Exploiting Entomopathogenic Nematode Neurobiology to Improve Bioinsecticide Formulations

DOCTOR OF PHILOSOPHY

Morris, Rob

Award date: 2020

Awarding institution: Queen's University Belfast

Link to publication

Terms of use All those accessing thesis content in Queen’s University Belfast Research Portal are subject to the following terms and conditions of use

• Copyright is subject to the Copyright, Designs and Patent Act 1988, or as modified by any successor legislation • Copyright and moral rights for thesis content are retained by the author and/or other copyright owners • A copy of a thesis may be downloaded for personal non-commercial research/study without the need for permission or charge • Distribution or reproduction of thesis content in any format is not permitted without the permission of the copyright holder • When citing this work, full bibliographic details should be supplied, including the author, title, awarding institution and date of thesis

Take down policy A thesis can be removed from the Research Portal if there has been a breach of copyright, or a similarly robust reason. If you believe this document breaches copyright, or there is sufficient cause to take down, please contact us, citing details. Email: [email protected]

Supplementary materials Where possible, we endeavour to provide supplementary materials to theses. This may include video, audio and other types of files. We endeavour to capture all content and upload as part of the Pure record for each thesis. Note, it may not be possible in all instances to convert analogue formats to usable digital formats for some supplementary materials. We exercise best efforts on our behalf and, in such instances, encourage the individual to consult the physical thesis for further information.

Download date: 04. Oct. 2021

QUEEN’S UNIVERSITY BELFAST

INSTITUTE FOR GLOBAL FOOD SECURITY

SCHOOL OF BIOLOGICAL SCIENCES

Exploiting Entomopathogenic Nematode Neurobiology to Improve Bioinsecticide Formulations

ROBERT MORRIS

Degree in Biology, Liverpool John Moores University, U.K.

FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

September 2019

Exploiting Entomopathogenic Nematode Neurobiology to Improve Bioinsecticide Formulations

Robert Morris

A dissertation submitted to Queen’s University Belfast in accordance with the requirements for award of the degree of PhD in the Institute for Global Food Security, School of Biological Sciences, September 2019.

Word Count: 34,225

Abstract

Entomopathogenic nematodes (EPNs) are soil dwelling organisms that target and kill insects. They have sophisticated chemosensory apparatus, with which they perceive host associated cues to locate them. Once a suitable host is located, they employ a diverse range of host finding behaviours to facilitate contact with a host, a prerequisite for infection. These EPNs are described as beneficial nematodes as they are employed as biocontrol agents for crop protection against insect pests. Insects cause devastating damage to annual crop yields. Many chemical pesticides have been banned across the world due to their devastating effects on the environment and the health of animals, therefore, a safer alternative is essential to protect crops from pests. EPNs have proven that they can provide effective protection against insects in both field and glasshouse trials, however, there have been reports of inconsistencies in biocontrol efficiency. This could be attributed to our limited knowledge of their biology post-application, and the molecular mechanisms that drives their host finding behaviours. Some insight into the genes that regulate these diverse host finding behaviours in EPNs could be used to enhance their biocontrol efficiency. Small interfering RNAs can silence genes post- transcriptionally. One method to achieve gene knockdown with small interfering RNAs is RNA interference (RNAi). RNAi is a powerful tool to determine the function of a gene, as it can be tailored to target a specific gene of interest, silence the gene in vivo, and observe the effect this has on the organism. Functional studies using RNAi have identified the role of many genes in the model organism Caenorhabditis elegans, including many genes involved in sensory perception. In this study, the neuropeptide encoding gene flp-21, will be targeted using RNAi in Steinernema carpocapsae to observe its effect on their host finding behaviours. This study is the first instance of RNAi in a Steinernema species of EPN, where Sc-flp-21 was suppressed by 84 % (P<0.0001) by soaking S. carpocapsae IJs in a high amount of dsRNA for 48 hours with 50 mM serotonin. The suppression of Sc-flp-21 had significant effects on their host finding behaviours through impeding olfactory perception in these nematodes. Another method used to identify genes that regulate intraspecific

III phenotypic differences between populations is RNA-sequencing. Sequencing the transcriptome allows observation of the gene expression pattern of a single cell or entire organism at one time. Differentially expressed genes between phenotypically different populations can indicate the genes responsible for the intraspecific differences observed between populations. Transcriptome analysis identified differentially expressed genes between S. carpocapsae strains that showed phenotypic differences with regards to their host finding behaviours. Nictation behaviour in S. carpocapsae may be heavily regulated by Sc-daf-2 and Sc-daf-7, which has been described in C. elegans previously. Host finding behaviour was enhanced in Breton strain, and transcriptome analysis revealed many GPCRs and neuropeptides to be upregulated in Breton, relative to the other two strains. Functional studies would need to take place before these genes’ roles can be confirmed. Natural EPN isolates were collected from Northern Irish soil, and challenged through host finding assays, along with various other trait assessments, to investigate their natural diversity. Ten isolates were collected, spanning at least four EPN species: S. feltiae, S. affine, Heterorhabditis downesi and other, unidentified Heterorhabditis species. All isolates tested, including some laboratory strains, showed phenotypic variation in their host finding behaviours. Intraspecific phenotypic variation was also observed between S. feltiae strains. The large phenotypic variation observed in natural populations of EPN may allow biocontrol formulations to be tailored to the user’s needs, and facilitate artificial selection for enhanced EPN strains. This thesis focuses on the molecular basis of host finding behaviours in EPNs, and exploring their natural diversity to enhance their biocontrol efficiency for crop protection.

Dedication and Acknowledgments

I would like to dedicate this Thesis to my Grandmother, who was always my biggest supporter and inspiration in life.

Firstly I would like to thank Queen’s University Belfast and their Business Alliance funding for allowing me to undertake and carry out my PhD degree. I am very grateful for my supervisors, Dr Johnathan Dalzell and Prof Aaron Maule, for the guidance, time and effort they’ve provided since starting my PhD, and for their academic expertise and knowledge, which helped me become a better scientist. Working in the same laboratory and starting my PhD alongside Matthew Sturrock was a blessing, his humour, professional and personal support was second to none, and I am very thankful to call him a close friend. I would like to especially thank Dr Debbie Cox for her encouragement, teachings, and for providing both professional and emotional support when I needed it. A big thank you to, Dr Neil Warnock, Dr Leonie Wilson and Dr Ciaran McCoy for their help, advice and all the good times we shared together since the moment we met. Dr Nikki Marks provided me with support and strength when I needed it, and brightened up my day every day we had a catch up, which I am so grateful for. Thank you to my family and friends for their patience, understanding and support during my PhD experience. To my new found family in Belfast, I thank Erica, CJ and Ben for making my time there so special; I couldn’t have done it without your support. I would also like to express my gratitude to the many others that also supported me during my time in Belfast, thank you for making my experience so unforgettable. And finally, thank you to Catherine Maciver and John Parker for always believing in me and supporting me throughout our friendship.

Author’s Declaration

I declare that the work in this thesis was carried out in accordance with the requirement of Queen’s University Belfast’s Regulations and Code of Practise for Research Degree Programmes and that it has not been submitted for any other academic award. Except where indicated by specific reference in the text, the work is the candidate’s own work. Work done in collaboration with, or with the assistance of others, is indicated as such. Any views expressed in the dissertation are these of the author.

Signed ………………………………………………………………. Date…………………………….

Table of Contents Title ...... I

Cover page ...... II

Abstract ...... III

Dedication and Acknowledgments ...... V

Author’s Declaration ...... VI

Table of Contents ...... VII

List of Figures ...... IX

List of Tables ...... XII

Abbreviations and Definitions ...... XIII

Chapter 1: General Introduction ...... 1

1.1 Overview ...... 1

1.2 Entomopathogenic Nematodes ...... 2

1.3 EPN Biology ...... 4

1.4 EPN Host Finding ...... 6

1.5 EPNs in Biocontrol ...... 7

1.6 EPN Genome ...... 8

1.7 EPN Soil Survey ...... 9

1.8 Nematode Neurobiology ...... 10

1.9 Nematode Olfactory Perception ...... 13

1.10 Nematode CO2 Perception ...... 14

1.11 Neuropeptides ...... 15

1.12 Neuropeptide and GPCR Interactions ...... 16

1.13 Concluding Remarks ...... 18

VII

Chapter 2: RNAi in Steinernema spp...... 20

2.1 Introduction ...... 20

2.2 Materials and Methods ...... 27

2.3 Results ...... 35

2.4 Discussion ...... 49

Chapter 3: Chapter 3: Isolation of Native EPNs in Northern Ireland ...... 54

3.1 Introduction ...... 54

3.2 Materials and Methods ...... 62

3.3 Results ...... 66

3.4 Discussion ...... 75

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae ...... 81

4.1 Introduction ...... 81

4.2 Materials and Methods ...... 86

4.3 Results ...... 89

4.4 Discussion ...... 120

Chapter 5: General Discussion ...... 134

References ...... 140

VIII

List of Figures

Fig 1. Perkins et al. (1986) adaptation of the amphid chemosensory organs ciliated dendritic ends...... 13

Fig 2. Host finding assay set up...... 34

Fig 3. Abundance of target transcript was measured by qRT-PCR expression analysis, and a knockdown ratio was calculated for each target relative to the house keeper genes Sc-act and Sc-tub...... 35

Fig 4. Behavioural observations of nictating individual IJs on a micro-dirt chip assay post RNAi treatment...... 37

Fig 5. Behavioural assessment of S. carpocapsae IJ host finding and dispersal ability on a 1.5 % (w/v) PBS agar post one hour incubation in darkness at 23ᵒC post RNAi treatment...... 40

Fig 7. Following 48 h incubation period in 5 mg / ml dsRNA and 50 mM serotonin RNAi treatment, nictating IJs were observed for their moving away behaviour upon exposure to either 1) no insect/clean air or 2) G. mellonella larvae...... 45

Fig 8. Following the same RNAi protocol as Sc-flp-21, other genes were targeted for knockdown, RT-qPCR knockdown analysis are presented with GFP and NEO dsRNA controls...... 46

Fig 9. Map of sites where soil samples were taken from natural Northern Irish soil...... 67

Fig 10. The native isolates collected were assessed on several attirbutes that may aid their biocontrol efficiancy by enhancing several desirable traits...... 69

Fig 11. The time for G. mellonella to succumb and die from EPN infection was recorded for each S. feltiae strain at varying IJ concentration...... 71

Fig 12. Each S. feltiae strain were challenged with a soil G. mellonella finding assay at a density of 100 IJs per insect, the time it took for IJs to travel through the soil matrix and kill the insect larvae were recorded. ... 73

Fig 13. Behavioural analysis of S. carpocapsae strain host finding behaviours...... 90

Fig 14. Comparative analysis of S. carpocapsae neuropeptide, GPCR and lipid metabolising gene expression with regards to nictating phenotypes; UK1 vs ALL and Breton strain. DESeq2 calculated each genes log2fold change relative to the other strains, and are presented in heatmaps...... 94

Fig 15. Normalised expression values presented in an expression plot for differentially expressed neuropeptide, GPCR and lipid metabolising genes between nictating groups; UK1 vs ALL and Breton (P<0.0001)...... 99

Fig 16. Comparative analysis of S. carpocapsae neuropeptide, GPCR and lipid metabolising gene expression with regards to their host finding phenotypes; Breton vs ALL and UK1 strain. DESeq2 calculated each genes log2fold change relative to the other strains, and are presented in heatmaps...... 103

Fig 17. Normalised expression values presented in an expression plot for differentially expressed neuropeptide, GPCR and lipid metabolising gene expression between host finding groups; Breton vs ALL and UK1...... 108

Fig 18. S. carpocapsae strains revealed to be differentially susceptible to Sc- srsx-3 gene knockdown by method of a 5 mg / ml dsRNA soak for 48 hours. Genes predicted to be associated with S. carpocapsae’s RNAi pathway were collected from Morris et al., (2017). These genes were examined for differential expression between the S. carpocapsae strains...... 111

Fig 19. EBSeq isoform analysis...... 116

Fig 20. The chemotaxis index (CI) scores from the insect volatile chemoattraction assays across three S. carpocapsae strain (ALL, UK & Breton) are presented in these figures. Their waxworm and mealworm (live) attraction CI scores are presented, alongside 16 of the insect volatiles that were tested...... 118

List of Tables

Table 1. The gene IDs of RNAi targets, collected from WormBase Parasite (2018)...... 28

Table 2. Primer sequences used for dsRNA synthesis and qRT-PCR analysis...... 29

Table 3. The ITS region of each isolate were targeted and amplified with the primer pair TW81 and AB28. The ITS regions were sequenced, and a nBLAST alignment was performed against the NCBI databank (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul, et al., 1990)...... 68 Table 4. Average results from laboratory assessments of attributes considered beneficial for biocontrol purposes. A ratio for the number of emerging IJs was created by dividing each average score with the highest scoring isolate (LM-4C). The average CI score is also presented for each strain. The average percentage of IJs that dispersed was transformed into a ratio and presented for each strain. All three ratios were then added to create a biocontrol score...... 70 Table 5. The average time for each isolate in the soil assay and the kill time assay (50 IJs per insect) were used to deduce the time it took for the IJs to travel across the soil matrix to reach the insect (> 14 cm), and therefore the speed at which they travel (14 / Time travelling = cm/h)...... 74

Table 6. EBSeq possible expression patterns for DE isoforms across three conditions; ALL, UK1 & Breton...... 115

XII

Abbreviations

EPN: Entomopathogenic nematode.

IJ: Infective juvenile. spp.: Species.

RNAi: RNA interference. dsRNA: Double stranded RNA.

CI: Chemotaxis index.

PCR: Polymerase chain reaction. qRT-PCR: Real-time quantitative reverse transcription PCR.

GPCR: G protein-coupled receptor.

GCR: Guanylyl cyclase receptor.

FLP: FMRF amide like peptides.

NLP: Neuropeptide like proteins.

ILP: Insulin like peptides.

RNA-Seq: RNA sequencing.

Puff: The forced ejection of air from a pipette.

XIII

Chapter 1: General Introduction

CHAPTER 1: GENERAL INTRODUCTION

1.1 Overview

The human population has been growing exponentially since the 18th century, with no signs of deceleration (FAO, 2009). A recent prediction from the United Nations (UN) has forecasted our numbers to reach almost 10 billion by 2050 (United Nations, Department of Economic and Social Affairs, Population Division, 2017). The ever-growing population of our species presents a serious threat to our sustainability, as resources become more limited by the year. Agriculture and food production industries are already facing the pressure to increase yield, as it was estimated that overall food production would have to increase by 60 % to support our population in 2050, relative to 2005/2007 (Alexandratos & Bruinsma, 2012). Part of the solution would be to intensify sustainable food production. Current challenges facing crop production efficacy include climate change, limited agricultural space and attack from plant damaging pests (Knox et al., 2010; Najafi et al., 2018; Oerke, 2006). Animal crop pests cause devastating damage to the world’s annual crop yield; some reports suggest they are responsible for almost 20 % of worldwide crop loss (Oerke, 2006). The majority of animal damage comes from insect pests, which can threaten as much as 70 % in damage to yield annually in more tropical regions (Thomas, 1999). The United States Department of Agriculture (USDA) have revealed that invasive insect pests cause annual damage of $120 billion to agricultural and environmental plant life in the United States alone. It is clear that insect pests already greatly threaten agriculture; however, some studies have highlighted how climate change can make the situation more severe. In a study by Bebber et al. (2013), it was revealed that global warming has facilitated the spread of insect pests towards higher altitudes and closer to the North and South Poles at a rate of nearly 3 kilometres a year. This has enabled the spread of pests such as Dendroctonus ponderosae (the mountain pine beetle), allowing them to access and destroy large areas of pine forest in the United States Pacific Northwest, which they previously could not reach. Control measures

Chapter 1: General Introduction

usually rely heavily on chemical pesticides, which have caused major environmental, animal and human health problems. This has led to many of these pesticides being banned from agricultural use; such as dichlorodiphenyltrichloroethane (DDT), an organochloride compound, and neurotoxic pesticides of the organophosphate class, such as bensulide and dicrotophos (Delcour et al., 2015; Donley, 2019). Less harmful control agents to reduce insect crop damage are a valuable resource to protect crops and increase crop yield worldwide to support our ever-growing population. Biological systems have been used with varying results to control pests; they have appeared as pathogens, parasites or predators of target pests. Live pest control agents are better known as biocontrol agents, where they may be insect predatory insects, such as beetles and wasps (Evans & England, 1996), bacterial, such as Bacillus spp. (Fravel, 2005), and nematodes; the entomopathogenic nematodes (EPNs). The biopesticide market was estimated to be worth $ 3 billion in 2018, and is projected to increase to $ 6.4 billion by 2023, at a compound annual growth rate (CAGR) of 15.99% (Marketsandmarkets.com, 2019). The demand for effective and safe biocontrol is increasing in line with the danger that insects pose to our crops. This is exasperated by the fact that our pesticide control strategies are highly regulated and limited to regimes and products that pose no harm to the health of humans and surrounding environment (Regulation, 2019).

1.2 Entomopathogenic Nematodes

EPNs are nematode-bacterial complexes that are pathogenic to insects.

They actively find insects following sensory cues, such as host CO2 and volatile output, and kill them rapidly with their entomopathogenic bacteria (Gaugler, 1988; Hallem et al., 2011a). EPNs borrow their name from the symbiotic gram-negative bacteria (Class: Gammaproteobacteria), which they harbour in their gut. Steinernema spp. and Heterorhabditis spp. nematodes associate with Xenorhabdus spp. and Photorhabdus spp. respectively (Poinar Jr & Grewal, 2012). Steinernema and Heterorhabditis spp. nematodes share similar morphologies and life histories, however,

Chapter 1: General Introduction

these lifestyles evolved independently, convergently around 350 million years ago (Poinar, 1993). EPNs span three taxonomic groups; Steinernema, Heterorhabditis and Oscheius spp. Members from the former two genera mentioned have attracted the most attention for economic and research purposes and are widely used as effective biocontrol agents (Grewal et al., 2005). Blaxter et al., (1998) organised Heterorhabditis spp. into clade V with Strongylida nematodes, and Steinernema spp. nematodes fell into clade IV with Strongyloides spp. In a similar study by Holterman (2006), Heterorhabditis spp. were positioned in clade 9 and Steinernema spp. in clade 10. Both studies support the separate origins of the EPN lifestyle. This kind of entomopathogenic lifestyle has arisen at least three times, and Dillman et al., (2012) proposed two key characteristics of the EPN lifestyle: 1) The nematode must have a symbiotic relationship with bacteria, and, 2) The insect’s death is rapid; within 120 hours. Members of the Oscheius genus have a facultative relationship with Serratia bacteria and rapidly kill their host (<120h), classifying them as EPNs. Another nematode, known to casually associate with Serratia bacteria, is Caenorhabditis briggsae. This nematode was thought to employ an entomopathogenic lifestyle; however, due to its inability to cause insect mortality within 120h, it is not classed as an EPN (Dillman et al., 2012a). The Steinernema genus consists of at least 70 defined species, and Heterorhabditis has 20 members (Stock, 2015).

The EPN lifestyle has likely arisen from an ancestral free-living bacteriovore nematode. Free living nematodes often associate closely with other organisms, including the model nematode Caenorhabditis elegans. Close symbiotic associations with molluscs and arthropods opens opportunities for parasitism to evolve, in organisms such as nematodes. It has been discovered that some free-living nematodes are able to survive a passage through the digestive tract of slugs (Petersen et al., 2015). Furthermore, nematodes actively seek out passing arthropods in their dauer life-stage, attaching themselves to a larger organism for phoretic purposes (when local conditions become unfavourable) (Lee et al., 2011). These close relationships open up opportunities for nematodes to become insect

Chapter 1: General Introduction

pathogenic or parasitic, as a host is nutritionally rich source that can be exploited.

1.3 EPN Biology

EPNs can be found and isolated from a range of soil types and various habitats all across the world, spanning all continents excluding Antarctica (Griffin et al., 1990). The infective juvenile (IJ) represents the only free living stage of an EPN’s life cycle. This specially adapted life stage displays various traits that promote the survival of the nematode outside of their natal insect cadavers. IJs do not feed; they remain in a developmentally arrested state where they rely upon lipid (triglycerides) and carbohydrates (glycogen) stores for energy to that facilitate their active host finding regime (Andaló et al., 2011). The IJ stage emerges with a double cuticle layer, by typically retaining their ‘moulted’ cuticle as a protective sheath, thought to protect against desiccation and infection by nematicidal organisms such as fungi (Gaugler & Campbell, 1991; Timper et al., 1991; Timper & Kaya, 1989). Steinernema spp. generally lose this sheath while moving across abrasive surfaces such as sand and soil, whereas Heterorhabditis spp. retain these sheaths until they infect a new host (Timper & Kaya, 1989). Exsheathed individuals are more mobile than their sheathed conspecifics, and exsheathment is thought to facilitate host finding behaviours such as nictation (Campbell & Gaugler, 1992). In contrast, Heterorhabditis spp. wear their sheath more tightly and retain it for longer, making them more tolerant to desiccation (Gaugler & Campbell, 1991).

IJs actively search for a new insect to infect so that they can continue their life cycle. Once an insect has been reached, IJs penetrate directly into their haemocoel via their natural body openings (mouth, spiracles and anus) and expel their symbiotic bacteria (regurgitation / defecation) (LeBeck et al., 1993). Additionally, Heterorhabditis spp. have a specialised tooth that can penetrate an insect’s cuticle, allowing them to mechanically burrow their way in (Bedding & Molyneux, 1982). Heterorhabditis spp. and Steinernema spp. nematodes carry pathogenic enteric bacteria, Photorhabdus spp. and

Chapter 1: General Introduction

Xenorhabdus spp. respectively, from host to host. To carry the bacteria from insect to insect, Steinernema spp. nematodes have a specialised bacterial receptacle, modified by the two most anterior intestinal cells, housing their Xenorhabdus spp. cells (Stock & Blair, 2008). Heterorhabditis spp. nematodes do not have this specialised structure; their Photorhabdus spp. bacteria have access to nutrients in the intestinal rumen where they proliferate (Stock & Blair, 2008). When inside the host and surrounded by haemolymph, the nematodes release their symbiotic pathogenic bacteria, which begin killing the insect. The IJs now develop into stage four larvae, feeding on the insect’s tissue and their proliferating symbiotic bacteria until they become adults. Steinernema spp. develop into amphimictic adults (with the exception of S. hermaphroditum (Chaerani & Stock., 2004), whereas Heterorhabditis spp. develop into a hermaphroditic stage in their first generation within a new host. EPNs can complete several generation cycles within a single host, with the number of cycles dependent on both host and nematode size. They then follow the typical nematode lifecycle starting with the egg, which is followed by their larval stages one, two, three and four, before they become adults (Johnigk & Ehlers, 1999). Heterorhabditis spp., after their initial hermaphroditic stage, develop as separate sexes in ensuing generation cycles within the cadaver (Johnigk & Ehlers, 1999). Once nutritional resources have been depleted, the subsequent generations then emerge again as IJs in search of a new host to infect. Signalling pheromones, named ascarocides, are the primary method of communication for nematodes, and once resources within the cadaver become depleted, both Steinernema and Heterorhabditis spp. release ascr#9, a pheromone closely linked to dispersal for these EPNs (Kaplan et al., 2012). The rising harmful conditions triggers the development of the IJ stage, which later disperse from their natal cadaver following ascarocide cues, to continue their life cycle.

EPN bacteria are lethal pathogens to insects. Their bacterial genomes encode large number of adhesins, proteases, hemolysins, toxins and lipases (Duchaud et al., 2003; Richards & Goodrich, 2010). These proteins enable the bacteria to rapidly kill the insect via septicaemia, and metabolise insect tissue, unlocking nutrition for both themselves and their nematode vectors

Chapter 1: General Introduction

(Park & Kim, 2000). Furthermore, their bacterial genomes encode for antibiotic synthesising genes that create an almost exclusive environment for the nematode-bacterial complex within the cadaver (Dreyer et al., 2018). This relationship benefits both nematode and bacteria partner, as the nematodes provide a stable environment for the bacteria, and act as a vector between insect hosts, while the bacteria kill and metabolise the insect, providing nutrition for the nematode. The nematodes themselves have recently been found to excrete/secrete peptidases (also described as venom proteins) that are pathogenic to insects (Chang et al., 2019; Lu et al., 2017). When inside an insect host, the proliferating bacteria create an almost exclusive environment for them and their nematode counterparts to develop by producing antibiotics and antimicrobial peptides (Sundar & Chang, 1993).

1.4 EPN Host Finding

IJs employ a sophisticated chemosensory apparatus to detect potential hosts, and employ two main strategies to contact an insect; ambush and cruise (Kaya & Gaugler, 1993). Campbell and Gaugler (1993) defined H. bacteriophora and Steinernema glaseri as cruisers because their IJs spent most of their time actively searching for a host, spanning a much larger area than that of an ambusher species such as S. carpocapsae and S. scapterisci, which spent most of their time nictating. Nictation is a specialised behaviour whereby a nematode stands upright, waving its anterior in the air (Campbell and Gaugler, 1993). This behaviour is adopted by some ambushers and serves two main purposes for EPNs i.e. host finding and phoresis (Kruitbos et al., 2008). Nictation behaviour is shared amongst many economically important mammalian parasites for host attachment (Castelletto et al., 2014). EPNs and C. elegans (dauer larvae) nictate to facilitate attachment to larger organisms for phoretic purposes (Lee et al., 2012). Ambushers are found closer to the surface of the soil and are effective at finding mobile prey, whereas cruisers are more effective at finding immobile insects (Campbell and Gaugler, 1993). Although they are considered ambushers, a small percentage (~4 %) of S. carpocapsae are

Chapter 1: General Introduction

classified as ‘sprinters’ that disperse quickly from their natal cadaver and can cover more distance at a quicker speed than the fastest EPN species tested; H. bacteriophora (Bal et al., 2014). This behaviour allows a subset of worms to disperse over long distances to find suitable insect hosts (Bal et al., 2014). Furthermore, S. carpocapsae can be found 20 cm down in the soil (Gaugler et al., 1991), therefore classifications are difficult to generalise, as there are exceptions. Steinernema feltiae has adopted an intermediate strategy that is equally effective at locating mobile and immobile insects (Grewal et al., 1994). They also lift their anterior in the air to break the surrounding water film, and detect changes in volatile compounds, but do not stand upright, hence they are considered to be incapable of performing nictation. Some ambusher EPN species, such as S. carpocapsae, have developed a highly specialised host-finding strategy – jumping. This behaviour is triggered when a nictating individual is exposed to insect volatiles, and the IJ directionally jumps towards the source of the host associated volatiles as a response (Campbell and Kaya, 1999). The release of built up pressure within the pseudocoel after body wall muscle contractions thrusts a standing nematode into the air. This can propel them to jumping seven times their height and a distance of nine times their body length (Campbell and Kaya, 1999). Nematode jumping behaviour is thought to increase the chances of contacting larger organisms such as insects (Campbell & Kaya, 1999).

1.5 EPNs in Biocontrol

All nematodes have four larval stages leading to a final adult stage, the transition from each stage is through a process called moulting, where they remove their old, outer sheath, grow a new one, enabling them to increase in size (Bogitsh et al., 2018). At these moulting stages, nematodes are able to reset their biology and physiology, moulding their morphology and neuroanatomy to suit their lifestyle at each life stage (Androwski et al., 2017). EPNs are classed as beneficial nematodes, due to their ability to control pest insect organisms in agriculture and forestry. Eleven species of EPN have been commercialised as biocontrol agents and are widely

Chapter 1: General Introduction

available for professional growers, amateur users, and the turf and amenity sectors as an organic approach to pest insect control (Kaya and Koppenhöfer, 1999). EPNs that are artificially placed for biocontrol purposes generally are added at a large number; usually >2.5x109 IJs per hectare (Shields, 2015). Many factors influence their effectiveness as biocontrol agents. Stresses during production and storage can weaken IJs, naturally deteriorating their biocontrol efficiency before they are applied. During application, the IJs are often exposed to UV radiation from the environment, which can be lethal to them (Shapiro-Ilan et al., 2015). Desiccation and temperature extremes are common variables in outdoor crop environments, which can cause many IJs to perish before they reach a host. Biotic factors such as soil-dwelling pathogenic fungi can contribute to a decrease in IJ numbers (Timper et al., 1991). Predation by carnivorous springtails (Collembola) on the IJ stages may have a significant effect on EPN numbers too, along with scavengers such as ants, cockroaches and earwigs that consume EPN infected cadavers (Ulug et al., 2014). Inconsistency in efficacy has been reported due to their storage conditions, relatively short shelf life, and also due to fundamental gaps in our understanding of EPN behaviour, particularly after application.

1.6 EPN Genome

Genetic and transcriptomic resources are valuable tools for molecular studies. Currently, there are five Steinernema spp. with these tools available online at Wormbase Parasite (https://parasite.wormbase.org); S. carpocapsae, S. glaseri, S. feltiae, S. monticolum and S. scapterisci (Howe et al., 2017). The genomes of Steinernema spp. vary in size, from the smaller, estimated between 79.4Mb for S. scapterisci, and bigger 92.9Mb for S. glaseri (Howe et al., 2017). Of the defined species in this genus, S. carpocapsae have the lowest number of predicted protein coding genes (28,313 protein coding genes) and S. monticolum has the largest number (36,007 protein coding genes) with a GC content ranging from 42-48%: Sm – Sg respectively (Dillman et al, 2015). Heterorhabditis bacteriophora too has genomic and transcriptomic resources online at Wormbase Parasite

Chapter 1: General Introduction

(Howe et al., 2017). A draft genome for is estimated to have almost 1300 scaffolds equating to about 77Mb of genetic information (Bai et al, 2013). This contains 21,250 protein coding genes, which is comparable to the model organism C. elegans (19,735 protein coding genes) (Hillier et al, 2005). Furthermore, they have a similar G-C content of around 32%. Protein domain analyses reveal expansions for putative genes coding for proteases, protease inhibitors, fatty acid and retinol binding proteins that are not found in related non-parasitic nematodes (Dillman et al., 2015). EPNs have similar gene family expansions to mammalian parasites (Strongyloides spp. and hookworms), notably astacin metallopeptidases that aid their pathogenic regime (Jing et al., 2010; Hunt at al., 2016). In both cases these proteases aid in making the host tissue a nutritional resource, and possibly support in overcoming the hosts immune response. Furthermore, transcriptome analysis has revealed that S. carpocapsae expresses genes that have been putatively associated with a pathogenic lifestyle, which suggests this EPN plays an active role in overcoming an insect (Rougon-Cardoso et al., 2016). Pyrosequencing has also been implemented to sequence the transcriptome of Steinernema spp. to identify the molecular basis of stress tolerance, where differentially expressed genes were identified between IJs under stress, and control IJs (Yaari et al., 2016). The genomic and transcriptomic resources available for EPNs will be a valuable tool for underpinning the molecular basis that drives host finding behaviours in these nematodes.

1.7 EPN Soil Survey

Soil surveys have been conducted on a global scale in search of new species and strains of EPN, as their natural genetic diversity is a valuable resource to improving their bioinsecticide capabilities (Hominick et al., 1996). New isolates can possess many qualities that are deemed desirable for crop protection, such as greater virulence towards pests, enhanced host finding and reproductive capabilities, and resistance to environmental extremes (Shapiro-Ilan et al., 2003). Soil type and texture seems to heavily influence EPN distribution. Generally, Heterorhabditis spp. are more commonly

Chapter 1: General Introduction

found in coastal areas, where soil is sandy, with greater ventilation and larger pore sizes, relative to peat and loam soil (Portillo-Aguilar et al., 1999; Hartley & Wallace, 2018). Although also sometimes found in coastal soils, Steinernema spp. nematodes are more commonly found inland in peat and loamy soils (Gwynn & Richardson, 1996; Kung et al., 1990; Rolston et al., 2005). Native isolates are not only adapted to their local environment, they are also more likely to successfully control native pests as they are in their natural surroundings. Some isolates may be able to target a wide range of arthropods, and be used as general protection for crops, where others may specifically target one pest, providing specific control (Parkman & Smart, 1996; Frank & Walker, 2006). These attributes allow for specially formulated biocontrol regimes to suit the users’ needs, which seems to be rather unique for a biocontrol agent. Studies investigating EPN biocontrol formulations have identified species that show resistance towards chemical pesticides, and later exhibiting high levels of protection when used in conjunction with one and other (Koppenhöfer et al., 2000; Madaure et al., 2017; Nardi et al., 2011). Further instances of enhanced crop protection has been observed when EPNs are used in conjunction with other biological agents; Bacillus spp. bacteria, and insects such as parasitoid wasps (Acevedo et al., 2007; Ansari et al., 2004; Ansari et al., 2006; Ansari et al., 2008; Casanova et al., 2010; Koppenhöfer & Kaya, 1997; Thurston et al., 1994). The EPNs ability to be used in conjunction with other pesticide regimes is a great trait to have as they allow room for tailoring biocontrol formulations to enhance protection.

1.8 Nematode Neurobiology

The nervous systems regulates all aspects of behaviour in animals, however the complexity of these neuronal pathways in most animals make them difficult to study. Nematode neuroanatomy has been widely studied for many years, due to their relatively simple neuronal networks (Chitwood & Chitwood, 1950). The model species C. elegans was the first metazoan to have its nervous system fully mapped, consisting of 302 neuronal cells in the adult hermaphrodite (Cook et al., 2019; White et al., 1986). Nematode

Chapter 1: General Introduction

neuroanatomy was long considered to be conserved across the Phyla, sharing similar numbers of amphid neurons, and in anatomically similar locations, even across distantly related species (Ashton et al., 1996). Both free-living and parasitic nematodes were found to share functionally similar sensory neurons, as revealed from laser ablation studies (Gang & Hallem, 2016). Both C. elegans and Ascaris suum share structurally similar ventral nerve cord (VNC); a sequence of motor neurons that regulate muscle movement for locomotion (Stretton et al., 1978). The neuromuscular synapses found on these motorneurons are found in the same locations in both C. elegans and A. suum; these findings suggest that they may share similar functions (Stretton et al., 1978).

A recent study by Hong et al., (2019) revealed homologous neurons shared between C. elegans and Pristionchus pacificus, including amphid, interneurons and internal receptor neurons. However, distinct differences were found between the pair, as the ‘winged’ features of the cilia found on several amphid neurons in C. elegans were absent in P. pacificus (Hong et al., 2019). Also, another study found that the VNC of P. pacificus and many other nematode species from a range of clades were stained with a DAPI fluorescent stain and observed with a DIC microscope. Han et al., (2016) discovered that P. pacificus had 20% fewer neurons in their VNC, relative to C. elegans and A. suum. Pristionchus pacificus and C. elegans are members of Clade 9, whereas A. suum is a member of Clade 8 (Holterman et al., 2006). The number of VNC neurons is conserved within the EPNs individual genera (Steinernema & Heterorhabditis) (Han et al., 2016). The ciliated neurons were also stained in this study. The infective stages of S. carpocapsae and H. bacteriophora could not be stained to observe their ciliated neurons, however, periodic staining of other life stages revealed dissimilarities relative to C. elegans. The bacterial feeding Acrobeles spp. ciliated neurons showed identical staining patterns to C. elegans: Aphelenchus avenae, a fungal feeding nematode also showed some conservation (Han et al., 2016). This study highlighted that nematode neuronal networks do not seem to be as conserved as once described. Further studies in a larger variety of nematode species, spanning all 12 Clades would be critical to assess their neuroanatomical conservation.

Chapter 1: General Introduction

Dye filling, laser ablation and behavioural studies across host-finding nematodes would be key to underpinning the mechanisms that drive their sensory perception; olfaction being the main focus in this thesis. Sensory neurons receive and relay sensory information from the environment, and are usually present as bilateral pairs, one on each side of the nematode (left / right). In the nematode C. elegans, the only neuronal cells that have ciliated dendritic ends are the sensory neurons, which are mostly exposed to the external environment through pores in the nematodes cuticle. However, sensory neurons are not always ciliated; e.g. URX neuron (Doroquez et al., 2014). Of the 302 neurons found in the hermaphroditic stage, 60 have ciliated dendritic ends that relay sensory information (Ward et al., 1975; Perkins et al., 1986; Hall & Russel, 1998; Cheung et al., 2005). Most of these neurons have only one function; mechanosensation, nociception, chemosensation, thermosensation, oxygen and light sensation, although some are polymodal with multiple functions. Amphids are the largest chemosensory organ found in nematodes, mostly present as a bilateral neuronal pairs running from the anterior region. Each amphid is composed of 12 sensory neurons; ADF, ADL, AFD, ASE, ASG, ASH, ASI, ASJ, ASK, AWA, AWB, AWC. Each of these neuronal pairs have their cilia ends exposed to the environment in the amphid channel; excluding one pair, the AFD thermosensory neurons that remain embedded within the sheath cell (Perkins et al., 1986). The dendritic cilia extend partially through a channel created by socket cells, exposing them to the environment. The remaining length of cilia is protected within a sheath cell (Fig 1).

