activation or proliferation in

454 response to TCR stimulation used to activate and culture Tregs in our screen. This is

455 consistent with a role for Smarca4 in Treg activation and control of autoimmunity in vivo

456 independent of affecting Foxp3 expression, which is not changed in Foxp3-

457 Cre:Smarca4f/f Tregs(Chaiyachati et al., 2013). Thus, deletion of Smarca4 or other BAF

458 complex subunits likely results in overall defects in Treg fitness, whereas deletion of

459 ncBAF subunits appears to have a selective effect on Foxp3 expression and its target

460 genes. Mechanistically, we find that the ncBAF complex co-binds and cooperates with

461 Foxp3 to potentiate its binding to the CNS2 and CNS0, enhancers of the Foxp3 locus.

462 In addition to the Foxp3 locus itself, our ChIP-seq analysis revealed that ncBAF also

463 binds to regulatory elements in a subset of Foxp3 target genes to regulate their gene

464 expression. One possibility is that reduced Foxp3 expression results in lowered Foxp3

465 binding at a select group of target genes, but what differentiates the dosage-dependent

466 binding of Foxp3 at these sites compared to other unaffected sites remains unclear.

467

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

468 Finally, we tested the vivo relevance of our findings by disrupting the ncBAF subunit

469 Brd9 in Tregs in mouse models of inflammatory bowel disease and cancer. Knockdown

470 of Brd9 in Tregs weakened their suppressor function in a model of T cell induced colitis,

471 leading to exacerbated disease progression. In the context of cancer, we found that

472 transfer of Brd9 deficient Tregs failed to restrict anti-tumor immune responses in the

473 MC38 cell induced cancer model, leading to slower tumor growth. Currently, there is a

474 concerted effort to develop compounds targeting a number of SWI/SNF complex

475 subunits to modulate their function. Our data show that bromodomain-directed

476 degradation of BRD9 by dBRD9 recapitulates the effects of Brd9 genetic deletion,

477 suggesting that the ncBAF complex can be targeted with small molecules to control

478 Foxp3 expression and Treg function. Thus, through the unbiased screen of Foxp3

479 regulators, we have identified novel proteins that can potentially be targeted to

480 manipulate Treg homeostasis and function in autoimmune diseases and cancer.

481

482

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

483 References

484 Alpsoy, A., and Dykhuizen, E.C. (2018). Glioma tumor suppressor candidate region 485 gene 1 (GLTSCR1) and its paralog GLTSCR1-like form SWI/SNF chromatin remodeling 486 subcomplexes. The Journal of biological chemistry 293, 3892-3903.

487 Andrews, N.C., and Faller, D.V. (1991). A rapid micropreparation technique for 488 extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic 489 Acids Res 19, 2499.

490 Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013). 491 Transposition of native chromatin for fast and sensitive epigenomic profiling of open 492 chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10, 1213-1218.

493 Burchill, M.A., Yang, J., Vogtenhuber, C., Blazar, B.R., and Farrar, M.A. (2007). IL-2 494 receptor beta-dependent STAT5 activation is required for the development of Foxp3+ 495 regulatory T cells. Journal of immunology 178, 280-290.

496 Chaiyachati, B.H., Jani, A., Wan, Y., Huang, H., Flavell, R., and Chi, T. (2013). BRG1- 497 mediated immune tolerance: facilitation of Treg activation and partial independence of 498 chromatin remodelling. EMBO J 32, 395-408.

499 Chapman, N.M., Zeng, H., Nguyen, T.M., Wang, Y., Vogel, P., Dhungana, Y., Liu, X., 500 Neale, G., Locasale, J.W., and Chi, H. (2018). mTOR coordinates transcriptional 501 programs and mitochondrial metabolism of activated Treg subsets to protect tissue 502 homeostasis. Nature communications 9, 2095.

503 Chen, W., Jin, W., Hardegen, N., Lei, K.J., Li, L., Marinos, N., McGrady, G., and Wahl, 504 S.M. (2003). Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ 505 regulatory T cells by TGF-beta induction of transcription factor Foxp3. The Journal of 506 experimental medicine 198, 1875-1886.

507 Chen, Z., Barbi, J., Bu, S., Yang, H.Y., Li, Z., Gao, Y., Jinasena, D., Fu, J., Lin, F., Chen, 508 C., et al. (2013). The ubiquitin ligase Stub1 negatively modulates regulatory T cell 509 suppressive activity by promoting degradation of the transcription factor Foxp3. 510 Immunity 39, 272-285.

511 Chinen, T., Kannan, A.K., Levine, A.G., Fan, X., Klein, U., Zheng, Y., Gasteiger, G., 512 Feng, Y., Fontenot, J.D., and Rudensky, A.Y. (2016). An essential role for the IL-2 513 receptor in Treg cell function. Nat Immunol 17, 1322-1333.

514 Delgoffe, G.M., Kole, T.P., Zheng, Y., Zarek, P.E., Matthews, K.L., Xiao, B., Worley, 515 P.F., Kozma, S.C., and Powell, J.D. (2009). The mTOR kinase differentially regulates 516 effector and regulatory T cell lineage commitment. Immunity 30, 832-844.

517 Delgoffe, G.M., Woo, S.R., Turnis, M.E., Gravano, D.M., Guy, C., Overacre, A.E., Bettini, 518 M.L., Vogel, P., Finkelstein, D., Bonnevier, J., et al. (2013). Stability and function of

23 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

519 regulatory T cells is maintained by a neuropilin-1-semaphorin-4a axis. Nature 501, 252- 520 256.

521 Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., 522 Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. 523 Bioinformatics 29, 15-21.

524 Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., 525 Smith, I., Tothova, Z., Wilen, C., Orchard, R., et al. (2016). Optimized sgRNA design to 526 maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 527 184-191.

528 Feng, Y., Arvey, A., Chinen, T., van der Veeken, J., Gasteiger, G., and Rudensky, A.Y. 529 (2014). Control of the inheritance of regulatory T cell identity by a cis element in the 530 Foxp3 locus. Cell 158, 749-763.

531 Feuerer, M., Hill, J.A., Kretschmer, K., von Boehmer, H., Mathis, D., and Benoist, C. 532 (2010). Genomic definition of multiple ex vivo regulatory T cell subphenotypes. 533 Proceedings of the National Academy of Sciences of the United States of America 107, 534 5919-5924.

535 Fujita, T., and Fujii, H. (2014). Identification of proteins associated with an IFNgamma- 536 responsive promoter by a retroviral expression system for enChIP using CRISPR. PloS 537 one 9, e103084.

538 Gatchalian, J., Malik, S., Ho, J., Lee, D.S., Kelso, T.W.R., Shokhirev, M.N., Dixon, J.R., 539 and Hargreaves, D.C. (2018). A non-canonical BRD9-containing BAF chromatin 540 remodeling complex regulates naive pluripotency in mouse embryonic stem cells. 541 Nature communications 9, 5139.

542 Gebuhr, T.C., Kovalev, G.I., Bultman, S., Godfrey, V., Su, L., and Magnuson, T. (2003). 543 The role of Brg1, a catalytic subunit of mammalian chromatin-remodeling complexes, in 544 T cell development. The Journal of experimental medicine 198, 1937-1949.

545 Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y.C., Laslo, P., Cheng, J.X., Murre, 546 C., Singh, H., and Glass, C.K. (2010). Simple combinations of lineage-determining 547 transcription factors prime cis-regulatory elements required for macrophage and B cell 548 identities. Mol Cell 38, 576-589.

549 Helmlinger, D., and Tora, L. (2017). Sharing the SAGA. Trends Biochem Sci 42, 850- 550 861.

551 Hill, J.A., Feuerer, M., Tash, K., Haxhinasto, S., Perez, J., Melamed, R., Mathis, D., and 552 Benoist, C. (2007). Foxp3 transcription-factor-dependent and -independent regulation of 553 the regulatory T cell transcriptional signature. Immunity 27, 786-800.

554 Josefowicz, S.Z., Lu, L.F., and Rudensky, A.Y. (2012). Regulatory T cells: mechanisms 555 of differentiation and function. Annu Rev Immunol 30, 531-564.

24 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

556 Josefowicz, S.Z., Wilson, C.B., and Rudensky, A.Y. (2009). Cutting edge: TCR 557 stimulation is sufficient for induction of Foxp3 expression in the absence of DNA 558 methyltransferase 1. Journal of immunology 182, 6648-6652.

559 Kim, H.P., and Leonard, W.J. (2007). CREB/ATF-dependent T cell receptor-induced 560 FoxP3 gene expression: a role for DNA methylation. The Journal of experimental 561 medicine 204, 1543-1551.

562 Kitagawa, Y., Ohkura, N., Kidani, Y., Vandenbon, A., Hirota, K., Kawakami, R., Yasuda, 563 K., Motooka, D., Nakamura, S., Kondo, M., et al. (2017). Guidance of regulatory T cell 564 development by Satb1-dependent super-enhancer establishment. Nat Immunol 18, 173- 565 183.

566 Kitoh, A., Ono, M., Naoe, Y., Ohkura, N., Yamaguchi, T., Yaguchi, H., Kitabayashi, I., 567 Tsukada, T., Nomura, T., Miyachi, Y., et al. (2009). Indispensable role of the Runx1- 568 Cbfbeta transcription complex for in vivo-suppressive function of FoxP3+ regulatory T 569 cells. Immunity 31, 609-620.