Chapter 1: General Introduction

Fig 1. Perkins et al. (1986) adaptation of the amphid chemosensory organs ciliated dendritic ends. so: socket cell. sh: sheath cell. Taken from WormBook.org (September 2018). http://www.wormbook.org/chapters/www_chemosensation/chemosensation.html

1.9 Nematode Olfactory Perception

Olfactory behaviour has been studied widely across Nematoda, as volatile perception provides important information about their current environment and ability to communicate with conspecifics. The chemosensory neurons that drive olfactory perception in C. elegans are the AWA, AWB, AWC, ASH and ADL anterior neurons, each connecting to other sensory neurons via synaptic connections (Gang and Hallem, 2016). Both AWA and AWC promote odour attraction to similar and overlapping volatiles, however, they have comparatively distinct sensory transduction mechanisms. AWA neurons remain active until an odour is detected by their chemoreceptors; for example, the odour diacetyl sensed by the ODR- 10 G protein-coupled receptor (GPCR), initiate neuronal depolarization (Larsch et al., 2013). The AWC glutamatergic neurons also detects diacetyl, however, they remain inactive until volatiles are detected, resulting in

Chapter 1: General Introduction

neuron hyperpolarisation (Chalasani et al., 2007). Like many other nematode neurons, the AWC neuron is polymodal (Zaslaver et al., 2015), as they can detect changes in temperature (Biron et al., 2008), pH, salt, and

CO2 (Fenk & de Bono, 2015), alongside odour perception, enabling complex signalling that would be otherwise restricted by a structurally simple neuroanatomy. AIA interneurons connect both AWA and AWC by a gap junction and chemical synapse, respectively. Ascarocides are highly conserved nematode signalling pheromones that mediate a wide range of behaviours in C. elegans; attraction, repulsion, aggregation (Choe et al., 2012). These pheromones are the primary communication method in nematodes, and are tightly linked to distinct behavioural responses (Choe et al., 2012). Although they are conserved, behavioural responses and the cocktail of ascarocides being released differs interspecifically (Choe et al., 2012).

1.10 Nematode CO2 Perception

Carbon dioxide (CO2) is an important gas for nematodes to perceive as it provides insight into the current surrounding environment, including predators, hosts, conspecifics and how favourable conditions are (Dillman et al., 2012b; Hallem et al., 2011a). Interestingly, C. elegans attractiveness towards CO2 varies across different life stages. Adult worms are repelled by

CO2 (Hallem & Sternberg, 2008), whereas the dauer stage are attracted to this gas (Hallem et al., 2011a). Carbon dioxide is detected by a pair of anterior sensory neurons known as BAG neurons in C. elegans. Caenorhabditis elegans without functioning BAG neurons exhibit no chemotaxis to CO2, regardless of life stage (Carrillo et al., 2013). The GCY-9 guanylyl cyclase CO2 receptors are found on BAG neurons, and depolarise the neuron upon detection of CO2 molecules (Hallem et al., 2011b). The BAG sensory neuron found in C. elegans is thus far the only olfactory sensing neuron to be identified in parasitic nematodes (Hallem et al., 2011a). Chemotaxis and jumping behaviour in S. carpocapsae is regulated by BAG neurons (Hallem et al., 2011a). Similarly to C. elegans dauer larvae, many host seeking nematodes, such as S. carpocapsae and Haemonchus

Chapter 1: General Introduction

contortus, show strong attraction towards CO2 as a host finding cue (Dillman et al., 2012b). Skin penetrating nematodes do not show attraction to CO2, and instead rely on skin related volatiles such as urocanic acid (Castelletto et al., 2014; Safer et al., 2007). Steinernema scapterisci IJs exhibit age dependent attraction to CO2 (Lee et al., 2016). Freshly emerged

IJs have been observed to be highly repelled by CO2, which may enhance their dispersal capabilities (Lee et al., 2016). As the IJs age, their attraction towards CO2 becomes greater, and seven days post emergence, the nematodes attractiveness to CO2 switches to becoming attractive (Lee et al., 2016). Carbon dioxide attractiveness varies among nematode species, life stage and age in some reports, however the way in which this molecule is perceived by the nematode seems to be conserved within Nematoda.

1.11 Neuropeptides

Although they have a relatively simple nervous system structure, nematodes have been shown to exibit a wide catalogue of behaviours, enabling them to thrive in diverse habitats and adapt distinct lifestyles (Rengarajan & Hallem, 2016; White et al., 1986). These diverse behaviours are thought to be possible by the abundance and diversity of their neuropeptides. There are three families of nematode neuropeptide 1) the FMRF amide like peptides (FLPs), 2) the neuropeptide like proteins (NLPs) and 3) the insulin like peptides (ILPs) (Li, 2006; McCoy et al., 2017). Neuropeptides are small signalling proteins that regulate complex behaviours in eukaryotic organisms. The largest and most diverse group of neuropeptides are the FMRFamide (Phe-Met-Arg-Phe-NH2)-related peptides (FaRPs). FaRPs show conservation in their RFamide C-terminus and are associated with a range of functions (Krajniak, 2013). These FaRPs are more commonly referred to as the FLPs in Nematoda. Currently, there are 32 members that have been classified as FLPs, present as over 70 distinct functioning neuropeptides (Li & Kim, 2014; McCoy et al., 2014; Peymen et al., 2013). FLP-31 is exclusive to parasitic nematodes, and has not yet been found in non-parasitic nematodes such as C. elegans (McCoy et al., 2014). FLP signalling is highly complex. Collectively they are

Chapter 1: General Introduction

expressed almost on every neuron in the adult hermaphrodite, regardless of their function, including sensory, motor and interneurons. Here they employ neuromodulatory roles, regulating biological processes such as locomotion, feeding, reproduction, egg laying and behaviour (Bowman et al., 1996; Franks et al., 1994). Unlike the FLPs, NLPs do not show much conservation or sequence motifs across the 32 members within the family (Nathoo et al., 2001). The great diversity of NLP neuropeptides enables them to be involved in many biological processes. Some of these peptides seem to have anti-microbial activity, as expression of several NLPs (NLP-29, NLP-31 and NLP-33) increases when C. elegans is under attack by bacterial and fungal infections (Couillault et al., 2004). While others play a role in modulating acetycholine signalling pathways; NLP-19 (Sieburth et al., 2005).

1.12 Neuropeptide and GPCR Interactions

GPCRs are the largest family of eukaryote transmembrane proteins that play essential roles mediating cellular communication by receiving neurotransmitter and neuromodulator information from outside the cell. GPCRs are essential for regulating neuronal activity, which is why almost 35 % of all drugs that are readily available today target GCPRs specifically (Hauser et al., 2018). Their abundance and diversity has allowed organisms to perceive environmental stimuli, enabling senses such as taste, vision and smell to develop. The architecture of GPCRs have remained conserved across the eukaryotes which possess them, including relatively simple yeast species; Saccharomyces cerevisiae (Versele et al., 2001). A GPCR is a polypeptide chain that spans the entire width of a cells membrane seven times by folding back on itself, looping inside and outside the cell (Yeagle & Albert, 2007). The loops create pockets for ligands to physically bind to the receptor. At the end of the polypeptide chain there are G proteins attached to the plasma membrane by lipid anchors, inside of the cell (Yeagle & Albert, 2007). The G proteins associated with GPCRs are heterotrimeric, meaning they have three different subunits; alpha, beta and gamma (Yeagle & Albert, 2007). G proteins bind to guanosine triphosphate (GTP) or

Chapter 1: General Introduction

diphosphate (GDP) nucleotides. Once a GPCR is activated by its ligand, the associated G protein substitutes it’s GDP (inactive) for a GTP (active). Once activated, the G protein dissociates from the GPCR and each other, separating into the alpha subunit (+ GTP) and a beta-gamma dimer. The G protein subunits remain anchored to the cell membrane, however while active they are free to interact with other membrane proteins. These interactions cause downstream biochemical events, such as catalysing membrane bound enzyme reactions, producing secondary messengers.

Nematode neuropeptides are known ligands to GPCRs, working in conjunction to perceive sensory information and respond with the appropriate behaviour. Currently most of the information available for nematode receptors and neuromodulators are only gene predictions from the C. elegans genome data. Many neuropeptides have been putatively associated with GPCRs, however only a fifth of which have been confirmed as receptor-ligand linked, termed deorphanised (Peymen et al., 2014; Frooninckx et al., 2012). Functional studies can be performed on putative neuropeptides and GCPRs in nematode systems by silencing, lowering the expression or overexpressing the gene. By manipulating the abundance of neuropeptides and their receptors in a biological system, phenotypic assessments can be performed to predict their function, including behavioural assays, body posture examinations and influence on the nervous system. Similarly to the nematode nervous system, the GPCR- ligand was once thought to be conserved across the Phylum, however, recent studies have again highlighted this may not be the case. Expansions in nematode genomics have revealed many C. elegans FLPs and GPCRs to be variably absent across 17 parasitic nematode species (McCoy et al., 2014). Therefore many of these GPCR-ligand relationships that have been identified in C. elegans cannot be translated to parasitic nematode species, this may be due to conservation being found in the nematodes lifestyle. The sheer number of receptor-ligand partners found in many nematode species makes deorphanisation a big challenge and the tools available currently make progress slow. However one GPCR has been deorphanised in a parasitic nematode. In C. elegans, FLP-18 is a known ligand to the GPCR NPR-4 (NPR-1 also) (Bhardwaj et al., 2018). The human filarial nematode

Chapter 1: General Introduction

Brugia malay genome too encodes an NPR-4 orthologue, which was cloned in vitro and were shown to be activated by members of the FLP-18 in the same manner as C. elegans; this in turn was the first record of GPCR deorphanisation in a parasitic nematode (Anderson et al., 2014; Atkinson et al., 2016).

1.13 Concluding Remarks

EPNs possess potential in increasing their efficiency as a natural pest control agent. Although they are currently being used for biocontrol purposes, their efficiency for pest control is highly variable (Gaugler, 1993; Georgis et al., 2006). Factors that affect their biocontrol efficiency in field and glass-house trials may be contributed to our limited understanding regarding their ecology and trophic interactions post-application, and their suitability to the environment, target pest and crop. As mentioned previously, EPNs show physiological and behavioural variation, which can be utilised to enhance biocontrol formulations and increase pest control efficiency. A large benefit to using EPNs is their ability to recycle their numbers within the soil, providing long-term protection for crops from soil- dwelling pests. This ability, however, is limited to larger insect pests, where smaller insects such as fungus gnats are too small to support EPN development and recycling in their cadavers. Their genetic and behavioural diversity are key to enhancing their biocontrol efficiency. Soil surveys across the world unlock new strains and species which can be utilised and selected for greater virulence, host finding, and dispersal capabilities. The molecular basis that drives these host finding behaviours are of particular interest, as their signalling pathways may be exploited to attain strains with enhanced host finding abilities, providing greater protection from arthropod pests. Furthermore, by investigating these molecular pathways, it may be possible to translate this information into the control of economically important mammalian parasites. This study will attempt to identify genes associated with host finding behaviours in Steinernema spp., isolate and identify natural EPN strains, and examine the host finding abilities of available EPN strains. RNAi will be used to silence

Chapter 1: General Introduction

genes associated with sensory perception, to observe and determine the role of genes in S. carpocapsae. Transcriptional sequencing will be undertaken in order to identify genes that regulate phenotypic differences between the S. carpocapsae strains. Finally, natural isolates of EPN from Northern Ireland will be carried out in order to explore their phenotypic diversity, and unlock lines that may be highly effective as biocontrol agents.

Chapter 2: RNAi in Steinernema spp.

CHAPTER 2: RNAI IN STEINERNEMA SPP.

2.1 Introduction

The nervous system regulates all aspects of behaviour in animals. The complex structures of these neuronal pathways, in most animals, make them difficult to study. Caenorhabditis elegans has a relatively simple nervous system made up of 302 neurons, and has been used as a model species to research the neuronal mechanisms of behaviour (White et al., 1986). Nematodes, although they have a simple nervous system, have been documented to exhibit a wide catalogue of behaviours. This enables them to thrive in a range of habitats, exhibiting diverse lifestyles. The key to these behaviours may lie in the abundance and diversity of their neuropeptides. Neuropeptides are small signalling molecules that are involved in important biological processes (Li, 2006). Nematode neuropeptides fall into three families: 1) insulin-like peptides, 2) neuropeptide-like proteins (NLPs) and 3) FMRF amide-like peptides (FLPs). This study will have a heavy focus on the FLPs.

Currently there are 32 known flp genes encoding over 70 distinct neuropeptides which have been found to be highly conserved across nematodes (Li & Kim, 2014; McCoy et al., 2014; Peymen et al., 2013). However, some FLPs, such as FLP-31, are exclusive to parasitic nematodes, and have not yet been found in non-parasitic nematodes such as C. elegans (McCoy et al., 2014). FLP receptors belong almost exclusively to the G protein coupled receptor family (GPCR). Single GPCRs can bind to multiple FLPs, just as FLPs can be ligands to multiple GPCRs, which increases signalling complexity and intricacy (McVeigh et al., 2006). The GPCR NPR-1 has two known ligands, FLP-18 and FLP-21 (Rogers et al., 2003). The FLP-21 neuropeptide is also a known ligand to five NPR GPCRs; NPR-1, -2, -3, -5 and -11 (Rogers et al., 2003; Cohen et al., 2009; Chang et al., 2015; Ezcurra et al., 2016). FLPs, along with their receptors, are involved in many important biological processes such as feeding, sensory perception, locomotion and reproduction (Rogers et al., 2003; Li & Kim, 2014). Immunocytochemistry (ICC) imaging has revealed FLP neuropeptides to be expressed throughout most of the nervous system, for example, in

Chapter 2: RNAi in Steinernema spp. motorneurons, sensory neurons and interneurons (Li & Kim, 2014). In addition, FLP neuropeptides have also been found in non-neuronal cells such as head and pharyngeal muscle cells, vulval cells and uterine cells (Ringstad & Horvits, 2008; Li & Kim, 2014).

Small RNAs (sRNAs) play a role as signalling molecules, which maintain proper cell function, homeostasis and development (Zhang, 2009). They fall into three categories in animals, microRNAs (miRNAs), small interfering RNAs (siRNAs), and piwi-interacting RNAs (piRNAs) (Carthew & Sontheimer, 2009; Siomi et al., 2011). RNA interference (RNAi) is a biological mechanism that regulates gene expression by destroying mRNA molecules, suppressing the complementary gene’s function. This mechanism has been described many times under various different names: Co-Suppression (Napoli et al., 1990), Post Transcriptional Gene Silencing, Quelling (Cogoni & Macino, 1997) and RNAi (Cagoni & Macino, 2000). The pioneers in describing the RNAi biochemical process were Andrew and Mello (Fire et al., 1998), who had previously published data suggesting antisense RNA obstructs a process in the late stages of gene expression (Fire et al., 1991). Guo and Kemphues (1995) discovered that both the sense and antisense RNA strands were just as potent as each other in suppressing gene expression in C. elegans. Fire et al. (1998), along with describing the mechanism of RNAi, discovered that the introduction of both antisense and sense RNA, in the form of double-stranded RNA (dsRNA), was substantially more effective at suppressing gene expression than antisense or sense alone. Furthermore, they showed that the dsRNA effects were potent and specific in destroying the mRNA molecules for the target mex-3 transcripts by in situ hybridisation (Fire et al., 1998). Post RNAi discovery there were a series of investigations into the biochemical mechanism of RNAi. Zamore et al. (2000) discovered that the initial step of RNAi was an ATP dependent stage that did not require the presence of mRNA molecules. This step involved the conversion of dsRNA into smaller dsRNA fragments (siRNAs), 21-23 nucleotides long (Zamore et al., 2000). Today we know that a dsRNA specific RNase III enzyme, known as the Dicer complex, initiates this reaction creating shorter dsRNA molecules of the same length (Zamore et al., 2000; Bernstein et al., 2001). The short dsRNA molecules bind to a

Chapter 2: RNAi in Steinernema spp. ribonucleoprotein known as the RNA-induced silencing complex (RISC) found in the cytoplasm (Hammond et al., 2000). Components of the RISC multi-protein complex are the argonaute proteins (ago), which catalyse the dissociation of the dsRNA molecule and keeps the guide strand. RISC then deliver the guide strand to its target mRNA by their sequence complementarity, where the ago proteins catalyse the cleavage of the mRNA. This leads to degradation. The development of an RNAi protocol has provided researchers with a powerful and specific tool to probe gene function in an array of living organisms. However, for this study, RNAi in the phylum Nematoda will be the main focus.

There are four main approaches to triggering RNAi in C. elegans; 1) soaking nematodes in double stranded RNA (dsRNA) (Tabara et al., 1998), 2) microinjection of dsRNA or siRNA (Fire et al., 1998), 3) feeding nematodes bacteria expressing dsRNA (Kamath et al., 2000; Timmons & Fire, 1998) and 4) transformation with hairpin constructs, from which dsRNA is produced (Lai et al., 2007). The most common RNAi method used in C. elegans is ingesting exogenous dsRNA, either by soaking the nematodes in dsRNA, or feeding them bacteria expressing dsRNA. Once the dsRNA is in the intestine, a dsRNA transporter protein SID-2 translocates the dsRNA from the intestinal lumen into the intestinal cells (McEwan et al., 2012). Interestingly, C. briggsae, a close relative of C. elegans, is RNAi defective when dsRNA is ingested, due to the lack of a functionally similar SID-2, regardless of their sequence similarity. However, the introduction and expression of C. elegans sid-2 gene in C. briggsae makes them susceptible to RNAi via dsRNA ingestion (Winston et al., 2007). Systemic RNAi takes place in C. elegans as a dsRNA transmembrane channel named SID-1 is present in their cell walls, allowing the dsRNA to spread from cell to cell (Winston et al., 2002). Although SID-1-independent transport of dsRNA has been observed, exhibiting that systemic RNAi spread is more complex than initially thought (Jose et al., 2009). An endosome associated protein known as SID-5, is a component of the SID-1 independent export of gene silencing signals required for systemic RNAi (Hinas et al., 2012). SID-3 plays a role in the efficient import of dsRNA to the cell for systemic RNAi (Jose et al., 2012). The RNAi spreading defective genes (rsd) allows systemic RNAi

Chapter 2: RNAi in Steinernema spp. to take place. Mutants of the rsd-4 and rsd-8 gene exhibited no RNAi phenotype when exposed to exogenous dsRNA. Curiously, rsd-2, rsd-3 and rsd-6 mutants only show RNAi effects in somatic cells, and have no effect on germ-line cells (Tijsterman et al., 2004). The mechanisms of intracellular transport of dsRNA have allowed RNAi to become a powerful tool for gene function studies in C. elegans. However, these pathways do not seem to be highly conserved among nematode species, and may account for the lack of success in many parasitic nematodes (Dalzell et al., 2011). RNAi via dsRNA ingestion has proven to be successful in animal parasitic nematodes: Brugia malayi (Aboobaker & Blaxter, 2003), Ascaris suum (Islam et al., 2005) and Onchocerca volvulus (Lustigman et al., 2004). To achieve gene suppression, many RNAi protocols use dsRNA amounts in the range of 0.5 – 2 mg / ml (Ford et al., 2009; Islam et al., 2005; Issa et al., 2005; Kotze & Bagnall, 2006; Lustigman et al., 2004; Visser et al., 2006), and up to as high as 3.7 mg / ml (Aboobaker & Blaxter, 2003).

RNAi has proven to be a practical tool for gene function studies in plant pathogenic nematodes (PPNs). Soaking PPNs in dsRNA is an effective protocol to trigger gene suppression, usually with the presence of octopamine, a bio amine that stimulates pharyngeal pumping to enable ingestion of environmental dsRNA (Urwin et al., 2002). Many FLPs have been suppressed in Globodera pallida, where behavioural analysis studies have taken place to identify their function (Kimber et al., 2007). This study also revealed that each Gp-flp gene targeted showed different degrees of gene inhibition, suggesting gene specific susceptibilities to dsRNA soaking (Kimber et al., 2007). Meloidogyne incognita also has a functional RNAi pathway (Rosso et al., 2005; Shingles et al., 2007). BLAST analysis searching for C. elegans RNAi pathway genes in other nematode revealed that the parasitic nematodes tested possessed between 30 – 60 % of the 77 C. elegans genes (Dalzell et al., 2011). Unsurprisingly, members of the same genus, Caenorhabditis, shared 78 – 85% of these genes. The root-knot nematode M. incognita has a functional RNAi pathway via dsRNA ingestion, and shares only 35% of the RNAi genes with C. elegans, where C. briggsae is not susceptible to RNAi, and shares 85% putative orthologues (Dalzell et al., 2011). Caenorhabditis briggsae is RNAi resistant due to its’ inability to

Chapter 2: RNAi in Steinernema spp. uptake dsRNA into the cell, however, M. incognita too does not appear to have a putative orthologue of dsRNA transporter genes sid-1, sid-2, rsd-2 and rsd-6, however they still have a functional RNAi pathway. This suggests that there must be another mechanism of uptake and spread, or that perhaps other dsRNA transport proteins are used. BLAST analysis searching for putative RNAi genes in S. carpocapsae found it to have a less diverse pathway, relative to C. elegans (Morris et al., 2017). Unsurprisingly, S. carpocapsae does not appear to encode sid gene orthologues, which is in line with other parasitic nematodes. Intercellular spread of dsRNA in S. carpocapsae may be facilitated by a C. elegans gene orthologue, Sc-rsd-3, which shares sequence conservation with rsd-3 (Morris et al., 2017). Argonaute proteins are vital components of the RNA-induced silencing complex (RISC) which associates and guides small RNAs, such as siRNAs and miRNAs, to target mRNAs for cleavage in RNAi gene silencing (Hammond et al., 2000; Song et al., 2004). Although S. carpocapsae has less gene conversation with C. elegans argonaute proteins, they appear to have large expansions in many of these putative genes (Morris et al., 2017). This suggests they have larger and more diverse components of RISC, relative to C. elegans.

In addition to dsRNA soaking, nematodes may be subject to an electroporation, which can sometimes enhance gene suppression effects. Usually, a single pulse of electricity of around 50 – 100 V in a 0.2 cm cuvette post dsRNA incubation (Geldhof et al., 2006; Issa et al., 2005). Generally, a recovery period is required for the nematodes after electroporation. The use of electricity to make cell membranes more permeable to exogenous dsRNA is called electroporation. This has successfully been utilised within RNAi studies on the sheep gastrointestinal parasite, Trichostrongylus colubriformis, and the strongylid parasitic nematode Haemonchus contortus (Geldhof et al., 2006; Issa et al., 2005). In H. contortus, it was discovered that they do have a functional RNAi pathway; however, this pathway seems to be target specific. This is because not all target genes were successfully suppressed, as not all the dsRNA tested triggered significant knockdown (Geldhof et al., 2006; Kotze & Bagnall, 2006). Similar results were found when eight genes were

Chapter 2: RNAi in Steinernema spp. targeted for RNAi suppression in the cattle parasite Ostertagia ostertagi, where five genes achieved significant gene suppression (Visser et al., 2006). These findings suggest that there are target specific susceptibilities between genes.

Nictation behaviour is a key component of some EPN species’ host finding strategy (Wang & Ishibashi, 1999). This behaviour is enacted by the IJs by them standing upright on their tails, and waving their anterior in the air, to attach themselves to larger passing organisms (Chaisson & Hallem, 2012). Nictation is also performed by economically important mammalian parasites. Examples include hookworms and threadworms, which would use it to facilitate host attachment, and C. elegans dauer larvae for phoresis (Castelletto et al., 2014; Lee et al., 2012). Some nematodes have the ability to jump while nictating. Jumping nematodes are stimulated by host associated volatiles and the vibrations, which provide the nematode with their position (Campbell and Kaya, 1999). Then, by contracting their body wall muscles unilaterally, these nematodes build up pressure within their pseudocoel, and cause differential stretching and compression across their cuticle. The release of this high pressure and opposing forces triggers the jump action, propelling the nematode into the air, up to seven times its height and nine times its body length in distance (Campbell and Kaya, 1999). Nictation behaviour is regulated by IL2 neurons in C. elegans (Schroeder et al., 2013). The IL2 neurons exist as lateral triplets that run down either side of the nematodes pharynx. In C. elegans, the IL2 neurons undergo extensive remodelling and arborisation, resulting in large structural changes to these neurons upon development into the dauer stage (Schroeder et al., 2013). Their neuroplasticity and enhanced connectivity during their dauer stage aid in increasing their chances of survival in harsh environmental conditions. Ablation of the IL2 neuron had drastically decreased the number of dauers nictating in C. elegans (Lee et al., 2011). The central pair of IL2 neurons express a neuropeptide receptor known as NPR-1 (Coates and de Bono, 2002), which is known to be activated by FLP 18 and FLP-21 (Rogers et al., 2003). NPR-1 is also present on other anterior sensory neurons (Coates & de Bono, 2002). In the feeding stages of C. elegans, NPR-1 and FLP-21 signalling regulates social vs solitary

Chapter 2: RNAi in Steinernema spp. feeding, i.e. disruptions to gene expression promotes social feeding, and overexpression enhances solitary feeding (Rogers et al., 2003). The social and solitary feeding behaviour is, at least in part, regulated by environmental olfactory cues, via conspecific ascarocide pheromone signalling. This study links NPR and FLP signalling to olfactory perception, which may be conserved in other nematode species. Further GPCR targets that are heterologously activated by FLP-21 and FLP-18 can also be explored; (NPR-2, -3, -5, -6, 11 and NPR-4, -5, -6 -10, -11, respectively) (Ezcurra et al., 2016; Li and Kim, 2014). Similarly to nictation in C. elegans, nictation and jumping behaviour may be regulated by NPR-1 and FLP-21 signalling in S. carpocapsae. The neuropeptide gene flp-21 has an orthologue in S. carpocapsae, Sc-flp-21, and immunocytochemistry has revealed that the Sc-FLP-21 neuropeptide is isolated to paired anterior neurons (Morris et al., 2017). The suppression of neuropeptide and GPCR genes in Steinernema spp. may have a significant impact on their host finding behaviours, identifying genes associated with host finding.

The aims of this study was to assess RNAi efficiency via dsRNA soak method in the EPN S. carpocapsae. Once gene knockdown was achieved, Sc-flp-21 was targeted to observe the effects that this neuropeptide has on host finding and dispersal behaviours, as it has been associated with sensory perception in C. elegans. The suppression of Sc-flp-21 plays a role in perceiving insect volatiles (nictation and host finding assays), and conspecific communication (dispersal). Other gene of interest tested included the GPCRs associated with flp-21, and the other known ligand of npr-1, flp-18. Further assessments took place on RNAi efficiency in the closely related species S. feltiae and S. glaseri. RNAi is a powerful tool that has identified Sc-flp-21’s role in olfactory perception for S. carpocapsae IJs. As the suppression of this gene has drastic effects on their ability to find a host, perhaps the upregulation of Sc-flp-21 may enhance their host finding abilities, offering greater protection than populations with lower expression of Sc-flp-21.

Chapter 2: RNAi in Steinernema spp.

2.2 Materials and Methods

EPN culture

The laboratory strains for each Steinernema spp. were used in this study; S. carpocapsae (ALL), S. feltiae (SN) and S. glaseri (NC) (Dillman et al., 2015) were maintained in Galleria mellonella last instar larvae at 23°C darkness. IJs were collected by White trapping (White, 1927) in a solution of Phosphate Buffered Saline (PBS). Freshly emerged IJs were used for each experiment (<3 days post-emergence).

Gene annotations in S. carpocapsae The pre-propeptide sequences for C. elegans genes of interest (such as neuropeptide & GPCR) were obtained from WormBase. These sequences were BLAST’ed against the S. carpocapsae genome in WormBaseParasite. The results from this BLAST were then reciprocally BLAST’ed against the C. elegans genome. The top scoring gene that matches back to the original C. elegans gene was then assigned as the putative S. carpocapsae orthologue.

dsRNA synthesis BLAST analysis revealed putative C. elegans gene orthologues for several genes spanning S. carpocapsae, S. feltiae and S. glaseri nematodes (Table 1). Templates for dsRNA synthesis were generated from the IJ cDNA using gene-specific primers with T7 recognition sites (T7 promotor: 5′ TAATACGACTCACTATAG 3′). Neomycin phosphotransferase (neo) and Green Fluorescent Protein (gfp) dsRNA templates were generated from pEGFP-N1 (GenBank: U55762.1). Template PCR products were generated as follows: [95 °C x 10 min, 40 x (95 °C x 30 s, 60 °C x 30 s, 72 °C x 30 s) 72 °C x 10 min]. PCR products were assessed by gel electrophoresis, and cleaned using the Chargeswitch PCR clean-up kit (Life Technologies). dsRNA was synthesised using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega), and quantified by a NanoDrop 1000 spectrophotometer (Mason Technology).

Chapter 2: RNAi in Steinernema spp.

Table 1. The gene IDs of RNAi targets, collected from WormBase Parasite (2018). S. carpocapsae gene name WormBase gene ID Sc-flp-21 L596_g19959.t1 Sc-flp-18 L596_g2714.t1 Sc-npr-1 L596_g21196.t1 Sc-npr-3 L596_g23710.t1 Sc-npr-5 L596_g18888.t1 Sf-flp-21 L889_g32029.t1 Sg-flp-21 L893_g17088.t1

RNAi Three dsRNA treatment groups were used in this study, no dsRNA (untreated), target dsRNA (dsRNA corresponding to the gene of interest) and the non-endogenous control dsRNA neomycin (neo). 1000 S. carpocapsae were incubated in 50 µl PBS with dsRNA and 50 mM serotonin across five experimental regimes; (i) 48 h in 5 mg / ml dsRNA / serotonin / PBS; (ii) 48 h in 1 mg / ml dsRNA and serotonin; (iii) 24 h in 5 mg / ml dsRNA / serotonin / PBS, followed by washes to remove the initial dsRNA, and 24 h recovery in PBS only; (iv) 120 h in 5 mg / ml dsRNA / serotonin / PBS; and (v) 48 h in 5 mg / ml dsRNA / serotonin / PBS, followed by electroporation (1 millisecond / 1,000 V / 0.4 cm path), washes to remove dsRNA and 24 h recovery in PBS only. Each experiment was conducted at 23 ᵒC. We found that 50 mM serotonin induced oral uptake of fluorescent dyes under all conditions tested.

RNA extraction Total RNA was extracted from 1000 IJs using the Simply RNA extraction kit (Promega, UK) and Maxwell 16 extraction system (Promega, UK). Quantification of the RNA took place on a NanoDrop 1000 spectrophotometer (Mason Technology), and RNA concentration was

Chapter 2: RNAi in Steinernema spp. normalised before cDNA synthesis. cDNA libraries were synthesised using the High Capacity RNA to cDNA kit (Applied Biosystems, UK).

Table 2. Primer sequences used for dsRNA synthesis and qRT-PCR analysis. Primer Primer Sequence (5’ – 3’) Sc-flp-21 F TTCTGAGCCGCTATCTGAGC Sc-flp-21 R AGTCGCAGGGAACAAACAAT Sc-flp-21 FT7 TAATACGACTCACTATAGGTTCTGAGCCGCTATCTGAGC Sc-flp-21 RT7 TAATACGACTCACTATAGGAGTCGCAGGGAACAAACAAT neo F GGTGGAGAGGCTATTCGGCTA neo R CCTTCCCGCTTCAGTGACAA neo FT7 TAATACGACTCACTATAGGGGTGGAGAGGCTATTCGGCTA neo RT7 TAATACGACTCACTATAGGCCTTCCCGCTTCAGTGACAA gfp F GGCATCGACTTCAAGGAGGA gfp R GTAGTGGTTGTCGGGCAGCA gfp FT7 TAATACGACTCACTATAGGGGCATCGACTTCAAGGAGGA gfp RT7 TAATACGACTCACTATAGGGTAGTGGTTGTCGGGCAGCA Sc-act qF ATGTTCCAGCCCTCTTTCCT Sc-act qR GATGTCGCACTTCATGATCG Sc-βtub qF CTCGGAGGAGGAGATGACAG Sc-βtub qR ATCATAACGGCACGAGGAAC Sc-flp-21 qF GCTGCCTTCCTCGTACTCTTC Sc-flp-21 qR TCAGATAGCGGCTCAGAAGC Sc-L596_g5821.t1 qF GTGGGAAATCCGACACAAA Sc-L596_g5821.t1 qR GTCACGTCGTCCACTATAAAC Sc-flp-18 F GGAGTCTTCACCCTCTGTGC Sc-flp-18 R ACGTACGCTTGTCCTCGTTT Sc-flp-18 FT7 TAATACGACTCACTATAG GGAGTCTTCACCCTCTGTGC Sc-flp-18 RT7 TAATACGACTCACTATAG ACGTACGCTTGTCCTCGTTT Sc-flp-18 qF TCGGAAAGAAGTCCGAGATG Sc-flp-18 qR AACCATTCTCGGGACAACAG Sc-npr-1 F ACGAGTCCAAGCGCTTCTAC

Chapter 2: RNAi in Steinernema spp.

Sc-npr-1 R TCCTTGTGCTGCTGACTGTC Sc-npr-1 FT7 TAATACGACTCACTATAGGACGAGTCCAAGCGCTTCTAC Sc-npr-1 RT7 TAATACGACTCACTATAGGTCCTTGTGCTGCTGACTGTC Sc-npr-1 qF CGAGGTCGACTTCTCGTACC Sc-npr-1 qR AGAGAACCGGGTTTGCTACG Sc-npr-3 F GGGTTGACAGTCCTGGTGTT Sc-npr-3 R GCGAGAACTAGTCCCAGCAC Sc-npr-3 FT7 TAATACGACTCACTATAGGGGGTTGACAGTCCTGGTGTT Sc-npr-3 RT7 TAATACGACTCACTATAGGGCGAGAACTAGTCCCAGCAC Sc-npr-3 qF TCACCTCCCAGATCGTCTTC Sc-npr-3 qR CCTGCTTGAAGGAAAGAACG Sc-npr-5 F CCTTATCTCTGGCCCCTCAT Sc-npr-5 R GCGAGGGCTTCTTTTTAGGT Sc-npr-5 FT7 TAATACGACTCACTATAGGCCTTATCTCTGGCCCCTCAT Sc-npr-5 RT7 TAATACGACTCACTATAGGGCGAGGGCTTCTTTTTAGGT Sc-npr-5 qF TGATCACTCTTGCGATCTGG Sc-npr-5 qR GCTACCGTCGATCAGTTCGT Sf-flp-21 F TCGCTTTCGTGAGGCTTCT Sf-flp-21 R CTTGATCGAGCGCGGTTC Sf-flp-21 FT7 TAATACGACTCACTATAGGCGCTTTCGTGAGGCTTCT Sf-flp-21 RT7 TAATACGACTCACTATAGGTTGATCGAGCGCGGTTC Sf-flp-21 qF GACCTCGACGGCTACAACAT Sf-flp-21 qR GTGAAGATCGAGGCGGTTAG Sf-act qF GCGACATCAAGGAGAAGCTC Sf-act qR ACTTCTCGAGCGAGGAGGAG Sf-βtub qF AGCCTTTGTCCATTGGTACG Sf-βtub qR CAAGAGCTGCCATGTCTTCA Sg-flp-21 F TACTCGTTAGCGCGCCTT Sg-flp-21 R CGCGTTGTACTGGTTCATGT Sg-flp-21 FT7 TAATACGACTCACTATAGTACTCGTTAGCGCGCCTT Sg-flp-21 RT7 TAATACGACTCACTATAGCGCGTTGTACTGGTTCATGT Sg-flp-21 qF GACCAGCGCTCCATCAA Sg-flp-21 qR TAAGAAGTGTCACTCGGAAAGG

Chapter 2: RNAi in Steinernema spp.

Sg-act qF ACCTCACTGACTACCTGATGA Sg-act qR GCAGAGCTTCTCCTTGATGT Sg-βtub qF GATCCTCGCAACGGAAAGTA Sg-βtub qR GGAGCGCTTCGTCTTGAT Sg-flp-21 qF GACCAGCGCTCCATCAA Sg-flp-21 qR TAAGAAGTGTCACTCGGAAAGG

qRT-PCR Expression Analysis Each individual qRT-PCR reaction comprised 5 µl Faststart SYBR Green mastermix (Roche Applied Science), 1 µl each of the forward and reverse primers (10 µM; Table 2), 1 µl water, 2 µl cDNA. PCR reactions were conducted in triplicate for each individual cDNA using a Rotorgene Q thermal cycler under the following conditions: [95 °C x 10 min, 40 x (95 °C x 20 s, 60 °C x 20 s, 72 °C x 20 s) 72 °C x 10 min]. Primer sets were optimised for working concentration along with annealing temperature were analysed by dissociation curve for contamination or non-specific amplification by primer–dimer as standard. The PCR efficiency of each specific amplicon was calculated using the Rotorgene Q software. Relative quantification of target transcript relative to two endogenous control genes (Sc-act and Sc-β-tubulin) was calculated by the augmented ΔΔCt method (Pfaffl, 2001), relative to the geometric mean of endogenous references (Vandesompele et al., 2002). One way ANOVA and Fisher’s LSD test were used to analyse data (GraphPad Prism 6). The most similar non- target gene to Sc-flp-21 was identified as L596_g5821.t1, by using BLASTn searches against the S. carpocapsae genomic contigs, and primers Sc- L596_g5821.t1 and Sc- L596_g5821.t1 were used to assess transcript abundance relative to Sc-act and Sc-β-tubulin across control and experimental conditions for the 48h dsRNA exposure experiments only.

Chapter 2: RNAi in Steinernema spp.

Dispersal assays 100 S. carpocapsae IJs were placed in the centre of a 90 mm PBS agar plate (1.5 % w/v) in a 5 µl aliquot of PBS. Plates were divided into four zones; a central zone 15 mm in diameter, and three further zones equally spaced over the remainder of the plate. Plates were allowed to air dry for ~5 min. Evaporation of the PBS allowed the IJs to begin movement over the agar surface. Lids were then placed back onto the Petri dishes, and plates were incubated at 23 °C in darkness for one hour. IJs were counted across central and peripheral zones and expressed as percentage of total worms. Subsequent analysis was conducted on total IJs found within the two central zones, relative to those found in the two peripheral zones.

Nictation & jumping assays As per Morris et al. (2017), 3.5 g of compost (John Innes No.2) was placed in a Petri dish (55 mm), and dampened evenly with 150 µl PBS. Approximately ten IJs were pipetted onto the compost in 5 µl of PBS, and left for 5 minutes at room temperature. This enabled IJs to begin nictating. For the waxworm volatile challenge, one healthy waxworm (Galleria mellonella; UK Waxworms Ltd.) was placed inside a 1 mL pipette tip, without filter. For the mealworm volatile challenge, two mealworms (Tenebrio molitor; Monkfield Nutrition, UK), weight-matched to the waxworm, were placed inside a 1 mL pipette tip, without filter. Blank exposure data were captured using an empty 1 ml pipette tip, without filter. In each case, the pipette was set to eject a volume of 500 µL, comprising air and the corresponding insect volatiles. A binocular microscope was used to record IJ behavioural responses following up to five volatile exposures each, on gentle ejection from the pipette within a distance of ~1 cm of the S. carpocapsae IJs. A five second period was allowed between each volatile exposure. Recording ended for any individual when jumping was observed or the IJ abandoned a nictating stance (this always corresponded with migration away from the stimulus). A jumping index was calculated for each treatment group (Baiocchi & Dillman, 2015). Additional behavioural observations were recorded, and subsequently reported as percentage IJs displaying the behaviour over the

Chapter 2: RNAi in Steinernema spp. course of up to five volatile exposures, or until the IJ migrated / jumped out of the field of vision.

Host Finding Assay Two circular holes (6 mm diameter, centred 4 mm from edge of lid) were drilled either side of a 90 mm Petri dish lid. Two microcentrifuge tubes (1.5 ml) with a small hole cut out the bottom (approx. 2mm diameter), were also used for each assay. 200 S. carpocapsae IJs were placed in the centre of a 90 mm PBS agar plate (1.5 % w/v) in a 5 µl aliquot of PBS. The arena was segmented into positive and a negative zones either side of the plate (25 mm in length from the edge, circling off the plate at a point 60 mm apart; see Fig 2B). Plates were allowed to air dry for ~5 min, allowing the IJs to begin migration. The lid was placed on top of the plate, and sealed with parafilm. The 1.5 ml tubes were secured in the holes with parafilm; positive tubes had four last instar larvae, negative tubes had no insects. Galleria mellonella (waxworm) or Tenebrio molitor (mealworm) larvae were used as positive attractants, as appropriate. The lids of the tubes were then closed. The plates were incubated at 23 °C in darkness for one hour. IJs were counted in the positive (host side) and negative (blank side) zones and then scored using a chemotaxis index (CI) (Fig 2C). The assay format was adapted from Grewal et al. (1994), and the same as Morris et al. (2017).

Chapter 2: RNAi in Steinernema spp.

C # IJs positive zone−#IJs negative zone Chemotaxis Index = #IJs in both zones

Fig 2. Host finding assay set up. A) Image of waxworm finding arena; four waxworms (left), empty tube (right). B) In silico design of the host finding arena. C) Chemotaxis Index (CI) score equation.

Statistical analysis All statistical tests were performed using GraphPad Prism 6. The mean differences across S. carpocapsae strains with regards to their host finding (CI score), nictation and dispersal (percentage) data was analysed using a one-way ANOVA, and followed with a Fishers LSD post-hoc test.

Chapter 2: RNAi in Steinernema spp.

2.3 Results

RT-qPCR Knockdown Analysis Various treatment conditions were used to assess RNAi efficacy in S. carpocapsae. The greatest level of Sc-flp-21 knockdown was observed when the IJs were incubated in 5 mg / ml dsRNA and 50mM serotonin for 48 h (CI: 0.16 ± 0.03, P<0.0001), relative to dsRNA controls (Fig 3A). A lower amount of dsRNA resulted in significant knockdown, relative to controls (CI: 0.49 ± 0.13, P<0.01). To ensure dsRNA specificity, transcript L596_g5821.t1 was assessed for knockdown post Sc-flp-21 dsRNA soak, no knockdown was observed (Fig 3C).

Chapter 2: RNAi in Steinernema spp.

Fig 3. Abundance of target transcript was measured by qRT-PCR expression analysis, and a knockdown ratio was calculated for each target relative to the house keeper genes Sc-act and Sc-tub. A) Sc-flp-21 transcript ratio following a 48 h incubation period in 5 mg / ml dsRNA and 50 mM serotonin. B) Sc-flp-21 transcript ratio following a 48 h incubation period in 1 mg / ml dsRNA and 50 mM serotonin. C) L596_g5821.t1 transcript ratio following a 48 h incubation period in 5 mg / ml dsRNA and 50 mM serotonin. (**= P< 0.01, **** = P<0.0001).

Behavioural assays S. carpocapsae IJs were challenged with a nictation assay, where they were exposed to insect and no insect volatiles to observe their behavioural response. IJ responses observed upon exposure to insect volatiles were jumping, hyperactive nictation (increase intensity of body waving), standing (body waving ceases and IJ stands straight), and moving away from the stimulus. Using the RNAi protocol, dsRNA treated IJs were challenged with the nictation assay, to see what effects this has on their nictation phenotypes. The suppressed gene expression of Sc-flp-21 following RNAi treatment significantly impacted their behaviour during nictation assays. The knockdown of Sc-flp-21 drastically reduced the jumping response to live G. mellonella volatiles, almost completely inhibiting the behaviour (Fig 4A. Untreated: 0.65 ± 0.092, neo: 0.50 ± 0.032 & Sc-flp-21: 0.06 ± 0.025. Untreated vs Sc-flp-21 = P<0.0001; neo vs Sc-flp- 21 = P<0.001). A significant decrease in jumping was also observed in the T.

Chapter 2: RNAi in Steinernema spp. molitor nictation assay for the Sc-flp-21 treated IJs, relative to controls (Fig 4B. Untreated: 0.45 ± 0.046, neo: 0.40 ± 0.045 & Sc-flp-21: 0.02 ± 0.022. P<0.0001). The suppression of Sc-flp-21 also impacted the percentage of IJs that responded to live insect volatiles by hyperactively nictating; G. mellonella (Fig 4C. Untreated: 36.6 ± 6.675, neo: 46.0 ± 4.472 & Sc-flp-21: 10.0 ± 2.449. Untreated vs Sc-flp-21 = P<0.01; neo vs Sc-flp-21 = P<0.001) and T. molitor (Fig 4D. Untreated: 55.8 ± 2.615, neo: 44.0 ± 10.300 & Sc-flp- 21: 4.0 ± 2.449. Untreated vs Sc-flp-21 = P<0.0001; neo vs Sc-flp-21 = P<0.001). Standing was also a common phenotype observed, however the suppression of Sc-flp-21 had no significant effect on this behaviour upon exposure to G. mellonella volatiles (Fig 4E). Conversely, when T. molitor insects were used, the knockdown of Sc-flp-21 had a significant impact on standing behaviour, relative to controls (Fig 4F. Untreated: 31.6 ± 4.007, neo: 38.0 ± 7.348 & Sc-flp-21: 2.0 ± 2.000. Untreated vs Sc-flp-21 = P<0.01; neo vs Sc-flp-21 = P<0.001).

Chapter 2: RNAi in Steinernema spp.

Fig 4. Behavioural observations of nictating individual IJs on a micro-dirt chip assay post RNAi treatment. A) Mean jumping index of IJs when exposed to G. mellonella volatiles. B) Mean jumping index of IJs when exposed to T. molitor volatiles. C) Percentage of IJs that began hyperactively nictating upon exposure to G. mellonella volatiles. D) Percentage of IJs that began hyperactively nictating upon exposure to T. molitor volatiles. E) Percentage of IJs that stand stiff upon exposure to G. mellonella volatiles. F) Percentage of IJs that stand stiff upon exposure to T. molitor volatiles. (*=P<0.05, **= P< 0.01, ***=P<0.001, **** = P<0.0001).

Chapter 2: RNAi in Steinernema spp.

The IJs were also challenged with host finding assays, that measured their attractiveness to waxworm and mealworm larvae volatiles, scoring them with a chemotaxis index score (CI). Dispersal behaviour was also assessed. IJs that had undergone dsRNA treatment (Fig 3A) were challenged with a G. mellonella chemotaxis assay, the suppression of Sc-flp-21 significantly reduced their CI score (Fig 5A. Untreated: 0.55 ± 0.031, neo: 0.44 ± 0.061 & Sc-flp-21: 0.06 ± 0.063. Untreated vs Sc-flp-21 = P<0.0001; neo vs Sc-flp-21 = P<0.001). Similar results were observed in a T. molitor chemotaxis assays, as the suppression of Sc-flp-21 significantly reduced the proportion of IJs positively chemotaxing towards the insects (Fig 5B. Untreated: 0.42 ± 0.060, neo: 0.35 ± 0.085 & Sc-flp-21: 0.02 ± 0.032. Untreated vs Sc-flp-21 = P<0.001; neo vs Sc-flp-21 = P<0.01). IJs soaked in Sc-flp-21 dsRNA significantly decreased the number of nematodes found in the outer zone (peripheral), relative to controls (Fig 5C. Untreated: 60.8 ± 2.871, neo: 60.4 ± 1.030 & Sc-flp-21: 38.0 ± 3.017. P<0.0001).

Chapter 2: RNAi in Steinernema spp.

Fig 5. Behavioural assessment of S. carpocapsae IJ host finding and dispersal ability on a 1.5 % (w/v) PBS agar post one hour incubation in darkness at 23ᵒC post RNAi treatment. A) Host finding: G. mellonella finding assay. B) host finding: T. molitor finding assay. C) Dispersal behaviour of 100 aggregated IJs that either remain in the central zone or migrate to the peripheral zone. (**= P< 0.01, ***=P<0.001, **** = P<0.0001).

At a lower dsRNA amount of 1 mg / ml, Sc-flp-21 expression is halved (Fig 3B). The IJs that have undergone this treatment were then subject to the nictation assay. These conditions had no significant effect on jumping, hyperactive nictation and standing responses upon exposure to G. mellonella insects, relative to controls (Fig 6A-C). 24 hour exposure to 5 mg

Chapter 2: RNAi in Steinernema spp.

/ ml dsRNA, followed by a 24 hour recovery period in PBS was enough to trigger a knockdown ratio of 0.70 for Sc-flp-21. Similarly to the lower amount of dsRNA, these conditions failed to impact these nictation responses upon exposure to G. mellonella larvae (Fig 6D-F).

Chapter 2: RNAi in Steinernema spp.

Fig 6. Behavioural observations of nictating individual IJs after exposure to G. mellonella volatiles on a micro-dirt chip assay post RNAi treatments that achieved an average knockdown ratio of 0.49 (1 mg / ml dsRNA **) and 0.70 (24h dsRNA + 24h recovery in PBS (Morris et al., 2017)). A) Mean jumping index of IJs; 48h, 1 mg / ml dsRNA, 50mM 5-HT. B) Percentage of IJs that began hyperactively nictating; 48h, 1 mg / ml dsRNA, 50mM 5-HT. C) Percentage of IJs that stand stiff; 48h, 1 mg / ml dsRNA, 50mM 5-HT. D) Mean jumping index of IJs; 24h, 5 mg / ml dsRNA, 50mM 5-HT + 24h PBS. E) Percentage of IJs that began hyperactively nictating; 24h, 5mg / ml dsRNA, 50mM 5-HT + 24h PBS. F) Percentage of IJs that stand stiff; 24h, 5 mg / ml dsRNA, 50mM 5-HT + 24h PBS. (*=P<0.05, **= P< 0.01, ***=P<0.001, **** = P<0.0001).

During the nictation assays, a no insect control was used to puff clean air on the IJs performing nictation. This was done to ensure the live insect volatiles were the cause of jumping, hyperactive nictation and standing phenotypes, and not the air movement itself. Across all dsRNA treatments (Fig 3A), no IJ responded to the blank stimulus by jumping. Hyperactive nictation was stimulated in 3.3% of all IJs tested for the no insect control, and the standing phenotype was observed in 7.5%. The most dominant response for this test was the halting of nictation, returning to the ground and moving away from the no insect puff (Fig 7A). No significant differences were observed between their moving away behaviour upon exposure to the stimulus (Fig 7A. No insect: untreated: 67.5 ± 12.500, neo: 77.5 ± 4.787 & Sc-flp-21: 82.5 ± 10.310). The suppression of Sc-flp-21 significantly increased the percentage of IJs that moved away from the G.

Chapter 2: RNAi in Steinernema spp. mellonella volatiles, relative to controls, that very rarely did this (Fig 7A. G. mellonella: untreated: 5.0 ± 2.887, neo: 0.0 ± 0.000 & Sc-flp-21: 27.5 ± 6.292. P<0.05).

All other gene targets for RNAi analysis did not trigger significant knockdown in their gene expression for S. carpocapsae (Fig 8A-D) when incubated in 48h, 5mg / ml dsRNA, 50mM 5-HT. Further adjustments were tested to suppress Sc-npr-1. The dsRNA exposure time was increased to 120 hours and failed to generate significant knockdown (Fig 8E). As an addition to the successful Sc-flp-21 RNAi protocol, IJs were electroporated post 48 hour incubation in dsRNA, and were allowed to recover in fresh PBS for 24 hours; this was also an unsuccessful protocol to trigger Sc-npr-1 knockdown (Fig 8F). No significant gene suppression was found when targeting Sf-flp-21 and Sg-flp-21 in S. feltiae (Fig 8G) and S. glaseri (Fig 8H), respectively.

Chapter 2: RNAi in Steinernema spp.

Fig 8. Following the same RNAi protocol as Sc-flp-21, other genes were targeted for knockdown, RT-qPCR knockdown analysis are presented with GFP and NEO dsRNA: A) Sc-flp-18, B) Sc-npr-1, C) Sc-npr-3 and D) Sc- npr-5. Further development of the RNAi protocol took place for Sc-npr-1: E) extending the time of dsRNA soak to 120 hours, and F) Post-48 h dsRNA soak, the IJs were electroporated, and then allowed 24 hours to recover in fresh PBS. S. feltiae and S. glaseri was also targeted for RNAi using the same successful protocol and target as S. carpocapsae: G) Sf- flp-21 and H) Sg-flp-21. (P>0.05).

Chapter 2: RNAi in Steinernema spp.

2.4 Discussion

RNAi is an effective tool for functional studies in Caenorhabditis elegans, however, this phenomenon seems to be limited to a number of nematodes. Steinernema carpocapsae has a functional RNAi pathway that is capable of up taking Sc-flp-21 dsRNA, resulting in significant gene suppression. However, this success was not shared with other targets and close relatives to S. carpocapsae. After 48 hours of incubation in a high dsRNA amount (5 mg / ml), Sc-flp-21 was greatly suppressed by 84 %, relative to controls (Fig 3A). A lower amount of 1 mg / ml dsRNA was also used, which achieved statistically significant knockdown of Sc-flp-21, however, it was not to the same magnitude as 5 mg / ml. The dsRNA used was specific to the Sc-flp-21 gene, as the expression of the next closest gene similar to the dsRNA found by BLAST, L596_g5821.t1, was unaffected by the Sc-flp-21 dsRNA (Fig 3C). In C. elegans, flp-21 is expressed on chemosensory, thermosensory, mechanosensory neurons and motorneurons (Kim & Li, 2004). The absence of a sid-2 orthologue in S. carpocapsae did not impact their ability to uptake dsRNA into the cells, suggesting another dsRNA transporter must be present. This corroborates the presence of a SID-2 independent RNAi pathway. Genes responsible for dsRNA transport were found to be conserved in S. carpocapsae. RNAi spreading defective gene rsd-3 is responsible for intracellular import of silencing RNAs in C. elegans (Tijsterman et al., 2004), and being present in S. carpocapsae (Morris et al., 2017), it may contribute heavily to the RNAi effects observed.

Nictating IJs are able to perform various behaviours to enhance contact with an insect upon exposure to their volatile, including jumping, hyperactive nictation and standing (Campbell & Kaya, 1999). Jumping behaviour was observed to be directional towards the source of the insect volatiles, and the lack of jumping when insects are not present support that jumping is triggered by host associated olfactory cues. Other popular responses observed were hyperactive nictation, where IJs increase the speed and frequency of body waving upon exposure to insect volatiles,

Chapter 2: RNAi in Steinernema spp. which may aid with host contact or to locate the direction of the smell. The final common response was a standing phenotype, where IJs remained straight and stiff, performing no body waving for extended periods of time, which seemingly aids in host contact, by stretching out their body as much as they can. The suppression of Sc-flp-21 significantly reduced the IJs jumping and hyperactive nictation upon exposure to insect volatiles, and standing behaviour with T. molitor volatiles. Standing behaviour was not effected when G. mellonella insects were used. All three nictation phenotypes were almost completely abandoned when live insects were absent from the assay. When no insect nictation assays took place, the dominant behavioural response was avoidance, where the nictating IJ would halt nictation, and crawl away within five puffs of the empty pipette tip. This behaviour was rarely seen when insects were present for control IJs, where Sc-flp-21 suppressed worms significantly crawled away relative to controls (P<0.05), although not to the extent of no insect assays. The perception of short range insect volatiles may still be present when Sc-flp- 21 is supressed by 84 %, suggested by the reduction in crawling away from stimulus, relative to no insect controls. If they still perceive the short range insect volatiles, it may be at low levels, at least not enough to trigger jumping and hyperactive nictation. These findings corroborate FLP-21’s role in olfactory perception. A lower amount of Sc-flp-21 dsRNA did not significantly impact the IJs jumping, hyperactive nictation and standing phenotypes, relative to untreated and dsRNA control IJs (Fig 6A-C). Furthermore, a shorter incubation period of 24 hours in 5 mg / ml dsRNA, plus a 24 hour recovery period in fresh PBS did not trigger a significant impact on these nictation phenotypes.

The suppression of Sc-flp-21 also had a significant impact on their host finding behaviours, relative to control IJs. Interestingly, Sc-flp-21 treated IJs were unable to to detect the presence of G. mellonella and T. molitor in host finding and nictation assays, relative to untreated and control IJs (Fig 4-5). Without Sc-flp-21, IJs consistently achieved a neutral CI score in the insect finding assays, suggesting they were unstimulated by volatile cues, therefore randomly dispersing. Further indication of Sc-flp-21’s role in

Chapter 2: RNAi in Steinernema spp. olfactory perception were found in their dispersal abilities post knockdown. Untreated and control IJs dispersed from their aggregated state (inner zone) within an hour of placement in the middle of the assay ~60 %. Their dispersal is likely triggered by conspecific ascarocide signalling, presumably by ascr#9 signalling which is used to disperse IJs from their natal cadaver (Kaplan et al., 2012). The knockdown of Sc-flp-21 significantly impacted the number of IJs migrating to the outer, peripheral zone, suggesting perception of ascarocide signalling is regulated by Sc-flp-21. As S. carpocapsae infects a wide variety of insects, showing little host specificity, live G. mellonella and T. molitor were used as attractive olfactory stimuli. The volatile output for both these insects were identified by Morris et al., (2017), which will later be exploited in later chapters. The results of the host finding behaviour assessment were similar, regardless of which insect was used, suggesting S. carpocapsae is attracted to volatiles shared between both insects, attracted to many insect associated volatiles, or they are attracted to non-diagnostic cues such as CO2.

Genes that have been associated with flp-21 were also targeted for RNAi, to observe their role in these host finding behaviours. A known ligand of the NPR-1 receptor, along with FLP-21, is FLP-18 (Rogers et al., 2003). Host derived dsRNA targeting Mi-flp-18 triggered significant knockdown in the PPN M. incognita, suppressing the gene by 84 % (Papolu et al., 2013); the same level as Sc-flp-21 in this study. Relative to controls, Mi-flp-18 suppressed J2s resulted in a reduction in migration and penetration in M. incognita (Dalzell et al., 2010; Papolu et al., 2013). Similar results were observed for the potato cyst nematode G. pallida (Kimber et al., 2007). Interestingly, Sc-flp-18 was not RNAi susceptible when using the same protocol as Sc-flp-21 in S. carpocapsae IJs. Although they are both known ligands to the NPR-1 receptor, they are not expressed on the same chemosensory neurons (Kim & Li, 2004). Differing target-specific RNAi efficiency may suggest that some neuronal cells in S. carpocapsae may be RNAi resistant to exogenous dsRNA. Further failed genes that were targeted for RNAi using the Sc-flp-21 protocols were Sc-npr-1, Sc-npr-2, Sc- npr-3 and Sc-npr-5 (Fig 8). The exposure time in high amounts of dsRNA (5

Chapter 2: RNAi in Steinernema spp. mg / ml) was increased to five days (120 hours) for the Sc-npr-1 target, with no knockdown observed, relative to controls. Electroporation, which has previously made RNAi gene targets more susceptible to suppression, did not result in significant knockdown, even with extended dsRNA exposure periods (48 hours) relative to previously published methods (24 hours) and a recovery period of 24 hours post electroporation. Varying knockdown susceptibility have also been observed for the H. contortus and O. ostertagi, where only some of the gene targets triggered significant suppression in expression (Geldhof et al., 2006; Kotze & Bagnall, 2006; Visser et al., 2006). These nematodes appear to have the cellular machinery to enable the uptake and spread of dsRNA, however, these mechanisms may be cell specific, with some cells being RNAi resistant. There may be a similarly sequenced gene to the target gene, that doesn’t get effected by the dsRNA, however the primers used for quantitative analysis may target mRNAs that share sequence similarities to other gene mRNAs, and may mask the quantitative analysis of the target gene expression by the qPCR primers binding to a non-target mRNA. To ensure Sc-flp-21 knockdown was specific to that gene with no off-target effects, the closest gene sharing the most sequence similarities to the target transcript was analysed; L596_g5821.t1. The Sc-flp-21 soaking method had no effect on L596_g5821.t1’s transcript levels. Off-target assessments were only done on Sc-flp-21 as it was the only successful gene knockdown RNAi protocol.

The flp-21 neuropeptide gene was also targeted for dsRNA knockdown in the closely related species S. feltiae and S. glaseri. Following the same conditions as S. carpocapsae, RNAi of Sf-flp-21 and Sg-flp-21 was unsuccessful, as no significant gene suppression was observed. Members of the same genus have been found to have differing RNAi susceptibilities; C. briggsae is resistant to exogenous dsRNA RNAi, where C. elegans is highly susceptible (Winston et al., 2007). The dsRNA transporter gene sid-2 shares sequence similarities with a gene in C. briggsae, however, they do not share the same function as dsRNA transporters. Such dsRNA transporting genes were rarely identified in parasitic nematodes, however,

Chapter 2: RNAi in Steinernema spp.

RNAi via exogenous dsRNA is possible in parasitic nematodes, as explored earlier. Many of the genes involved in C. elegans RNAi may not have a conserved function between species, suggesting the molecular basis of RNAi is not strongly conserved between nematode species (Dalzell et al., 2011).

RNAi via exogenous dsRNA soaking method is possible for S. carpocapsae, however efficiency is very low, as only a single gene target was knocked down; 20% of genes tested. The suppression of Sc-flp-21 had drastic effects on their insect and conspecific perception, suggesting this neuropeptide plays a central role in volatile perception.

Chapter 3: Isolation of Native EPNs in Northern Ireland

CHAPTER 3: ISOLATION OF NATIVE EPNS IN NORTHERN IRELAND

3.1 Introduction

Entomopathogenic nematode (EPN) surveys have been conducted around the world as EPN natural genetic diversity is important for improving their bioinsecticide capabilities (Hominick et al., 1996). Different populations of EPN species possess individuals with greater virulence, reproductive capabilities and tolerance towards environmental stresses; desiccation, UV resistance (Campos-Herrera & Gutiérrez, 2014; Downes et al., 2009; Grewal et al., 2002b; Hazir et al., 2001; Somasekhar et al., 2002; Stuart et al., 2004). EPNs inhabit a range of habitats and soil types. Soil is comprised of numerous particles of varying in size such as sand, silt and clay. Sand and sandy loam soils have large pore sizes that provide good aeration and lower water retention, making the environment more favourable for nematodes (Portillo-Aguilar et al., 1999; Hartley & Wallace, 2018). Conversely, clay, and clayey loam soils have small pores resulting in poor aeration with high moisture content. EPN distribution is closely related to soil type and texture, generally EPNs establish better in sandy loam soils (Kung et al., 1990). Although, it is difficult to generalise as EPNs display significant variation in behaviour, environmental stress tolerance, infectivity, host range and reproductivity. Collecting natural isolates from soils around the world can unlock new isolates that exhibit enhanced beneficial qualities for their use as biocontrol agents; host finding, nictation, dispersal and environmental tolerances. EPN surveys have been conducted across the UK and Ireland. Heterorhabditis downesi were found to be more prevalent in British and Irish coastal areas (Griffin et al., 1994; Rolston et al., 2005). They have also been isolated from roadside soils and pastures in Hungary (Griffin et al., 1999). Steinernema feltiae are more frequently found inland with a preference for loamy soils, although they have also been discovered in Irish, sandy soil (Rolston et al., 2005). Steinernema affine, Steinernema kraussei, Steinernema glaseri and recently Steinernema carpocapsae have also been isolated from British soils (Edmunds et al., 2018; Gwynn & Richardson, 1996). The isolation of native EPN species is a prerequisite to their use as biocontrol agents. Previous EPN surveys have shown that soil samples positive with EPNs are rather

Chapter 3: Isolation of Native EPNs in Northern Ireland rare, usually not exceeding 10 %. Positive hit rates have been recorded in the Republic of Ireland (10.5 %; Griffin et al., 1991), Egypt (9.5 %; Shamseldean & Abd-Elgawad, 1994: 0.2 %; Abdel-Razek et al., 2018), Syria (9.0 %; Jawish et al., 2015), India (8.2 %; Kaushal et al., 2000), Turkey (5.8 %; Kepenekci, 2002: 2.0 %; Hazir et al., 2003), Northern Spain (5.4 %; Campos-Herrera & Gutiérrez, 2008), South Africa (5.2 %; Hatting et al., 2009), Korea (4.6 %; Choo et al., 1995), Irish coast (4.4 – 6.9 %; Griffin et al., 2005), La Rioja, Azores (3.9 %; Rosa et al., 2000), UK (3.5 %; Edmunds et al., 2018) and north-west Iran (3.0 %; Niknam et al., 2010: 3.2 %; Kary et al., 2009) and Scotland (2.2 %; Boag et al., 1992). One of the highest instances of positive EPN samples from a survey was in Quebec (85.0 %), which harboured mostly S. carpocapsae (Bélair et al., 2001). Further instances of high hit rates have been found in the Czech Republic (53.8 %; Mráček et al., 1999), Denmark (38.5 %; Dix et al., 1999), Hungary (32.6 %; Dix et al., 1999), Estonia (27.3 %; Dix et al., 1999) and California (26.3 %; Stock et al., 1999). Once isolates are collected, they can be identified using morphological or molecular techniques. Identifying EPN species by their morphological features is difficult due to their similarities; this method is unreliable and often requires significant previous experience. Therefore molecular identification is the dominant and most reliable method, by sequencing regions of the nematodes DNA. The Ribosomal DNA (rDNA) region consists of the internal transcribed spacer (ITS) regions (ITS1 and ITS2), and the 18S, 5.8S and 28S rRNA genes. The ITS regions show sequence variability whereas the 5.8S rRNA gene is highly conserved (Hillis & Dixon, 1991; Ferris, 1993). Having both variable and conserved regions in the rDNA makes it an ideal candidate for phylogenetic studies. The internal transcribed spacer (ITS) regions of nematode rDNA have been used to identify parasitic nematodes species and populations since the early 1990’s (Ferris, 1993). Since then, the ITS region of Steinernema spp. has shown sequence variation down to the species level (Nguyen et al., 2001; Szalanski et al., 2000).

Entomopathogenic nematodes (EPNs) are promising candidates as biocontrol agents for soil dwelling arthropods. This is because they actively

Chapter 3: Isolation of Native EPNs in Northern Ireland search for target pests in an environment, and they have been documented to produce over 300,000 new IJs per insect (Grewal et al., 1994). Additionally, they can be produced on a commercial level and then be used solely or alongside other agricultural pesticides (Koppenhöfer et al., 2000; Koppenhöfer et al., 2002). Some EPN species have a wide range of hosts, while others display narrow host ranges, such as Steinernema scapterisci, which has been found to be an effective biocontrol agent of mole crickets (Parkman & Smart, 1996; Frank & Walker, 2006). The variation in EPN host range provides an opportunity to develop environmentally friendly biocontrol agents for specific applications, thereby reducing the risk of killing unintended species by ensuring that they only target pest insects. This is one reason why they are desirable candidates for enhancing crop protection worldwide. Other desirable traits include their ability to rapidly kill a host, also that they can actively search for a host following sensory cues, they can be mass produced in vitro, easily applied to soil and they are considered safe for vertebrates and many non- target invertebrate organisms. However, our lack of EPN knowledge post- application has resulted in some inconsistencies in insect control efficiency. Controlled laboratory studies can be misleading regarding their biocontrol fitness as many important environmental conditions are not accounted for. Examples include: natural trophic interactions and the influence of abiotic factors on their persistence in soil. Their sensitivity to UV light, desiccation and inability to swim limits their use to mainly soil dwelling pests (Kaya & Gaugler, 1993). Furthermore, many EPN crop protection studies have been found to be not as effective as some of the predominant insecticidal programs currently in place (Georgis et al., 2006).

Mole crickets (Family: Gryllotalpidae) are major pests of turf land. They cause extensive damage to golf courses by feeding on grass, and mechanically damaging turf by burrowing and tunnelling (Parkman & Smart, 1996; Frank & Walker, 2006). The application of S. scapterisci has proven to be an effective biocontrol agent for mole crickets in turf land. Steinernema riobrave is initially effective, however as they do not reproduce in mole crickets, making them unable to recycle. Steinernema

Chapter 3: Isolation of Native EPNs in Northern Ireland carpocapsae only provide moderate control (Parkman & Smart, 1996; Frank & Walker, 2006). Other golf course pests include the black cutworm, which causes similar damage as the mole cricket, but can additionally cause large areas of dead grass. Effective, fast and consistent protection against the black cutworm (Agrostis ipsilon) is provided by S. carpocapsae, where Heterorhabditis bacteriophora is considered ineffective (Georgis & Poinar, 1994; Ebssa & Koppenhofer, 2012). A further grass predator that threatens golf courses is the billbug (Sphenophorus spp.). Steinernema carpocapsae and H. bacteriophora both greatly suppress billbug numbers in trials (74 – 84 %), and it has proven just as effective as commercial pesticides (Georgis & Poinar, 1994; Smith, 1994; Kinoshita & Yamanaka, 1998). When protecting golf courses from arthropod pests, the dominant control method is chemical insecticides as they are usually cheaper, and offer greater control. Method of application of IJs to crops can impact their control efficiency. A study in Cuba found that Heterorhabditis indica was an effective control agent of the blue-green weevil (Pachnaeus litus) in citrus crops, where both the adults and larvae damage the plants (Montes & Montejo, 1990). Two H. indica application methods were tested; one was delivering the IJs through infected Galleria mellonella cadavers, which resulted in 61 – 80 % suppression. The second method sprayed IJs suspended in water onto the crops, where they provided 74 – 82 % protection against the blue-green weevil (Montejo & Montes, 1990). Another study in Cuba highlighted that H. indica was also able to offer protection against Diaphania hyalinata (melon worms) in cucumber crops with 68 % suppression (Pozo et al., 2004). Tomato pinworm larvae (Keiferia lycopersicella) cause damage to the leaves, stems and developing fruits of tomato plants. With no control method in place, they damage on average 43 % of plants. The application of H. bacteriophora to the crops reduced plant damage down to 9 % (Peña et al., 2015). Steinernema kraussei provides great protection for spruce tree crops from sawflies (92 – 96 % mortality to diapausing larvae), where their larvae can cause complete defoliation of trees which leads to death when unprotected (Mráček, 1986). Palm trees are one of the most cultivated and profitable plants in the world. One of the largest natural threats facing them is the red palm

Chapter 3: Isolation of Native EPNs in Northern Ireland weevil (Rhynchophorus ferrugineus), damaging crops across Asia, the Mediterranean & the Middle East. High densities of S. carpocapsae sprayed over the top of the palm trees provides 71 – 78 % protection from red palm weevil damage, which often leads to plant death (Nardi et al., 2011). Insecticides may also be used in conjunction with EPNs to enhance biocontrol efficiency. Heterorhabditis bacteriophora, S. glaseri and Steinernema kushidai work synergistically with imidacloprid to increase biocontrol efficiency against third instar Cyclocephala hirta larvae in greenhouse trials. However, large differences in virulence have been observed between strains of EPN (Koppenhöfer et al., 2000). When S. carpocapsae is applied to palm crops alongside azadirachtin, an insecticidal compound, it resulted in a mortality rate ranging from 91 – 93 % (Nardi et al., 2011). Chemical pesticides currently offer the best protection against these weevils for palm crops; 86 - 100 % protection (Nardi et al., 2011). Direct exposure to chemical insecticides can have drastic effects on IJ survival; however, S. feltiae exposure to the residues post-application has been observed to have no significant effect on their biocontrol ability (Head & Walters, 2002). Furthermore, S. feltiae has shown some nematicidal resistance to the plant pathogenic nematode (PPN) control agent Nemafric-BL phytonematicide, suggesting they can be used in conjunction with other pesticide programmes (Madaure et al., 2017). EPN crop protection has been found to exceed other control programmes in certain trials. Steinernema feltiae consistently and greatly outperformed five pesticides in glasshouse trials attempting to control the South American leafminer, Liriomyza huidobrensis (Head & Walters, 2002). The alfalfa clover is an important crop for the dairy sector; however, they are threatened by their own commercial pest, the alfalfa snout beetle. Poison baiting and commercially available insecticides are ineffective at protecting crops from the snout beetle, but the combination of H. bacteriophora, S. carpocapsae and S. feltiae provides effective control (Neumann & Shields, 2008). They also established in the soil and were present there a year after their first and only application (Neumann & Shields, 2011). The combination of these three EPN species provides protection throughout depths of a sand column, as S. carpocapsae dominated the top layer (<6.5

Chapter 3: Isolation of Native EPNs in Northern Ireland cm), S. feltiae dominated the middle layer (6.5 cm - 19.5 cm) and H. bacteriophora dominated the lower levels (>19.5 cm) (Neumann & Shields, 2006). Along with working alongside each other, EPNs are able to work alongside other biocontrol agents to offer greater overall protection than single applications alone. Cabbage plots are threatened by Plutella xylostella (diamondback moths), whose larvae can seriously damage the crop and affect yield. High densities of H. bacteriophora applied to soil and the release of 45 parasitoid wasps (Tetrastichus howardi) per plot almost fully protected the crops from diamond back moth larvae attack resulting in a 96 % reduction in damaged cabbage leaves (Casanova et al., 2010).