570 Koutelou, E., Hirsch, C.L., and Dent, S.Y. (2010). Multiple faces of the SAGA complex. 571 Curr Opin Cell Biol 22, 374-382.

572 Lal, G., Zhang, N., van der Touw, W., Ding, Y., Ju, W., Bottinger, E.P., Reid, S.P., Levy, 573 D.E., and Bromberg, J.S. (2009). Epigenetic regulation of Foxp3 expression in 574 regulatory T cells by DNA methylation. Journal of immunology 182, 259-273.

575 Lee, H.M., Bautista, J.L., Scott-Browne, J., Mohan, J.F., and Hsieh, C.S. (2012). A 576 broad range of self-reactivity drives thymic regulatory T cell selection to limit responses 577 to self. Immunity 37, 475-486.

578 Li, W., Koster, J., Xu, H., Chen, C.H., Xiao, T., Liu, J.S., Brown, M., and Liu, X.S. (2015). 579 Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. 580 Genome Biol 16, 281.

581 Li, W., Xu, H., Xiao, T., Cong, L., Love, M.I., Zhang, F., Irizarry, R.A., Liu, J.S., Brown, 582 M., and Liu, X.S. (2014a). MAGeCK enables robust identification of essential genes 583 from genome-scale CRISPR/Cas9 knockout screens. Genome Biol 15, 554.

584 Li, X., Liang, Y., LeBlanc, M., Benner, C., and Zheng, Y. (2014b). Function of a Foxp3 585 cis-element in protecting regulatory T cell identity. Cell 158, 734-748.

586 Liston, A., Nutsch, K.M., Farr, A.G., Lund, J.M., Rasmussen, J.P., Koni, P.A., and 587 Rudensky, A.Y. (2008). Differentiation of regulatory Foxp3+ T cells in the thymic cortex. 588 Proceedings of the National Academy of Sciences of the United States of America 105, 589 11903-11908.

590 Liu, Y., Zhang, P., Li, J., Kulkarni, A.B., Perruche, S., and Chen, W. (2008). A critical 591 function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ 592 regulatory T cells. Nat Immunol 9, 632-640.

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

593 Long, M., Park, S.G., Strickland, I., Hayden, M.S., and Ghosh, S. (2009). Nuclear factor- 594 kappaB modulates regulatory T cell development by directly regulating expression of 595 Foxp3 transcription factor. Immunity 31, 921-931.

596 Michel, B.C., D'Avino, A.R., Cassel, S.H., Mashtalir, N., McKenzie, Z.M., McBride, M.J., 597 Valencia, A.M., Zhou, Q., Bocker, M., Soares, L.M.M., et al. (2018). A non-canonical 598 SWI/SNF complex is a synthetic lethal target in cancers driven by BAF complex 599 perturbation. Nature cell biology 20, 1410-1420.

600 Mootha, V.K., Lindgren, C.M., Eriksson, K.F., Subramanian, A., Sihag, S., Lehar, J., 601 Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E., et al. (2003). PGC-1alpha- 602 responsive genes involved in oxidative phosphorylation are coordinately downregulated 603 in human diabetes. Nat Genet 34, 267-273.

604 Ouyang, W., Beckett, O., Ma, Q., and Li, M.O. (2010). Transforming growth factor-beta 605 signaling curbs thymic negative selection promoting regulatory T cell development. 606 Immunity 32, 642-653.

607 Platt, R.J., Chen, S., Zhou, Y., Yim, M.J., Swiech, L., Kempton, H.R., Dahlman, J.E., 608 Parnas, O., Eisenhaure, T.M., Jovanovic, M., et al. (2014). CRISPR-Cas9 knockin mice 609 for genome editing and cancer modeling. Cell 159, 440-455.

610 Polansky, J.K., Kretschmer, K., Freyer, J., Floess, S., Garbe, A., Baron, U., Olek, S., 611 Hamann, A., von Boehmer, H., and Huehn, J. (2008). DNA methylation controls Foxp3 612 gene expression. Eur J Immunol 38, 1654-1663.

613 Remillard, D., Buckley, D.L., Paulk, J., Brien, G.L., Sonnett, M., Seo, H.S., Dastjerdi, S., 614 Wuhr, M., Dhe-Paganon, S., Armstrong, S.A., et al. (2017). Degradation of the BAF 615 Complex Factor BRD9 by Heterobifunctional Ligands. Angew Chem Int Ed Engl 56, 616 5738-5743.

617 Rudra, D., Egawa, T., Chong, M.M., Treuting, P., Littman, D.R., and Rudensky, A.Y. 618 (2009). Runx-CBFbeta complexes control expression of the transcription factor Foxp3 in 619 regulatory T cells. Nat Immunol 10, 1170-1177.

620 Sakaguchi, S., Yamaguchi, T., Nomura, T., and Ono, M. (2008). Regulatory T cells and 621 immune tolerance. Cell 133, 775-787.

622 Samstein, R.M., Arvey, A., Josefowicz, S.Z., Peng, X., Reynolds, A., Sandstrom, R., 623 Neph, S., Sabo, P., Kim, J.M., Liao, W., et al. (2012). Foxp3 exploits a pre-existent 624 enhancer landscape for regulatory T cell lineage specification. Cell 151, 153-166.

625 Sanjana, N.E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome-wide 626 libraries for CRISPR screening. Nat Methods 11, 783-784.

627 Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelson, T., Heckl, D., 628 Ebert, B.L., Root, D.E., Doench, J.G., et al. (2014). Genome-scale CRISPR-Cas9 629 knockout screening in human cells. Science 343, 84-87.

26 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

630 Shifrut, E., Carnevale, J., Tobin, V., Roth, T.L., Woo, J.M., Bui, C.T., Li, P.J., Diolaiti, 631 M.E., Ashworth, A., and Marson, A. (2018). Genome-wide CRISPR Screens in Primary 632 Human T Cells Reveal Key Regulators of Immune Function. Cell 175, 1958-1971 e1915.

633 Spahn, P.N., Bath, T., Weiss, R.J., Kim, J., Esko, J.D., Lewis, N.E., and Harismendy, O. 634 (2017). PinAPL-Py: A comprehensive web-application for the analysis of CRISPR/Cas9 635 screens. Scientific reports 7, 15854.

636 Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., 637 Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set 638 enrichment analysis: a knowledge-based approach for interpreting genome-wide 639 expression profiles. Proceedings of the National Academy of Sciences of the United 640 States of America 102, 15545-15550.

641 Sun, I.H., Oh, M.H., Zhao, L., Patel, C.H., Arwood, M.L., Xu, W., Tam, A.J., Blosser, 642 R.L., Wen, J., and Powell, J.D. (2018). mTOR Complex 1 Signaling Regulates the 643 Generation and Function of Central and Effector Foxp3(+) Regulatory T Cells. Journal 644 of immunology 201, 481-492.

645 Tanaka, A., and Sakaguchi, S. (2017). Regulatory T cells in cancer immunotherapy. 646 Cell research 27, 109-118.

647 Tone, Y., Furuuchi, K., Kojima, Y., Tykocinski, M.L., Greene, M.I., and Tone, M. (2008). 648 Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat 649 Immunol 9, 194-202.

650 van Loosdregt, J., and Coffer, P.J. (2014). Post-translational modification networks 651 regulating FOXP3 function. Trends Immunol 35, 368-378.

652 van Loosdregt, J., Fleskens, V., Fu, J., Brenkman, A.B., Bekker, C.P., Pals, C.E., 653 Meerding, J., Berkers, C.R., Barbi, J., Grone, A., et al. (2013). Stabilization of the 654 transcription factor Foxp3 by the deubiquitinase USP7 increases Treg-cell-suppressive 655 capacity. Immunity 39, 259-271.

656 Wang, X., Wang, S., Troisi, E.C., Howard, T.P., Haswell, J.R., Wolf, B.K., Hawk, W.H., 657 Ramos, P., Oberlick, E.M., Tzvetkov, E.P., et al. (2019). BRD9 defines a SWI/SNF sub- 658 complex and constitutes a specific vulnerability in malignant rhabdoid tumors. Nature 659 communications 10, 1881.

660 Webster, K.E., Walters, S., Kohler, R.E., Mrkvan, T., Boyman, O., Surh, C.D., Grey, 661 S.T., and Sprent, J. (2009). In vivo expansion of T reg cells with IL-2-mAb complexes: 662 induction of resistance to EAE and long-term acceptance of islet allografts without 663 immunosuppression. The Journal of experimental medicine 206, 751-760.

664 Xue, Y., Canman, J.C., Lee, C.S., Nie, Z., Yang, D., Moreno, G.T., Young, M.K., 665 Salmon, E.D., and Wang, W. (2000). The human SWI/SNF-B chromatin-remodeling 666 complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes.

27 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

667 Proceedings of the National Academy of Sciences of the United States of America 97, 668 13015-13020.

669 Yan, Z., Cui, K., Murray, D.M., Ling, C., Xue, Y., Gerstein, A., Parsons, R., Zhao, K., 670 and Wang, W. (2005). PBAF chromatin-remodeling complex requires a novel specificity 671 subunit, BAF200, to regulate expression of selective interferon-responsive genes. 672 Genes Dev 19, 1662-1667.