Exposure to entomopathogenic bacteria, such as Bacillus popilliae and Bacillus thuringiensis, has been known to significantly enhance an insect’s susceptibility to EPN infection. Therefore, their use alongside each other can increase biocontrol efficiency against more EPN tolerant insects (Thurston et al., 1994; Koppenhöfer & Kaya, 1997). The same enhancement to protection was observed when EPNs were applied with the entomopathogenic fungi Metarhizium anisopliae (Acevedo et al., 2007; Ansari et al., 2004; Ansari et al., 2006, Ansari et al., 2008). However, these biocontrol pairings do not always enhance protection from insect pests, therefore combining the correct formulations is important for enhancement (Choo et al., 2002). EPNs have also shown to protect animals against their parasitic fleas. Cat fleas, Ctenocephalides felis, are susceptible to S. carpocapsae infection, both cocooned and uncocooned; although they cannot recycle and produce new IJs in the cadaver (Silverman et al., 1982; Henderson et al., 1995). The Cattle tick, Rhipicephalus (Boophilus) annulatusis, a pest often associated with mammalian farm animals, is highly susceptible to EPN infection (Samish & Glazer, 1991; Samish & Glazer, 2001). Soil trials have revealed EPN biocontrol efficiency is highly dependent on the substrate they are on. Manure substrate greatly reduces tick supressing efficiency (Samish et al., 1998). The composition of soil substrate also effected EPN control efficiency against the carrot weevil, Listronotus oregonensis for many EPN species tested, including: S. carpocapsae, S. riobrave, S. feltiae, H. megidis, H. bacteriophora

Chapter 3: Isolation of Native EPNs in Northern Ireland

(Miklasiewicz et al., 2002). Temperature also appears to drastically impact EPN biocontrol fitness, and limits their use in hotter countries (Georgis & Gaugler, 1991; Jagdale et al., 2004; van Tol & Raupp, 2005). Steinernema feltiae has a large temperature range, within which it can remain infective (8 – 30 ᵒC), and reproduce (10 - 25 ᵒC), relative to other EPN species (Grewal et al., 1994; Hazir et al., 2002). Other EPN species are limited to a narrower temperature range. Infectivity of EPN species and strains towards target pests is highly variable (Grewal et al., 2002a). Four EPN species have shown little to no infectivity towards the European chafer, Rhizotrogus majalis; S. glaseri, S. feltiae, S. carpocapsae, and H. bacteriophora (Simard et al., 2001). Cappaerta & Koppenhöfer (2003) later discovered that efficient EPN suppression of the European chafer, Rhizotrogus majalis, and the Japanese beetle, Popillia japonica, was only achieved with S. scarabaei in field trials; H. bacteriophora had little to no effect on pest survival. Steinernema scarabaei also proved effective against the Asiatic garden beetle, Maladera castanea, where H. bacteriophora offered little control in a micro-plot field trial (Koppenhöfer & Fuzy, 2003). Some pests seem to be resistant to EPN attack. Control of the cabbage maggot, Delia radicum, was unsuccessful when using EPNs (H. bacteriophora, S. glaseri, S. feltiae and S. riobravus) in glasshouse and field trials (Schroeder et al., 1996). Entomopathogenic fungi are more promising biocontrol candidates for cabbage maggot control (Myrand et al., 2015). Differences in virulence against vegetable pests, Spodoptera litura, Crocidolomia pavonana and Plutella xylostella, have also been observed between natural isolates of Heterorhabditis spp. from the Philippines (Pascual et al., 2018). EPNs have shown some success when employed as biocontrol agents for a variety of crops, however, inconsistencies in efficiency have been observed, often not reaching the same level of control as chemical pesticides. Their diversity in behaviour, virulence and tolerance to environmental conditions make them a versatile tool in achieving effectiveness and specificity towards pests. Traits can be artificially selected in order to generate EPN strains that display desired phenotypes and the wealth of global genetic variation can drive the development of enhanced bioinsecticide products.

Chapter 3: Isolation of Native EPNs in Northern Ireland

The aim of this study is to survey Northern Irish soil for the presence of native, natural EPN populations. Once collected, the isolates shall be identified, and challenged with behavioural assays such as host finding and dispersal, and assessed on various qualities that may be beneficial for their use as biocontrol agents, for example, number of emerging IJs from one cadaver and time taken to kill an insect. These qualities will then be compared to a soil trial, where fresh IJs of each isolates must find and infect G. mellonella in a soil matrix.

Chapter 3: Isolation of Native EPNs in Northern Ireland

3.2 Materials and Methods

Soil sample collection Soil samples were collected from 17, relatively undisturbed, natural landscape sites across Northern Ireland from January 2017 to February 2018. Within each site, three samples (within 20 m2) were taken from three predominant soil and vegetation types. Samples from different soil and vegetation types were taken 100 m apart from each other. Samples were taken using a 1.5cm (radius) soil corer that reached to depths of 20cm: 140cm3. Each sample was stored in individual 650ml plastic containers (17 cm x 12 cm x 4.5 cm).

EPN extraction The soil samples were dampened with a spray of water and then baited with five last-instar G. mellonella larvae, and then stored at 17⁰C in darkness. Every 3 days the samples were checked for any dead waxworm cadavers. Dead cadavers were removed, gently washed in sterile water, and placed on a White trap (White, 1927). All samples were kept for a maximum of 14 days. All collected nematodes from the White trap were subjected to a second round of insect infection by exposing five waxworms to 500 individual nematodes, confirming their insect pathogenicity.

EPN strains

Natural isolates of EPN were collected from Northern Irish soil. Six S. feltiae isolates were collected; LM-1C, LM-2A, LM-2B, LM-4A, LM-4B, LM-4C, along with a single S. affine isolate. Three Heterorhabditis isolates were also collected, however only one could be identified to the species level: M18- 1B (H. downesi). The remaining Heterorhabditis isolates were identified by their initial hermaphroditic adult stage post infection. Laboratory strains of S. feltiae (gen and 4cfmo) were also incorporated and tested in this study.

Chapter 3: Isolation of Native EPNs in Northern Ireland

DNA extraction 2µl of pelleted IJs were transferred to a 0.2ml tube. A pellet pestle was used to crush the IJs. Immediately, 4µl of worm lysis buffer (500mM KCl, 100mM Tris-HCl (pH 8.3), 15mM MgCl₂, 10mM DTT (dithiothreitol), 4.5% Tween 20 and 0.1% Gelatin), 4µl of ddH₂O and 1µl of Protease K (600µg/ml) was added to the crushed worms. The samples were then quickly transferred and incubated at 65⁰C for 1 hour. The temperature was then increased to 95⁰C for 10 minutes. The lysate contains the DNA.

Identification The ITS region of the nematodes were amplified using primers identified by Joyce et al. (1994): TW81 (5’’- GTTTCCGTAGGTGAACCTGC -3’’) and AB28 (5’’- ATATGCTTAAGTTCAGCGGGT -3’’). 10µl of DNA suspension was added to a PCR mix (25µl Taq Mix, 1µl of each primer, 13µl of ddH2O). The PCR product was generated as follows: [94°C x 2 min, 40 x (94°C x 30 s, 60°C x 60 s, 72°C x 90 s) 72°C x 5 min]. PCR products were assessed by gel electrophoresis, and cleaned using the Chargeswitch PCR clean-up kit (Life Technologies). PCR products were transformed and cloned in E. coli using the TOPO TA Cloning Kit (Invitrogen), following manufacturer’s instructions. Plasmid extraction was undertaken with the Qiagen Plasmid Extraction Kit (Qiagen), as per manufacturer instructions. Samples for each isolate were prepared for DNA sequencing with the Mix2Seq Kit and sequenced by Eurofins Genomics. Once obtained, the ITS sequences for each isolate was nucleotide BLASTed against the NCBI databank (Altschul, et al., 1990). The top hit referencing directly to an EPNs ITS region was confirmation of their species.

Number of emerging IJs 50 EPN IJs were transferred onto the dorsal side of a single isolated G. mellonella larvae. The insect cadaver was transferred to a White trap seven days post infection (White, 1927) in a 65 mm Petri dish. Two days post- emergence, the surrounding PBS in the White trap was collected, and replaced with fresh PBS; this continued every two days until no more IJs

Chapter 3: Isolation of Native EPNs in Northern Ireland appeared in the PBS, and all were collected. The IJs were counted by collecting them all into a known volume of PBS, followed by counting the number of IJs in 5 μl aliquots. Estimation can then be made by scaling up the number of IJs into the full known volume. This was repeated five times per assay, and five time per strain (n = 5).

Kill time Galleria mellonella larvae were exposed to IJs directly onto the middle of their dorsal side with three different densities; 100, 50 and 10 IJs per insect. After 24 hours, the kill time assays were checked every three hours for insect mortality; unresponsive to touch. The time it took the IJs to kill the larvae was recorded (n = 10).

Soil G. mellonella finding assay Three 1.5 ml Eppendorf tubes (with a small hole that IJs can pass through) were used to contain a single G. mellonella larvae in each. The tubes were placed at one side of a 650 ml plastic container (17 cm x 12 cm x 4.5 cm). 200 g of autoclaved compost (John Innes No.2) was added to the container, burying the insect tubes. Water was sprayed on the soil until the weight reached 235 g. 300 IJs (100 per insect) was then transferred to the other side of the soil assay, where they would have to travel at least 14 cm to reach an insect. The container was then sealed with its lid, and the assay is stored at room temperature in darkness. After 48 h, the soil host finding assays were investigated every three hours for insect mortality; unresponsive to touch. The cadavers are stored for three days, and then dissected to confirm EPN infection. The time for each strain at the same IJ density to travel 14 cm through a soil matrix, attach, infect and kill the insects were recorded (n = 3).

Chapter 3: Isolation of Native EPNs in Northern Ireland

Statistical analysis All statistical tests were performed using GraphPad Prism 6. The mean differences across strains were analysed using a one-way ANOVA, and followed with a Fishers LSD post-hoc test.

Chapter 3: Isolation of Native EPNs in Northern Ireland

3.3 Results

Nine soil samples were collected from 17, relatively undisturbed, natural landscape sites across Northern Ireland from January 2017 to February 2018 (Fig 9A). They were later baited with G. mellonella larvae to attempt EPN extraction from the soil. 153 samples were taken in total, and ten were positive for EPNs (6.5 %) from five sites (29.4 %). Insect mortality was observed in almost all samples (93.5 %). The majority of G. mellonella deaths were as a result of entomopathogenic fungi or bacteria, and only 7.0 % were caused by EPN infection. Ten strains were collected across five sites; Whiterocks Beach, Whitepark Bay, Lagan Meadows, Belvoir Forest and Murlough Beach. ITS sequences were used to identify EPN species where possible. The ITS regions of two strains did not amplify for two strains; WR14-1B and W16-1B, from Whiterocks Beach and Whitepark Bay, respectively. They were identified as a member of the Heterorhabditis genus by their initial hermaphroditic adult stage after infection. Three strains were isolated from Lagan Meadows; LM-1C, LM-2A and LM-2B, and ITS sequence alignment identified all three as S. feltiae (Table 3). Another three S. feltiae strains were collected from Belvoir Forest Park; LM-4A, LM- 4B and LM-4C (Table 3). The final two strains were collected from Murlough Beach; M18-1B was identified as H. downesi and M18-2B was found to be S. affine (Table 3).

Chapter 3: Isolation of Native EPNs in Northern Ireland

Fig 9. Sites where soil samples were taken from natural Northern Irish Soil. 1) Whiterocks Beach. 2) Portballintrae. 3) Whitepark Bay. 4) Glenariff Forest. 5) Ballyboley Forest. 6) Tardree Forest. 7) Cavehill. 8) Crawfordsburn Country Park. 9) Divis Mountain. 10) Colin Glen Forest Park. 11a) Lagan Meadows. 11b) Belvoir Forest Park. 12) Gosford Park. 13) Murlough Beach. 14) Tollymore Forest. 15) Slieve Donard. 16) Slieve Gullion. Made with https://www.mapcustomizer.com/

Chapter 3: Isolation of Native EPNs in Northern Ireland

Table 3. The ITS region of each isolate were targeted and amplified with the primer pair TW81 and AB28. The ITS regions were sequenced, and a nBLAST alignment was performed against the NCBI databank (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul, et al., 1990). NCBI Top Identity Query Isolate Species E Value Description Gene Hit (%) Cover (%) S. feltiae small subunit LM-1C MG952288.1 S. feltiae 99 0.0 99 ribosomal RNA gene S. feltiae gene for 18S LM-2A AB243439.1 S. feltiae 99 0.0 74 rRNA S. feltiae gene for 18S LM-2B AB243439.1 S. feltiae 99 0.0 73 rRNA S. feltiae small subunit LM-4A MG952288.1 S. feltiae 99 3e-166 99 ribosomal RNA gene S. feltiae small subunit LM-4B MG952288.1 S. feltiae 99 0.0 74 ribosomal RNA gene S. feltiae gene for 18S LM-4C LN611139.1 S. feltiae 99 0.0 78 rRNA H. downesi 18S M18-1B KU573062.1 H. downesi 73 2E-28 69 ribosomal RNA gene S. affine small subunit M18-2B KY818705.1 S. affine 78 9e-101 93 ribosomal RNA gene

The two isolates with the highest number of emerging IJs from a single cadaver, LM-4C and LM-2B, were only significantly different from the lowest scoring isolate, LM-2A (Fig 10A. LM-4C: 74500 ± 18791, LM-2B: 70667 ± 24222 & LM-2A: 28667 ± 8743. P<0.05). All isolates tested scored highly in the host finding assays, although significant differences are found when isolates are tested against the highest scoring isolate, WR14-1B (Fig 10B. WR14-1B: 1.00 ± 0.004 [LM-4C: 0.73 ± 0.094; P<0.01] [LM-4A: 0.67 ± 0.036; P<0.001] [LM-2A: 0.58 ± 0.074, M18-1B: 0.56 ± 0.021, LM-4B: ± 0.56 ± 0.084; P<0.0001]). Isolate dispersal behaviours were analysed against the highest scoring isolate, W16-1B, where significant differences were observed (Fig 10C. W16-1B: 62.3 ± 4.096 [LM-4A: 48.4 ± 4.411, LM-2A: 45.6 ± 1.923; P<0.01] [LM-2B: 39.9 ± 0.505; P<0.001] [LM-4C: 32.5 ± 3.949, LM- 1C: 29.1 ± 3.489, LM-4B: 26.4 ± 1.312; P<0.0001]).

Chapter 3: Isolation of Native EPNs in Northern Ireland

Fig 10. The native isolates collected were assessed on several attirbutes that may aid their biocontrol efficiancy by enhancing several desirable traits. A) The number of emerging IJs from a single G. mellonella last instar larvae that was infected with 50 IJs. B) CI scores presented for each isolate in G. mellonella host finding assays; statistical analysis is relative to the highest scoring isolate,

Chapter 3: Isolation of Native EPNs in Northern Ireland

WR14-1B. C) The percentrage of IJs that migrated to the outer zone in a dispersal assay were calculated for each isolate; statistical analysis is relative to the highest scoring isolate, W16-1B (one-way ANOVA). (* = P<0.05, **= P< 0.01, *** = P<0.001, **** = P<0.0001).

Table 4. Average results from laboratory assessments of attributes considered beneficial for biocontrol purposes. A ratio for the number of emerging IJs was created by dividing each average score with the highest scoring isolate (LM-4C). The average CI score is also presented for each strain. The average percentage of IJs that dispersed was transformed into a ratio and presented for each strain. All three ratios were then added to create a biocontrol score. Ratio IJs that Biocontrol Isolate Ratio Emerging IJs CI Score dispersed Score LM-2B 0.95 0.85 0.40 2.2 W16-1B 0.57 0.94 0.62 2.13 LM-1C 0.86 0.96 0.29 2.11 WR14-1B 0.52 1.00 0.57 2.09 LM-4C 1.00 0.73 0.32 2.05 M18-1B 0.79 0.56 0.58 1.93 LM-4A 0.49 0.67 0.48 1.64 LM-2A 0.38 0.58 0.46 1.42 LM-4B 0.50 0.56 0.26 1.32

The S. feltiae isolates collected from NI soil were assessed with laboratory assays, along with the two other S. feltiae strains already present in the laboratory; S. feltiae (gen) and 4cfmo. The time it took for each isolate to kill a single G. mellonella larvae were recorded at various IJ densities, and were analysed relative to the isolate achieving the fastest kill time for each IJ density (Fig 11). At a density of 100 IJs per G. mellonella, the LM-4B isolates killed the waxworms the quickest, and was significantly faster than other strain (Fig 11A. LM-4B: 33.0 ± 0.000 [LM-2B: 38.1 ± 0.781; P<0.01] [LM-4C: 42.3 ± 1.758, Sf (gen): 48.0 ± 1.732, 4cfmo: 40.2 ± 1.685; P<0.0001]). At 50 IJs per G. mellonella larvae, LM-4B again killed the insects

Chapter 3: Isolation of Native EPNs in Northern Ireland quicker than the other strains (Fig 11B. LM-4B: 34.5 ± 0.500 [LM-2A: 42.6 ± 2.358; P<0.01] [LM-2B: 43.5 ± 1.204; P<0.001] [LM-4C: 49.2 ± 1.497, Sf (gen): 51.0 ± 2.933, 4cfmo: 45.3 ± 2.809; P<0.0001]). Upon exposure to 10 IJs per G. mellonella larvae, the strain that achieved the fastest kill time was LM-4A (Fig 11C. LM-4A: 39.9 ± 1.100 [4cfmo: 48.9 ± 2.968; P<0.05] [LM-2B: 51.9 ± 2.283; P<0.001] [LM-2A: 54.0 ± 3.286, LM-4C: 67.5 ± 2.500, Sf (gen): 74.4 ± 1.400; P<0.0001]).

60 ****

)

(

t r

o 40 **

w x

a 20

m i T 0 B C A A B o C ) 4 1 4 2 2 4 n - - - - - fm - e M M M M M c M (g L L L L L 4 L f S 100 S. feltiae IJs per G. mellonella larvae

B ****

)

(

i l

a ** ***

t r

o 40

w x

a 20

m i T 0 B A C A B o C ) 4 4 1 2 2 4 n - - - - - fm - e M M M M M c M (g L L L L L 4 L f S 50 S. feltiae IJs per G. mellonella larvae

Chapter 3: Isolation of Native EPNs in Northern Ireland

C ****

)

(

l a

t 60 r

o * ***

m r

o 40

o 20

m i T 0 A B C o B A C ) 4 4 1 2 2 4 n - - - fm - - - e M M M c M M M (g L L L 4 L L L f S 10 S. feltiae IJs per G. mellonella larvae

Fig 11. The time for G. mellonella to succumb and die from EPN infection was recorded for each S. feltiae strain at varying IJ concentration; A) 100 IJs per insect. B) 50 IJs per insect. C) 10 IJs per insect. (* = P<0.05, **= P< 0.01, *** = P<0.001, **** = P<0.0001).

The time that the IJs took to travel through the soil matrix to find and kill G. mellonella larvae were recorded for each isolate. The fastest isolate was LM-4B, where they significantly outperformed all other isolates, with the exception of LM-4A (Fig 12. LM-4B: 55.0 ± 1.500 [LM-1C: 57.7 ± 2.000; P<0.05] [LM-2B: 64.3 ± 2.646, LM-2A: 72.3 ± 0.782, LM-4C: 77.7 ± 1.803, 4cfmo: 79.3 ± 0.527, Sf (gen): 83.7 ± 0.601; P<0.0001]). From the distance travelled, time taken to kill G. mellonella larvae (50 IJs / insect), and their time to kill the insects in the soils assay, their speed travelling through the soil matrix was calculated. The IJ isolates speed ranged from 0.411 – 0.723 cm / h, with 4cfmo being the slowest, and LM-4A being the fastest isolate (Table 5).

Chapter 3: Isolation of Native EPNs in Northern Ireland

) ****

h 90

(

y t

i 80

a t

r 70 o

M *

m r

o 50 w

x 40

a W

e 20

m i

T 10 0 B A C B A C o ) 4 4 1 2 2 4 n ------fm e M M M M M M c (g L L L L L L 4 f S 300 IJs, >14 cm through soil matrix to 3 G. mellonella larvae

Chapter 3: Isolation of Native EPNs in Northern Ireland

Table 5. The average time for each isolate in the soil assay and the kill time assay (50 IJs per insect) were used to deduce the time it took for the IJs to travel across the soil matrix to reach the insect (soil assay – kill time; distance = 14 cm) , and therefore the speed at which they travel (14 / Time travelling = cm/h). Soil Assay (h) Kill Time (h) Time Isolate Speed (cm/h) (± SEM) (± SEM) Traveling (h) 57.7 37.2 LM-1C 20.5 0.684 (± 0.667) (± 0.663) 72.3 42.6 LM-2A 29.7 0.471 (±0.782) (± 2.358) 64.3 43.5 LM-2B 20.8 0.672 (± 0.882) (± 1.204) 55.7 36.3 LM-4A 19.4 0.723 (± 0.727) (± 0.700) 55.0 34.5 LM-4B 20.5 0.683 (± 0.500) (± 0.500) 77.7 49.2 LM-4C 28.5 0.492 (± 0.601) (± 1.497) 83.7 51.0 Sf (gen) 32.7 0.429 (± 0.601) (± 2.933) 79.3 45.3 4cfmo 34.0 0.411 (± 0.527) (± 2.809)

Chapter 3: Isolation of Native EPNs in Northern Ireland

3.4 Discussion

Within Northern Ireland (NI), soil samples were taken across natural, undisturbed areas in order to collect and identify native EPN species. The isolation of native EPN species is necessary for their biocontrol use as they have adapted to the local climates, and are already likely to be pathogenic to the native insect pests. Sub-sites were chosen randomly unless the location provides a range of soil types and environments, in an attempt to enhance the biodiversity, a valuable resource, between EPN isolates. In total, one hundred and fifty three soil samples were taken from seventeen sites. From these samples, ten were positive with EPN infection (6.5 %) from five sites (29.4 %). The percentage of soil samples positive with EPNs in this study is similar to, or higher than, what has previously been recorded in the UK: Scotland (2.2 %; Boag et al., 1992), Irish coast (4.4 – 6.9 %; Griffin et al., 2005) and UK (3.5 %; Edmunds et al., 2018). Greater positive hit rates have been recorded in the Republic of Ireland (10.5 %; Griffin et al., 1991). Many EPN surveys conducted around the globe also have a low positive hit rate: Turkey (5.8 %; Kepenekci, 2002: 2.0 %; Hazir et al., 2003), Northern Spain (5.4 %; Campos-Herrera & Gutiérrez, 2008), South Africa (5.2 %; Hatting et al., 2009), Korea (4.6 %; Choo et al., 1995). Three sites during this survey harboured Heterorhabditis species IJs, which were collected from sandy-loam soil near seaside beaches i.e. Whiterocks Beach, Whitepark Bay and Murlough Beach. These findings seem to support the idea that Heterorhabditis spp. habituates, and is more prevalent in, coastal areas (Griffin et al., 1994). Samples were also taken from peat-loam soil in Murlough Beach which contained S. affine IJs, which could not be maintained under laboratory conditions in G. mellonella. Under laboratory conditions, S. affine were found to successfully reproduce and complete their life cycles in only around half of the G. mellonella larvae tested (Půža & Mráček, 2009). As such, G. mellonella may not be a suitable host for this species. Furthermore, S. affine is known to co-infect with S. kraussei, and this co-infection enables S. affine to greatly increase the number of G. mellonella that were successfully infected where progeny production took place, relative to single species infection (Půža & Mráček,

Chapter 3: Isolation of Native EPNs in Northern Ireland

2009). EPN behaviour and ecology outside of the laboratory is not fully understood, and co-infections between species may enhance survival for some species such as S. affine and S. kraussei. The laboratory insect host G. mellonella is also not a natural host for EPNs, therefore single species infections from S. affine may be limited to a narrow host range from their natural environment. Generally, UK soil surveys have shown Heterorhabditis spp. to be more prevalent in coastal sandy loam soil, and rarely found inland in peat loam soil; and vice versa for Steinernema spp. (Homininck & Briscoe, 1990; Griffin et al., 1991; Boag et al., 1992; Griffin et al., 1994; Gwynn & Richardson, 1996; Rolston et al., 2005). Three coastal sites (five in total) were positive for Heterorhabditis spp. in this study, isolated from sandy-loam soil. Steinernema affine was also collected from a coastal site; however the soil that harboured them was peat loam in composition, further back from the beach. The remaining six strains collected were from inland peat loam soil from Lagan Meadows and Belvoir Forest Park, which were later identified as S. feltiae. The location of these positive EPN sites corroborate the general pattern found of Heterorhabditis spp. being a coastal EPN, and Steinernema spp. being a more inland EPN. Three samples returned positive for S. feltiae IJs, taken from both Lagan Meadows and Belvoir Forest Park, isolated from open grassland and deciduous forest environments.

Intraspecific variation has been observed between EPN strains on the number of IJs developing and emerging from a single cadaver. Two S. feltiae strains, when maintained at 20 ᵒC, showed great variation in the number of emerging IJs per G. mellonella larvae; SN strain <90,000 and Argentina strain <50,000 (Grewal et al., 1994b). The natural S. feltiae isolates collected also showed a range of total emerging IJs numbers at room temperature, where LM-4C had the highest (74,500 per larvae) and LM-2A had the lowest number (28,667 per larvae). All isolates collected performed well in the G. mellonella finding assay (CI score: 0.56 – 1.00). The highest scoring isolate was WR14-1B; their IJs consistently migrated towards the positive zone of the host finding assay, and were very rarely found in the negative zone of the assay. Thereby achieving a perfect

Chapter 3: Isolation of Native EPNs in Northern Ireland positive CI score in most replicates. Cruiser species respond to host volatile cues with directional movement towards the stimulus, where ambusher species typically display less directional movement to volatile cues (Baiocchi & Dillman, 2015; Lewis et al., 1993). The Heterorhabditis isolates WR14-1B and W16-1B performed typically for a cruiser species, where almost all IJs exhibited directional movement towards live G. mellonella. Although the third Heterorhabditis isolate (H. downesi; M18-1B) achieved one of the poorest CI scores relative to the others, they still displayed a strong attraction to the insect volatiles. EPN distribution exhibits spatial heterogeneity, where populations show a patchy distribution and an uneven distribution and concentrations of individual species in an area (Stuart & Gaugler, 1994). Although the S. feltiae isolates were found in sites within close proximity to each other, they have likely all adapted while isolated from other populations in their own unique environment, soil type and host availability. As an intermediate ambush-cruiser, it could be expected to find variation in S. feltiae host finding capabilities between isolates as their host finding method is versatile and adapted to their own environment. This study showed consistent performance variation between the S. feltiae isolates (CI score: 0.56 - 0.96). However, each isolate did score highly in the G. mellonella finding assays, as they can adopt a cruising method of host finding (Baiocchi & Dillman, 2015). The three Heterorhabditis spp. isolates exhibited enhanced dispersal relative to the S. feltiae strains. By undertaking a cruiser method of host finding, Heterorhabditis spp. IJs actively search for their next host (Grewal et al., 1994a). It is, therefore, unsurprising that they outperformed the intermediate cruiser-ambusher species S. feltiae in the dispersal assays. Within the S. feltiae isolates, they show a range of dispersal ability from strain to strain. One of the key components of their biocontrol success is their ability to disperse in soil. H. bacteriophora displayed exceptional dispersal behaviour when assayed in soil with no source of volatile attraction, with some IJs travelling more than 60 cm in 240 hours (Bal et al., 2009). Ambusher species, such as S. carpocapsae, have a greater proportion of IJs remaining around their natal cadaver relative to a cruiser species such as H. bacteriophora, suggesting that they may respond more

Chapter 3: Isolation of Native EPNs in Northern Ireland strongly to conspecific dispersal signals (Bal & Grewal, 2015). These results suggest that cruiser species display greater dispersal behaviour relative to non-cruisers, and because of this may provide superior coverage and consistent protection throughout the test area. The S. feltiae isolates showed variation between their results; LM-4A and LM-2A performed the strongest, almost achieving scores similar to that of the Heterorhabditis spp. isolates. A biocontrol score was created from the emergence, host finding and dispersal results, all collated into one score in an attempt to calculate which isolate has the greatest potential for biocontrol purposes. The highest biocontrol score possible in this study is 3.0, the isolates that scored the highest were LM-2B (2.2), W16-1B (2.13) and LM-1C (2.11). The poorest score was achieved by LM-4B (1.32). These biocontrol scores will later be compared to their soil host finding results.

The S. feltiae natural isolates were then selected and tested against two other S. feltiae strains already available in the laboratory. The first was an Irish isolate called 4cfmo and the second was laboratory strain (gen), both of which have been cultured in G. mellonella for years. Each strain was then tested on their virulence against G. mellonella, where the time to kill a single larva at different IJ densities was measured. The kill time assays showed a similar pattern of isolate performance, regardless of the IJ density, in Petri dish assays; quickest G. mellonella mortality: LM-4B, LM-4A and LM-1C, slowest :LM-4C and Sf (gen). Soil G. mellonella finding assays showed that the isolates causing the quickest G. mellonella mortality, also outperformed the other isolates in the soil assay; LM-4B, LM-4A and LM- 1C. Both glass house and laboratory EPN soil trials have indicated that Petri dish killing assays may have some correlation with their biocontrol efficiency. Within EPN species, strains have shown variation in their virulence relative to each other. A strain of S. yirgalemense (HI) and H. bacteriophora (AEH) caused significantly more mortality to the red teff worm (Mentaxya ignicollis)in Petri dish assays, and provided more protection in glass house trials, relative to the other strains tested within their species (Hailu et al., 2018). The kill time assays revealed LM-4B and LM-4A to be the most virulent towards G. mellonella, where, later, they too

Chapter 3: Isolation of Native EPNs in Northern Ireland outperformed the other strains in the soil host finding assays; similarly to S. yirgalemense (HI) and H. bacteriophora (AEH) (Hailu et al., 2018). Virulence, host finding, reproductive capability and heat tolerance are known attributes to deteriorate for EPN strains during in vivo G. mellonella culture within the laboratory (Gaugler et al., 2006). The S. feltiae strain Sf (gen) consistently performed the poorest relative to the other isolates. Sf (gen) has been maintained in G. mellonella for the longest, which may have deteriorated their virulence over countless G. mellonella cultures. The second oldest laboratory cultured S. feltiae strain is 4cfmo, often being outperformed by the recently collected S. feltiae isolates in all kill time assays and soil host finding assay, supporting in vivo attribute deterioration. All S. feltiae strains caused 100 % mortality to G. mellonella, regardless of number of in vivo G. mellonella passages, which has seemingly only slowed down Sf (gen) and 4cfmo’s killing speed. All the strains tested caused 100 % G. mellonella mortality in the soil host finding assays. The most successful isolate in the soil host finding assay was LM-4B, where previously they performed the worst in the host finding and dispersal assays. The kill time assay results seem to mirror that of the soil host finding assay, where their virulence against G. mellonella reflected their soil trial results. Interestingly the host finding and dispersal assays had no reflection on S. feltiae’s performance in the soil host finding assay. The kill time assay results for the 50 IJs per insect was used alongside the soil host finding assay results to deduce a potential speed of movement through the soil matrix, which ranged from 0.41 – 0.72 cm / h for 4cfmo and LM-4A, respectively. The slowest nematodes that performed the worst in the soil host finding assay were both from the laboratory, and not natural isolates.

Interestingly, isolate LM-4B had the lowest biocontrol score, relative to the other natural S. feltiae strains, but achieved the quickest time when finding and killing G. mellonella larvae in the soil assay. LM-1C performed consistently well in the soil host finding assay and achieved a high biocontrol score, relative to other strains. On the other hand, the consistently poorest performing S. feltiae natural isolate was LM-2A. The

Chapter 3: Isolation of Native EPNs in Northern Ireland relationship between the isolated laboratory experiments and the soil host finding assay was not totally clear and present, however to fully evaluate this relationship, a field or glasshouse trial with insect pest problems must take place. This will help determine which attribute assessed within the laboratory correlates with greater biocontrol performance.

The collection of native EPN species in this study revealed that they were found at a similar hit rate as other EPN survey studies conducted in the UK. Many more samples would have been needed across Northern Ireland to determine their distribution across the country. The low hit rate may be affected by the other entomopathogenic organisms collected with the soil, which killed many of the baited larvae. Baiting each soil sample with a soil dwelling insect that is susceptible to EPN attack may decrease the large percentage of IJs that perished due to other pathogenic organisms. As per previous EPN survey findings, Heterorhabditis spp. are more commonly found around coastal areas whereas Steinernema spp. are found more inland. Behavioural studies conducted in the laboratory also support their host finding techniques, where Heterorhabditis isolates performed as cruisers, and S. feltiae isolates displayed a range of capabilities that could be associated with an ambusher or cruiser. Steinernema feltiae are a plastic EPN species as they show versatility regarding their host finding strategy, virulence and tolerance towards environmental changes. These qualities would make them excellent candidates for selective breeding projects. Of the natural isolates collected from Northern Ireland, the most promising candidates for biocontrol purposes would be LM-1C, LM-4A and LM-2B for the S. feltiae strains, and of the Heterorhabditis spp. isolates, W16-1B.

I’d like to thank Matthew Sturrock and Dr Ciaran McCoy for driving me to each beautiful site across Northern Ireland and Nicole Paul for helping me with my soil sample collecting.

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

CHAPTER 4: PHENOTYPIC AND TRANSCRIPTIONAL VARIATION IN STEINERNEMA CARPOCAPSAE

4.1 Introduction

RNA molecules are essential macromolecules that translate the genetic information of a cell into functional proteins (Chapeville et al., 1962; Grunberger et al., 1969). Gene expression is controlled by RNA molecules, and adapts in response to environmental and intercellular cues by switching on, switching off, upregulating and downregulating gene expression; an essential component of a living cell. RNA-sequencing protocols have enabled researchers to underpin the molecular characterization of a cell or organism at any one point (Wang et al., 2009). Most RNA-seq techniques do not read the RNA itself, instead the complimentary DNA (cDNA) sequences of the RNA are synthesised for sequencing analysis; this is due to the advancement in DNA sequencing technologies relative to RNA reading methods. High throughput sequencing techniques have been developed since the early 1990’s. Expressed sequence tag (EST) (Adams et al., 1991), Serial Analysis of Gene Expression (SAGE) (Velculescu et al., 1995), DNA microarray technology (Schena et al., 1995) and next generation sequencing (NGS) are biochemical methods that have been devised for high throughput sequencing. The Human Genome Project must be mentioned for the advancement in these technologies. Back in 1988, a committee from the U.S. National Academy of Sciences publicised the challenge of accomplishing a high-quality version of the full human genome, along with five other model species. The first genome to be fully sequenced was the bacterium Haemophilus influenza, in 1995 (Fleischmann et al., 1995). Other organisms, such the bacteria Escherichia coli (Blattner et al., 1997), closely followed by the nematode Caenorhabditis elegans (Press, 1998) also had their genomic sequences published. Further advancements proceeded with Drosophila melanogaster, its genome sequenced and published in the year 2000 (Adams et al., 2000). The first mammalian genome to be completed was for the mouse (Mus musculus) (Mouse Genome Sequencing Consortium et al., 2002); the human genome was declared complete the following year (National Human Genome Research Institute, 2003), hence completing the

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

goals of 1988. In order to excel these technologies, the National Human Genome Research Institute (NHGRI) offered a funding program back in 2004 to achieve a protocol that can sequence the human genome for less than $1000 within ten years. Significant advancement then took place with the birth of NGS technology, an umbrella term for many sequencing protocols that offer sequencing of entire genomes in a short amount of time. Illumina HiSeq technology was later to be the first to proclaim their ability of sequencing the entire human genome for under $1000 (Hayden, 2014). This was made possible by Illumina with the release of ten HiSeq X sequencing machines. These increased sequencing speed and efficiency by exploiting flow cells with billions of nanowells which increases the cluster density and monoclonality within each well. In addition, the polymerase enzymes used in the sequencing reaction is faster than its predecessors (http://www.illumina.com). In relative terms, this protocol reduces the cost of the Human Genome Project by 10000-fold when compared to the protocols available in 2004 (http:// www.genome.gov/sequencingcosts/). The Human Genome Project remains the largest collaborative biological project in existence (Tripp & Grueber, 2011). Currently, many powerful sequencing platforms are available for laboratories to create genome and transcriptome libraries. They offer a lot of data in a relatively short amount of time and detect novel transcripts and produce less background noise when compared to the aforementioned methods.