673 Yang, X.O., Nurieva, R., Martinez, G.J., Kang, H.S., Chung, Y., Pappu, B.P., Shah, B., 674 Chang, S.H., Schluns, K.S., Watowich, S.S., et al. (2008). Molecular antagonism and 675 plasticity of regulatory and inflammatory T cell programs. Immunity 29, 44-56.

676 Yue, Y., Liu, J., and He, C. (2015). RNA N6-methyladenosine methylation in post- 677 transcriptional gene expression regulation. Genes Dev 29, 1343-1355.

678 Zhao, K., Wang, W., Rando, O.J., Xue, Y., Swiderek, K., Kuo, A., and Crabtree, G.R. 679 (1998). Rapid and phosphoinositol-dependent binding of the SWI/SNF-like BAF 680 complex to chromatin after T lymphocyte receptor signaling. Cell 95, 625-636.

681 Zheng, Y., Josefowicz, S., Chaudhry, A., Peng, X.P., Forbush, K., and Rudensky, A.Y. 682 (2010). Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T- 683 cell fate. Nature 463, 808-812.

684 Zheng, Y., and Rudensky, A.Y. (2007). Foxp3 in control of the regulatory T cell lineage. 685 Nat Immunol 8, 457-462.

686 Zhou, Y., Zhou, B., Pache, L., Chang, M., Khodabakhshi, A.H., Tanaseichuk, O., 687 Benner, C., and Chanda, S.K. (2019). Metascape provides a biologist-oriented resource 688 for the analysis of systems-level datasets. Nature communications 10, 1523.

689

28 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

690 Acknowledgments

691 We would like to thank C. Gordon for mouse colony management, B. Kuo and X. Hu for

692 assistance in plasmid extraction and mouse dissection, N. Hah and G. Chou for

693 assistance in RNA-seq, ChIP-seq, CRISPR screen experiments, E. Shifrut and A.

694 Marson (UCSF) for providing us the R script to generate the sgRNA distribution

695 histograms, A. Williams and M. Shokhirov for bioinformatic assistance, and M. Downes

696 and R. M. Evans for helpful discussion. C.S.L. was partly supported by the Albert G.

697 and Olive H. Schlink Foundation. J.G. was supported by the Salk Institute T32 Cancer

698 Training Grant T32CA009370 and the NIGMS NRSA F32 GM128377-01. D.C.H. was

699 supported by the National Institutes of Health (GM128943-01, CA184043-03), the V

700 Foundation for Cancer Research V2016-006, and the Leona M. and Harry B. Helmsley

701 Charitable Trust. Y.Z. was supported by the NOMIS Foundation, the Crohn’s and Colitis

702 Foundation, the Leona M. and Harry B. Helmsley Charitable Trust, and National

703 Institute of Health (AI107027 and OD023689). This work was also supported by

704 National Cancer Institute funded Salk Institute Cancer core facilities (CA014195).

705

706 Author Contributions

707 Conceptualization: C.S.L., J.G., D.C.H. and Y.Z. Methodology: C.S.L. Investigation:

708 C.S.L., J.G., Y.L., M.X., J.H., B.V. Resources: D.C.H. and Y.Z. Formal analysis: C.S.L.,

709 J.G., M.L. Data Curation: C.S.L., J.G. Supervision: D.C.H. and Y.Z. Funding acquisition:

710 D.C.H. and Y.Z. Writing – original draft preparation: C.S.L., J.G., D.C.H. and Y.Z.

711 Writing – review and editing: C.S.L., J.G., D.C.H. and Y.Z.

712

29 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

713 Figure Legends

714 Figure 1 | A genome-wide CRISPR screen in Treg cells

715 A, Workflow of the CRISPR screen in Tregs. B-D, Validation of the CRISPR screen

716 conditions. B, FACS plots showing Foxp3 expression in Tregs after knocking out Foxp3

717 (sgFoxp3), positive regulator Cbfb (sgCbfb), and negative regulator Dnmt1 (sgDnmt1).

718 Red and green gates were set based on Foxp3 low 20% and high 20% in sgNT Treg,

719 respectively. C, Mean fluorescence intensity (MFI) of Foxp3 and D, Relative Log2FC of

720 cell count comparing Foxp3Low to Foxp3High after deletion of the indicated target gene

721 (n=3 per group). See also Figure S1 and S2.

722

723 Figure 2 | Identification of novel Foxp3 regulators in Treg cells

724 A, B, A scatter plot of the Treg screen result showing positive regulators (A) and

725 negative regulators (B). Genes that have met cutoff criteria (P-value<0.01, and

726 Log2FC >± 0.5) are shown as red dots for positive regulators and green dots for

727 negative regulators. C, Distribution of sgRNA Log2FC comparing Foxp3Low to Foxp3High.

728 Red stripes represent sgRNAs from positive Foxp3 regulators, whereas green stripes

729 represent sgRNAs from negative Foxp3 regulators. D, Venn diagram showing the

730 overlap of Foxp3 regulators with genes involved in cell contraction or expansion. E, F,

731 Gene ontology analysis of positive Foxp3 regulators (E) and negative Foxp3 regulators

732 (F). See also Figures S3 and S4; Tables S1, S2, S3, and S4.

733

734 Figure 3 | The three SWI/SNF complex assemblies have distinct regulatory roles

735 for Foxp3 expression in Tregs

30 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

736 A, A diagram showing three different variants of SWI/SNF complexes: BAF, ncBAF, and

737 PBAF. BAF-specific subunits (ARID1A, DPF1-3) are colored blue, ncBAF-specific

738 subunits (BRD9, SMARCD1, GLTSCR1L, GLTSCR1) colored orange, and PBAF-

739 specific subunit (PBRM1, ARID2, BRD7, PHF10) colored green. Shared components

740 among complexes are colored gray. Immunoprecipitation assay of ARID1A, BRD9, and

741 PHF10, and BRG1 in Tregs. The co-precipitated proteins were probed for shared

742 subunits (SMARCA4, SMARCC1, SMARCB1), BAF-specific ARID1A, ncBAF-specific

743 BRD9, and PBAF-specific PBRM1. B, FACS histogram of Foxp3 expression in Tregs

744 after sgRNA knockout of the indicated SWI/SNF subunits. C, Mean fluorescence

745 intensity (MFI) of Foxp3 after sgRNA knockout of the indicated SWI/SNF subunits. Data

746 represents mean and standard deviation of biological replicates (n = 3-21). D, Principal

747 component analysis of RNA-seq data collected from Tregs transduced with guides

748 against the indicated SWI/SNF subunits. In cases where two independent guides were

749 used to knockdown a gene, the second guide for targeting gene indicated as “-2”. E,

750 MFI of Foxp3 expression in Tregs after treatment with either DMSO or 0.16-10 μM

751 dBRD9 for 4 days. Data represent mean ± s.d. Statistical analyses were performed

752 using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05, **p<0.01, ***p<0.001,

753 ****p<0.0001).

754

755 Figure 4 | BRD9 deletion reduces Foxp3 binding at CNS0, CNS2 enhancers and a

756 subset of Foxp3 target sites

757 A, Genome browser tracks of SMARCA4, BRD9, PHF10 ChIP-seq and ATAC-seq

758 signal, as well as Foxp3 ChIP-seq in sgNT, sgFoxp3, sgBrd9 and sgPbrm1 Tregs and

31 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

759 Foxp3 in DMSO and dBRD9 treated Tregs (2.5 μM dBRD9 for 4 days). Foxp3 locus is

760 shown with CNS0 and CNS2 enhancers indicated in gray ovals. B, Heat map of Foxp3,

761 BRD9, SMARCA4, PHF10 ChIP-seq and ATAC-seq signal ± 3 kb centered on Foxp3-

762 bound sites in Tregs, ranked according to Foxp3 read density. C, Venn diagram of the

763 overlap between ChIP-seq peaks in Tregs for BRD9, Foxp3, and PHF10

764 (hypergeometric p value of BRD9:Foxp3 overlap = e-30704, hypergeometric p value of

765 PHF10:Foxp3 overlap = e-13182, hypergeometric p value of BRD9:PHF10 overlap = e-

766 12895). D, Heat map of Foxp3 ChIP-seq signal in sgNT, sgFoxp3, sgBrd9 and sgPbrm1

767 Tregs ± 3 kilobases (kb) centered on Foxp3-bound sites in sgNT, ranked according to

768 read density. E, Venn diagram of the overlap (hypergeometric p value = e-11,653)

769 between sites that significantly lose Foxp3 binding (FC 1.5, Poisson p value < 0.0001) in

770 sgFoxp3 and sgBrd9, overlaid on all Foxp3-bound sites in sgNT (in gray). F, Histogram

771 of Foxp3 ChIP read density ± 1 kb surrounding the peak center of sites that significantly

772 lose Foxp3 binding in both sgFoxp3 and sgBrd9 (n=1,699) in sgNT, sgFoxp3, sgBrd9

773 and sgPbrm1. G, As in E, but for sites that lose H3K27ac (FC 1.5, Poisson p value <

774 0.0001, hypergeometric p value of overlap = e-7,938). H, As in F, but for H3K27ac ChIP

775 read density. I, As in E, but for sites that significantly lose Foxp3 binding in dBRD9

776 treated Tregs versus DMSO (FC 1.5, Poisson p value < 0.0001). J, As in F, but for

777 DMSO and dBRD9 treated cells.

778

779 Figure 5 | BRD9 co-regulates the expression of Foxp3 and a subset of Foxp3

780 target genes

32 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

781 A, Volcano plot of log2 fold change RNA expression in sgFoxp3/sgNT Tregs versus

782 adjusted p value (Benjamin-Hochberg). Number of down- and up-regulated genes are

783 indicated, which are colored blue and red, respectively. B, Significance of enrichment of

784 Foxp3-dependent genes in each gene ontology. C, Pie chart of Foxp3 and BRD9

785 binding by ChIP-seq for Foxp3-dependent genes. D, Scatterplot of the mRNA log2 fold

786 changes in sgFoxp3/sgNT and sgBrd9/sgNT for Foxp3-dependent genes. Linear

787 regression analysis was performed to calculate the r2. Best fit is represented as an

788 orange dashed line. E, Gene set enrichment analysis (GSEA) enrichment plot for up-

789 and down-regulated genes in sgBrd9/sgNT compared with RNA-seq data of genes that

790 significantly change in sgFoxp3/sgNT Tregs. ES: Enrichment Score, NES: Normalized

791 Enrichment Score, FWER: Familywise Error Rate. F, As in E, but for up- and down-

792 regulated genes in dBRD9/DMSO Tregs. G, GSEA of the sgFoxp3/sgNT RNA-seq data;

793 plot shows the familywise error rate (FWER) p value versus the normalized enrichment

794 score (NES). See also Table S5.

795

796 Figure 6 | The ncBAF complex regulates Treg suppressor function in vitro and in

797 vivo.

798 A. In vitro suppression assay of Tregs with sgRNA knockout of Brd9, Smarcd1, Pbrm1,

799 and Phf10 (n=3 per group, data represent ± s.d.). sgNT was used as non-targeting

800 control. B-F. Experiment to measure Treg function of sgNT or sgBrd9 knockout Treg

801 cells relative to no Tregs in a T cell transfer induced colitis model. B, Experimental

802 procedure. C, Body weight loss. D, Colon histology (left) and colitis scores (right). E,

803 Percentage of Foxp3+ cells in transferred CD45.2+CD4+ Treg population at end point.

33 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

804 (n=4-6 per group. Data represent mean ± s.e.m.) Statistical analyses were performed

805 using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05, **p<0.01, ***p<0.001).

806

807 Figure 7 | Targeting BRD9 in Treg improves anti-tumor immunity.

808 A, Experiment procedure to measure function of sgNT or sgBrd9 knockout Treg cells

809 relative to no Tregs in MC38 tumor model. B, Tumor growth curve. C, Tumor weight at

810 end point. D,E, Bar graph of total CD4 T cells (D) and CD8 T cells (E) percentage in

811 CD45+ immune cell population. F,G, Bar graph of IFN-γ+ cell percentage in CD4 T cells

812 (F) and in CD8 T cells (G). H, Bar graph of CD4+eGFP+Foxp3+ donor cells in CD4+ T

813 cells. I, Ratio of CD8/Treg. (n=5-7 per group. Data represent mean ± s.e.m.) Statistical

814 analyses were performed using unpaired two-tailed Student's t test (ns: p≥0.05, *p<0.05,

815 **p<0.01, ***p<0.001).

816

817

34 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

818 Methods

819 List of antibodies

Target protein Antibody source Application (dilution)

CD4-Alexa fluor 700 eBioscience 56-0042-82 Flow (1:400)

CD4-PerCP-Cy5.5 TONBO 65-0042-U100 Flow (1:400)

CD8-PE eBioscience 12-0081-85 Flow (1:400)

CD8-BV510 Biolegend 100752 Flow (1:400)

CD45.1-BV605 Biolegend 110735 Flow (1:400)

CD45.2-Alexa 700 Biolegend 109822 Flow (1:400)

Foxp3-eFluor 450 eBioscience 48-5773-82 Flow (1:400)

NGFR-PE Biolegend 345106 Flow (1:400)

NGFR-APC Biolegend 345108 Flow (1:400)

Thy1.1-PE eBioscience 12-0900-83 Flow (1:400)

CD44-BV650 Biolegend 103049 Flow (1:400)

CD62L-BV605 Biolegend 104438 Flow (1:400)

IFNg-APC eBioscience 17-7311-82 Flow (1:400)

Ghost Viability Dye TONBO 13-0865-T100 Flow (1:800)

Foxp3 In-house WB (1:2000); ChIP (1:100)

BRG1/SMARCA4 Abcam 110641 WB (1:2000); IP, ChIP (1:100)

BAF155/SMARCC1 Santa Cruz sc-10756 WB (1:1000)

BAF47/SMARCB1 Santa Cruz sc-166165 WB (1:1000)

BRD9 Active Motif 61537 WB (1:2000); IP, ChIP (1:100)

PBRM1 Bethyl A301-591A WB (1:2000)

35 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

PHF10 Thermo Fisher PA5-30678 IP, ChIP (1:100)

ARID1A Santa Cruz sc-32761 WB (1:1000)

Histone H3K27ac Abcam ab4729 ChIP (1:100)

IgG Cell Signaling 2729S IP (1:100)

anti-mouse secondary Thermo Fisher A21058 WB (1:20,000)

anti-rabbit secondary Thermo Fisher SA535571 WB (1:20,000)

820

821 List of sgRNA sequence

Plasmid name Target gene sgRNA sequence

pSIRG-NGFR-sgFoxp3 Foxp3 TCTACCCACAGGGATCAATG

pSIRG-NGFR-sgCbfb Cbfb GCCTTGCAGATTAAGTACAC

pSIRG-NGFR-sgDnmt1 Dnmt1 TAATGTGAACCGGTTCACAG

pSIRG-NGFR-sgArid1a Arid1a GCAGCTGCGAAGATATCGGG

pSIRG-NGFR-sgArid1a-2 Arid1a TACCCAAATATGAATCAAGG

pSIRG-NGFR-sgArid1b Arid1b TGAGTGCAAAACTGAGCGCG

pSIRG-NGFR-sgArid1b-2 Arid1b CAGAACCCCAACATATAGCG

pSIRG-NGFR-sgDpf1 Dpf1 TCTTCTACCTCGAGATCATG

pSIRG-NGFR-sgDpf2 Dpf2 GAAGATACGCCAAAGCGTCG

pSIRG-NGFR-sgPbrm1 Pbrm1 AAAACACTTGCATAACGATG

pSIRG-NGFR-sgPbrm1-2 Pbrm1 CAATGCCAGGCACTACAATG

pSIRG-NGFR-sgArid2 Arid2 ACTTGCAGTAAATTAGCTCG

pSIRG-NGFR-sgBrd7 Brd7 CAGGAGGCAAGCTAACACGG

pSIRG-NGFR-sgPhf10 Phf10 GTTGCCGACAGACCGAACGA

36 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

pSIRG-NGFR-sgBrd9 Brd9 ATTAACCGGTTTCTCCCGGG

pSIRG-NGFR-sgBrd9-2 Brd9 GGAACACTGCGACTCAGAGG

pSIRG-NGFR-sgGltscr1 Gltscr1 GTTCTGTGTAAAATCACACT

pSIRG-NGFR-sgGltscr1l Gltscr1l ATGGCTTTATGCAACACGTG

pSIRG-NGFR-sgSmarcd1 Smarcd1 CAATCCGGCTAAGTCGGACG

pSIRG-NGFR-sgEny2 Eny2 AGAGCTAAATTAATTGAGTG

pSIRG-NGFR-sgAtxn7l3 Atxn7l3 GCAGCCGAATCGCCAACCGT

pSIRG-NGFR-sgUsp22 Usp22 GCCATCGACCTGATGTACGG

pSIRG-NGFR-sgCcdc101 Ccdc101/Sgf29 CCAGGTTTCCCGATCCAGAG

pSIRG-NGFR-sgTada3 Tada3 GAAGGTCTGTCCCCGCTACA

pSIRG-NGFR-sgTada1 Tada1 TTTCCTTCTCGACACAACTG

pSIRG-NGFR-sgTaf6l Taf6l TCATGAAACACACCAAACGA

pSIRG-NGFR-sgSupt20 Supt20 TTAGTAGTCAATCTGTACCC

pSIRG-NGFR-sgSupt5 Supt5 GATGACCGATGTACTCAAGG

pSIRG-NGFR-sgNT Non-targeting AAAAAGTCCGCGATTACGTC

pSIRG-eGFP-sgBrd9 Brd9 ATTAACCGGTTTCTCCCGGG

pSIRG-eGFP-sgNT Non-targeting AAAAAGTCCGCGATTACGTC

822

823 Mice

824 C57BL/6 Rosa-Cas9/Foxp3Thy1.1 mice were generated by crossing Rosa26-LSL-Cas9

825 knockin mice(Platt et al., 2014) (The Jackson Laboratory #024857) with Foxp3Thy1.1

826 reporter mice(Liston et al., 2008). Male Cas9/Foxp3Thy1.1 mice at 8-12 weeks age were

827 used to isolate Tregs for the CRISPR screen, and no gender preference was given for

37 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

828 other experiments. C57BL.6 Ly5.1+ congenic mice and Rag1-/- mice purchased from

829 the Jackson Laboratory were used for Treg suppression assay and adoptive T cell

830 transfer in colitis and tumor models. All mice were bred and housed in the specific

831 pathogen-free facilities at the Salk Institute for Biological Studies and were conducted

832 under the regulation of the Institutional Animal Care and Use Committee (IACUC) and

833 institutional guidelines.