The molecules of interest in an RNA-seq study are generally the protein coding RNAs (mRNA) and a majority of long non-coding RNAs that make up <5% of a cells total RNA pool in eukaryotic cells (Blanco & Blanco, 2017; Chapeville et al., 1962; Grunberger et al., 1969). These coding RNAs are either removed from an RNA pool using oligo (dT) primers, or by removing the unwanted rRNA (80 – 90 % of total eukaryote cell RNA) from the pool. A pool of coding RNAs are either fragmented into smaller parts before being synthesised into cDNA, or RNA is converted to cDNA first and then fragmented (Nicholson, 2014). Post-fragmentation, adapter oligonucleotides are ligated onto both ends of the RNA library, often these 3’ and 5’ adapters differ to preserve strand directionality. A small PCR

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

amplification (8 - 12 cycles) of the cDNA library takes place as there is a detection limit on current sequencing machines. High throughput sequencing obtains short reads from one end of a cDNA fragment (single- end sequencing), or from both ends (paired-end sequencing) and uses these sequences to identify and map the reads to the transcriptome. In a study by Chhangawala et al. (2015), it was found that there was no substantial improvement to mapping quality (uniquely mapped reads) when using reads >50 bp. Although 100 bp, paired-end reads were shown to significantly improve the detection of splice junctions (Chhangawala et al., 2015). RNA-seq is a powerful tool that allows the characterisation of a transcriptome at any one time. Comparison studies using gene expression data can help identify genes responsible for certain phenotypes, and underpin the molecular basis of behaviours and characteristics.

This section will begin exploring insect volatile molecules, specifically those emitted by waxworm and mealworm larvae (Morris et al., 2017). The most abundant volatile emitted by waxworm larvae was found to be α-pinene (Morris et al., 2017). This organic compound is a bicyclic monoterpene that is considered to be the most abundant terpene found in nature. Plants biosynthesise this terpene as a primary defence against herbivory, although they do also emit it when they are not under attack (Ali et al., 2010). α-pinene has been found to be an attractant to devastating plant predators, such as bark beetles and the checkered beetle, Thanasimus dubius, although for some species, such as Ips avulsus, high levels of this turpentine are repellent (Billings, 1985). Insects that have ingested α- pinene can recycle it in synthesising their own pheromones, which are used for aggregation, dispersal and egg laying (Shi & Sun, 2010). Chemotaxis studies using α-pinene have shown that it is not very attractive to EPNs, however it does stimulate jumping behaviour in S. carpocapsae, suggesting that it may be associated with short range host finding (Hallem et al., 2011a). Waxworm larvae also emit tridecane, an alkane hydrocarbon

(CH3(CH2)11CH3) (Morris et al., 2017). Various species of stink bug (Family Pentatomidae) produce tridecane during both nymph and adult stages (Fucarino et al. 2004; Nixon et al., 2016). Tridecane is a major component

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

of a stink bug’s defensive fluid, and it has also been implicated in controlling their dispersal and aggregation behaviours (Todd, 1989; Krall et al., 1999). Tridecane is also an attractant to the stink bug’s predator, the minute pirate bug (Orius spp.) (Fraga et al., 2016). Nonanal is an aldehyde that occurs naturally in plants and animals, and was found to be emitted by both waxworms and mealworms (Morris et al., 2017). Humans and birds (pigeon and chicken) produce substantial quantities of nonanal, which

seems to be emitted synergistically with the respiratory by-product CO2 (Syed & Leal, 2009). Nonanal is attractive to blood feeding mosquitos (Culex spp.); this attraction is synergistically enhanced by carbon dioxide (Syed & Leal, 2009). This work suggested that host volatiles were important in insects identifying the ‘correct’ host species, and that they might also be responsible for seasonal host switches in mosquito feeding behaviour. Kissing bugs (Subfamily Triatominae) are also attracted to their hosts by nonanal (Guerenstein & Guerin, 2001). The most abundant volatile emitted by mealworms was decanal (aldehyde), which is also in the human odorant profile (also emitted by birds), and detected by mosquitos as a host specific cue (Syed & Leal, 2009). Decanal and nonanal are also involved in insect communication, for example being important components of pheromones used in aggregation behaviour of the common bed bug (Cimex lectularius) (Siljander et al., 2008). Chemotaxis assays have identified decanal and nonanal are chemoattractive to a range of EPNs (Laznik & Trdan, 2016). Potato tubers release both decanal and nonanal when under attack by insect herbivores, which is thought to attracts surrounding EPNs to the feeding site as a natural insecticide (Laznik & Trdan, 2016). While there was evidence of chemoattraction by EPNs, the chemoattraction was not particularly strong, with no chemotaxis index (CI) score greater than +0.35 (Laznik & Trdan, 2016).

EPN’s attraction to volatile molecules can be highly dependent on the temperature. For example, S. carpocapsae showed significant differences in their chemoattraction when maintained at 15, 20 or 25OC. Importantly, some of these molecules changed from being attractive to repulsive, based on temperature (Lee et al., 2016). This temperature dependent olfactory

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

plasticity may aid the IJ in finding its host when environmental conditions change, when the hosts’ volatile production itself changes.

Three S. carpocapsae strains will be assessed for their host finding capabilities (nictation, host finding, dispersal) and attributes that may aid their biocontrol efficiency (lipid storage, life span) or study (RNAi). Transcriptomic analysis using an RNA-seq platform will then be used to investigate the molecular basis that drives these host finding behaviours in S. carpocapsae. Furthermore, the attractiveness of insect volatiles identified by Morris et al., (2017) across the three S. carpocapsae strains; ALL, UK1 & Breton. 16 insect volatiles were available to purchase and test for this study.

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

4.2 Materials and Methods

EPN strains

The laboratory strain S. carpocapsae ALL, the British commercial strain (UK1) and the German commercial strain (BR) were used in this study.

Nictation Assay Micro-dirt chip assays were made from moulds according to Lee et al., (2015) with 3.5% dH₂O agar. IJs were transferred to a micro-dirt chip (nictation platform); 20 IJs per assay. Once the IJs could freely move on the agar, a timer was started. The numbers of nictating IJs were counted at 1, 2.5 and 5 minutes.

Life Span Assay 50 individual IJs were rinsed and suspended in 400 μl of PBS (1x) in a 24 well plate. Every three days, after the initial count, the IJs were observed using a stereo microscope and counted for the number of IJs that were moving and not straight and stiff, defined here as alive. The PBS suspension was replaced weekly to maintain a fresh environment for the IJs.

Oil red O Lipid Staining 0.5 ml of Oil red O dye (500 mg per 100 ml ethanol) was added to 1000 clean IJs. This was then incubated at 60 ᵒC for 20 min. Post incubation, the nematodes were left to settle at the bottom of their tube. The supernatant was then discarded and 1 ml of a water-glycine solution (1:1 ratio) was added to the stained worms. IJs were then transferred onto a microscope slide with a cover slide and viewed under Leica microscope.

RNAi The S. carpocapsae strains (ALL, BR & UK1) underwent RNAi treatment to examine for any intraspecific differences between their susceptibility to RNAi via ingestion of exogenous dsRNA. The chemosensory GPCR Sc-srsx-3 was targeted for RNAi knockdown, and the non endogenous control dsRNA

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

used was GFP. dsRNA was created (as previously described; Chapter Two Methods) for Sc-srsx-3 and GFP. For every replicate on each strain, 1000 S. carpocapsae were incubated in 50 µl PBS with dsRNA and 50 mM for 48 h in 5 mg / ml dsRNA / serotonin / PBS/ 23 ᵒC. Post dsRNA treatment, RNA is extracted and synthesised into cDNA, before quantitative analysis on a qPCR (as described previously).

Statistical analysis All statistical tests were performed using GraphPad Prism 6. The mean differences across S. carpocapsae strains with regards to their phenotypic assessments were analysed using a one-way ANOVA and a two-way ANOVA, and followed with a Fishers LSD post-hoc test. Analysis of sequencing data is following in the next section.

Volatile Assay Volatile attractants were made up fresh before each assay by making a 1M

solution in dimethyl sulfoxide. They were then diluted in ddH2O to achieve desired concentration. The control was dimethyl sulfoxide, diluted in

ddH2O; exactly like the volatile preparation. 1.5 % PBS agar in a 95 mm Petri dish served as the chemotaxis arena. The IJs used in this study were not older than < 3 days post initial emergence, from a mixed population of multiple cadavers. The nematodes were washed three times in fresh 1x PBS. 200 IJs were placed in the middle of the arena, with the lid off to allow the water suspension to evaporate away. Once the water evaporates, and the IJs can freely move, 1 μL of a 1 μM volatile solution was placed at the end of the positive zone, and a 1 μL control was placed on the opposite side (negative zone). The plates were sealed with parafilm and left in 23 ᵒC darkness for an hour. The numbers of worms found in both scoring zones are counted and a CI score is calculated.

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

RNA-Sequencing and Transcriptomics Total RNA was extracted from approximately 10,000 IJs, six biological replicates were collected per strains by Trizol method. The integrity of the extracted RNA was checked using gel electrophoresis, and was later quantified using Qubit RNA BR Assay Kit (Life Technologies). Libraries were generated by Genewiz using the TruSeq RNA Library Prep Kit v2 (Illumina) using a minimum of 1 μg of total RNA. Sequencing took place on an Illumina HiSeq 2500 sequencing system with 150 bp paired end reads. Adapter sequences were removed from the reads using Trimmomatic (Illumina adapter sequence trimming tool). Genomic data and annotations for S. carpocapsae were downloaded from WormBase Parasite. RNA-seq reads were aligned to the genome using STAR aligner v2.6 (RNA-Seq aligner: Dobin, 2013) and RSEM (transcript quantifier: Li & Dewey, 2011) was used to generate gene and isoform counts. Differential gene expression analysis took place on the raw read gene counts, using the DESeq2 R package DESeq2 v1.20.0 (Love et al., 2014). Differential isoform expression analysis took place using the R package EBSeq v1.20.0. Heatmaps were created using the ‘heatmap.2’ function found in the R package gplots v3.0.1.

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

4.3 Results

Behavioural S. carpocapsae strain UK1 exhibited a significant reduction in their nictation phenotype, relative to ALL and Breton strain (Fig 13A. UK1: 2.3% ± 0.99, ALL: 26.5% ± 3.80, Breton: 27.7% ± 3.70. P<0.0001). A significantly greater ratio of Breton IJs migrated towards four live waxworms in host finding assays relative to ALL and UK1 strain (Fig 13B. BR: 0.88 ± 0.009, ALL: 0.42 ± 0.059 & UK1: 0.31 ± 0.077. P<0.0001). Mealworm larvae host finding assays revealed that Breton strain had a significantly higher chemotaxis index score relative to ALL strain only (Fig 13C. BR: 0.65 ± 0.060 & ALL: 0.40 ± 0.165. P<0.05), no other differences observed. Dispersal assays revealed that a greater percentage of the UK1 strain dispersed to the outer zones relative to ALL strain (Fig 13D. UK1: 51.0% ± 1.924 & ALL: 40.0% ± 5.128. P<0.05), and Bretons score is not statistically different to ALL and UK1. Freshly emerging ALL strain IJs had significantly larger lipid stores relative to the other two strains (Fig 13E. ALL: 90.7% ± 1.2, UK1: 72.5% ± 2.2 & BR: 68.7% ± 2.1. P<0.01). Incubation of S. carpocapsae strains in 5 mg / ml dsRNA and 50 mM serotonin for 48 h triggered significant knockdown in ALL strain only for the gene target Sc-srsx-3 (0.46 ±0.03, P<0.01) (Fig 13F). The percentage of living individual IJs were counted every 3-4 days for all the S. carpocapsae strains, freshly emerging (3 day) ALL strain IJs had a significantly higher percentage of alive worms than the other two strains (Fig 13G. ALL: 99.75% ± 0.24, UK1: 89.71% ± 1.24 & BR: 90.01% ± 2.78. P<0.01).

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

E 100 **

stain (%) stain 40

Body surface area with with +tive areasurface Body 0

F 2

1.5 ** 1

0.5 Knockdown Ratio Knockdown

0 sc-srsx-3 control sc-srsx-3 control sc-srsx-3 control ALL UK1 BR

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

G 100

Percentage of Alive IJs (%) IJs Alive of Percentage 25 ALL Breton UK1

0 3 10 18 24 30 36 42 48 54 60 66 72 78 84 90 96 102 108 114 120 Days 50 IJs Suspended in 400 μL 1x PBS, 23 ᵒC Darkness

Fig 13. Behavioural analysis of S. carpocapsae strain host finding behaviours. A) Percentage of worms nictating at time points 1, 2.5 and 5 minutes post addition to micro-dirt nictating platform (plus trendline from time pint 1 and 5 minutes) (n = 10,± SEM). B) Chemotaxis index scores represent S. carpocapsae strain attractiveness to four live waxworms in a host finding assay (n = 5, ± SEM). C) IJ attractiveness to four live mealworm larvae. (CI score of +0.5 = 75% attraction) (n = 5, ± SEM). D) Dispersal. (* = P<0.05, ** = P< 0.01, **** = P<0.0001) (n = 5, ± SEM). E) Oil Red O image analysis using ImageJ for percentage body surface area with positive red stain for freshly emerged IJs (<3 days) (n = 5, ± SEM). F) Strain susceptibility to Sc-srsx-3 and non-endogenous RNAi gene suppression using 5 mg / ml dsRNA, 50mM serotonin, 48h at 23⁰C darkness (ALL & BR, n = 3; UK1, n = 1, ± SEM) . G) The percentage of alive IJs (moving and not straight as a pencil) for each strain observed over 120 days (n = 3, ± SEM).

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

RNA-Seq Sequencing results identified a total of 28313 genes that were mapped to the S. carpocapsae genome.

Variant Nictation Phenotype Eight Sc-flp genes were significantly DE between low nictating and high nictating strains; UK1 vs ALL & Breton (P<0.05) based on their log2 fold change (Fig 14A). Sc-flp-12 & sc-flp-14 were significantly upregulated in UK1, relative to the high nictating strains (Log2fold change of ALL = +0.81 & BR = +0.58: ALL = +0.50 & Breton = +0.30, respectively. P<0.0001) and two exhibited significant downregulation; sc-flp-5 & sc-flp-7 (Log2fold change of ALL = -0.35 & BR = -0.44: ALL = -0.37 & Breton = -0.60, respectively. P<0.0001. Fig 15A). Eleven Sc-nlp genes were differentially expressed between low nictating and high nictating strains based on their log2 fold change (P<0.05) (Fig 15B). Sc-nlp-2, sc-nlp-9 and sc-nlp-36 were significantly upregulated in UK1 strain when compared to the high nictating strains (Log2fold change of ALL = +0.53 & BR = +0.67: ALL = +0.40 & Breton = +0.38: ALL = +3.09 & Breton = +4.09, respectively. P<0.0001) (Fig 15B-C). Seven GPCR genes were either significantly upregulated or downregulated between low and high nictating strains; UK1 vs ALL & Breton (P<0.05) based on their log2fold change (Fig 14C). The genes that exhibited the most significant differences (P<0.0001) between nictating groups were all very lowly expressed (<10 normalised expression values): Sc-seb-3, Sc-npr-5, Sc- srt-62 and Sc-srsx-21i (Log2fold change of ALL = +1.99 & BR = +1.91: ALL = +0.47 & Breton = +0.51: ALL = +4.81 & BR = +4.81: ALL = -0.98 & Breton = - 1.30, respectively. P<0.0001. Fig 15D). 13 GCRs were differentially expressed between varying nictating phenotypes (P<0.05) (Fig 14D). Sc-odr- 8 was significantly upregulated in UK1 strain, relative to ALL & BR (Log2fold change of ALL = +0.16 & BR = +0.38, respectively. P<0.0001) (Fig 15F). DE analysis between nictating groups revealed eight Sc-daf genes to be DE (P<0.05) (Fig 14E). UK1 strain expressed two Sc-daf genes significantly more than ALL and Breton; sc-daf-2 and sc-daf-10 (Log2fold change of ALL = 0.61 & BR = 0.90: ALL = 1.53 & Breton = 1.15, respectively. P<0.0001. Fig 15G). Furthermore, two Sc-daf genes were downregulated in UK1 strain;

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

sc-daf-1 and sc-daf-7 (Log2fold change of ALL = -0.16 & BR = -0.65: ALL = - 0.74 & Breton = -1.18, respectively. P<0.0001. Fig 15G-H).

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Fig 14. Comparative analysis of S. carpocapsae neuropeptide, GPCR and daf gene expression with regards to nictating phenotypes; UK1 vs ALL and Breton strain. DESeq2 calculated each genes log2fold change relative to the other strains, and are presented in heatmaps. A) FMRFamide-like peptide (FLP). B) Neuropeptide-like proteins (NLP). C) G protein-coupled receptors (GPCRs). D) Guanylyl cyclase receptors (GCR). E) Abnormal DAuer Formation genes: daf. (* = P<0.05, **= P< 0.01, *** = P<0.001, **** = P<0.0001).

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

A 5000 4500 4000 3500 3000 ALL 2500 UK1 2000 1500 BR 1000

Normalised Normalised expression value 500 0 Sc-flp-5 Sc-flp-7 Sc-flp-12 Sc-flp-14

B 2000 1800 1600 1400 1200 ALL 1000 UK1 800 600 BR 400

Normalised Normalised expression value 200 0 Sc-nlp-2 Sc-nlp-9

C 80

70 60 50 ALL 40 UK1 30 BR 20

Normalised Normalised expression value 10 0 Sc-nlp-36

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

D 10 9 8 7 6 ALL 5 UK1 4 3 BR 2

Normalised Normalised expression value 1 0 Sc-npr-5 Sc-srt-62 Sc-srsx-21i

E 160

140 120 100 ALL 80 UK1 60 BR 40

Normalised Normalised expression value 20 0 Sc-seb-3

F 900

800 700 600 500 ALL 400 UK1 300 BR 200 Normalised Normalised expression value 100 0 Sc-odr-8

100

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

G 1200

1000

800 ALL 600 UK1 400 BR

Normalised Normalised expression value 200

0 Sc-daf-2 Sc-daf-10 Sc-daf-7

H 7000

6000

5000

4000 ALL UK1 3000 BR 2000

Normalised Normalised expression value 1000

0 Sc-daf-1

Fig 15. Normalised expression values presented in an expression plot for differentially expressed neuropeptide, GPCR and Sc-daf genes between nictating groups; UK1 vs ALL and Breton (P<0.0001). A) FMRFamide-like peptides. B-C) Neuropeptide-like proteins. D- E) G protein-coupled receptors (GPCRs). F) Guanylyl cyclase receptors (GCR). G-H) Abnormal DAuer Formation genes: daf. (P<0.0001).

Variant Waxworm Finding Phenotype Eight Sc-flp genes were DE between high host finding (host finding) and the low host finding strains; Breton vs ALL & UK1 (P<0.05) based on their log2 fold change (Fig 16A). Sc-flp-5, Sc-flp-7 & Sc-flp-33 were significantly upregulated in Breton strain, relative to the low host finding strains (Log2fold change of ALL = +0.36 & UK1 = +0.43933: ALL = +0.37 & UK1 = +0.60: ALL = +0.22 & Breton = +0.53, respectively. P<0.0001) (Fig 17A). Five Sc-nlp genes were differentially expressed between high host finding and low host finding strains based on their log2 fold change (P<0.05) (Fig 16B).

101

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Sc-nlp-3 & Sc-calcitonin-like-peptide-a were significantly upregulated in Breton strain when compared to the low host finding strains (Log2fold change of ALL = +0.53 & UK1 = +0.84: ALL = +0.63 & Breton = +0.75, respectively. P<0.0001) (Fig 17B). 26 GPCR genes were either significantly upregulated or downregulated between host finding groups; BR vs ALL & UK1 (P<0.05) based on their log2fold change (Fig 16C). Sc-srsx-25v, Sc-srsx- 3ii, Sc-srsx-25vi, Sc-srsx-22i, Sc-srsx-33ii, Sc-srsx-15ii, Sc-srsx-25vii, Sc-mth-2, Sc-rhodopsin-like-1, Sc-srsx-24ii & Sc-rhodopsin-like-2 exhibited large differential expression between Breton, and the low host finding strains (seven of these Sc-GPCRs showed a Log2fold change value ranging from ±2- 6.65 for the comparison test against ALL and UK1) (P<0.0001) (Fig 17C-D). Four GCRs were differentially expressed between varying host finding phenotypes (P<0.05) (Fig 16D). Breton strain’s expression of sc-odr-8 was significantly downregulated relative to ALL & UK1 (Log2fold change of ALL = -0.23 & BR = -0.38, respectively. P<0.0001) (Fig 17E). Breton strain had eight Sc-daf genes that were DE relative to ALL and UK1 (P<0.05) (Fig 16E). Upregulation of two of these genes in Breton strain was observed: sc-daf-1 and Sc-daf-19 (Log2fold change of ALL = 0.49 & UK1 = 0.65: ALL = 0.25 & Breton = 0.41, respectively. P<0.0001) (Fig 17G-H). Two Sc-daf genes were downregulated in Breton strain relative to ALL and UK1; Sc-daf-2 and Sc- daf-31 (Log2fold change of ALL = -0.28 & UK1 = -0.90: ALL = -0.48 & Breton = -0.62, respectively. P<0.0001) (Fig 17G).

102

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

103

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

104

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

105

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

106

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Fig 16. Comparative analysis of S. carpocapsae neuropeptide, GPCR and daf gene expression with regards to their host finding phenotypes; Breton vs ALL and UK1 strain. DESeq2 calculated each genes log2fold change relative to the other strains, and are presented in heatmaps. A) FMRFamide- like peptide (FLP). B) Neuropeptide-like proteins (NLP). C) G protein-coupled receptors (GPCRs). D) Guanylyl cyclase receptors (GCR). E) Abnormal DAuer Formation genes: daf. (* = P<0.05, ** = P< 0.01, *** = P<0.001, **** = P<0.0001).

107

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

A 1800 1600 1400 1200 1000 ALL 800 UK1 600 BR 400

Normalised Normalised expression value 200 0 Sc-flp-5 Sc-flp-7 Sc-flp-33

400

B 350 300

250 ALL 200 UK1 150 BR 100

50 Normalised Normalised expression value 0 Sc-nlp-3 calcitonin-like-peptide-a

C 80 70 60 50 40 30 ALL 20 UK1 10 BR

Normalised Normalised expression values 0

108

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

D 900

800 700 600 500 ALL 400 UK1 300 BR 200

Normalised Normalised expression value 100 0 Sc-mth-2 Sc-rhodopsin-like-1

E 900

800 700 600 500 ALL 400 UK1 300 BR 200

Normalised Normalised expression value 100 0 Sc-odr-8

F 7000

6000

5000

4000 ALL

3000 UK1 BR 2000

Normalised expression Normalised expression value 1000

0 Sc-daf-1 Sc-daf-19

109

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

G 1200

1000

800 ALL 600 UK1 400 BR

200 Normalised Normalised expression value

0 Sc-daf-31 Sc-daf-2

Fig 17. Normalised expression values presented in an expression plot for differentially expressed neuropeptide, GPCR and Sc-daf gene expression between host finding groups; Breton vs ALL and UK1. A) FMRFamide-like peptides. B) Neuropeptide-like proteins. C-D) G protein-coupled receptors (GPCRs). E) Guanylyl cyclase receptors (GCR). F-G) Abnormal DAuer Formation genes: daf. (P<0.0001).

Variant Lipid Stores & RNAi Susceptibility

Seven S. carpocapsae RNAi associated genes were DE when ALL is compared with Breton and UK1 strain (P<0.05) based on their log2 fold change (Fig 18A). Three of these genes showed significant upregulation in ALL strain; sc-alg-3, sc-hrde-1 & sc-wago-5 (Log2fold change of Breton = +0.51 & UK1 = +0.10: Breton = +0.91 & UK1 = +0.16: Breton = +0.53 & UK1 = +0.14, respectively. P<0.0001) (Fig 18D). DE was observed between ALL strain, relative to UK1 and BR for genes associated with lipid metabolism (P<0.05) (Fig 18B). Of these genes, Sc-asm-2, sc-acl-12 & sc-acl-2 were highly DE (Log2fold change of Breton = -0.75 & UK1 = -1.07: Breton = -0.26 & UK1 = -0.395787: Breton = +1.16 & UK1 = +1.0467, respectively. P<0.0001) (Fig 18E). Interestingly only three Sc-daf genes were DE when ALL strain was assessed against the other strains (P<0.05) (Fig 18C). A large significant downregulation was observed in ALL strain for Sc-daf-10 (Log2fold change of Breton = -0.38 & UK1 = -1.53, respectively. P<0.0001) (Fig 18F).

110

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

111

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

112

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

D 700

600

500

400 ALL UK1 300 BR

200 Normalised Normalised expression value 100

0 Sc-alg-3 Sc-hrde-1 Sc-wago-5

113

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

E 600

500

400 ALL 300 UK1

200 BR

Normalised Normalised expression value 100

0 Sc-asm-2 Sc-acl-12 Sc-acl-2

F 700

600

500

400 ALL UK1 300 BR 200

Normalised Normalised expression value 100

0 Sc-daf-10

Fig 18. S. carpocapsae strains revealed to be differentially susceptible to sc-srsx-3 gene knockdown by method of a 5 mg / ml dsRNA soak for 48 hours. Genes predicted to be associated with S. carpocapsae’s RNAi pathway were collected from Morris et al., 2017. These genes were examined for differential expression between the S. carpocapsae strains, along with their lipid metabolising associated genes, and Sc-daf genes. A) Knockdown ratios of sc-srsx-3 and control GFP dsRNA for each strain: 3 reps for ALL and Breton, a single rep for UK1. B) Heatmap presenting the log2fold changes of genes associated with Sc-RNAi: DESeq2 results for Breton and UK1 relative to ALL. C) DESeq2 results for lipid metabolising (associated) genes for Breton and UK1 relative to ALL. D) Expression plot revealing the normalised expression values for differentially expressed Sc- RNAi genes: ALL vs Breton and UK1 (P<0.0001). E) Expression plot revealing the normalised expression values for differentially expressed Sc-lipid metabolising genes: ALL vs Breton and UK1 (P<0.0001). F) Abnormal DAuer Formation genes: daf (P<0.0001). (* = P<0.05, **= P< 0.01, *** = P<0.001, **** = P<0.0001).

114

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Isoform Analysis EBSeq is an R package that tests for DE between isoform expressions between multiple conditions following the Bayesian inference method. EBSeq analysis does not output p-values and Log2fold changes, instead they calculate the posterior probability that isoforms are differentially expressed (PPDE), and categorise them into descriptive patterns that represent where the differential expression lies between conditions. The PPDE values range from 0-1, where a value of 1 represents differential expression. Controlled under a false discovery rate (FDR) of 5%, PPDE values ranging from 0.95-1 are considered significantly DE. The number of DE patterns is determined by the number of conditions being tested, for three experimental conditions, five patterns are possible. Pattern one represents no DE isoforms between conditions, pattern two shows Bretons transcript is DE to ALL and UK1s, and so on (Table 1).The transcript is then mapped (MAP) to a described pattern.

Table 6. EBSeq possible expression patterns for DE isoforms across three conditions; ALL, UK1 & Breton. ALL UK1 BR

Pattern1 1 1 1 Pattern2 1 1 2 Pattern3 1 2 1 Pattern4 1 2 2 Pattern5 1 2 3

The DE genes of interest from DESeq analysis were then analysed for DE isoforms. Two returned that had multiple transcripts for a gene; sc-seb-3 & sc-daf-19. The predicted S. carpocapsae seb-3 GPCR has two transcripts, both of which were mapped to pattern three: DE was observed between UK1 vs ALL and Breton. The PPDE for transcript one was 0.72, which failed to fall under our target FDR, therefore does not show significant differences (Fig 19A). Transcript two however scored a PPDE of 1, suggesting that transcript two was responsible for the DE reported by

115

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

DESeq for sc-seb-3. No significant isoform differential expression was found for sc-daf-19 (PPDE <0.95) (Fig 19B). Therefore, DE was only observed when the normalised expression values for each splice variant were pooled together, highlighting the importance of isoform analysis in RNA-seq studies.

A 100 s 90

70 I 60 ALL n 50 UK1 40 s BR e 30

c Normalised expression value 20 t 10 0 Sc-seb-3.t1 Sc-seb-3.t2 V B 1000 o

900 I 800 n 700 600 s ALL 500 e UK1 400 BR c 300

t 200 Normalised Normalised expression value 100

0 V Sc-daf-19.t1 Sc-daf-19.t2 Sc-daf-19.t3

oFig 19. EBSeq isoform analysis. A) Sc-seb-3 has two transcripts, their normalised lexpression values are presented in a chart. B) Sc-daf-19; three transcripts. ‘s’ arepresents significant differences in isoform expression between strains. t

116

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Insect Volatiles A Two-way ANOVA analysed for differential attraction of single synthetic insect volatiles across three strains, and their attractiveness relative to live G. mellonella host finding within their strain (Fig 20A-B). Any individual insect volatile that scored in the range of the largest and smallest CI score for G. mellonella host finding were defined as highly attractive; +0.88 (BR) to +0.30 (UK1). Five volatiles showed to be highly attractive to at least one strain (Table 7). ALL and Breton strain were highly attracted to α-pinene; + 0.57 (P> 0.05) and +0.47 (P<0.05), respectively. Nonanal only proved to be highly attractive to ALL strain (CI: +0.69; P>0.05), their CI score surpassed that of G. mellonella attraction. UK1 and Breton IJs showed high attraction to pentadecanoic acid (CI: +0.65; P>0.05, and +0.38; P<0.01, respectively). Nonanoic acid was only highly attractive to UK1 strain (CI: +0.60; P>0.05), and conversely, decanoic acid was only highly attractive to ALL and Breton strain (CI: +0.61; P>0.05, and +0.39; P<0.01), respectively). Interestingly, not one volatile proved to be highly attractive across all S. carpocapsae strains (Fig 20A-B)).

117

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

A Chemotaxis Index Score -0.5 0 0.5 1

Waxworm

Mealworm

Decanal

Alpha Pinene * Nonanal

Palmitoleic Acid

Pentadecanoic Acid **

1-Tridecanol ALL

UK1 1-Hexadecanol Breton

Stearic Acid Attractant Attractant Nonanoic Acid

Myristic Acid

Squalene

Dodecanoic Acid

Tridecane

Heptadecanoic Acid

Hexanoic Acid

Decanoic Acid **

118

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Table 7. Waxworm attraction across S. carpocapsae strains ranged from a CI score of +0.30 (UK) to +0.88 (BR). Volatile attraction, with a CI score falling within this range are presented here with their average CI score and P values, relative to their strains waxworm CI score. ( - = did not fall in range. * = P<0.05, ** = P< 0.01). Volatiles ALL UK BR α-pinene + 0.570 - +0.473 * Nonanal +0.694 - - Pentadecanoic Acid - +0.645 +0.378 ** Nonanoic Acid +0.596 - Decanoic Acid +0.609 - +0.394 **

119

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

4.4 Discussion

Interestingly, the initial behavioural assessments have revealed some consistent strain specific divergences in S. carpocapsae host finding behaviours.

Parasitic nematodes in their IJ stage are the only members with the ability to nictate, which is similarly found in the C. elegans dauer stage. Nictation is performed by C. elegans to enhance their contact with a passing organism (usually insects) for phoretic purposes (Castelletto et al., 2014; Lee et al., 2012). The ability of C. elegans dauer phoretic ability was investigated using Drosophila melanogaster as available transportation. In the presence of earthworms (Lumbric terrestris & Aporrectodea trapezoids), S. carpocapsae IJs exhibited enhanced dispersal, travelling further, deeper and higher through the soil attached to the surface of the earthworms or by surviving a passage through the earthworms digestive system(Shapiro et al., 1993). Once free, they remain alive and infective (Shapiro et al., 1993). Nematode interactions with larger organisms are extremely common; these close relationships seem to have given rise to nematode parasites. Lee et al., (2012) presented evidence of their ability to use larger organisms for phoretic purposes, but they also found a C. elegans strain that did not exhibit this ability. S. carpocapsae also uses larger organisms for phoretic purposes. During the nictation assays, it was clear that UK1 strain had little to no ability to perform this host finding behaviour, while the remaining strains exhibited a steady increase in nictating individuals during the allocated time (Fig 1A). UK1’s ability to perform nictation has seemingly deteriorated from its ancestor, or conversely it may be a result of natural selection. Mechanisms of nictation deterioration will be investigated in the following section.

As mentioned previously, the strains used in this study were cultured in vivo in last instar G. mellonella larvae. An investigation took place into how this method of rearing in vivo affects S. carpocapsae’s ability to nictate.

120

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Typically, in vivo S. carpocapsae culturing methods use G. mellonella larvae as their hosts, however it has been shown that with each cycle through these larvae (at 25 ⁰C) resulted in the deterioration of the progeny IJs ability to nictate, consistently across the five strains tested, relative to control (Bilgrami et al., 2006). All three strains used in this study were maintained in G. mellonella larvae, however, UK1 and Breton strain are commercial strains that have been reared in vitro before reaching the laboratory. Although it is unclear how these strains would perform in the nictation assay before in lab rearing, this transition may have had an adverse effect on their nictating abilities, especially for UK1 strain.

Nictation behaviour is often initiated or influenced by environmental cues perceived by nematodes in the form of olfactory and mechanosensory cues. Before Ancylostoma caninum infective larvae initiate nictation they must first sense the presence of a host dog; an increase in CO₂ levels, temperature, humidity and vibrations on the substrate (Granzer and Haas, 1991). In this case, nictation behaviour is used to enhance the IJs contact with a dog’s fur before infection. Failure to perceive a potential host would prevent this nematode from beginning nictation, and therefore attaching to a host. Host volatile cues have also been found to influence S. carpocapsae’s performance of nictation. Upon exposure to live G. mellonella volatiles, these IJs often increased their rate of nictation, waving their anterior more rapidly than before (Morris et al., 2017). However, UK1 strains almost inability to nictate must be independent of chemosensation, as the host finding data for this strain suggests they do perceive host associated cues.

Nictation behaviour is S. carpocapsae’s primary host finding behaviour. The nictation assay revealed that the IJs initiate this behaviour as soon as possible, even without insect specific cues. During the assays, vibrations on the work space were controlled as much as possible, and a mask was worn to avoid breathing on the IJs. Another, unknown cue may have initiated nictation for ALL and Breton strain, or they do initiate nictation without any

121

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

host cues, unlike Ancylostoma caninum (Granzer and Haas, 1991). Therefore, it is difficult to conclude if their immediate commencement of this behaviour is a triggered response or an instinctual initiation.

The dauer stages of non-parasitic nematodes are often associated and compared to the IJ stage of parasitic nematodes. Dauer formation is regulated heavily by the abnormal dauer formation genes (daf) in C. elegans; currently there are 34 known members (WormBase, 2018). These genes play many important roles during C. elegans development, and defects in these genes often result in partial dauer formation (Albert et al., 1988; Antebi et al., 2000; Vowels & Thomas, 1992). Partial dauer formation is also observed in Pristionchus pacificus. Naturally occurring P. pacificus strains have been isolated that exhibit an inability to perform nictation (strain: tu427 and tu426). Within their dauer populations there where high numbers of partial dauers, which may suggest they express daf genes differently to closely related nictating strains (Brown et al., 2011). Sc-daf genes have revealed to be DE in UK1 strain, possibly as a result of generations of reproductive isolation in vitro on a commercial scale, leading to a partial IJ formation, in turn resulting in nictation inhibition.

An in depth study discovered that FLP-14 signalling on the peptidergic motorneuron named RID, regulates and sustains forward movement in C. elegans; acting as a positive modulator for this behaviour (Lim et al., 2016). FLP-14 signalling on the RID neuron is conserved in the parasitic nematode Ascaris suum where the sequence of the neuropeptide is identical, and expressed on an architecturally similar neuron with location conservation relative to C. elegans. Gene suppression studies on M. incognita have revealed that a transcript reduction of 40 % for Mi-flp-14 results in a significant reduction of infective J2s finding a host and successfully invading it (Papolu et al., 2013). Interestingly UK1 strain had elevated levels of Sc- flp-14 relative to ALL and Breton. In terms of their nictation behaviours, high expression of this neuropeptide may influence their decision making to perform nictation, programming the IJs to remain crawling instead. In

122

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

situ hybridisation studies revealed that Globodera pallida gene orthologues to flp-14, along with flp-12, are expressed on motor neurons, and silencing these genes revealed obvious harmful phenotypes to their locomotory behaviour: twitching and paralysis (Kimber et al., 2007). Meloidogyne graminicola highly expresses Mg-flp-7 in its infective J2 stage, relative to other life stages; this study also revealed the same expression pattern for Mg-flp-12 and Mg-flp-14 (Kumari et al., 2017). The knockdown of these genes, along with many other Mg-flp genes tested had detrimental effects on their host invasion ability. Mg-flp-7 is expressed on interneurons (Kumari et al., 2017), where they relay chemosensory or mechanosensory information that contributed to host penetration, or it may have locomotory hindering effects as seen for Gp-flp-12 and Gp-flp14. Differential expression analysis revealed that UK1 strain expressed lower levels of Sc-flp-7 relative to the high nictating strains. However, it is still unclear how flp-7 and their identified orthologues have these aberrant effects upon gene silencing. In opposition, Breton strain showed enhanced levels of flp-7 relative to ALL and UK1, which may support the role flp-7 undertakes with regards to regulating locomotory behaviour. Further functional studies on Sc-flp-7 would need to take place on the S. carpocapsae strains with gene suppression protocols to see what effects this has on their locomotory, host finding and nictating abilities. The nlps are a large neuropeptide family with diverse functions, many of which are signalling peptides housed on chemosensory neurons, regulating a variety of behaviours (Nathoo et al., 2001; Li, 2006). UK1 strain expressed Sc-nlp- 36 much more greatly than ALL and Breton strain (Log2fold change 3.1 & 4.1). In C. elegans, nlp-36 GFP fusion expression has localised this neuropeptide to the intestine, and cells in both the head and tail of the worm, where this gene is regulated by temperature (van der Linden et al., 2010). Its rhythmic expression is dependent on a cyclic nucleotide-gated channel subunit gene called tax-2, which is localised to sensory neurons, including the thermosensory neuron AFD (Coburn & Bargmann, 1996). It is curious that UK1 had such elevated levels of Sc-nlp-36, as all the strains used were stored in the same conditions. Therefore, it is difficult to conclude its effects on UK1 strains nictation behaviour. Nematode

123

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

receptors have shown sequence and functional similarities to both mammalian and insect receptors. A characterised receptor in C. elegans named seb-3 is closely related to the mammalian CRF (corticotropin- releasing factor) receptors which are involved with response pathways associated with stress and infection; such as ethanol response (Jee et al., 2012). UK1 strain had greater expression levels of Sc-seb-3, relative to other strains, which may indicate population wide health issues or a higher susceptibility to an immune response. Interestingly, EBSeq isoform analysis revealed that Sc-seb-3 had two splice variants. The first isoform, Sc-seb- 3.t1, did not show any statistical differences in expression across strains. The DE found in the DESeq results were achieved by the second transcript, Sc-seb-3.t2, where UK1 strain expressed this isoform greatly relative to ALL and Breton strain. EBSeq analysis is curious, and provides greater insight into RNA-seq data. GPCR isoforms have been found to significantly differ in their affinity towards the same ligand (Janssen et al., 2008). Upon exposure to organobromine (a toxic organohalogen), C. elegans alters its expression of the receptor srt-69, however it is still unclear what role this receptor undertakes during this response to its toxic environment (Saul et al., 2014). Further study is required to determine whether the DE neuropeptide and GCPR genes play a role in almost inhibiting nictation for UK1 strain. In the case that they have no effect, it may well indicate that their inability to nictate lies with development defect, possibly due to their reproductive isolation during commercial culture.

Silencing or suppressing daf genes result in various interesting phenotypes. Nictating strains ALL and Breton both showed similar levels of Sc-daf-2, where UK1 strain had elevated expression levels for this gene. Studies investigating the function of daf-2 signalling have revealed it to be a nictation suppressor, as their mutants show a significant increase in the number of individuals nictating, relative to wild type (Lee et al., 2017). Furthermore, Sc-daf-7 was downregulated in UK1 strain relative to the high nictating strains. In the same study by Lee et al., (2017), they discovered that the expression levels of daf-7 positively correlated with the ratio of nictating nematodes i.e. lower expression, less nictation. The DE observed

124

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

in the present work seems to corroborate with this study, as elevated levels of the nictation suppressor Sc-daf-2, and lower levels of Sc-daf-7 may play a significant role in negatively impacting nictation for UK1 strain.

UK1 strains have exhibited almost an inability to perform their primary host finding behaviour. Transcriptome analysis have revealed some subtle differences in their neuropeptide and GCPR expression levels, relative to the nictating strain, ALL and Breton. For this reason, it would be difficult to conclude they would be a major contributor to the nictating phenotype. Interestingly, the abnormal dauer formation (daf) genes in S. carpocapsae may give some insight into genes regulating nictation. The findings in this study seems to be in line with what has been previously found in C. elegans with regards to daf-2 and daf-7 impact on nictation behaviour (Lee et al., 2017). The ability to perform nictation may therefore lie with development, through genes such as daf, rather than neuropeptide signalling.

The host finding assay in this work assessed the chemoattraction of the S. carpocapsae IJs towards live G. mellonella and T. molitor insects. Breton strain exhibited heightened G. mellonella finding relative to ALL and UK1 strain, according to their CI score. Ambusher EPN species, such as S. carpocapsae have shown to perform more poorly at host finding assays than the species defined as cruisers. Cruisers such as S. glaseri respond to long distance host volatile cues, and show directional movement towards G. mellonella larvae, where S. carpocapsae did not (Lewis et al., 1993). The mechanisms that can enhance an EPNs CI score will be investigated here. In a large host finding study by Dillman et al., (2012b), EPN attraction to various invertebrates was investigated. The EPN species used were H. bacteriophora, S. carpocapsae, S. scapterisci, S. glaseri and Oscheius carolinensis. Species specific attraction and virulence were observed across the invertebrate species; scarab beetles (Scapteriscus borellii), house crickets (Acheta domesticus), earwigs (Euborellia femoralis), waxworms (G. mellonella), flatheaded borers (Chrysobothris mali), pillbugs (Armadillidium

125

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

vulgare), and slugs (Lehmannia valentiana). Interspecific insect attraction variations were observed. Across all the species tested their host seeking

ability deteriorated in the absence of CO2, after scoring highly on G. mellonella finding assays (CI score = 0.88) (Dillman et al., 2012b). This suggests that this respiratory by-product seems to be an important and attractive long distance host volatile, however close range host

identification seems more complex as both CO2 and CO2-independent

attraction assays trigger jumping. Although CO2 as a stimulus triggers jumping behaviour across a range of low concentrations in S. carpocapsae,

it was clear that it was not essential, as when CO2 is removed from the insect volatile output, jumping remained a prevalent response (Dillman et al., 2012b). Similar results were found by Hallem et al. (2011a) were the S. carpocapsae strains used performed well in G. mellonella finding assays (CI

scores >0.85), but showed no attraction when CO2 was removed. These high CI scores resemble Breton strains G. mellonella finding ability (Fig 1B- C), supporting their ability to adopt a cruising method of host finding. Furthermore, Breton strains attraction to T. molitor larvae was significantly decreased relative to G. mellonella’s CI attraction, paralleled data has been observed for S. carpocapsae achieving a CI score of ~0.60 (Hallem et al., 2011a). Morris et al. (2017) reported no difference between ALL strains attraction to G. mellonella and T. molitor, both of which with a CI score = ~0.50 which is almost paralleled in this study for ALL strain: CI score = ~0.40 for both larvae species.

Transcriptomic data showed that Breton strain showed a significant upregulation in Sc-flp-33 transcripts relative to the other strains. Expression of flp-33 in C. elegans is almost exclusive and most prevalent in the dauer stage, abundant on dopaminergic-mechanosensory neurons (WormBase, 2018); suggesting its role in locomotory behaviour. Sc-flp-33 may play a role in lateral host finding, and elevated levels may aid in Breton strains enhanced host finding. The infective stage (J2) of M. incognita expresses Mi-nlp-3 abundantly, relative to the other life stages. Reverse-genetics tools have revealed that suppression of Mi-nlp-3 in the J2 stage impacts negatively on their host finding and egg laying abilities (Dash et al., 2017).

126

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Conversely, elevated levels of Sc-nlp-3 in Breton IJs may heighten their host finding abilities. C. elegans chemosensory GPCRs belonging to the srsx gene class share sequence homologies with vertebrate olfactory receptors (Krishnan et al., 2014). Breton strain revealed to have elevated expression levels of five Sc-srsx genes, relative to ALL and UK1. Increased expression of this GPCR class may enhance their host identification ability, which would lead with a more direct route to the insect volatiles, increasing their CI score. One method that may have been used on Breton strain to enhance their host finding behaviours is selective breeding. The related species S. feltiae greatly increased their host finding ability under positive selection pressure for this trait; increase from 3 % to 80 % after 13 insect rounds (Gaugler et al., 1989). ALL strain was under no selective pressure in the laboratory; presumably UK1 strain was under no selective pressure before arriving in the lab, unless this pressure had an effect on non-selected traits

which deteriorated their fitness. As mentioned previously, CO2 is an important long ranged host finding cue for cruiser EPN species. daf-1

activity has been associated with CO2 perception as mutants demonstrate reduced avoidance of this cue in C. elegans (Hallem & Sternberg, 2008). It has also been discovered that C. elegans dauer larvae need the expression of daf-1 to perform nictation behaviour, as mutants display a significant decrease in the percentage of dauers that nictate, relative to control (Lee et al., 2017). Interestingly here, Sc-daf-1 may support the heightened host finding ability of Breton strain, instead of contributing to the nictation defect found in UK1 strain, however many genes have been found to regulate and play key roles in performing this behaviour. The C. elegans gene daf-19 is a transcription factor essential for the development of cilia on sensory neurons (Swoboda et al., 2000). daf-19 mutants are unable to perceive environmental sensory information, due to the absence of sensory cilia (Senti et al., 2009). The significant increase in Sc-daf-19 expression relative to ALL and UK1 may have enhanced sensory cilia connectivity, in turn having a more sophisticated olfactory perception.

Previous findings in EPN host finding studies have revealed that although S. carpocapsae is mostly considered to be an ambusher, they have been

127

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

found to adopt a cruising method by achieving high host finding scores. Breton strain was found to have many GPCRs expressed significantly higher relative to the ambusher S. carpocapsae strains in this study. Elevated levels of these genes may influence their ability to detect and react to long range host finding cues, enabling them to behave as cruisers like S. glaseri. Neuropeptide genes were also significantly upregulated in Breton strain. As previously shown in the Sc-flp-21 RNAi study, a single neuropeptides’ expression level can have marked effects on host finding performance.

Freshly emerging ALL strain IJs showed a greater percentage of alive IJs, relative to the other strains. The effects of various storage conditions on S. carpocapsae IJs life span were assessed by Qiu and Bedding (2000). This study attempted to test too many variables for the number of conditions they presented, making direct comparisons tricky, in my opinion. Ringer’s solution was not tested under any other condition. The optimum condition was found to be a smaller density of IJs (2000 / ml), a smaller volume of 60 mls and removal of the orbital shaker; the only condition to not have this, achieving almost ten more weeks survival at 90 %, relative to the poorest condition. The other two conditions tested the smaller density again, and decreased the temperature from 28 ᵒC to 23 ᵒC, however as touched on previously, direct comparisons were tricky due to more than one variable changing between experiments. ALL and Breton strain showed a larger rate of decrease on survival for the initial weeks (<8 weeks), relative to the plateau in survival that followed, while suspended in PBS (1x) (darkness; 23 ᵒC; 125 IJs / ml). UK1 followed a steady decrease in survival throughout the experiment where they later interestingly achieved similar survival rates (≈ 50%) towards the end of the experiment at 17 weeks. Qui and Bedding (2000) did not see this initial steady decrease in survival, and mostly did not see any decrease until at least 6 weeks. Factors that influence H. bacteriophora survival that were not measured in this study were osmotic stress levels and oxygen levels within their PBS suspension (Kagimu et al., 2017). However conditions remained controlled between and three strains used in this study, therefore no dramatic changes in oxygen and osmotic levels should have taken place. The quality of the IJs reared in vivo are said

128

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

to be equal or superior to those reared in vitro; both solid and liquid methods with regards to their biocontrol efficiency, although there are advantages to both methods (Gaugler & Georgis, 1991). The commercial strains showed a lower percentage survival than ALL strain, which may have been a consequence of in vitro culturing on a commercial scale. Transcriptional data indicated that UK1 strain had elevated expression levels of Sc-daf-2, relative to ALL and Breton strain. A life span regulating genetic pathway was described in C. elegans, where it was discovered that mutants with low expression of daf-2 had their life span more than doubled relative to control (Kenyon et al., 1993). The elevated levels of Sc- daf-2 in UK1 may contribute to the significant initial decrease in their population. Although Breton strain also showed the initial population decline, they significantly expressed Sc-daf-2 the least, relative to ALL and UK1.

Steinernema carpocapsae has a long term survival strategy by adopting a quiescent state when environmental conditions are harsher, and they do so better than larger EPN species (Grewal, 2000). While in a quiescent state, energy is conserved, and lipid stores would be reasonably stable, which could explain the decreasing rate of alive IJs post 54 days, especially for ALL and Breton strain. UK1 strain seemed to have a consistent fall in percentage alive IJs until the end of the experiment. Lipid store data that matched the life span data would have been very beneficial for concluding this experiment, however, the fresh IJs lipid store is of interest for this transcriptomic study. Oil Red O staining revealed that ALL strain had significantly larger lipid coverage across their body, relative to Breton and UK1 strain (P<0.01). ALL strain had a percentage of total body area stained with lipid of 90.7%, which is almost exactly what has been published previously; 90.3% (Andaló et al., 2011). Lipid source and diet had a marked effect on body lipid storage for the EPN H. bacteriophora, where it was discovered that insect derived lipid diets proved to be the greatest lipid source for storage (Hatab & Gaugler, 1999). Steinernema glaseri had a larger total of body lipid when reared in insect hosts, when compared to in vitro solid and liquid culture. The S. carpocapsae commercial strains that

129

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

retained less body lipid were previously maintained in vitro, which may have had a negative impact on their lipid metabolising and storage ability, relative to the in vivo cultured ALL strain. Genes with known associations to lipid metabolism in C. elegans were used to find S. carpocapsae predicted orthologues. DE of these genes was observed between ALL strain and the commercial strains. Downregulated in ALL strain, asm-2 encodes a sphingomyelin phosphodiesterase which is an enzyme involved in sphingolipid metabolism reactions and plays a role in cellular response and signalling in C. elegans. Larger differences were observed with genes belonging to Sc-acl class, Sc-acl-2 & Sc-acl-12, which have predicted acetyltransferase roles in C. elegans (WormBase, Dec 2017). Collectively they may play a role in the lipid storage differenced observed between the S. carpocapsae strains, however there are many unexplored genes that could contribute to lipid storage and metabolism.

Although significant knockdown was achieved in ALL strain, the magnitude of knockdown was not large (P<0.01). Differential expression of RNAi associated genes was observed, however, it’s difficult to conclude that these genes have an effect on knockdown efficiency due to their small differences. Although RNAi by dsRNA ingestion has proven to be a powerful tool for gene suppression studies in nematodes, it remains inconsistently efficient from species to species (Félix, 2008), and possibly between strains of the same species. Environmental dsRNA is up taken in the nematode intestine, by the transmembrane protein SID-2 in C. elegans. RNAi soak defective species C. briggsae have a SID-2 homologue that differs functionally in their dsRNA uptake role. Winston et al. (2007) discovered that the expression of C. elegans’ sid-2 gene in C. briggsae made them susceptible to environmental RNAi, allowing the uptake of dsRNA through the cells that now express this transmembrane protein. Reciprocal BLAST analyses revealed no obvious SID-2 homologues in S. carpocapsae, therefore no differential analysis across the strains could take place. As RNAi using the dsRNA soaking method in S. carpocapsae is possible (Morris et al, 2017), there must be a functionally similar transmembrane protein that facilitates dsRNA uptake in S. carpocapsae; however, this gene is

130

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

currently unknown. The ability to uptake dsRNA alone is not enough to trigger an RNAi response. Findings from my previous chapter concluded that ALL strain was susceptible to Sc-flp-21, but interestingly not to Sc-flp- 18, where both share expression on the same neurons in C. elegans. It remains unclear why similar targets and their receptors were unable to be suppressed in S. carpocapsae ALL strain. In the future, I would like to attempt to knockdown Sc-flp-21 in both UK1 and Breton strain, to assess their susceptibility to RNAi with a target that greatly supresses ALL strains Sc-flp-21.

All three S. carpocapsae strains were all attracted to the insect volatiles α- pinene, nonanoic acid, and tridecane. In contrary to Hallem et al., (2011a) all the S. carpocapsae IJs were attracted to α-pinene, which was found to be the most abundant volatile output for G. mellonella worms (Morris et al., 2017). Their strong attraction toward G. mellonella larvae and α-pinene as a single volatile seems to support that α-pinene is indeed a host finding cue, as seen with the plant and insect predatory insects discussed previously. Tridecane is emitted by numerous insects and is an attractive volatile to insect predators. The attraction that the S. carpocapsae strains showed towards tridecane also seems to support its claim as an insect finding volatile. Furthermore, they seem to be repelled by myristic acid which corroborates previous findings assessing S. carpocapsae attraction to this volatile (Castello et al., 2014). The strains did not seem to respond to the presence of stearic acid and hexanoic acid. The remaining volatiles tested all showed intraspecific variation in their attraction. Nematode chemosensory GPCRs are responsible for perceiving olfactory cues. The abundance and diversity of these GPCRs make linking a specific volatile to a receptor difficult. In order to confirm a GPCRs ligand, the gene must be suppressed and tested with single volatiles to see if there are significant changes to their attraction (Larsch et al., 2013). Upon GPCR expression recovery, attraction should return to normal.

131

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

Laboratory cultures over countless generations have had drastic effects on the N2 strain of C. elegans, as they have been selectively bred to live in unnatural conditions i.e. higher oxygen concentrations, constant environmental conditions and readily available food sources on a 2D platform. The artificial selection that took place made the N2 strain adapt to these conditions, where all wild type C. elegans exhibit significantly lower laboratory fitness (Weber et al., 2010; Duveau & Felix, 2012). Genetic variation of the npr-1 gene has found wild type strains to possess the 215F allele, where the N2 strain has the 215V allele. For all C. elegans strains, FLP-21 is a known ligand to NPR-1. The N2 strains 215V allele has resulted in NPR-1 becoming additionally sensitive to FLP-18 (Rogers et al., 2006). This N2 strain divergence for NPR-1 abnormally inactivates the RMG interneuron; a central neuron for social behaviours (Edison, 2009). Possibly the most obvious phenotypic difference lies in their aerotaxis response. Wild type strains naturally migrate towards areas where ambient levels of oxygen are much lower than atmospheric levels; aerotaxing sensitively towards oxygen levels of 10 % (Gray et al., 2004). N2 strains do not show the same sensitivity towards oxygen, as they distribute happily in higher ambient levels of oxygen (~17 %) (Sterken et al., 2015). The NPR-1 GPCR with the 215F allele promotes social feeding, as aggregated nematodes and the growth of bacterial colonies reduce the ambient oxygen levels. N2 strains with the inactive RMG neuron are not as sensitive to oxygen levels, which promotes solitary feeding.

Chemosensory receptors are highly diverse in animals, encoded by many genes. When genes are not essential for an organism, and they undergo many mutations, these genes may become pseudogenes, which have lost some functionality to the corresponding gene, decreasing in expression (Vanin, 1985). Gene expression is heavily influenced by the environment in this way, and is thought to contribute to intraspecific variation in gene expression. Polymorphic genes express themselves differently across populations of the species. Intraspecific variation in sensory receptor expression is common in animals (Niimura & Nei, 2007). Steinernema

132

Chapter 4: Phenotypic and Transcriptional Variation in Steinernema carpocapsae

carpocapsae is no exception, the three strains in this study expressed many receptors differently relative to each other in this study. Their rearing method histories almost certainly differ, as UK1 and Breton strain were commercial, and began in lab and in vivo rearing in 2017. Previous culture methods for UK1 strain were in large in vitro tankers, Breton’s history is unknown, however, its superiority in behavioural assays (presented), and ease of culture may suggest some selective pressure on their commercial culture conditions. ALL strain has remained under laboratory in vivo (G. mellonella) rearing for many years. In vitro rearing, no choice in host and environmentally stable culture conditions may give rise to many of these genes becoming pseudogenes or polymorphic genes within populations, altering their expression. These factors may explain the large intraspecific variation in single volatile attraction among the strain. As mentioned previously, a chemosensory receptor usually has one ligand; one receptor sensing one volatile. Although only a fraction of putative Sc-GPCRs have been identified in this study, and most are largely unknown, it may be possible to identify ligands to chemoreceptors.

Thank you to Dr Ciaran McCoy and Dr Neil Warnock for extracting the RNA for sequencing when I was unwell. I’d also like to thank Dr Debbie Cox for helping me create a script for the RNA-Seq analysis; I greatly appreciated your support.

133

Chapter 5: General Discussion

CHAPTER 5: GENERAL DISCUSSION

During the course of my PhD, I have gained extensive knowledge on EPN host finding behaviours and gained some insight into the molecular basis that drive these behaviours. Achieving a stable and reproducible RNAi protocol in S. carpocapsae has permitted a functional study to take place, revealing the role of Sc-flp-21 in sensory perception. This mechanics facilitating RNAi spread via exogenous dsRNA ingestion seems to take place differently to the model organism C. elegans, as dsRNA transporter genes, such as sid-2 and sid-2, do not seem to be present in S. carpocapsae. Systemic RNAi spread is more complex than what has been previously identified in C. elegans, as many parasitic nematodes are RNAi susceptible, but do not share the same dsRNA transporter genes as the model organism (Aboobaker & Blaxter, 2003; Islam et al., 2005; Lustigman et al., 2004). Conserved dsRNA transporter gene orthologues are present in S. carpocapsae, such as rsd-4, which is known to facilitate the intracellular import of silencing RNAs in C. elegans. The lack of other dsRNA transporter genes may be responsible for the high dsRNA concentration required for efficient knockdown of a gene. Gene suppression was achieved for both Sc- flp-21 and Sc-srsx-3 in S. carpocapsae ALL strain. Other targets tested did not achieve significant knockdown, following the same protocol as the successful targets. It is possible that the silencing RNAs could not entirely systemically spread to all of the IJs tissue, due to the lack of diversity in their RNAi associated genes. Argonaute proteins that associate and guide silencing RNAs to their target are also not highly conserved between C. elegans and S. carpocapsae (Morris et al., 2017). On the other hand, large expansions in the conserved argonaute proteins have been observed in S. carpocapsae, which has aided and enabled RNAi to take place. Their diverse and large argonaute library which has allowed RNAi to take place in S. carpocapsae suggests the lack of RNAi taken place for other targets is not associated with their argonaute proteins, as the intracellular mechanisms are present once the silencing RNAs arrive within the cell. The molecular drivers for the uptake and spread of dsRNA and their silencing complexes are likely the cause of more failed targets than successful ones

134

Chapter 5: General Discussion in S. carpocapsae. It would be interesting to examine RNAi efficiency on S. carpocapsae mutants expressing sid-1, to see if that facilitates RNAi effects for the failed gene targets in this study, as has been done for C. briggsae (Winston et al., 2007).

Once the stable RNAi method was achieved for S. carpocapsae, the effects of Sc-flp-21 knockdown on the IJs host finding behaviours were explored. Drastic effects were observed with Sc-flp-21 treated IJs, relative to untreated and dsRNA control worms. Host finding assays revealed that Sc- flp-21 IJs did not show positive chemotaxis towards live insects, which was consistently observed for control worms. Secondly, their nictation associated behaviours, jumping and rapid nictation, were also strongly effected by Sc-flp-21 treatment, as they were performed significantly less often than control worms, upon exposure to insect volatiles. Further observations were made when no insects were used for the nictation assays, and only a puff of air was blown onto nictating IJs. The nictating Sc- flp-21 IJs that were exposed to live insect volatiles behaved similarly to control worms that had no insect volatile stimulus in the nictation assays. They responded by moving away from the stimulus, rather than continuing to nictate. This strongly suggests Sc-flp-21’s role in perception of insect associated volatiles, and the importance of these olfactory stimuli for their host finding behaviours. EPN dispersal abilities is an important attribute to their success as biocontrol agents, to ensure complete and equal protection throughout the soil. The effects of Sc-flp-21 suppression was not limited to insect associated volatiles. Dispersal behaviour is regulated by conspecific communication via ascarocide signalling, namely ascr#9 which has been associated with dispersal behaviours (Kaplan et al., 2012). In this work, the suppression of Sc-flp-21 significantly impacted the number of IJs migrating to the outer scoring zones in the dispersal assay, relative to controls. More of the Sc-flp-21 IJs remained aggregated in the centre of the assay, signifying Sc-flp-21’s role in olfactory perception of conspecific cues, linking this neuropeptide to olfactory perception as a whole, and not specifically for insect perception.

135

Chapter 5: General Discussion

Soil sampling in Northern Ireland revealed there to be a number of EPN species living in UK and Irish soils, as has previously been found from soil surveys undertaken here. Isolates collected in this study were S. feltiae, S. affine, H. downesi and unidentified Heterorhabditis spp., to the species level. Of the soil samples taken, the number of samples positive with EPN presence were consistent with previous surveys in the UK and Ireland. The Heterorhabditis spp. isolates collected where all from coastal sites, where they harboured in sandy-soil, as has previously been described by previous studies. The S. affine isolate was collected from the same site as the H. downesi isolate (M18-1B), however, the soil sampled was from an area with trees and bushes growing in peaty-loam soil. The S. feltiae isolates were found inland, in loamy soil, which is again consistent with previous findings, suggesting EPNs fill particular niches, which may be a result of their host finding method: cruiser or ambusher. Cruiser species would benefit from the porous and well ventilates sandy soil, where ambushers tend to remain on or close to the soil surface waiting for a passing insect. Baiting sampled soil with G. mellonella larvae for EPN collection may be impeding the collection of EPNs, as many baited larvae in this study succumbed to bacterial or fungal infections, as they are not soil dwelling insects. By using insects naturally found in the soil environment, such as T. molitor, less larvae would perish from opportunistic soil pathogens, enhancing the chances of EPN colonisation. The S. feltiae isolates collected showed diversity in their behavioural and trait assessments, which is generally expected with an EPN that exhibits versatile host finding methods. This attribute would make the S. feltiae isolates collected in this study great candidates for artificial selection studies attempting to achieve enhanced host finding behaviours. The natural S. feltiae isolates largely outperformed the laboratory maintained S. feltiae strains in the assessments carried out in this study, when assessing their biocontrol attributes in the laboratory. Behavioural trait deterioration with laboratory domestication has been revealed previously, and the present findings seem to corroborate these. In field or glasshouse biocontrol trials would be the next step for these natural isolates, as the results of these trials would identify which laboratory assessment, or assessments, is the greatest

136

Chapter 5: General Discussion indicator for promising candidates for crop protection, and which traits would be selected for to enhance biocontrol efficiency. The results from this study suggest that the most promising S. feltiae isolates for biocontrol purposes are LM-1C, LM-4A and LM-2B, and for the Heterorhabditis spp. isolate, W16-1B.

Transcriptomic analysis through an RNA-seq platform was used to try and identify differentially expressed genes between three S. carpocapsae strains that showed phenotypic differences, primarily with their host finding behaviours. The commercially available S. carpocapsae strain, UK1, rarely performed nictation behaviour, where the other two strains did. A number of Sc-daf genes were greatly differentially expressed between nictating phenotypes: UK1 vs ALL and Breton strain. The findings from this study largely corroborate what has previously been found in C. elegans. Lee et al., (2017) identified daf-2 as a nictation suppressor, where elevated expression levels of this gene reduce the number of C. elegans dauer larvae that perform nictation. Furthermore, expression levels of daf-7 positively correlate with the number or worms that nictate: higher expression, greater number of nictating dauer larvae (Lee et al., 2017). UK1 strain had elevated levels of Sc-daf-2, and lower levels of Sc-daf-7, relative to the nictating strains. Following these findings, I would have liked to attempt RNAi on ALL and Breton strains, targeting Sc-daf-2 and Sc-daf-7, to see what affect that would have had on their nictation behaviour. The three S. carpocapsae strains also exhibited variation between their host finding performances. Breton strain significantly had a greater number of individuals in the positive zone with the insects, relative to the negative zone with no insects, when compared to the other two strains. Transcriptome analysis revealed many GPCRs, investigated in this study, to be expressed significantly greater in Breton strain, relative to ALL and UK1 strain. There were also a number of neuropeptide genes that were upregulated in Breton strain relative to the other strains. This may suggest that their heightened host finding behaviour may be facilitated by their neuropeptide signalling systems. The expression of GPCRs could correlate with the sensitivity of their sensory perception systems.

137

Chapter 5: General Discussion

RNAi can be a powerful tool to investigate gene function in vivo in biological systems. This study has revealed that RNAi via exogenous dsRNA exposure is possible in S. carpocapsae. Using this protocol, the neuropeptide Sc-flp-21 was identified as an essential component of the molecular basis of olfactory perception. Genes associated with Sc-flp-21 could not be suppressed and investigated for their function in host finding behaviours. The knockdown of Sc-flp-21 should be further tested on the other S. carpocapsae strains used in this study, to corroborate the intraspecific variation observed in their RNAi susceptibility to Sc-srsx-3. If variation persists between isolates, then an investigation into defining the RNAi pathway of S. carpocapsae should be initiated, which may translate to non C. elegans nematode. Other RNAi targets attempted in this study could be silenced by other means, such as utilising CRISPR-Cas9 technology. Transcriptome analysis provides a molecular map of expressed genes at any one time in an organism. Many of the differentially expressed genes revealed in this study would be great candidates for functional analysis, where RNAi could be attempted to suppress the gene in the three S. carpocapsae strains, and see how this effects their phenotypes, such as host finding behaviours, that show variation between strains. Further study should be initiated with the suppression of genes associated with the nictation phenotype, such as Sc-daf-2 and Sc-daf-7, which were significantly differentially expressed between nictating and non-nictating strains, and are known regulators of this behaviour in C. elegans. Collecting more S. carpocapsae strains, assessing their phenotypic attributes and sequencing their transcriptome would further our understanding of the genetic control of these host finding behaviours. Linking which attributes tested within the laboratory are the greatest indicators for their biocontrol efficiency would be a large benefit to enhancing their protective capabilities. The laboratory assessments for each natural isolate, and laboratory strain, can be related to their performance in glasshouse and field trials. Their abilities to control a number of common pests should be tested, alongside the type of crops they’re most successful in protecting. The laboratory traits associated with the most successful isolates in biocontrol trials can then be artificially selected for and tested to improve

138

Chapter 5: General Discussion their biocontrol capabilities. To conclude, identifying genes associated with host finding behaviours, and exploiting the diversity observed in EPNs offers the ability to enhance beneficial behaviours and traits, and tailor their application to individually suit the pest problem.

139

References

Abdel-Razek, A. S., Hussein, M., & Shehata, I. (2018). Isolation and identification of indigenous entomopathogenic nematode (EPN) isolate from Egyptian fauna. Archives of Phytopathology and Plant Protection, 51(3-4), 197-206.

Aboobaker, A. A., & Blaxter, M. L. (2003). Use of RNA interference to investigate gene function in the human filarial nematode parasite Brugia malayi. Molecular and Biochemical Parasitology, 129(1), 41–51. doi:10.1016/s0166-6851(03)00092-6

Acevedo, J. P. M., Samuels, R. I., Machado, I. R., & Dolinski, C. (2007). Interactions between isolates of the entomopathogenic fungus Metarhizium anisopliae and the entomopathogenic nematode Heterorhabditis bacteriophora JPM4 during infection of the sugar cane borer Diatraea saccharalis (Lepidoptera: Pyralidae). Journal of Invertebrate Pathology, 96(2), 187-192.

Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., ... & George, R. A. (2000). The genome sequence of Drosophila melanogaster. Science, 287(5461), 2185-2195.

Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymeropoulos, M. H., Xiao, H., Merril, C. R., Wu, A., Olde, B., & Moreno, R. F. (1991) Complementary DNA sequencing: expressed sequence tags and human genome project. Science, 252(5013), 1651–6.

Albert, P. S., & Riddle, D. L. (1988). Mutants of Caenorhabditis elegans that form dauer-like larvae. Developmental Biology, 126(2), 270-293.

Aldrich, J. R. (1988). Chemical ecology of the Heteroptera. Annual Review of Entomology, 33(1), 211-238.

Alexandratos, N., & Bruinsma, J. (2012). World agriculture towards 2030/2050: the 2012 revision. Agricultural Development Economics Division, Food and Agriculture Organization of the United Nations. www.fao.org/economic/esa

140

References

Ali, J. G., Alborn, H. T., & Stelinski, L. L. (2010). Subterranean herbivore- induced volatiles released by citrus roots upon feeding by Diaprepes abbreviatus recruit entomopathogenic nematodes. Journal of Chemical Ecology, 36(4), 361-368.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403- 410.

Andaló, V., Moino, A., Maximiniano, C., Campos, V. P., & Mendonca, L. A. (2011). Influence of temperature and duration of storage on the lipid reserves of entomopathogenic nematodes. Revista Colombiana de Entomología, 37(2), 203-209.

Anderson, R. C., Newton, C. L., Millar, R. P., & Katz, A. A. (2014). The Brugia malayi neuropeptide receptor-4 is activated by FMRFamide-like peptides and signals via Gαi. Molecular and Biochemical Parasitology, 195(1), 54–58. doi:10.1016/j.molbiopara.2014.07.002

Androwski, R. J., Flatt, K. M., & Schroeder, N. E. (2017). Phenotypic plasticity and remodeling in the stress‐induced Caenorhabditis elegans dauer. Wiley Interdisciplinary Reviews: Developmental Biology, 6(5), e278.

Ansari, M. A., Shah, F. A., & Butt, T. M. (2008). Combined use of entomopathogenic nematodes and Metarhizium anisopliae as a new approach for black vine weevil, Otiorhynchus sulcatus, control. Entomologia Experimentalis et Applicata, 129(3), 340-347.

Ansari, M. A., Shah, F. A., Tirry, L., & Moens, M. (2006). Field trials against Hoplia philanthus (Coleoptera: Scarabaeidae) with a combination of an entomopathogenic nematode and the fungus Metarhizium anisopliae. Biological Control, 39(3), 453-459.

Ansari, M. A., Tirry, L., & Moens, M. (2004). Interaction between Metarhizium anisopliae CLO 53 and entomopathogenic nematodes for the control of Hoplia philanthus. Biological Control, 31(2), 172-180.

Antebi, A., Yeh, W. H., Tait, D., Hedgecock, E. M., & Riddle, D. L. (2000). daf- 12 encodes a nuclear receptor that regulates the dauer diapause and

141

References developmental age in C. elegans. Genes & Development, 14(12), 1512- 1527.

Ashton, F. T., & Schad, G. A. (1996). Amphids in Strongyloides stercoralis and other parasitic nematodes. Parasitology Today, 12(5), 187-194. doi:10.1016/0169- 4758(96)10012-0

Atkinson, L. E., Miskelly, I. R., Moffett, C. L., McCoy, C. J., Maule, A. G., Marks, N. J., & Mousley, A. (2016). Unraveling flp-11/flp-32 dichotomy in nematodes. International Journal for Parasitology, 46(11), 723-736.

Bai, X., Adams, B. J., Ciche, T. A., Clifton, S., Gaugler, R., Kim, K. S., Spieth, J., Sternberg, P. W., Wilson, R. K., & Grewal, P. S. (2013). A lover and a fighter: the genome sequence of an entomopathogenic nematode Heterorhabditis bacteriophora. PLOS One, 8(7).

Baiocchi, T., & Dillman, A. R. (2015). Chemotaxis and Jumping Assays in Nematodes. Bio-protocol, 5, e1587.

Bal, H. K., & Grewal, P. S. (2015). Lateral dispersal and foraging behavior of entomopathogenic nematodes in the absence and presence of mobile and non-mobile hosts. PLOS One, 10(6), e0129887. Bal, H. K., Taylor, R. A., & Grewal, P. S. (2014). Ambush Foraging Entomopathogenic Nematodes Employ ‘Sprinters' for Long-Distance Dispersal in the Absence of Hosts. Journal of Parasitology, 100(4), 422-433.

Bal, H. K., Taylor, R. R., & Grewal, P. S. (2009). Lateral Dispersal of the Entomopathogenic Nematode Heterorhabditis bacteriophora From Infected Host Cadavers in Soil. In Journal of Nematology 41(4), 305-306. Marceline, USA: Soc Nematologists.

Bebber, D. P., Ramotowski, M. A., & Gurr, S. J. (2013). Crop pests and pathogens move polewards in a warming world. Nature Climate Change, 3(11), 985.

Bedding, R. A., & Molyneux, A. S. (1982). Penetration of insect cuticle by infective juveniles of Heterorhabditis spp. (Heterorhabditidae: Nematoda). Nematologica, 28(3), 354-359.

142

References

Bélair, G., Dauphinais, N., Fournier, Y., & Mauléon, H. (2001). Survey of plant-parasitic and entomopathogenic nematodes in vineyards of Quebec. Phytoprotection, 82(2), 49-55.

Bernstein, E., Caudy, A. A., Hammond, S. M., & Hannon, G. J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409(6818), 363.