834

835 Retroviral vectors and sgRNA library construction

836 Self-inactivating retroviral vector pSIRG-NGFR was generated by modifying pSIR-

837 dsRed-Express2(Fujita and Fujii, 2014) (Addgene #51135), which enables us to clone

838 sgRNA as efficient as lentiCRISPRv2, to enrich transduced cells via magnetic beads

839 isolation, and to perform intracellular staining without losing transduced reporter marker.

840 We first mutated all BbsI sites in pSIR-dsRed-Express2, then inserted a sgRNA

841 expressing cassette containing the U6 promoter, guide RNA scaffold and a 500bp filler

842 embedded with BbsI cloning site. The dsRed cassette was replaced by cDNA sequence

843 of human NGFR with truncated intracellular domain. We also generated pSIRG vector

844 with eGFP (pSIRG-eGFP) for the purpose of T cells transfer in tumor study, minimizing

845 potential immune rejection. The pSIRG-eGFP was generated by cutting pSIRG-NGFR

846 with XcmI to remove NGFR cassette and replaced by eGFP cDNA by Gibson cloning.

847 For cloning single guide RNA into the pSIRG vector, an annealed sgRNA oligos can be

848 directly inserted into BbsI-digested pSIRG-NGFR by T4 ligation similar to the cloning

849 method utilized by lentiCRISPRv2(Sanjana et al., 2014). To create a pooled sgRNA

850 library in pSIRG-NGFR, we first amplified sgRNA sequences from an optimized mouse

38 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

851 CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL

852 PCR reactions were performed to maximize coverage of sgRNA complexity. Each 50 μL

853 PCR reaction contained Q5 High-Fidelity DNA polymerase and buffer (NEB #M0491),

854 15ng of lentiCRISPRv2-Brie, and targeted primers (Forward:

855 GGCTTTATATATCTTGTGGAAAGGACGAAACACCG, Reverse:

856 CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). PCR was performed at 98°C

857 denature, 67°C annealing, 72°C extension for 12 cycles. The sgRNA library amplicons

858 were then combined and separated in 2 % agarose gel, and purified by the QIAquick

859 Gel Extraction Kit (Qiagen #28704). The purified sgRNA amplicons was inserted into

860 the BbsI-digested pSIRG-NGFR by NEBuilder HIFI assembly (NEB #E2621S). The

861 sgRNA representative of the retroviral CRISPR library (pSIRG-NGFR-Brie) was

862 validated by deep sequencing and comparing to the original lentiCRISPRvs-Brie. The

863 coverage of the new pSIRG-NGFR sgRNA library was evaluated by the PinAPL-Py

864 program (Spahn et al., 2017) (see Extended Data Figure 1).

865

866 T cell isolation and culture

867 For large scale Treg culture, we first expanded Treg in Rosa-Cas9/Foxp3Thy1.1 mice by

868 injecting IL-2:IL-2 antibody immune complex according protocol described in Webster

869 KE et. al(Webster et al., 2009). Spleen and lymph node Tregs were labeled with PE-

870 conjugated Thy1.1 antibody and isolated by magnetic selection using anti-PE

871 microbeads (Mitenyl #130-048-801). All isolated Tregs were activated by plate bound

872 anti-CD3 and anti-CD28 antibodies and cultured with X-VIVO 20 media (LONZA #04-

873 448Q) supplemented by 1X Pen/Strep, 1X Sodium pyruvate, 1X HEPES, 1X GlutaMax,

39 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

874 55 μM beta-mercaptoethanol in the presence of IL-2 at 500 U/mL. For experiments with

875 BRD9 degradation, Tregs were treated at day 0 with 2.5μM dBRD9 (Tocris #6606) and

876 cultured for four days for RNA- and ChIP-seq and 0.16-10μM treated at day 0 and

877 cultured dBRD9 for four days for Foxp3 MFI, cell viability and cell proliferation assays.

878 Live cells were enriched by Ficoll-Paque 1.084 (GE Health 17-5446-02) for RNA-seq

879 and ChIP-seq.

880

881 Retroviral production and T cell transduction

882 HEK293T cells were seeded in 6-wells plate at 0.5 million cells per 2mL DMEM media

883 supplemented by 10% FBS, 1% Pen/Strep, 1X GlutaMax, 1X Sodium Pyruvate, 1X

884 HEPES, and 55 μM beta-mercaptoethanol. One day later, cells from each well was

885 transfected with 1.2 μg of targeting vector pSIRG-NGFR and 0.8 μg of packaging vector

886 pCL-Eco (Addgene, #12371) by using 4 μL of FuGENE HD transfection reagent

887 (Promega #E2311) according manufactured protocol. Cell culture media was replaced

888 by 3 mL fresh DMEM complete media at 24 hours and 48 hours after transfection. The

889 retroviral supernatant was collected at 48 and 72 hours post transfection for T cell

890 infection. For experiments with CRISPR sgRNA targeted knockdown, Cas9+ Tregs

891 were first seeded in 24-wells plate coated with CD3 and CD28 antibodies. At 24 hour

892 post-activation, 70% of Treg media from each well was replaced by retroviral

893 supernatant, supplemented with 4 μg/mL Polybrene (Milipore # TR-1003-G), and spun

894 in a benchtop centrifuge at 1,258 x g for 90 minutes at 32°C. After centrifugation, Treg

895 media was replaced with fresh media supplemented with IL-2 and cultured for another

896 three days. Transduced cells were analyzed for Foxp3 and cytokine expression in

40 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

897 eBioscience Fix/Perm buffer (eBioscience #00-5523-00) using flow cytometry.

898 Transduced NGFR+ cells were FACS-sorted for subsequent RNA- and ChIP-seq

899 experiments.

900

901 Genome-wide CRISPR screen in Treg

902 Approximately 360 million Treg cells isolated from Rosa-Cas9/Foxp3Thy1.1 mice were

903 used for the Treg screen. On day 0, Tregs were seeded at 1x106 cells/mL into 24-wells

904 plate coated with anti-CD3/28 and cultured with X-VIVO complete media with IL-2 (500

905 U/ml). On day 1, sgRNA retroviral library transduction was performed with a MOI<0.2.

906 On day 3, approximately 4 million (~50X coverage) NGFR+ transduced cells were

907 collected in three replicates as the starting state sgRNA input. Treg cells reached

908 confluence on day 4. NGFR+ transduced cells were isolated via magnetic selection by

909 anti-PE beads (Mitenyl #130-048-801), and then plated onto new 24-wells plates coated

910 with anti-CD3/CD28, and cultured in X-VIVO complete media with IL-2 (500 U/ml). On

911 day 6, approximately 4 million NGFR+ transduced cells were collected in three

912 replicates as the ending state sgRNA output. The remaining cells were fixed,

913 permeabilized, and stained for intracellular Foxp3. Approximately 2 million Foxp3High

914 (top 20%) and 2 million Foxp3Low (bottom 20%) cell populations were sorted in three

915 replicates by a FACS Aria cell sorter for genomic DNA extraction and library

916 construction.

917

918 Preparation of sgRNA amplicons for Next-Generation Sequencing

41 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

919 To extract genomic DNA, we first lysed cells with homemade digestion buffer (100mM

920 NaCl, 10mM Tris, 25mM EDTA, 0.5% SDS, 0.1mg/mL Proteinase K) overnight in 50 °C.

921 On the following day, the lysed sample was mixed with phenol: chloroform: isoamyl

922 alcohol (25:24:1, v/v) in 1:1 ratio, and spun at 6000rpm for 15 min at room temperature.

923 The supernatant containing genomic DNA was transferred into a new tube and mixed

924 with twice volume of 100% ethanol, then spun at 12,500 rpm for 5 min in room

925 temperature to precipitate DNA. Supernatant was removed, and the precipitated DNA

926 was dissolved in ddH2O. DNA concentration was measured by Nanodrop. To generate

927 sgRNA amplicons from extracted genomic DNA, we used a two-step PCR protocol

928 which was adopted from the protocol published by Shalem et. al. (Shalem et al., 2014).

929 We performed eight 50 μL PCR reactions containing 2 μg genomic DNA, NEB Q5

930 polymerase, and buffer, and targeted primers (Forward:

931 GGCTTTATATATCTTGTGGAAAGGACGAAACACCG, Reverse:

932 CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC). PCR was performed at 98°C

933 denature, 70°C annealing, 15s extension for 20 cycles. The products from the first PCR

934 were pooled together, and purified by AMPure XP SPRI beads according to

935 manufacturer’s protocol, and quantified by Qubit dsDNA HS assay. For the second

936 round PCR, we performed eight 50 μL PCR reactions containing 2 ng purified 1st round

937 PCR product, barcoded primer (see primer set from (Shalem et al., 2014), Priming site

938 of reverse primer was changed to CTTCCCTCGACGAATTCCCAAC), NEB Q5

939 polymerase, and buffer. PCR was performed at 98°C denature, 70°C annealing, 15 s

940 extension for 12 cycles. The 2nd round PCR products were pooled, purified by AMPure

42 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

941 XP SPRI beads, quantified by Qubit dsDNA HS assay, and sequenced by NEXTSeq

942 sequencer at single end 75 bp (SE75).