Bhardwaj, A., Thapliyal, S., Dahiya, Y., & Babu, K. (2018). FLP-18 functions through the G-protein-coupled receptors NPR-1 and NPR-4 to modulate reversal length in Caenorhabditis elegans. Journal of Neuroscience, 38(20), 4641-4654.

Bilgrami, A., Gaugler, R., Adams, B., & Shapiro-Ilan, D. (2006). Source of trait deterioration in entomopathogenic nematodes Heterorhabditis bacteriophora and Steinernema carpocapsae during in vivo culture. Nematology, 8(3), 397–409. doi:10.1163/156854106778493394

Billings, R. F. (1985). Southern pine bark beetles and associated insects: Effects of rapidly‐released host volatiles on response to aggregation pheromones 1. Zeitschrift für Angewandte Entomologie, 99(1‐5), 483-491.

Biron, D., Wasserman, S., Thomas, J. H., Samuel, A. D., & Sengupta, P. (2008). An olfactory neuron responds stochastically to temperature and modulates Caenorhabditis elegans thermotactic behavior. Proceedings of the National Academy of Sciences, 105(31), 11002-11007.

Blanco, A., & Blanco, G. (2017). Medical Biochemistry. London, United Kingdom: Academic Press.

Blattner, F. R., Plunkett, G., Bloch, C. A., Perna, N. T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F., Gregor, J., Davis, N. W., Kirkpatrick, H. A., Goeden, M. A., Rose, D. J., Mau, B., & Shao, Y. (1997). The complete genome sequence of Escherichia coli K-12. Science, 277(5331), 1453-1462.

Blaxter, M. L., De Ley, P., Garey, J. R., Liu, L. X., Scheldeman, P., Vierstraete, A., Vanfleteren, J. R., Mackey, L. Y., Dorris, M., Frisse L. M., Vida, J. T., &

143

References

Thomas, K. (1998). A molecular evolutionary framework for the phylum Nematoda. Nature, 392(6671), 71-75.

Boag, B., Neilson, R., & Gordon, S. C. (1992). Distribution and prevalence of the entomopathogenic nematode Steinernema feltiae in Scotland. Annals of Applied Biology, 121(2), 355-360.

Bogitsh, B. J., Carter, C. E., & Oeltmann, T. N. (2018). Human parasitology. Academic Press. https://doi.org/10.1016/B978-0-12-813712-3.00015-1

Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114-2120.

Bowman, J. W., Friedman, A. R., Thompson, D. P., Ichhpurani, A. K., Kellman, M. F., Marks, N., Maule, A. G., & Geary, T. G. (1996). Structure- activity relationships of KNEFIRFamide (AF1), a nematode FMRFamide- related peptide, on Ascaris suum muscle. Peptides, 17(3), 381-387.

Brown, F. D., D'Anna, I., & Sommer, R. J. (2011). Host-finding behaviour in the nematode Pristionchus pacificus. Proceedings of the Royal Society B: Biological Sciences, 278(1722), 3260-3269. doi: 10.1098/rspb.2011.0129.

Campbell, J. F., & Gaugler, R. (1993). Nictation behaviour and its ecological implications in the host search strategies of entomopathogenic nematodes (Heterorhabditidae and Steinernematidae). Behaviour, 155-169.

Campbell, J. F., & Kaya, H. K. (1999). How and why a parasitic nematode jumps. Nature, 397(6719), 485.

Campbell, L. R., & Gaugler, R. (1992). Effect of exsheathment on motility and pathogenicity of two entomopathogenic nematode species. Journal of Nematology, 24(3), 365.

Campos-Herrera, R., & Gutiérrez, C. (2008). Comparative study of entomopathogenic nematode isolation using Galleria mellonella (Pyralidae) and Spodoptera littoralis (Noctuidae) as baits. Biocontrol Science and Technology, 18(6), 621-626.

Campos-Herrera, R., & Gutiérrez, C. (2014). Steinernema feltiae intraspecific variability: infection dynamics and sex-ratio. Journal of Nematology, 46(1), 35.

144

References

Cappaert, D. L., & Koppenhöfer, A. M. (2003). Steinernema scarabaei, an entomopathogenic nematode for control of the European chafer. Biological Control, 28(3), 379-386.

Carrillo, M. A., Guillermin, M. L., Rengarajan, S., Okubo, R. P., & Hallem, E.

A. (2013). O2-sensing neurons control CO2 response in C. elegans. Journal of Neuroscience, 33(23), 9675-9683.

Carthew, R. W., & Sontheimer, E. J. (2009). Origins and mechanisms of miRNAs and siRNAs. Cell, 136(4), 642-655.

Casanova-Garcia, Y., Diaz-Guerra, M., Naranjo, F., Alvarez-Gonzalez, J. F., Barroso-Rodriguez, G., Albuernes-Escobar, F. & Leyva-Vinaiza, Y. (2010). Evaluacion de las potencialidades parasiticas de Tetrastichus howardi (Olliff) y efectividad combinada con Heterhorabditis bacteriophora contra Plutella xylostella Lin. en col. In Congreso Científico del INCA, XVII, San José de las Lajas, 22-26 nov. 2010. Instituto Nacional de Ciencias Agrícolas.

Castelletto, M. L., Gang, S. S., Okubo, R. P., Tselikova, A. A., Nolan, T. J., Platzer, E. G., Lok, J.B., & Hallem, E. A. (2014). Diverse host-seeking behaviors of skin-penetrating nematodes. PLOS Pathogens, 10(8), e1004305.

Chaerani, R., & Stock, S. P. (2004). Morphological and molecular characterisation of Steinernema hermaphroditum (Nematoda: Steinernematidae), an entomopathogenic nematode from Indonesia, and its phylogenetic relationships with other members of the genus. Nematology, 6(3), 401-412.

Chaisson, K. E., & Hallem, E. A. (2012). Chemosensory behaviors of parasites. Trends in Parasitology, 28(10), 427-436.

Chalasani, S. H., Chronis, N., Tsunozaki, M., Gray, J. M., Ramot, D., Goodman, M. B., & Bargmann, C. I. (2007). Dissecting a circuit for olfactory behaviour in Caenorhabditis elegans. Nature, 450(7166), 63.

Chang, D. Z., Serra, L., Lu, D., Mortazavi, A., & Dillman, A. R. (2019). A core set of venom proteins is released by entomopathogenic nematodes in the genus Steinernema. PLOS Pathogens, 15(5), e1007626.

145

References

Chang, Y. J., Burton, T., Ha, L., Huang, Z., Olajubelo, A., & Li, C. (2015). Modulation of locomotion and reproduction by FLP neuropeptides in the nematode Caenorhabditis elegans. PlOS One, 10(9), e0135164.

Cheung, B.H., Cohen, M., Rogers, C., Albayram, O., & de Bono, M. (2005). Experience-dependent modulations of C. elegans behavior by ambient oxygen. Current Biology. 15, 905–917

Chhangawala, S., Rudy, G., Mason, C. E., & Rosenfeld, J. A. (2015). The impact of read length on quantification of differentially expressed genes and splice junction detection. Genome Biology. 16, 1–10. doi:10.1186/s13059-015-0697-y

Chitwood, B. G., & Chitwood, M. B. (1950). An introduction to nematology. Section I. Anatomy. In An Introduction to Nematology.

Choe, A., von Reuss, S. H., Kogan, D., Gasser, R. B., Platzer, E. G., Schroeder, F. C., & Sternberg, P. W. (2012). Ascaroside signaling is widely conserved among nematodes. Current Biology, 22(9), 772-780.

Choo, H. Y., Kaya, H. K., & Stock, S. P. (1995). Isolation of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) from Korea. Nematological Research (Japanese Journal of Nematology), 25(1), 44-51.

Choo, H. Y., Kaya, H. K., Huh, J., Lee, D. W., Kim, H. H., Lee, S. M., & Choo, Y. M. (2002). Entomopathogenic nematodes (Steinernema spp. and Heterorhabditis bacteriophora) and a fungus Beauveria brongniartii for biological control of the white grubs, Ectinohoplia rufipes and Exomala orientalis, in Korean golf courses. BioControl, 47(2), 177-192.

Coates, J. C., & de Bono, M. (2002). Antagonistic pathways in neurons exposed to body fluid regulate social feeding in Caenorhabditis elegans. Nature, 419(6910), 925.

Coburn, C. M., & Bargmann, C. I. (1996). A putative cyclic nucleotide-gated channel is required for sensory development and function in C. elegans. Neuron, 17, 695-706. doi:10.1016/S0896-6273(00)80201-9

146

References

Cogoni, C., & Macino, G. (1997). Conservation of transgene-induced posttranscriptional gene silencing in plants and fungi. Trends in Plant Science, 2(11), 438-443.

Cogoni, C., & Macino, G. (2000). Post-transcriptional gene silencing across kingdoms. Current Opinion in Genetics & Development, 10(6), 638-643.

Cohen, M., Reale, V., Olofsson, B., Knights, A., Evans, P., & de Bono, M. (2009). Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling. Cell Metabolism, 9(4), 375-385.

Cook, S. J., Jarrell, T. A., Brittin, C. A., Wang, Y., Bloniarz, A. E., Yakovlev, M. A., Nguyen, K. C. Q., Tang, L. T. H., Bayer, E. A., Duerr, J. S., Bülow, H. E. Hobert, O., Hall, D. H., & Emmons, S. W. (2019). Whole-animal connectomes of both Caenorhabditis elegans sexes. Nature, 571(7763), 63- 71.

Couillault, C., Pujol, N., Reboul, J., Sabatier, L., Guichou, J. F., Kohara, Y., & Ewbank, J. J. (2004). TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARM. Nature Immunology, 5(5), 488.

Dalzell, J. J., McMaster, S., Fleming, C. C., & Maule, A. G. (2010). Short interfering RNA-mediated gene silencing in Globodera pallida and Meloidogyne incognita infective stage juveniles. International Journal for Parasitology, 40(1), 91-100.

Dalzell, J. J., McVeigh, P., Warnock, N. D., Mitreva, M., Bird, D. M., Abad, P., Fleming, C. C., Day, T. A., Mousley, A., Marks, N. J., & Maule, A. G. (2011). RNAi effector diversity in nematodes. PLOS Neglected Tropical Diseases, 5(6), e1176.

Dash, M., Dutta, T. K., Phani, V., Papolu, P. K., Shivakumara, T. N., & Rao, U. (2017). RNAi-mediated disruption of neuropeptide genes, nlp-3 and nlp-12, cause multiple behavioral defects in Meloidogyne incognita. Biochemical and Biophysical Research Communications, 490(3), 933–940. doi:10.1016/j.bbrc.2017.06.143

147

References

Delcour, I., Spanoghe, P., & Uyttendaele, M. (2015). Literature review: Impact of climate change on pesticide use. Food Research International, 68, 7-15.

Dillman, A. R., Chaston, J. M., Adams, B. J., Ciche, T. A., Goodrich-Blair, H., Stock, S. P., & Sternberg, P. W. (2012). An entomopathogenic nematode by any other name. PLOS Pathogens, 8(3), e1002527.

Dillman, A. R., Guillermin, M. L., Lee, J. H., Kim, B., Sternberg, P. W., & Hallem, E. A. (2012). Olfaction shapes host–parasite interactions in parasitic nematodes. Proceedings of the National Academy of Sciences, 109(35), e2324-e2333.

Dillman, A. R., Macchietto, M., Porter, C. F., Rogers, A., Williams, B., Antoshechkin, I., Lee, M., Goodwin, Z., Lu, X., Lewis, E., Goodrich-Blair, H., Stock, S. P., Adams, B. J., Sternberg, P. W., & Mortazavi, A. (2015). Comparative genomics of Steinernema reveals deeply conserved gene regulatory networks. Genome Biology, 16(1), 200.

Dillon, A. B., Ward, D., Downes, M. J., & Griffin, C. T. (2006). Suppression of the large pine weevil Hylobius abietis (L.)(Coleoptera: Curculionidae) in pine stumps by entomopathogenic nematodes with different foraging strategies. Biological Control, 38(2), 217-226.

Dix, I., Burnell, A., Joyce, S., Griffin, C., & Downes, M. (1999). Isolation and characterisation of Heterorhabditis spp. (Nematoda: Heterorhabditidae) from Hungary, Estonia and Denmark. Nematology, 1(3), 321-332.

Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., & Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29(1), 15-21.

Donley, N. (2019). The USA lags behind other agricultural nations in banning harmful pesticides. Environmental Health, 18(1), 44.

Doroquez, D. B., Berciu, C., Anderson, J. R., Sengupta, P., & Nicastro, D. (2014). A high-resolution morphological and ultrastructural map of anterior sensory cilia and glia in Caenorhabditis elegans. Elife, 3, e01948.

148

References

Downes, M., Meade, C., Boyle, S., Rolston, A., & Kakouli-Duarte, T. (2009). Intraspecific variation among isolates of the entomopathogenic nematode Steinernema feltiae from Bull Island, Ireland. Nematology, 11(3), 439-451.

Dreyer, J., Malan, A. P., & Dicks, L. M. (2018). Bacteria of the genus Xenorhabdus, a novel source of bioactive compounds. Frontiers in Microbiology, 9.

Duchaud, E., Rusniok, C., Frangeul, L., Buchrieser, C., Givaudan, A., Taourit, S., Bocs, S., Boursaux-Eude, C., Chandler, M., Charles, J. F., Dassa, E., Derose, R., Derzelle, S., Freyssinet, G., Gaudriault, S., Médigue, C., Lanois, A., Powell, K., Siguier, P., Vincent, R., Wingate, V., Zouine, M., Glaser, P., Boemare, N., Danchin, A., & Kunst, F. (2003). The genome sequence of the entomopathogenic bacterium Photorhabdus luminescens. Nature Biotechnology, 21(11), 1307.

Duveau, F., & Félix, M. A. (2012). Role of pleiotropy in the evolution of a cryptic developmental variation in Caenorhabditis elegans. PLOS Biology, 10(1), e1001230.

Ebssa, L., & Koppenhöfer, A. M. (2012). Entomopathogenic nematodes for the management of Agrotis ipsilon: effect of instar, nematode species and nematode production method. Pest Management Science, 68(6), 947-957.

Edison, A. S. (2009). Caenorhabditis elegans pheromones regulate multiple complex behaviors. Current Opinion in Neurobiology, 19(4), 378-388.

Edmunds, C., Post, R. J., Wilding, C. S., & Rae, R. (2018). A survey investigating the diversity and distribution of entomopathogenic nematodes in the UK and the first confirmed UK record of Steinernema carpocapsae, Nematology, 20(9), 851-858. doi:https://doi.org/10.1163/15685411-00003180

Evans, E. W., & England, S. (1996). Indirect Interactions in Biological Control of Insects: Pests and Natural Enemies in Alfalfa. Ecological Applications, 6(3), 920-930.

149

References

Ezcurra, M., Walker, D. S., Beets, I., Swoboda, P., & Schafer, W. R. (2016). Neuropeptidergic signaling and active feeding state inhibit nociception in Caenorhabditis elegans. Journal of Neuroscience, 36(11), 3157-3169.

FAO; Food and Agriculture Organization of the United Nations (2009). Global agriculture towards 2050. [last accessed June 2019] http://www.fao.org/fileadmin/templates/wsfs/docs/Issues_papers/HLEF20 50_Global_Agriculture.pdf

Félix, M. A. (2008). RNA interference in nematodes and the chance that favored Sydney Brenner. Journal of Biology, 7(9), 34.

Fenk, L. A., & de Bono, M. (2015). Environmental CO2 inhibits Caenorhabditis elegans egg-laying by modulating olfactory neurons and evokes widespread changes in neural activity. Proceedings of the National Academy of Sciences, 112(27), e3525-e3534.

Ferris, V. R. (1993). Variation in spacer ribosomal DNA in some cyst-forming species of plant parasitic nematodes. Fundamental & Applied Nematology, 16, 177-184.

Fire, A., Albertson, D., Harrison, S. W., & Moerman, D. G. (1991). Production of antisense RNA leads to effective and specific inhibition of gene expression in C. elegans muscle. Development, 113(2), 503-514.

Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., & Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391(6669), 806.

Fleischmann, R. D., Adams, M. D., White, O., Clayton, R. A., Kirkness, E. F., Kerlavage, A. R., Bult, C. J., Tomb, J. F., Dougherty, B. A., & Merrick, J. M. (1995). Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science, 269(5223), 496-512.

Ford, L., Zhang, J., Liu, J., Hashmi, S., Fuhrman, J. A., Oksov, Y., & Lustigman, S. (2009). Functional analysis of the cathepsin-like cysteine protease genes in adult Brugia malayi using RNA interference. PLOS Neglected Tropical Diseases, 3(2), e377.

150

References

Fraga, D. F., Parker, J., Busoli, A. C., Hamilton, G. C., Nielsen, A. L., & Rodriguez-Saona, C. (2017). Behavioral responses of predaceous minute pirate bugs to tridecane, a volatile emitted by the brown marmorated stink bug. Journal of Pest Science, 90(4), 1107-1118.

Frank, J. H., & Walker, T. J. (2006). Permanent control of pest mole crickets (Orthoptera: Gryllotalpidae: Scapteriscus) in Florida. American Entomologist, 52(3), 138-144.

Franks, C. J., Holden-Dye, L., Williams, R. G., Pang, F. Y., & Walker, R. J. (1994). A nematode FMRFamide-like peptide, SDPNFLRFamide (PF1), relaxes the dorsal muscle strip preparation of Ascaris suum. Parasitology, 108(2), 229-236.

Fravel, D. R. (2005). Commercialization and Implementation of Biocontrol. Annual Review of Phytopathology, 43, 337-359.

Frooninckx, L., Van Rompay, L., Temmerman, L., Van Sinay, E., Beets, I., Janssen, T., Husson, S. J., & Schoofs, L. (2012). Neuropeptide GPCRs in C. elegans. Frontiers in Endocrinology, 3, 167. doi:10.3389/fendo.2012.00167

Fucarino, A., Millar, J. G., McElfresh, J. S., & Colazza, S. (2004). Chemical and Physical Signals Mediating Conspecific and Heterospecific Aggregation Behavior of First Instar Stink Bugs. Journal of Chemical Ecology, 30(6), 1257–1269. doi:10.1023/b:joec.0000030276.32665.cb

Gang, S. S., & Hallem, E. A. (2016). Mechanisms of host seeking by parasitic nematodes. Molecular and Biochemical Parasitology, 208(1), 23-32.

Gaugler, R. (1988). Ecological considerations in the biological control of soil-inhabiting insects with entomopathogenic nematodes. Agriculture, Ecosystems & Environment, 24(1-3), 351-360.

Gaugler, R., & Campbell, L. R. (1991). Role of the sheath in desiccation tolerance of two entomopathogenic nematodes. Nematologica, 37(1-4), 324-332. doi:https://doi.org/10.1163/187529291X00321

Gaugler, R., & Georgis, R. (1991). Culture method and efficacy of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae). Biological Control, 1(4), 269-274.

151

References

Gaugler, R., Adams, B., Bilgrami, A., & Shapiro-Ilan, D. (2006). Source of trait deterioration in entomopathogenic nematodes Heterorhabditis bacteriophora and Steinernema carpocapsae during in vivo culture. Nematology, 8(3), 397-409.

Gaugler, R., Campbell, J. F., & Gupta, P. (1991). Characterization and basis of enhanced host-finding in a genetically improved strain of Steinernema carpocapsae. Journal of Invertebrate Pathology, 57(2), 234-241.

Gaugler, R., Campbell, J. F., & McGuire, T. R. (1989). Selection for host- finding in Steinernema feltiae. Journal of Invertebrate Pathology, 54(3), 363-372.

Geldhof, P., Murray, L., Couthier, A., Gilleard, J. S., McLauchlan, G., Knox, D. P., & Britton, C. (2006). Testing the efficacy of RNA interference in Haemonchus contortus. International Journal for Parasitology, 36(7), 801- 810.

Georgis, R., & Gaugler, R. (1991). Predictability in biological control using entomopathogenic nematodes. Journal of economic entomology, 84(3), 713-720.

Georgis, R., Koppenhöfer, A. M., Lacey, L. A., Bélair, G., Duncan, L. W., Grewal, P. S. & Van Tol, R. W. H. M. (2006). Successes and failures in the use of parasitic nematodes for pest control. Biological Control, 38(1), 103- 123.

Georgis, R., & Poinar Jr., G.O. (1994). Nematodes as biopesticides in turf and ornamentals. In: Leslie, A. (Ed.), Integrated Pest Management for Turf and Ornamentals. CRC Press, Boca Raton, FL, USA, pp. 477–489.

Granzer, M., & Haas, W. (1991). Host-finding and host recognition of infective Ancylostoma caninum larvae. International Journal for Parasitology, 21(4), 429-440.

Gray, J. M., Karow, D. S., Lu, H., Chang, A. J., Chang, J. S., Ellis, R. E., Marletta, M. A., & Bargmann, C. I. (2004). Oxygen sensation and social feeding mediated by a C. elegans guanylate cyclase homologue. Nature, 430(6997), 317.

152

References

Grewal, P. S., Ehlers, R. U., & Shapiro-Ilan, D. I. (2005). Nematodes as Biocontrol Agents. CABI. New York, NY

Grewal, P. S., Grewal, S. K., Malik, V. S., & Klein, M. G. (2002a). Differences in susceptibility of introduced and native white grub species to entomopathogenic nematodes from various geographic localities. Biological Control, 24(3), 230-237.

Grewal, P. S., Lewis, E. E., Gaugler, R., & Campbell, J. F. (1994a). Host finding behaviour as a predictor of foraging strategy in entomopathogenic nematodes. Parasitology, 108(2), 207-215.

Grewal, P. S., Selvan, S., & Gaugler, R. (1994b). Nematodes: Niche Breadth For Infection, Establishment, And Reproduction. Journal of Thermal Biology, 19(4), 245-253.

Grewal, P.S., Selvan, S., Gaugler, R. (1994). Thermal adaptation of entomopathogenic nematodes: Niche breadth for infection, establishment, and reproduction. Journal of Thermal Biology. 19, 245–253.

Grewal, P. S., Wang, X., & Taylor, R. A. J. (2002b). Dauer juvenile longevity and stress tolerance in natural populations of entomopathogenic nematodes: is there a relationship?. International Journal for Parasitology, 32(6), 717-725.

Griffin, C. T., Dix, I., Joyce, S. A., Burnell, A. M., & Downes, M. J. (1999). Isolation and characterisation of Heterorhabditis spp. (Nematoda: Heterorhabditidae) from Hungary, Estonia and Denmark. Nematology, 1(3), 321-332.

Griffin, C. T., Downes, M. J., & Block, W. (1990). Tests of Antarctic soils for insect parasitic nematodes. Antarctic Science, 2(3), 221-222.

Griffin, C. T., Moore, J. F., & Downes, M. J. (1991). Occurrence of insect- parasitic nematodes (Steinernematidae, Heterorhabditidae) in the Republic of Ireland. Nematologica, 37(1), 92-100.

Griffin, C., Joyce, S. A., Dix, I., Burnell, A. M., & Downes, M. J. (1994). Characterisation of the entomopathogenic nematode Heterorhabditis (Nematoda: Heterorhabditidae) from Ireland and Britain by molecular and

153

References cross-breeding techniques, and the occurrence of the genus in these islands. Fundamental Applied Nematology, 17(3), 245-253.

Griffin, C., Rolston, A., & Downes, M. (2005). Distribution of entomopathogenic nematodes in an Irish sand dune system. Nematology, 7(2), 259-266.

Grunberger, D., Weinstein, I. B., & Jacobson, K. B. (1969). Codon recognition by enzymatically mischarged valine transfer ribonucleic acid. Science, 166(3913), 1635-1637.

Guerenstein, P., & Guerin, P. (2001). Olfactory and behavioural responses of the blood-sucking bug Triatoma infestans to odours of vertebrate hosts. Journal of Experimental Biology, 204(3), 585-597.

Guo, S., & Kemphues, K. J. (1995). par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell, 81(4), 611-620.

Gwynn, R. L., & Richardson, P. N. (1996). Incidence of entomopathogenic nematodes in soil samples collected from Scotland, England and Wales. Fundamental and Applied Nematology, 19(5), 427-431.

Hailu, T., Habtegebriel, B., & Daba, T. (2018) In-vitro and In-vivo Evaluation of Entomopathogenic nematodes, Steinernema yirgalemense and Heterorhabditis bacteriophora for control of Red Teff Worm, Mentaxya ignicollis. Journal of Plant Sciences and Agricultural Research, 3, 1-17.

Hall, D. H., & Russell, R. L. (1991). The posterior nervous system of the nematode Caenorhabditis elegans: serial reconstruction of identified neurons and complete pattern of synaptic interactions. Journal of Neuroscience. 11, 1–22.

Hallem, E. A., & Sternberg, P. W. (2008). Acute carbon dioxide avoidance in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the United States of America, 105, 8038-43.

Hallem, E. A., Dillman, A. R., Hong, A. V., Zhang, Y., Yano, J. M., DeMarco, S. F., & Sternberg, P. W. (2011a). A sensory code for host seeking in parasitic nematodes. Current Biology, 21(5), 377-383.

154

References

Hallem, E. A., Spencer, W. C., McWhirter, R. D., Zeller, G., Henz, S. R., Rätsch, G., Miller, D. M., Horvitz, H. R., Sternberg, P. W., & Ringstad, N. (2011b). Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans. Proceedings of the National Academy of Sciences, 108(1), 254-259. doi:https://doi.org/10.1073/pnas.1017354108

Hammond, S. M., Bernstein, E., Beach, D. & Hannon, G. J. (2000). An RNA- directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature, 404, 293–296

Han, Z., Boas, S., & Schroeder, N. E. (2016) Unexpected Variation in Neuroanatomy among Diverse Nematode Species. Frontiers in Neuroanatomy. 9, 162. doi:10.3389/fnana.2015.00162

Hartley, S. M., & Wallace, J. R. (2018). The effects of soil moisture, soil texture, and host orientation on the ability of Heterorhabditis bacteriophora (Rhabditida: Heterorhabditidae) to infect Galleria mellonella (Lepidoptera: Pyralidae). The Great Lakes Entomologist, 50(2), 4.

Hatab, M. A. A., & Gaugler, R. (1999). Lipids of in vivo and in vitro cultured Heterorhabditis bacteriophora. Biological Control, 15(2), 113-118.

Hatting, J., Stock, S. P., & Hazir, S. (2009). Diversity and distribution of entomopathogenic nematodes (Steinernematidae, Heterorhabditidae) in South Africa. Journal of Invertebrate Pathology, 102(2), 120-128.

Hayden, E. C . (2014) Is the $1,000 genome for real? Nature News.

Hauser, A. S., Chavali, S., Masuho, I., Jahn, L. J., Martemyanov, K. A., Gloriam, D. E., & Babu, M. M. (2018). Pharmacogenomics of GPCR drug targets. Cell, 172(1-2), 41-54.

Hazir, S., Keskin, N., Stock, S. P., Kaya, H. K., & Özcan, S. (2003). Diversity and distribution of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) in Turkey. Biodiversity & Conservation, 12(2), 375-386.

Hazir, S., Stock, S. P., Kaya, H. K., Koppenhofer, A. M., & Keskin, N. (2002). Developmental temperature effects on five geographic isolates of the

155

References entomopathogenic nematode Steinernema feltiae (Nematoda: Steinernematidade). Journal of Invertebrate Pathology. 77, 243–250.

Head, J., & Walters, K. F. A. (2002). Augmentation biological control using the entomopathogenic nematode Steinernema feltiae against the South American leafminer Liriomyza huidobrensis. In International Symposium on Biological Control of Arthropods. Honolulu (pp. 136-140).

Henderson, G., Manweiler, S. A., Lawrence, W. J., Tempelman, R. J., & Foil, L. D. (1995). The effects of Steinernema carpocapsae (Weiser) application to different life stages on adult emergence of the cat flea Ctenocephalides felis (Bouche). Veterinary Dermatology, 6(3), 159-163.

Hillier, L. W., Coulson, A., Murray, J. I., Bao, Z., Sulston, J. E., & Waterston, R. H. (2005). Genomics in C. elegans: so many genes, such a little worm. Genome Research, 15(12), 1651-1660.

Hillis, D. M., & Dixon, M. T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology, 66(4), 411- 453.

Hinas, A., Wright, A. J., & Hunter, C. P. (2012). SID-5 is an endosome- associated protein required for efficient systemic RNAi in C. elegans. Current Biology, 22(20), 1938-1943.

Ho, H. Y., & Millar, J. G. (2001). Compounds in metathoracic glands of adults and dorsal abdominal glands of nymphs of the stink bugs, Chlorochroa uhleri, C. sayi, and C. ligata (Hemiptera: Pentatomidae). Zoological Studies-Taipei, 40(3), 193-198.

Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T., Holovachov, O., Bakker, J., & Holder, J. (2006). Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution, 23, 1792–1800. doi:10.1093/molbev/ msl044

Homininck, W. M., & Briscoe, B. R. (1990). Occurrence of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) in British soils. Parasitology, 100(2), 295-302.

156

References

Hominick, W. M., Reid, A. P., Bohan, D. A., & Briscoe, B. R. (1996). Entomopathogenic nematodes: biodiversity, geographical distribution and the convention on biological diversity. Biocontrol Science and Technology, 6(3), 317-332.

Hong, R. L., Riebesell, M., Bumbarger, D. J., Cook, S. J., Carstensen, H. R., Sarpolaki, T., Cochella, L., Castrejon, J., Moreno, E., Sieriebriennikov, B., Hobert, O., & Sommer, R. J. (2019). Evolution of neuronal anatomy and circuitry in two highly divergent nematode species. Elife, 8.

Hudson, W. G., Frank, J. H., & Castner, J. L. (2014). Biological control of Scapteriscus spp. mole crickets (Orthoptera: Gryllotalpidae) in Florida. Bulletin of the ESA, 34(4), 192-198. doi:http://dx.doi.org/10.1093/besa/34.4.192

Howe, K. L., Bolt, B. J., Shafie, M., Kersey, P. & Berriman, M. (2017). WormBase ParaSite − a comprehensive resource for helminth genomics. Molecular and Biochemical Parasitology, 215 2-10. doi:10.1016/j.molbiopara.2016.11.005 [last accessed October 2019] https://parasite.wormbase.org

Hunt, V. L., Tsai, I. J., Coghlan, A., Reid, A. J., Holroyd, N., Foth, B. J., Tracey, A., Cotton, J. A., Stanley, E. J., Beasley, H., Bennett, H. M., Brooks, K., Harsha, B., Kajitani, R., Kulkami, A., Hardback, D., Nagayasu, E., Nichol, S., Ogura, Y., Quail, M. A., Randle, N., Xia, D., Brattig, N. W., Soblik, H., Ribeiro, D, M., Sanchez-Flores, A., Hayashi, T., Itoh, T., Denver, D. R., Grant, W., Stoltzfus, J. D., Lok, J. B., Murayama, H., Wastling, J., Streit, A., Kikuchi, T., Viney, M., & Berriman, M. (2016). The genomic basis of parasitism in the Strongyloides clade of nematodes. Nature Genetics, 48(3), 299.

Ishibashi, N., & Takii, S. (1993). Effects of Insecticides on Movement, Nictation, and Infectivity of Steinernema carpocapsae. Journal of Nematology, 25(2), 204-13.

Islam, M. K., Miyoshi, T., Yamada, M., & Tsuji, N. (2005). Pyrophosphatase of the roundworm Ascaris suum plays an essential role in the worm's molting and development. Infection and Immunity, 73(4), 1995-2004.

157

References

Issa, Z., Grant, W. N., Stasiuk, S., & Shoemaker, C. B. (2005). Development of methods for RNA interference in the sheep gastrointestinal parasite, Trichostrongylus colubriformis. International Journal for Parasitology, 35(9), 935–940. doi:10.1016/j.ijpara.2005.06.001

Jagdale, G. B., Casey, M. L., Grewal, P. S., & Lindquist, R. K. (2004). Application rate and timing, potting medium, and host plant effects on the efficacy of Steinernema feltiae against the fungus gnat, Bradysia coprophila, in floriculture. Biological Control, 29(2), 296–305. doi:10.1016/s1049-9644(03)00164-6

Janssen, T., Husson, S. J., Lindemans, M., Mertens, I., Rademakers, S., Ver Donck, K., Geysen, J., Jansen, G., & Schoofs, L. (2008). Functional characterization of three G protein-coupled receptors for pigment dispersing factors in Caenorhabditis elegans. Journal of Biological Chemistry, 283(22), 15241-15249.

Jarecki, J. L., Andersen, K., Konop, C. J., Knickelbine, J. J., Vestling, M. M., & Stretton, A. O. (2010). Mapping neuropeptide expression by mass spectrometry in single dissected identified neurons from the dorsal ganglion of the nematode Ascaris suum. ACS Chemical Neuroscience, 1(7), 505-519. doi:https://doi.org/10.1021/cn1000217

Jawish, A., Al‐assas, K., & Basheer, A. (2015). A survey of entomopathogenic nematodes of the families Steinernematidae and Heterorhabditidae (Nematoda: Rhabditida) in Damascus countryside of Syria. EPPO Bulletin, 45(1), 81-89.

Jee, C., Lee, J., Lim, J. P., Parry, D., Messing, R. O., & McIntire, S. L. (2012). SEB-3, a CRF receptor-like GPCR, regulates locomotor activity states, stress responses and ethanol tolerance in Caenorhabditis elegans. Genes, Brain, and Behavior, 12(2), 250-62.

Jing, Y., Toubarro, D., Hao, Y., & Simões, N. (2010). Cloning, characterisation and heterologous expression of an astacin metalloprotease, Sc-AST, from the entomoparasitic nematode Steinernema carpocapsae. Molecular and Biochemical Parasitology, 174(2), 101-108.

158

References

Johnigk, S. A., & Ehlers, R. U. (1999). Juvenile development and life cycle of Heterorhabditis bacteriophora and H. indica (Nematoda: Heterorhabditidae). Nematology, 1(3), 251-260.

Jose, A. M., Kim, Y. A., Leal-Ekman, S., & Hunter, C. P. (2012). Conserved tyrosine kinase promotes the import of silencing RNA into Caenorhabditis elegans cells. Proceedings of the National Academy of Sciences, 109(36), 14520-14525.

Jose, A. M., Smith, J. J., & Hunter, C. P. (2009). Export of RNA silencing from C. elegans tissues does not require the RNA channel SID-1. Proceedings of the National Academy of Sciences, 106(7), 2283-2288.

Kagimu, N., Ferreira, T., & Malan, A. P. (2017). The Attributes of Survival in the Formulation of Entomopathogenic Nematodes Utilised as Insect Biocontrol Agents. African Entomology, 25(2), 275–291. doi:10.4001/003.025.0275

Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., & Ahringer, J. (2000). Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology, 2(1).

Kaplan, F., Alborn, H. T., von Reuss, S. H., Ajredini, R., Ali, J. G., Akyazi, F.,

Stelinski, L. L., Edison, A. S., Schroeder, F. C., & Teal, P. E. (2012). Interspecific nematode signals regulate dispersal behavior. PLOS One, 7(6).

Kary, N. E., Niknam, G., Mohammadi, S. A., Griffin, C., & Moghaddam, M. (2009). A survey of entomopathogenic nematodes of the families Steinernematidae and Heterorhabditidae (Nematoda: Rhabditida) in the north-west of Iran. Nematology, 11(1), 107-116.

Kaushal, K. K., Renuka, R., Naved, S. H., & Siya, N. (2000). Survey of entomopathogenic nematodes in India. Annals of Plant Protection Sciences, 8(1), 119-121.

Kaya, H. K., & Gaugler, R. (1993). Entomopathogenic nematodes. Annual Review of Entomology, 38(1), 181-206.

159

References

Kaya, H.K., & A.M. Koppenhöfer. (1999). Biology and Ecology of Insecticidal Nematodes. In Workshop Proceedings: Optimal Use of Insecticidal Nematodes in Pest Management, pp. 1–8. Edited by S. Polavarapu, Rutgers University.

Kenyon, C., Chang, J., Gensch, E., Rudner, A., & Tabtiang, R. (1993). A C. elegans mutant that lives twice as long as wild type. Nature, 366(6454), 461.

Kepenekci, I. (2002). Entomopathogenic nematodes (Rhabditida) in the Mediterranean region of Turkey. Nematologia Mediterranea, 30(1).

Ketting, R. F., Fischer, S. E., Bernstein, E., Sijen, T., Hannon, G. J., & Plasterk, R. H. (2001). Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes & Development, 15(20), 2654-2659.

Kim, K., & Li, C. (2004). Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans. The Journal of Comparative Neurology, 475(4), 540–550. doi:10.1002/cne.20189

Kimber, M. J., McKinney, S., McMaster, S., Day, T. A., Fleming, C. C., & Maule, A. G. (2007). flp gene disruption in a parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA interference. The FASEB Journal, 21(4), 1233–1243. doi:10.1096/fj.06-7343com

Kinoshita, M., & Yamanaka, S. (1998) Development and prevalence of entomopathogenic nematodes in Japan. Japanese Journal of Nematology 28, 42–45.