943

944 Data analysis of pooled CRISPR screen

945 The screening hit identification and quality control was performed by MAGeCK-VISPR

946 program(Li et al., 2015; Li et al., 2014a). The abundance of sgRNA from a sample fastq

947 file was first quantified by MAGeCK “Count” module to generate a read count table. For

948 hit calling, we used MAGeCK “test” module to generate a gene-ranking table that

949 reporting RRA gene ranking score, p-value, and log2 fold change. The size factor for

950 normalization was adjusted according to1000 non-targeting control assigned in the

951 screen library. All sgRNAs that are zero read were removed from RRA analysis. The

952 log2 fold change of a gene was calculated from a mean of 4 sgRNA targeting per gene.

953 The scatter plots showing the screen results were generated by using the R script

954 EnhancedVolcano (https://github.com/kevinblighe/EnhancedVolcano). The R script that

955 generated the sgRNA distribution histogram was provided by E. Shifrut and A. Marson

956 (UCSF)(Shifrut et al., 2018). A gene list from Foxp3 regulators (either positive or

957 negative) without affecting cell proliferation was subjected to Gene Ontology analysis

958 using Metascape(Zhou et al., 2019). Genes were analyzed for enrichment for Functional

959 Set, Pathway, and Structural Complex.

960

961 In vitro Treg suppression assay

962 Tregs were transduced by retrovirus expressing sgRNA targeting gene of interest and

963 cultured in X-VIVO complete media supplemented with IL-2 (500 U/ml). Four days after

43 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

964 transduction, transduced cells were sorted and mixed with FACS sorted CD45.1+ naive

965 CD4 T cells (CD4+ CD25– CD44Low CD62LHigh) labeled with CellTrace Violet (Thermo

966 Fisher Scientific #C34571) in different ratio in the presence of irradiated T cell depleted

967 spleen cells as antigen-presenting cells (APC). Three days later, Treg suppression

968 function was measured by the percentage of non-dividing cells within the CD45.1+

969 effector T cell population. For dBRD9 treatment experiment, dBRD9 was first dissolved

970 in DMSO (10 mM stock) and added into Treg:Teff:APC mixture at 2.5μM. For Foxp3

971 overexpression rescue experiment, Tregs were first transduced with sgNT or sgBrd9 at

972 24 hour post-activation, and then transduced with MIGR empty vector or MIGR-Foxp3

973 at 48 hour post-activation. Double transduced Tregs were FACS sorted on day 4 based

974 on NGFR+ and GFP+ markers and then mixed with CellTrace labeled effector T cells in

975 the presence of APC. Treg suppression readout was measured after three days of co-

976 culture.

977

978 Adoptive T cells transfer-induced colitis model

979 Tregs were transduced by retrovirus expressing sgRNA targeting gene of interest, and

980 cultured in X-VIVO complete media and IL-2 (500 U/ml). Four days after transduction,

981 the NGFR+ transduced Treg cells were FACS sorted before transferred into recipient

982 mice. To induce colitis, 2 million effector T cells (CD45.1+ CD4+ CD25– CD45RBHigh) and

983 1 million sgRNA knockout Tregs (CD45.2+ CD4+ Thy1.1+ NGFR+) were mixed together

984 and transferred into Rag1 knockout recipient mice. The body weight of recipient mice

985 was monitored weekly for signs of wasting symptoms. Mice were harvested 7 weeks

44 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

986 after T cell transfer. Spleens were used for profiling immune cell populations by FACS.

987 Colons were collected for histopathological analysis.

988

989 Colon histopathological analysis

990 Histopathological analysis was performed in a blinded manner and scored using the

991 following criteria. Eight parameters were used that include (i) the degree of inflammatory

992 infiltrate in the LP (0-3); (ii) Goblet cell loss (0–2); (iii) reactive epithelial

993 hyperplasia/atypia with nuclear changes (0–3); (iv) the number of IELs in the epithelial

994 crypts (0–3); (v) abnormal crypt architecture (distortion, branching, atrophy, crypt loss)

995 (0–3); (vi) number of crypt abscesses (0–2); (vii) mucosal erosion to frank ulcerations

996 (0–2) and (viii) submucosal spread to transmural involvement (0-2). The severity of

997 lesion was scored independently in 3 regions (proximal, middle and distal colon) over a

998 maximal score of 20. The overall colitis score was based as the average of each

999 regional score (maximal score of 20).

1000

1001 Adoptive T cells transfer and MC38 tumor model

1002 Similar to the “Adoptive T cells transfer-induced colitis model”, Tregs were activated in

1003 vitro and transduced with pSIRG-eGFP expressing sgNT or sgBrd9. Four days after

1004 transduction, the eGFP+ transduced Treg were FACS sorted. Concurrently, Treg

1005 depleted CD4 and CD8 T cells isolated from Rosa-Cas9/Foxp3Thy1.1 mice were used as

1006 effector T cells. A total of 1 million pSIRG-sgRNA transduced eGFP+ Tregs, 1 million

1007 effector CD8 T cells, and 2 million Treg-depleted CD4 T cells were mixed and

1008 transferred into Rag1 knockout recipient mice. on the following day, mice were

45 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1009 implanted with 0.5 million MC38 cells (a gift from the laboratory of Dr. Susan Kaech) by

1010 subcutaneous injection on the flank of mouse. When palpable tumor appeared, tumor

1011 size was measured every two day by electronic calipers. At the end point, spleen and

1012 tumor were collected for immune profiling. For tumor processing, tumor tissues were

1013 minced into small pieces and digested with 0.5 mg/mL Collagenase IV (Sigma #C5138)

1014 and DNAase I (Roche #4716728001) for 20 minutes and passed through 0.75 μm cell

1015 strainer to collect single cell suspension. Isolated cells were stimulated with

1016 PMA/Ionomycin and Golgi plug for 5 hours, and then were subjected to Foxp3 and

1017 cytokines staining with eBioscience Fix/Perm buffer (eBioscience #00-5523-00).

1018

1019 Nuclear protein extraction

1020 Nuclear lysates were collected from Treg cells following a revised Dignam

1021 protocol(Andrews and Faller, 1991). After cellular swelling in Buffer A (10 mM Hepes pH

1022 7.9, 1.5 mM MgCl2, 10 mM KCl) supplemented with 1 mM DTT, 1 mM PMSF, 1 µM

1023 pepstatin, 10 µM leupeptin and 10 µM chymostatin, cells were lysed by homogenization

1024 using a 21-gauge needle with six to eight strokes. If lysis remained incomplete, cells

1025 were treated with 0.025 - 0.05% Igepal-630 for ten minutes on ice prior to nuclei

1026 collection. Nuclei were spun down at 700 x g for five minutes then resuspended in

1027 Buffer C (20 mM Hepes pH 7.9, 20% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM

1028 EDTA) supplemented with 1 mM DTT, 1 mM PMSF, 1 µM pepstatin, 10 µM leupeptin

1029 and 10 µM chymostatin. After thirty minutes of end-to-end rotation at 4°C, the sample

1030 was clarified at 21,100 x g for ten minutes. Supernatant was collected, flash frozen in

1031 liquid nitrogen and stored in the -80°C freezer.

46 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1032

1033 Co-Immunoprecipitation

1034 Nuclear lysates were thawed on ice then diluted with two-thirds of original volume of 50

1035 mM Tris-HCl pH 8, 0.3% NP-40, EDTA, MgCl2 to bring down the NaCl concentration.

1036 Proteins were quantified using Biorad DC Protein Assay (Cat #5000112) according to

1037 manufacturer’s instructions. For the co-IP reaction, 200-300 µg of proteins were

1038 incubated with antibody against normal IgG, SMARCA4, BRD9, ARID1A or PHF10

1039 overnight at 4°C, with end-to-end rotation. Precipitated proteins were bound to 50:50

1040 Protein A: Protein G Dynabeads (Invitrogen) for one to two hours and washed

1041 extensively with IP wash buffer (50 mM Tris pH 8, 150 mM NaCl, 1 mM EDTA, 10%

1042 glycerol, 0.5% Triton X100). Proteins were eluted in SDS-PAGE loading solution with

1043 boiling for five minutes and analyzed by western blotting.

1044

1045 Western blot

1046 Protein samples were run on 4-12% Bis-Tris gels (Life Technologies). After primary

1047 antibody incubation which is typically done overnight at 4°C, blots were probed with

1048 1:20,000 dilution of fluorescently-labeled secondary antibodies in 2% BSA in PBST (1X

1049 Phospho-buffered saline with 0.1% Tween-20) for an hour at room temperature (RT).

1050 Fluorescent images were developed using Odyssey and analyzed using Image Studio 2.

1051 Protein quantitation was performed by first normalizing the measured fluorescence

1052 values of the proteins of interest against the loading control (TBP) then normalizing

1053 against the control sample (vehicle treated).

1054

47 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1055 RNA-seq sample preparation

1056 RNA from 1-3 x 106 cells was extracted and purified with TRIzol reagent (Thermo Fisher)

1057 according to manufacturer’s instructions. RNA-seq libraries were prepared using

1058 Illumina TruSeq Stranded mRNA kit following manufacturer’s instructions with 5 µg of

1059 input RNA.

1060

1061 RNA-seq analysis

1062 Single-end 50 bp reads were aligned to the mouse genome mm10 using STAR

1063 alignment tool (V2.5)(Dobin et al., 2013). RNA expression was quantified as raw integer

1064 counts using analyzeRepeats.pl in HOMER(Heinz et al., 2010) using the following

1065 parameters: -strand both -count exons -condenseGenes -noadj. To identify differentially

1066 expressed genes, we performed getDiffExpression.pl in HOMER, which uses the

1067 DESeq2 R package to calculate the biological variation within replicates. Cut-offs were

1068 set at log2 FC = 0.585 and FDR at 0.05 (Benjamin-Hochberg). Principal Component

1069 Analysis (PCA) was performed with the mean of transcript per million (TPM) values

1070 using Cluster 3.0 with the following filter parameters: at least one observation with

1071 absolute value equal or greater than two and gene vector of four. TPM values were log

1072 transformed then centered on the mean.

1073

1074 Gene Set Enrichment Analysis

1075 GSEA software(Mootha et al., 2003; Subramanian et al., 2005) was used to perform the

1076 analyses with the following parameters: number of permutations = 1000; enrichment

1077 statistic = weighted; and metric for ranking of genes = difference of classes (Input RNA-

48 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1078 seq data was log-transformed). For Figure 5G, input RNA-seq data contained the

1079 normalized log-transformed reads of the 1,325 differentially expressed genes (DEGs) in

1080 sgFoxp3/sgNT Tregs. The compiled gene list included GSEA Gene Ontology,

1081 Immunological Signature, Curated Gene, and the up- and down-regulated DEGs in

1082 sgBrd9/sgNT Tregs. The resulting normalized enrichment scores and FWER p values

1083 were combined to generate the graph.

1084

1085 ChIP-seq sample preparation

1086 Treg cells were collected and cross-linked first in 3 mM disuccinimidyl glutarate (DSG)

1087 in 1X PBS for thirty minutes then in 1% formaldehyde for another ten minutes, both at

1088 RT, for chromatin binding protein ChIP or in 1% formaldehyde only for histone

1089 modification ChIP. After quenching the excess cross-linker with a final concentration of

1090 125 mM glycine, the cells were washed in 1X PBS, pelleted, flash-frozen in liquid

1091 nitrogen, and stored at -80°C. Cell pellets were thawed on ice and incubated in lysis

1092 solution (50 mM HEPES-KOH pH 8, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5%

1093 NP40, 0.25% Triton X-100) for ten minutes. The isolated nuclei were washed with wash

1094 solution (10 mM Tris-HCl pH 8, 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl) and

1095 shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 8) then sheared in a

1096 Covaris E229 sonicator for ten minutes to generate DNA fragments between ~ 200-

1097 1000 base pairs (bp). After clarification of insoluble material by centrifugation, the

1098 chromatin was immunoprecipitated overnight at 4°C with antibodies against Foxp3,

1099 SMARCA4, BRD9, PHF10 or H3K27ac. The next day, the antibody bound DNA was

1100 incubated with Protein A+G Dynabeads (Invitrogen) in ChIP buffer (50 mM HEPES-

49 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1101 KOH pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% DOC, 0.1% SDS),

1102 washed and treated with Proteinase K and RNase A. Cross-linking was reversed by

1103 incubation at 55°C for two and a half hours. Purified ChIP DNA was used for library

1104 generation (NuGen Ovation Ultralow Library System V2) according to manufacturer’s

1105 instructions for subsequent sequencing.

1106

1107 ChIP-seq analysis

1108 Single-end 50 bp or paired-end 42 bp reads were aligned to mouse genome mm10

1109 using STAR alignment tool (V2.5)(Dobin et al., 2013). ChIP-Seq peaks were called

1110 using findPeaks within HOMER using parameters for histone (-style histone) or

1111 transcription factor (-style factor) (Christopher Benner, HOMER,

1112 http://homer.ucsd.edu/homer/index.html, 2018). Peaks were called when enriched > two-

1113 fold over input and > four-fold over local tag counts, with FDR 0.001 (Benjamin-

1114 Hochberg). For histone ChIP, peaks within a 1000 bp range were stitched together to

1115 form regions. ChIP-Seq peaks or regions were annotated by mapping to the nearest

1116 TSS using the annotatePeaks.pl command. Differential ChIP peaks were found by

1117 merging peaks from control and experiment groups and called using

1118 getDiffExpression.pl with fold change ≥ 1.5 or ≤ -1.5, Poisson p value < 0.0001.

1119

1120 Motif analysis

1121 Sequences within 200 bp of peak centers were compared to motifs in the HOMER

1122 database using the findMotifsGenome.pl command using default fragment size and

1123 motif length parameters. Random GC content-matched genomic regions were used as

50 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1124 background. Enriched motifs are statistically significant motifs in input over background

1125 by a p-value of less than 0.05. P-values were calculated using cumulative binomial

1126 distribution.

1127

1128 ATAC-seq sample preparation

1129 ATAC-seq was performed according to previously published protocol(Buenrostro et al.,

1130 2013). Briefly, 50,000 Treg cells were collected in duplicates and washed first with cold

1131 1X PBS then with Resuspension buffer (RSB; 10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3

1132 mM MgCl2). Cells were lysed in RSB supplemented with 0.1% Igepal-630 and nuclei

1133 were isolated by centrifugation at 500 x g for ten minutes. Nuclei were incubated with

1134 Tn5 transposase in Tagment Buffer (Illumina) for thirty minutes at 37°C. Purified DNA

1135 was ligated with adapters, amplified and size selected using AMPure XP beads

1136 (Beckman) for sequencing. Library DNA was sequenced using paired end 42 bp reads.

1137

1138 ATAC-seq analysis

1139 Paired end 42 bp reads were aligned to mouse genome mm10 using STAR alignment

1140 tool (V2.5). ATAC-seq peaks were called using findPeaks within HOMER using the style

1141 parameter dnase. Peaks were called when enriched > four-fold over genomic

1142 background and > four-fold over local tag counts, with FDR 0.001 (Benjamin-Hochberg).

1143

51 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 1

A Day 0 1 2 3 4 5 6 High

IL2 Pooled sgRNAs Refreshing Fix/Perm and retroviral infection media & Foxp3 staining Low Cas9 Tregs MOI < 0.2 reactivation Isolation Collecting Collecting Transduced T cells Transduced T cells (sgRNAs Input) (sgRNAs Output) Foxp3

B sgNT sgFoxp3 sgCbfb sgDnmt1 C 800 D 8 6 600 4

400 2

MFI Foxp 3 0 200 -2 Log2FC of cell coun t

0 -4 Foxp3

sgNT sgNT sgCbfb sgCbfb sgFoxp3 sgDnmt1 sgFoxp3 sgDnmt1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 2

A Positive Foxp3 regulator (254 hits) B Negative Foxp3 regulator (490 hits) Smarcd1 Tada1 Cbfb Foxp3 Cnot11 Dhps Cnot10 6 Ube2m Gtf2a2 Wdr82 6 Wdr25 Bcor Mettl14 Ccdc84 Usp22 Sympk Ssu72 Drap1 Aip Stk11 Edrf1 Ccdc101 Taf5l Slc39a7 Dohh Dbr1 Prpf19 P P 4 4 Rc3h1 Commd4 Taf11 Ddit4 Snrnp40 Usp5 10 10 Rps3 Brd9 Tbx21 Jak1 Otud5 Eif5a Rpl19 -Log -Log 2 Batf Tox4 Runx3 Rrm1 2 Mettl3 Il2ra Zap70 Rpl32 Defa2

0 0 -4 -2 0 2 4 6 4 2 0 -2 -4 -6 Log2 Fold Change Log2 Fold Change

Foxp3Low Vs Foxp3High C 1.0 D

0.5 Expansion Positive 21 Negative 0.0 1 −10 −5 0 5 10 327 Log2FC [sgRNA] P-value 197 56 163 Foxp3 2.40E-07

Cbfb 2.40E-07

Runx3 0.00273 1278

Usp7 0.00798 Contraction Dnmt1 0.06094

Stub1 0.00758 Depleted Enriched

Positive Foxp3 regulator E SAGA-type complex negative regulation of T cell activation RNA polymerase II, holoenzyme regulation of histone acetylation SWI/SNF complex nuclear receptor transcription coactivator activity regulation of DNA-binding transcription factor activity dendritic cell differentiation chromosome, telomeric region protein polyubiquitination

0 4 8 12 16 -Log10(P) F Negative Foxp3 regulator negative regulation of TOR signaling transcriptional repressor complex Deadenylation-dependent mRNA decay Hypusine synthesis from eIF5A-lysine regulation of small molecule metabolic process protein export from nucleus cellular response to hormone stimulus positive regulation of transferase activity forebrain radial glial cell differentiation mRNA metabolic process

-10 -8 -6 -4 -2 0 Log10(P) bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 3