Kiontke, K., & Sudhaus, W. (2006). Ecology of Caenorhabditis species. WormBook, 9, 1-14.

Knox, J., Morris, J., & Hess, T. (2010). Identifying future risks to UK agricultural crop production: Putting climate change in context. Outlook on Agriculture, 39(4), 249-256.

Koppenhöfer, A. M., & Fuzy, E. M. (2003). Biological and chemical control of the Asiatic garden beetle, Maladera castanea (Coleoptera: Scarabaeidae). Journal of Economic Entomology, 96(4), 1076-1082.

160

References

Koppenhöfer, A. M., & Kaya, H. K. (1997). Additive and Synergistic Interaction between Entomopathogenic Nematodes and Bacillus thuringiensis for Scarab Grub Control. Biological Control, 8(2), 131-137.

Koppenhöfer, A. M., Cowles, R. S., Cowles, E. A., Fuzy, E. M., & Baumgartner, L. (2002). Comparison of neonicotinoid insecticides as synergists for entomopathogenic nematodes. Biological Control, 24(1), 90- 97.

Koppenhöfer, A. M., Grewal, P. S., & Kaya, H. K. (2000). Synergism of imidacloprid and entomopathogenic nematodes against white grubs: the mechanism. Entomologia Experimentalis et Applicata, 94(3), 283-293.

Kosaka, N., Iguchi, H., Yoshioka, Y., Takeshita, F., Matsuki, Y., & Ochiya, T. (2010). Secretory mechanisms and intercellular transfer of microRNAs in living cells. Journal of Biological Chemistry, jbc-M110.

Kotze, A. C., & Bagnall, N. H. (2006). RNA interference in Haemonchus contortus: Suppression of beta-tubulin gene expression in L3, L4 and adult worms in vitro. Molecular and Biochemical Parasitology, 145(1), 101–110.

Kou, R., Tang, D. S., & Chow, Y. S. (1989). Alarm pheromone of pentatomid bug, Erthesina fullo Thunberg (Hemiptera: Pentatomidae). Journal of Chemical Ecology, 15(12), 2695-2702.

Krajniak, K. G. (2013). Invertebrate FMRFamide related peptides. Protein and Peptide Letters, 20(6), 647-670.

Krall, B. S., Bartelt, R. J., Lewis, C. J., & Whitman, D. W. (1999). Chemical defense in the stink bug Cosmopepla bimaculata. Journal of Chemical Ecology, 25(11), 2477-2494.

Krishnan, A., Almén, M. S., Fredriksson, R., & Schiöth, H. B. (2014). Insights into the origin of nematode chemosensory GPCRs: putative orthologs of the Srw family are found across several phyla of protostomes. PLOS One, 9(3), e93048. doi:https://doi.org/10.1371/journal.pone.0093048

Kruitbos, L. M., Heritage, S., & Wilson, M. J. (2008). Phoresy in entomopathogenic nematodes-a mode of dispersal?. Insect Pathogens and Insect Parasitic Nematodes, 31, 278.

161

References

Kumari, C., Dutta, T. K., Chaudhary, S., Banakar, P., Papolu, P. K., & Rao, U. (2017). Molecular characterization of FMRFamide-like peptides in Meloidogyne graminicola and analysis of their knockdown effect on nematode infectivity. Gene, 619, 50–60. doi:10.1016/j.gene.2017.03.042

Kung, S. P., Gaugler, R., & Kaya, H. K. (1990). Soil type and entomopathogenic nematode persistence. Journal of Invertebrate Pathology, 55(3), 401-406.

Lai, S. R., Andrews, L. G., & Tollefsbol, T. O. (2007). RNA interference using a plasmid construct expressing short-hairpin RNA. In Telomerase Inhibition (pp. 31-37). Humana Press.

Larsch, J., Ventimiglia, D., Bargmann, C. I., & Albrecht, D. R. (2013). High- throughput imaging of neuronal activity in Caenorhabditis elegans. Proceedings of the National Academy of Sciences, 110(45), e4266-e4273.

Laznik, Ž., & Trdan, S. (2016). Attraction Behaviors of Entomopathogenic Nematodes (Steinernematidae and Heterorhabditidae) to Synthetic Volatiles Emitted by Insect Damaged Potato Tubers. Journal of Chemical Ecology, 42(4), 314–322. doi:10.1007/s10886-016-0686-y

LeBeck, L. M., Gaugler, R., Kaya, H. K., Hara, A. H., & Johnson, M. W. (1993). Host stage suitability of the leafminer Liriomyza trifolii (Diptera: Agromyzidae) to the entomopathogenic nematode Steinernema carpocapsae (Rhabditida: Steinernematidae). Journal of Invertebrate Pathology, 62(1), 58-63.

Lee, D., Lee, H., Choi, M. K., Park, S., & Lee, J. (2015). Nictation assays for Caenorhabditis and other nematodes. Bioprotocol, 5, e1433.

Lee, J. H., Dillman, A. R., & Hallem, E. A. (2016). Temperature-dependent changes in the host-seeking behaviors of parasitic nematodes. BMC Biology, 14(1), 36.

Lee, D., Lee, H., Kim, N., Lim, D. S., & Lee, J. (2017). Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans. Biochemical and Biophysical Research Communications, 484(2), 323–330. doi:10.1016/j.bbrc.2017.01.113

162

References

Lee, H., Choi, M., Lee, D., Kim, H., Hwang, H., Kim, H., Hwang, H., Kim, H., Park, S., Paik, Y., & Lee, J. (2012). Nictation, a dispersal behavior of the nematode Caenorhabditis elegans, is regulated by IL2 neurons. Nature Neuroscience, 15(1), 107–112. doi:10.1038/nn.2975

Leng, N., Dawson, J., & Kendziorski, C. (2014). EBSeq: An R Package for Gene and Isoform Differential Expression Analysis of RNA-seq Data. R Package Version 1.2. 0.

Lewis, E. E., Gaugler, R., & Harrison, R. (1993). Response of cruiser and ambusher entomopathogenic nematodes (Steinernematidae) to host volatile cues. Canadian journal of Zoology, 71(4), 765-769.

Li, C. (2006). The ever-expanding neuropeptide gene families in the nematode Caenorhabditis elegans. Parasitology, 131(S1), S109. doi:10.1017/s0031182005009376

Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics, 12(1), 323. doi:10.1186/1471-2105-12-323

Li, C., & Kim, K. (2014). Family of FLP peptides in Caenorhabditis elegans and related nematodes. Frontiers in Endocrinology, 5, 150. doi:http://dx.doi.org/10.3389%2Ffendo.2014.00150

Lim, M. A., Chitturi, J., Laskova, V., Meng, J., Findeis, D., Wiekenberg, A., Mulcahy, B., Luo, L., Li, Y., Lu, Y., Hung, W., Qu, Y., Ho, C. Y., Holmyard, D., Ji, N., McWhirter, R., Samuel, A. D., Miller, D. M., Schnabel, R., Calarco, J. A., & Zhen, M. (2016). Neuroendocrine modulation sustains the C. elegans forward motor state. Elife, 5, e19887. doi:10.7554/eLife. 19887

Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550.

Lu, D., Macchietto, M., Chang, D., Barros, M. M., Baldwin, J., Mortazavi, A., & Dillman, A. R. (2017). Activated entomopathogenic nematode infective juveniles release lethal venom proteins. PLOS Pathogens, 13(4), e1006302.

163

References

Lustigman, S., Zhang, J., Liu, J., Oksov, Y., & Hashmi, S. (2004). RNA interference targeting cathepsin L and Z-like cysteine proteases of Onchocerca volvulus confirmed their essential function during L3 molting. Molecular and Biochemical Parasitology, 138(2), 165–170. doi:10.1016/j.molbiopara.2004.08.003

Macosko, E. Z., Pokala, N., Feinberg, E. H., Chalasani, S. H., Butcher, R. A., Clardy, J., & Bargmann, C. I. (2009). A hub-and-spoke circuit drives pheromone attraction and social behaviour in C. elegans. Nature, 458(7242), 1171.

Madaure, J. T., Mashela, P. W., & De Waele, D. (2017). Responses of entomopathogenic nematode, Steinernema feltiae to cucurbitacin- containing Nemafric-BL phytonematicide. Res Crops, 18, 739-744.

Margie, O., Palmer, C., & Chin-Sang, I. (2013). C. elegans chemotaxis assay. JoVE (Journal of Visualized Experiments), (74), e50069.

Marketsandmarkets. (March 2019). Biopesticides Market by Type (Bioinsecticides, Biofungicides, and Bionematicides), Source (Microbials, Plant Extracts, and Beneficial Insects), Mode of Application, Formulation, Crop Application, and Region -Global Forecast to 2023. https://www.marketsandmarkets.com/Market-Reports/biopesticides- 267.html (accessed August 2019).

McCoy, C. J., Atkinson, L. E., Zamanian, M., McVeigh, P., Day, T. A., Kimber, M. J., Marks, N. J., Maule, A. G., & Mousley, A. (2014). New insights into the FLPergic complements of parasitic nematodes: informing deorphanisation approaches. EuPA Open Proteomics, 3, 262-272.

McCoy, C. J., Atkinson, L. E., Robb, E., Marks, N. J., Maule, A. G., & Mousley, A. (2017). Tool-driven advances in neuropeptide research from a nematode parasite perspective. Trends in Parasitology, 33(12), 986-1002.

McEwan, D. L., Weisman, A. S., & Hunter, C. P. (2012). Uptake of extracellular double-stranded RNA by SID-2. Molecular Cell, 47(5), 746-754.

McVeigh, P., Geary, T. G., Marks, N. J., & Maule, A. G. (2006). The FLP-side of nematodes. Trends in Parasitology, 22(8), 385-396.

164

References

Miklasiewicz, T. J., Grewal, P. S., Hoy, C. W., & Malik, V. S. (2002). Evaluation of entomopathogenic nematodes for suppression of carrot weevil. BioControl, 47(5), 545-561.

Montejo, R., & Montes, M. (1990). Susceptibility of neonatal Pachnaeus litus larvae to the activity of Metarhizium anisopliae, Beauveria bassiana and Heterorhabditis heliothidis in soil and in direct contamination under laboratory conditions. Ciencia y Tecnica en la Agricultura. Citricos y Otros Frutales, 13(3-4), 63-71.

Morris, R., Wilson, L., Sturrock, M., Warnock, N. D., Carrizo, D., Cox, D., Maule, A. G., & Dalzell, J. J. (2017). A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae. PLOS Pathogens, 13(3), e1006185. doi:https://doi.org/10.1371/journal.ppat.1006185

Mouse Genome Sequencing Consortium. (2002). Initial sequencing and comparative analysis of the mouse genome. Nature, 420(6915), 520.

Mráček, Z. (1986). Nematodes and other factors controlling the sawfly, Cephaleia abietis (Pamphilidae: Hymenoptera), in Czechoslovakia. Forest Ecology and Management, 15(1), 75–79. doi:10.1016/0378-1127(86)90092-7

Mráček, Z., Becvár, S., & Kindlmann, P. (1999). Survey of entomopathogenic nematodes from the families Steinernematidae and Heterorhabditidae (Nematoda: Rhabditida) in the Czech Republic. Folia Parasitologica, 46(4), 145-148.

Myrand, V., Buffet, J. P., & Guertin, C. (2015). Susceptibility of cabbage maggot larvae (Diptera: Anthomyiidae) to hypocreales entomopathogenic fungi. Journal of Economic Entomology, 108(1), 34-44.

Najafi, E., Devineni, N., Khanbilvardi, R. M., & Kogan, F. (2018). Understanding the changes in global crop yields through changes in climate and technology. Earth's Future, 6(3), 410-427.

165

References

Napoli, C., Lemieux, C., & Jorgensen, R. (1990). Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. The Plant Cell, 2(4), 279-289.

Nardi, S., Ricci, E., Lozzi, R., Marozzi, F., Ladurner, E., Chiabrando, F., Granchelli, L., Verdolini, E., Isidoro, N., & Riolo, P. (2011). Control of Rhynchophorus ferrugineus (Olivier, 1790) according to EU Decision 2007/365/EC in the Marche region (Central‐Eastern Italy). EPPO Bulletin, 41(2), 103-115.

Nathoo, A. N., Moeller, R. A., Westlund, B. A., & Hart, A. C. (2001). Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species. Proceedings of the National Academy of Sciences of the United States of America. 98, 14000–14005.

National Human Genome Research Institute. (2003). The Human Genome Project Completion: Frequently Asked Questions. [ONLINE] Available at: https://www.genome.gov/11006943/human-genome-project-completion- frequently-asked-questions/. [Accessed 7 October 2018].

Neumann, G., & Shields, E. J. (2006). Interspecific interactions among three entomopathogenic nematodes, Steinernema carpocapsae Weiser, S. feltiae Filipjev, and Heterorhabditis bacteriophora Poinar, with different foraging strategies for hosts in multipiece sand columns. Environmental Entomology, 35(6), 1578-1583.

Neumann, G., & Shields, E. J. (2008). Multiple-species natural enemy approach for biological control of alfalfa snout beetle (Coleoptera: Curculionidae) using entomopathogenic nematodes. Journal of Economic Entomology, 101(5), 1533-1539.

Neumann, G., & Shields, E. J. (2011). Field persistence of Steinernema carpocapsae Weiser (NY001), Steinernema feltiae Filipjev (Valko) and Heterorhabditis bacteriophora Poinar (Oswego) in Alfalfa fields. Gt. Lakes. Entomology, 44, 42-52.

Nguyen, K. B., Maruniak, J., & Adams, B. J. (2001). Diagnostic and phylogenetic utility of the rDNA internal transcribed spacer sequences of Steinernema. Journal of Nematology, 33(2-3), 73.

166

References

Nicholson, A. W. (2014). Ribonuclease III mechanisms of double‐stranded RNA cleavage. Wiley Interdisciplinary Reviews: RNA, 5(1), 31-48.

Niimura, Y., & Nei, M. (2007). Extensive gains and losses of olfactory receptor genes in mammalian evolution. PLOS One, 2(8), e708.

Niknam, G., Kary, N. E., Nikdel, M., & Griffin, C. (2010). Diversity of entomopathogenic nematodes (Nematoda: Steinernematidae, Heterorhabditidae) from Arasbaran forests and rangelands in north-west Iran. Nematology, 12(5), 767-773.

Nixon, L. J., Morrison, W. R., Rice, K. B., Brockerhoff, E. G., Leskey, T. C., Guzman, F., Khrimian, A., Goldson, S., & Rostás, M. (2018). Identification of volatiles released by diapausing brown marmorated stink bug, Halyomorpha halys (Hemiptera: Pentatomidae). PlOS One, 13(1), e0191223. doi:https://doi.org/10.1371/journal. pone.0191223

Oerke, E. C. (2006). Crop losses to pests. The Journal of Agricultural Science, 144(1), 31-43. doi:http://dx.doi.org/10.1017/S0021859605005708

Papolu, P. K., Gantasala, N. P., Kamaraju, D., Banakar, P., Sreevathsa, R., & Rao, U. (2013). Utility of host delivered RNAi of two FMRF amide like peptides, flp-14 and flp-18, for the management of root knot nematode, Meloidogyne incognita. PLOS One, 8(11), e80603. doi:https://doi.org/10.1371/journal.pone.0080603

Park, Y., & Kim, Y. (2000). Eicosanoids rescue Spodoptera exigua infected with Xenorhabdus nematophilus, the symbiotic bacteria to the entomopathogenic nematode Steinernema carpocapsae. Journal of Insect Physiology, 46(11), 1469-1476.

Parkman, J. P., & Smart Jr, G. C. (1996). Entomopathogenic nematodes, a case study: introduction of Steinernema scapterisci in Florida. Biocontrol Science and Technology, 6(3), 413-420.

Pascual, M. L. D., Pascual, P. R. L., & Alburo, H. M. (2018). Heterorhabditis taysearae And Heterorhabditis bacteriophora: Promising Indigenous Entomopathogenic Nematodes Against Vegetable Insect Pest. Journal of Agriculture and Technology Management, 8-13.

167

References

Peña, A. S., Velázquez, E. P., Suárez, E. G., & Samper, B. P. (2015). Lucha biológica de Keiferia lycopersicella (Walsg.) en tomateen producciones protegidas de Ciego de Ávila. Fitosanidad, 19(2), 106-106.

Pegtel, D. M., Cosmopoulos, K., Thorley-Lawson, D. A., van Eijndhoven, M. A., Hopmans, E. S., Lindenberg, J. L., de Gruijl, T. D., Würdinger, T., & Middeldorp, J. M. (2010). Functional delivery of viral miRNAs via exosomes. Proceedings of the National Academy of Sciences, 107(14), 6328-6333.

Perkins, L. A., Hedgecock, E. M., Thomson, J. N., & Culotti, J. G. (1986). Mutant sensory cilia in the nematode Caenorhabditis elegans. Developmental Biology, 117(2), 456–487. doi:10.1016/0012- 1606(86)90314-3

Petersen, C., Hermann, R. J., Barg, M. C., Schalkowski, R., Dirksen, P., Barbosa, C., & Schulenburg, H. (2015). Travelling at a slug’s pace: possible invertebrate vectors of Caenorhabditis nematodes. BMC Ecology, 15(1), 19.

Peymen, K., Watteyne, J., Frooninckx, L., Schoofs, L., & Beets, I. (2014). The FMRFamide-like peptide family in nematodes. Frontiers in Endocrinology, 5, 90. doi:10.3389/fendo.2014.00090

Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research, 29(9), e45-e45.

Poinar, G. O. (1993). Origins and phylogenetic relationships of the entomophilic rhabditids, Heterorhabditis and Steinernema. Fundamental and Applied Nematology, 16(4), 333-338.

Poinar Jr, G. O., & Grewal, P. S. (2012). History of Entomopathogenic Nematology. Journal of Nematology, 44(2), 153.

Portillo-Aguilar, C., Villani, M. G., Tauber, M. J., Tauber, C. A., & Nyrop, J. P. (1999). Entomopathogenic nematode (Rhabditida: Heterorhabditidae and Steinernematidae) response to soil texture and bulk density. Environmental Entomology, 28(6), 1021-1035.

Pozo, E., Valdús, R., Mora, E., & Cárdenas, M. (2004). Consumo de área foliar del pepino y umbral económico y señalización de Diaphania hyalinata

168

References

(Linn.)(Lepidoptera: Pyralidae) y control con nematodos entomopatógenos en organopónicos. In Revista de Protección Vegetal. (No. 2132).

Press, H. (1998). Genome sequence of the nematode C. elegans: a platform for investigating biology. Science, 282, 2012-2018.

Půža, V., & Mráček, Z. (2009). Mixed infection of Galleria mellonella with two entomopathogenic nematode (Nematoda: Rhabditida) species: Steinernema affine benefits from the presence of Steinernema kraussei. Journal of Invertebrate Pathology, 102(1), 40-43.

Qiu, L., & Bedding, R. (2000). Energy metabolism and its relation to survival and infectivity of infective juveniles of Steinernema carpocapsae under aerobic conditions. Nematology, 2(5), 551–559. doi:10.1163/15685410050933

Regulation, E. U. (2009). No 1107/2009 of the European Parliament and of the Council of 21 October 2009 concerning the placing of plant protection products on the market and repealing Council Directives 79/117/EEC and 91/414/EEC. EU, Brussels.

Rengarajan, S., & Hallem, E. A. (2016). Olfactory circuits and behaviors of nematodes. Current Opinion in Neurobiology, 41, 136-148.

Richards, G. R., & Goodrich-Blair, H. (2010). Examination of Xenorhabdus nematophila lipases in pathogenic and mutualistic host interactions reveals a role for xlpA in nematode progeny production. Applied and Environmental Microbiology, 76(1), 221-229.

Ringstad, N., & Horvitz, H. R. (2008). FMRFamide neuropeptides and acetylcholine synergistically inhibit egg-laying by C. elegans. Nature Neuroscience, 11(10), 1168.

Rogers, C., Persson, A., Cheung, B., & de Bono, M. (2006). Behavioral motifs and neural pathways coordinating O2 responses and aggregation in C. elegans. Current Biology, 16(7), 649-659.

Rogers, C., Reale, V., Kim, K., Chatwin, H., Li, C., Evans, P., & de Bono, M. (2003). Inhibition of Caenorhabditis elegans social feeding by FMRFamide- related peptide activation of NPR-1. Nature Neuroscience, 6(11), 1178.

169

References

Rolston, A. N., Griffin, C. T., & Downes, M. J. (2005). Distribution of entomopathogenic nematodes in an Irish sand dune system. Nematology, 7(2), 259-266.

Rosa, J. S., Bonifassi, E., Amaral, J., Lacey, L. A., Simoes, N., & Laumond, C. (2000). Natural occurrence of entomopathogenic nematodes (Rhabditida: Steinernema, Heterorhabditis) in the Azores. Journal of Nematology, 32(2), 215.

Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., & Abad, P. (2005). Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins. Molecular Plant-Microbe Interactions, 18(7), 615-620.

Rougon-Cardoso, A., Flores-Ponce, M., Ramos-Aboites, H. E., Martínez- Guerrero, C. E., Hao, Y. J., Cunha, L., Rodríguez-Martínez J. A., Ovando- Vázquez, C., Bermúdez-Barrientos, J. R., Abreu-Goodger, C., Chavarría- Hernández, N., Simões, N., & Montiel, R. (2016). The genome, transcriptome, and proteome of the nematode Steinernema carpocapsae: evolutionary signatures of a pathogenic lifestyle. Scientific Reports, 6(1), 1- 15.

Safer, D., Brenes, M., Dunipace, S., & Schad, G. (2007). Urocanic acid is a major chemoattractant for the skin-penetrating parasitic nematode Strongyloides stercoralis. Proceedings of the National Academy of Sciences, 104(5), 1627-1630.

Samish, M., & Glazer, I. (1991). Killing ticks with parasitic nematodes of insects. Journal of Invertebrate Pathology (USA).

Samish, M., & Glazer, I. (2001). Entomopathogenic nematodes for the biocontrol of ticks. Trends in Parasitology, 17(8), 368-371.

Samish, M., Alekseev, E., & Glazer, I. (1998). The Effect of Soil Composition on Anti‐Tick Activity of Entomopathogenic Nematodes. Annals of the New York Academy of Sciences, 849(1), 402-403.

Saul, N., Baberschke, N., Chakrabarti, S., Stürzenbaum, S. R., Lieke, T., Menzel, R., Jonáš, A., & Steinberg, C. E. (2014). Two organobromines

170

References trigger lifespan, growth, reproductive and transcriptional changes in Caenorhabditis elegans. Environmental Science and Pollution Research, 21(17), 10419-10431. doi:10.1007/s11356-014-2932-6

Schena, M., Shalon, D., Davis, R. W., & Brown, P. O. (1995). Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science, 270(5235), 467-470.

Schroeder, N. E., Androwski, R. J., Rashid, A., Lee, H., Lee, J., & Barr, M. M. (2013). Dauer-specific dendrite arborization in C. elegans is regulated by KPC-1/Furin. Current Biology, 23(16), 1527-1535. doi:http://dx.doi.org/10.1016/j.cub.2013.06.058

Schroeder, P. C., Ferguson, C. S., Shelton, A. M., Wilsey, W. T., Hoffmann, M. P., & Petzoldt, C. (1996). Greenhouse and field evaluations of entomopathogenic nematodes (Nematoda: Heterorhabditidae and Steinernematidae) for control of cabbage maggot (Diptera: Anthomyiidae) on cabbage. Journal of Economic Entomology, 89(5), 1109-1115.

Senti, G., Ezcurra, M., Löbner, J., Schafer, W. R., & Swoboda, P. (2009). Worms with a single functional sensory cilium generate proper neuron- specific behavioral output. Genetics, 183(2), 595-605.

Shamseldean, M. M., & Abd-Elgawad, M. M. (1994). Natural occurrence of insect pathogenic nematodes (Rhabditida: Heterorhabditidae) in Egyptian soils. Afro-Asian Journal of Nematology, 4(2), 151-154.

Shapiro, D. I., Berry, E. C., & Lewis, L. C. (1993). Interactions between nematodes and earthworms: enhanced dispersal of Steinernema carpocapsae. Journal of Nematology, 25(2), 189.

Shapiro-Ilan, D. I., Hazir, S., & Lete, L. (2015). Viability and virulence of entomopathogenic nematodes exposed to ultraviolet radiation. Journal of Nematology, 47(3), 184.

Shapiro-Ilan, D. I., Stuart, R., & McCoy, C. W. (2003). Comparison of beneficial traits among strains of the entomopathogenic nematode, Steinernema carpocapsae, for control of Curculio caryae (Coleoptera: Curculionidae). Biological Control, 28(1), 129-136.

171

References

Shi, Z. H., & Sun, J. H. (2010). Quantitative variation and biosynthesis of hindgut volatiles associated with the red turpentine beetle, Dendroctonus valens LeConte, at different attack phases. Bulletin of Entomological Research, 100(3), 273-277.

Shields, E. J. (2015). Utilizing persistent entomopathogenic nematodes in a conservation or a more classical biological control approach. In Nematode Pathogenesis of Insects and Other Pests (pp. 165-184). Springer, Cham.

Shingles, J., Lilley, C. J., Atkinson, H. J., & Urwin, P. E. (2007). Meloidogyne incognita: molecular and biochemical characterisation of a cathepsin L cysteine proteinase and the effect on parasitism following RNAi. Experimental Parasitology, 115(2), 114-120.

Sieburth, D., Ch'ng, Q. L., Dybbs, M., Tavazoie, M., Kennedy, S., Want, D., Dupuy, D., Rual, J. F., Hill, D. E., Vidal, M., Ruvkun, G., & Kaplan, J. M. (2005). Systematic analysis of genes required for synapse structure and function. Nature, 436, 510–517.

Siljander, E., Gries, R., Khaskin, G., & Gries, G. (2008). Identification of the airborne aggregation pheromone of the common bed bug, Cimex lectularius. Journal of Chemical Ecology, 34(6), 708. doi:10.1007/s10886-008-9446-y

Silverman, J., Platzer, E. G., & Rust, M. K. (1982). Infection of the cat flea, Ctenocephalides felis (Bouche) by Neoaplectana carpocapsae Weiser. Journal of Nematology, 14(3), 394.

Simard, L., Bélair, G., & Brodeur, J. (2001). Susceptibility of the European chafer (Coleoptera: Scarabaeidae) to entomopathogenic nematodes (Rhabditida: Steinernematidae, Heterorhabditidae). Journal of Nematology, 33(4S), 297.

Siomi, M. C., Sato, K., Pezic, D., & Aravin, A. A. (2011). PIWI-interacting small RNAs: the vanguard of genome defence. Nature Reviews Molecular Cell Biology, 12(4), 246.

172

References

Smith, K. A. (1994). Control of weevils with entomopathogenic nematodes. In Control of Insect Pests with Entomopathogenic Nematodes, ed. KA Smith, M Hatsukade, 1-13.

Somasekhar, N., Grewal, P. S., & Klein, M. G. (2002). Genetic variability in stress tolerance and fitness among natural populations of Steinernema carpocapsae. Biological Control, 23(3), 303-310.

Song, J. J., Smith, S. K., Hannon, G. J., & Joshua-Tor, L. (2004). Crystal structure of Argonaute and its implications for RISC slicer activity. Science, 305(5689), 1434-1437.

Sterken, M. G., Snoek, L. B., Kammenga, J. E., & Andersen, E. C. (2015). The laboratory domestication of Caenorhabditis elegans. Trends in Genetics, 31(5), 224–231. doi:10.1016/j.tig.2015.02.009

Stock, S. P. (2015). Diversity, biology and evolutionary relationships. In Nematode pathogenesis of insects and other pests (pp. 3-27). Springer, Cham.

Stock, S. P., & Blair, H. G. (2008). Entomopathogenic nematodes and their bacterial symbionts: the inside out of a mutualistic association. Symbiosis (Rehovot), 46(2), 65.

Stock, S. P., Pryor, B. M., & Kaya, H. K. (1999). Distribution of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) in natural habitats in California, USA. Biodiversity & Conservation, 8(4), 535- 549.

Stretton, A. O., Fishpool, R. M., Southgate, E., Donmoyer, J. E., Walrond, J. P., Moses, J. E., & Kass, I. S. (1978). Structure and physiological activity of the motoneurons of the nematode Ascaris. Proceedings of the National Academy of Sciences, 75(7), 3493-3497. doi:0.073/pnas.75.7.3493

Stuart, R. J., & Gaugler, R. (1994). Patchiness in populations of entomopathogenic nematodes. Journal of Invertebrate Pathology, 64(1), 39-45.

Stuart, R. J., Shapiro-Ilan, D. I., James, R. R., Nguyen, K. B., & McCoy, C. W. (2004). Virulence of new and mixed strains of the entomopathogenic

173

References nematode Steinernema riobrave to larvae of the citrus root weevil Diaprepes abbreviatus. Biological Control, 30(2), 439-445.

Sundar, L., & Chang, F. N. (1993). Antimicrobial activity and biosynthesis of indole antibiotics produced by Xenorhabdus nematophilus. Microbiology, 139(12), 3139-3148.

Swoboda, P., Adler, H. T., & Thomas, J. H. (2000). The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Molecular Cell, 5(3), 411-421.

Syed, Z., & Leal, W. S. (2009). Acute olfactory response of Culex mosquitoes to a human-and bird-derived attractant. Proceedings of the National Academy of Sciences, 106(44), 18803-18808. doi:10.1073/pnas.0906932106.

Szalanski, A. L., Taylor, D. B., & Mullin, P. G. (2000). Assessing nuclear and mitochondrial DNA sequence variation within Steinernema (Rhabditida: Steinernematidae). Journal of Nematology, 32(2), 229.

Tabara, H., Grishok, A., & Mello, C. C. (1998). RNAi in C. elegans: soaking in the genome sequence. Science, 282(5388), 430-431.

Thomas, M. B. (1999). Ecological approaches and the development of “truly integrated” pest management. Proceedings of the National Academy of Sciences of the United States of America, 96:5944–5951

Thurston, G. S., Kaya, H. K., & Gaugler, R. (1994). Characterizing the enhanced susceptibility of milky disease-infected scarabaeid grubs to entomopathogenic nematodes. Biological Control, 4(1), 67-73.

Tijsterman, M., May, R. C., Simmer, F., Okihara, K. L., & Plasterk, R. H. (2004). Genes required for systemic RNA interference in Caenorhabditis elegans. Current Biology, 14(2), 111-116.

Timmons, L., & Fire, A. (1998). Specific interference by ingested dsRNA. Nature, 395(6705), 854.

Timper, P., & Kaya, H. K. (1989). Role of the second-stage cuticle of entomogenous nematodes in preventing infection by nematophagous fungi. Journal of Invertebrate Pathology, 54(3), 314-321.

174

References

Timper, P., Kaya, H. K., & Jaffee, B. A. (1991). Survival of entomogenous nematodes in soil infested with the nematode-parasitic fungus Hirsutella rhossiliensis (Deuteromycotina: Hyphomycetes). Biological Control, 1(1), 42-50.

Todd, J. W. (1989). Ecology and Behavior of Nezara viridula. Annual Review of Entomology, 34(1), 273–292. doi:10.1146/annurev.en.34.010189.001421

Tripp, S., & Grueber, M. (2011). Economic impact of the human genome project. Battelle Memorial Institute, 58. (https://www.battelle.org/docs/default-source/misc/battelle-2011-misc- economic-impact-human-genome-project.pdf) Retrieved 8 October 2018.

Ulug, D., Hazir, S., Kaya, H. K., & Lewis, E. (2014). Natural enemies of natural enemies: The potential top‐down impact of predators on entomopathogenic nematode populations. Ecological Entomology, 39(4), 462-469.

United Nations, Department of Economic and Social Affairs, Population Division (2017). World Population Prospects: The 2017 Revision, Key Findings and Advance Tables. Working Paper No. ESA/P/WP/248.

Urwin, P. E., Lilley, C. J., & Atkinson, H. J. (2002). Ingestion of Double- Stranded RNA by Preparasitic Juvenile Cyst Nematodes Leads to RNA Interference. Molecular Plant-Microbe Interactions, 15(8), 747–752. doi:10.1094/mpmi.2002.15.8.747 van der Linden, A. M., Beverly, M., Kadener, S., Rodriguez, J., Wasserman, S., Rosbash, M., & Sengupta, P. (2010). Genome-wide analysis of light-and temperature-entrained circadian transcripts in Caenorhabditis elegans. PLOS Biology, 8(10), e1000503. doi:https://doi.org/10.1371/journal.pbio.1000503

Van Tol, R. W. H. M., & Raupp, M. J. (2005). Nursery and tree application. Nematodes as Biological Control Agents. Wallingford: CABI Publishing, 167- 190.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., & Speleman, F. (2002). Accurate normalization of real-time

175

References quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology, 3(7), research0034-1.

Vanin, E. F. (1985). Processed pseudogenes: characteristics and evolution. Annual Review of Genetics, 19(1), 253-272. doi:10.1146/annurev.ge.19.120185.001345.

Velculescu, V. E., Zhang, L., Vogelstein, B., & Kinzler, K. W. (1995). Serial analysis of gene expression. Science, 270(5235), 484-487.

Versele, M., Lemaire, K., & Thevelein, J. M. (2001). Sex and sugar in yeast: two distinct GPCR systems. EMBO Reports, 2(7), 574–579. doi:http://doi.org/10.1093/embo-reports/kve132

Visser, A., Geldhof, P., De Maere, V., Knox, D. P., Vercruysse, J., & Claerebout, E. (2006). Efficacy and specificity of RNA interference in larval life-stages of Ostertagia ostertagi. Parasitology, 133(6), 777-783.

Vowels, J. J., & Thomas, J. H. (1992). Genetic analysis of chemosensory control of dauer formation in Caenorhabditis elegans. Genetics, 130(1), 105-123.

Walley, J.W., Kliebenstein, D. J., Bostock, R. M., & Dehesh, K. (2013). Fatty acids and early detection of pathogens. Current Opinion in Plant Biology, 16(4), 520-526. doi:http://dx.doi.org/10.1016/j.pbi.2013.06.011

Wang, Z., Gerstein, M., & Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nature Reviews Genetics, 10(1), 57.

Wang, X. D., & Ishibashi, N. (1999). Infection of the entomopathogenic nematode, Steinernema carpocapsae, as affected by the presence of Steinernema glaseri. Journal of Nematology, 31(2), 207.

Ward, S., Thomson, N., White, J. G., & Brenner, S. (1975). Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. The Journal of Comparative Neurology, 160(3), 313–337. doi:10.1002/cne.901600305

Weber, K. P., De, S., Kozarewa, I., Turner, D. J., Babu, M. M., & de Bono, M. (2010). Whole genome sequencing highlights genetic changes associated with laboratory domestication of C. elegans. PLOS One, 5(11), e13922.

176

References

White, G. F. (1927). A method for obtaining infective nematode larvae from cultures. Science, 66(1709).

White, J. G., Southgate, E., Thomson, J. N., & Brenner, S. (1986). The structure of the nervous system of the nematode Caenorhabditis elegans. Philosophical Transactions of the Royal Society B: Biological Sciences, 314(1165), 1-340. doi: 0.098/rstb.986.0056

Wilson, M., Kruitbos, L., & Heritage, S. (2009). Phoretic dispersal of entomopathogenic nematodes by Hylobius abietis. Nematology, 11(3), 419-427. doi:10.1163/156854109X446999

Winston, W. M., Sutherlin, M., Wright, A. J., Feinberg, E. H., & Hunter, C. P. (2007). Caenorhabditis elegans SID-2 is required for environmental RNA interference. Proceedings of the National Academy of Sciences, 104(25), 10565-10570.

Winston, W. M., Molodowitch, C., & Hunter, C. P. (2002). Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1. Science, 295(5564), 2456-2459.

Yeagle, P. L., & Albert, A. D. (2007). G-protein coupled receptor structure. Biochimica et Biophysica Acta (BBA)-Biomembranes, 1768(4), 808-824.

Zamore, P. D., Tuschl, T., Sharp, P. A., & Bartel, D. P. (2000). RNAi: double- stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell, 101(1), 25-33.

Zaslaver, A., Liani, I., Shtangel, O., Ginzburg, S., Yee, L., & Sternberg, P. W. (2015). Hierarchical sparse coding in the sensory system of Caenorhabditis elegans. Proceedings of the National Academy of Sciences, 112(4), 1185- 1189.

Zhang, C. (2009). Novel functions for small RNA molecules. Current Opinion in Molecular Therapeutics, 11(6), 641.

177