A B sgArid1a sgArid1b sgArid1a/b sgDpf1 sgDpf2 D1-D3 SS18 E1 ARID1A DPF1-3 B1 BAF ARID1B Bcl7 A4 a-c A2 C1 C2 Bcl11 ACTB a,b ACTL6A sgBrd9 sgSmarcd1 sgGltscr1 sgGltscr1l sgGltscr1/1l BAF GLTSCR1L D1-D3 E1 ncBAF D1 GLTSCR1 PBRM1 SS18 ARID2 B1 BRD9 A4 A4 Bcl7 BRD7 b,c A2 A2 C1 C1 C1 C2 sgBrd7 sgArid2 sgPbrm1 sgPhf10 ACTB PHF10 ACTB

ACTL6A ACTL6A PBAF ncBAF PBAF

IP for BAF subunits Foxp3

C Input IgG SMARCA4ARID1A BRD9 PHF10 2.0 SMARCA4 n.s. ******** **** SMARCC1 1.5 n.s. n.s. n.s. * SMARCB1 *** n.s. n.s. **** **** **** **** ARID1A 1.0 BRD9

PBRM1 Normalized Foxp3 MFI 0.5

0.0 D PCA of transcriptomic changes in Tregs sgNT sgDpf1sgDpf2 sgBrd9 sgBrd7sgArid2 sgArid1asgArid1b sgDpf1/2 sgPbrm1sgPhf10 40 sgGltscr1sgGltscr1l Pbrm1-2 sgArid1a/1b sgSmarcd1 sgGltscr1/1l

Arid2 20 Phf10 E 8000 Dpf1/2 Pbrm1 Brd7 Dpf2 6000 0 NT Arid1a/b 4000

PC2 (11.5%) PC2 Arid1a-2/b-2 Gltscr1 Arid1a Gltscr1/Gltscr1l Brd9-2 Smarcd1 Foxp3 MF I 2000 -20 Arid1a-2 Brd9 0 -60 -40 -20 0 20 40 5uM 10uM DMSO0.16uM0.31uM0.63uM1.25uM2.5uM PC1 (20.3%) dBRD9 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint Loo, et al. Figure(which 4 was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A Ppp1r3f Foxp3 Flicr Ccdc22 CNS0 CNS2 Conservation 1.6 _ ATAC SMARCA4 0.7 _ 1.5 _ BRD9 0.6 _ PHF10 1.8 _ sgNT 1.8 _ sgFoxp3 1.8 _ sgBrd9 1.8 _ sgPbrm1

Foxp3 2.1 _ DMSO 2.1 _ dBRD9

B BRD9 PHF10 C Overlap of binding sites, nTreg D Foxp3 binding Foxp3 SMARCA4 ATAC sgNT sgFoxp3 sgBrd9 sgPbrm1 BRD9 FOXP3 n = 21,916 n = 20,096

7,001 10,565 8,763

3,362 PHF10 n = 6,791 986 968 1,475 Foxp3 peaks (n = 20,096) Read density centered on Read density centered on Foxp3 peaks (n = 11,287)

-3 kb 3 kb -3 kb 3 kb E Sites with decreased Foxp3 binding F BRD9-dependent Foxp3 target sites Down in 12 sgNT sgFoxp3 sgFoxp3 n = 9,730 8 sgBrd9 sgPbrm1 4 Down in density 1,699 sgBrd9

n = 1,809 Foxp3 ChIP-seq 0 -1 0 1 sgNT, n = 11,287 distance from peak center (kb) G Overlap of H3K27ac down sites H H3K27ac at BRD9-dependent Foxp3 target sites sgFoxp3 sgNT n = 10,609 16 sgFoxp3 12 sgBrd9 8,548 sgPbrm1 8

1,847 sgBrd9 density 4 n = 2,880 0 966 H3K27ac ChIP-seq -1 0 1 sgNT, n = 25,678 distance from peak center (kb)

I Decreased Foxp3 J BRD9-dependent Foxp3 binding with dBRD9 sites 16 Down in DMSO 12 dBRD9 dBRD9 n = 7,245 8

7,154 density 4

FOXP3 ChIP-seq 0 -1 0 1 distance from peak DMSO, n = 17,135 center (kb) bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 5

Foxp3 and BRD9 binding at A Foxp3-dependent genes B GO Enrichment of Foxp3 DEGs C Foxp3-dependent genes 10-300 n = 793 n = 532 cytokine production -250 regulation of defense response 81 10 regulation of cell adhesion Foxp3 and BRD9 Gbp2 272 169 -200 leukocyte differentiation 10 Ccr8 cytokine-cytokine receptor interaction BRD9 only Igfbp4 positive regulation of locomotion 10-150 cytokine biosynthetic process regulation of innate immune response Foxp3 only negative regulation of catalytic activity 803 10-100

adj p valu e positive regulation of cell death Il13 taxis Neither 10-50 angiogenesis Il4 Il21 regulation of MAPK cascade 0 Il5 10 0 5 10 15 20 25 -10 -5 0 5 10 -log10 of P value sgFoxp3 vs. sgNT Log2 Fold Change

D E Up in sgBrd9 Genes Down in sgBrd9 Genes Foxp3-dependent genes 0.0 0.8 -0.2 6 r 2 = 0.534 0.6 4 -0.4 0.4 2 -0.6 NES = -3.30 0.2 NES = 3.13 Running ES FWER p = 0 Running ES FWER p = 0 0 -0.8 0.0 -2 5.0 5.0 -4

Log2FC sgBrd9/sgNT 2.5 2.5 -10 -5 0 5 10 sgFoxp3 (negative correlation) sgFoxp3 (negative correlation) 0.0 0.0 Log2FC sgFoxp3/sgNT sgNT (positive correlation) sgNT (positive correlation) metric -2.5 metric -2.5 Ranked list -5.0 Ranked list -5.0 0 250 500 750 1000 1250 0 250 500 750 1000 1250 Rank in ordered data set Rank in ordered data set

F Up in dBrd9 Genes Down in dBrd9 Genes 0.0 0.5 G Gene Set Enrichment Down in 0.4 sgFoxp3/sgNT

-0.2 Norm. Enrichment Score 0.3 Down, Down, FOXP3 4 0.2 sgBrd9 mutant -0.4 NES = -2.52 NES = 2.25 0.1 Down, 9,229 gene

Running ES 2 FWER p = 0 Running ES FWER p = 0 dBRD9 -0.6 0.0 Down, CD8 lists vs Treg 0 4.0 4.0 Down, Treg 2.0 Up, dBRD9 sgFoxp3 (negative correlation) 2.0 sgFoxp3 (negative correlation) vs Tcell 0 0 Up, FOXP3 sgNT (positive correlation) sgNT (positive correlation) -2

metric -2.0 mutant metric -2.0 JAK STAT -4.0 signaling Ranked list -4.0

Ranked list Up,sgBrd9 -6.0 -6.0 -4 0 250 500 750 1000 1250 0 250 500 750 1000 1250 0 0.6 1.2 Up in Rank in ordered data set Rank in ordered data set FWER p value sgFoxp3/sgNT bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 6

A 100 100 sgNT sgNT ** 80 sgBrd9 80 *** sgSmarcd1 *** *** 60 60 *** *** 40 *** 40 ***

20 20 Non-dividing Cells (% ) Non-dividing Cells (% ) 0 0 1:1 1:2 1:4 1:8 1:1 1:2 1:4 1:8 Treg:Teff ratio Treg:Teff ratio

100 100 sgNT sgNT ns ns 80 sgPbrm1 80 sgPhf10 *** *** 60 *** 60 **

40 ns 40 **

20 20 Non-dividing Cells (% ) Non-dividing Cells (% ) 0 0 1:1 1:2 1:4 1:8 1:1 1:2 1:4 1:8 Treg:Teff ratio Treg:Teff ratio

B C 5

0 e (%) ng e -5

t cha igh t -10

e sgNT w -15 sgBrd9 od y

B Teff only -20 0 1 2 3 4 5 6 7 Weeks D sgNT sgBrd9 Teff only 20

15 sc ore 10 tis oli tis C 5

150 uM 150 uM 150 uM 0

sgNT sgBrd9 Teff only E sgNT sgBrd9

80 CD 4

60

40 xp3+ % Fo xp3+

20 CD45 .2

0 Foxp3 sgNT sgBrd9 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.26.964981; this version posted February 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Loo, et al. Figure 7

A

B 1000 C 1.5 sgNT * ) 3 800 sgBrd9 No Treg 1.0 600 ht (g) ig ht (mm ze * e 400 w * 0.5 Tumor Tumor si Tumor 200 *

0 0.0 0 8 10 12 14 16 18 Day sgNT sgBrd9No Treg

D 40 E 50 sgNT

40 sgBrd9 30 No Treg 30 (%) CD45+ 20 (%) CD45+ f f

0f 20 10 CD8 CD4 o 10

0 0 Tumor Spleen Tumor Spleen

F 100 G 100 sgNT 80 80 sgBrd9 + + % + + % No Treg γ 60 γ 60

40 40 CD4 + IF N CD8 + IF N 20 20

0 0 Tumor Spleen Tumor Spleen

H I 25 15 sgNT

(%) 20 sgBrd9 +

10 rat io 15 re g 10

GFP+ Fo xp3 5 CD8 /T e 5 CD4 + 0 0 Tumor Spleen Tumor Spleen