Floral Morphology, Pollination Mechanisms, and Phylogenetics Of

“Floral Morphology, Pollination Mechanisms, and Phylogenetics of

Pleurothallis Subgenera Ancipitia and Scopula”

A Senior Thesis Presented to

The Faculty of the Department of Organismal Biology and Ecology,

Colorado College

Katharine Dupree

Bachelor of Arts Degree in Biology

16th day of May, 2016

Abstract

Pleurothallis is the largest myophilous (fly-pollinated) genus in subtribe

Pleurothallidinae. Although many studies show highly specific relationships in pollination systems in the Orchidaceae, our understanding of these relationships in myophilous orchids is almost non-existent (Borba & Semir 2001). This study focuses on the floral micromorphology, specifically the lip and column, of species within subgenera Ancipitia and Scopula. Scanning electron microscopy of the micromorphology of floral structure shows a range of morphology and pollination mechanisms within the two studied subgenera. These include deceit pollination by pseudocopulation and reward pollination. In concert, phylogenetic analysis was performed to determine if a correlation existed between morphology or pollination mechanism and taxonomic groupings. Maximum parsimony trees were produced using

ITS and matK sequences for subgenera Ancipitia, Scopula, and Pleurothallis, with species from the genera Laelia, Pabstiella, and Arpophyllum as outgroups. The ITS, matK and combined trees strongly support an Ancipitia/Scopula section within a monophyletic subgenus Pleurothallis. Within this section, both reward and deceit pollination mechanisms are found, meaning they are not restricted to the current taxonomic groupings. Morphological and genetic data therefore support the grouping of subgenera Ancipitia, Scopula, and Pleurothallis into one monophyletic subgenus.

Acknowledgements

I would like to thank Dr. Mark Wilson, my advisor, for his guidance, inspiration, and encouragement. I would also like to thank former students for sequence contributions,

Graham Frank for establishing protocols, and the Colorado College Organismal

Biology and Ecology Department for funding. I thank Dr. Ron Hathaway for scanning electron microscopy instruction, Dr. Nick Brandley for editing assistance, Jaime

Micciulla for providing supplies, and Donna Sison for her continued assistance.

Introduction

Floral Morphology in Pleurothallidinae

Within the family Orchidaceae, subtribe Pleurothallidinae comprises an estimated 4000 Neotropical species (Luer 1986). Species in the subtribe

Pleurothallidinae exhibit a broad array of growth habits (epiphytic, terrestrial) and occupy many habitats (Higgins 2009). A typical pleurothallid is an epiphyte with a restricted distribution, frequently endemic, that lives in sympatry with other pleurothallids in extremely moist forests in the Andes (1800-2800 m) and is pollinated by flies (Borba & Semir 2001, Higgins 2009).

In a typical Pleurothallis flower, the gynostemium, commonly referred to as the column, lies at the center, a result of the fusion of stigma and stamen (Claessens &

Kleynen 2013). Within the stamen lies the pollinarium, a unit containing a variable number of pollinia. In some species, the pollinia are connected by the caudicle to the viscidium, a sticky structure. It is the viscidium that attaches to the pollinator. The entirety of the column is attached to the lip, a modified petal. The rest of the flower is comprised of two petals, a dorsal sepal, and a lateral sepal which results from the fusion of the two lower sepals (Figure 1).

Figure 1: Illustration of typical Pleurothallis morphology (a) Petals, (b) lateral sepal, (c) column, (d) pollinarium and pollinia, (e) labellum or lip, and (f) synsepal.

In this study, I will be looking at the micromorphology, specifically the lip and column, of species within Pleurothallis subgenera Ancipitia and Scopula (Luer

1989). The micromorphology of these species can be very informative. From characteristics of the lip and column, we can speculate the size and type of pollinator, and the strategy employed to attract said pollinator.

Pollination Mechanisms in Pleurothallidinae

Pleurothallis is one of the two largest myophilous groups in the subtribe

Pleurothallidinae (van der Pijl & Dodson 1966). Although there are many studies

showing highly specific relationships in pollination systems in the Orchidaceae, our

understanding of these relationships in myophilous (fly pollinated) orchids is almost

non-existent (Borba & Semir 2001). This lack of attention is probably due in part to the

reputation of Diptera as inefficient, irregular, unreliable and poor pollinators,

characterized by lack of constancy and random, casual behavior (van der Pijl & Dodson

1966). Most knowledge about pollination of pleurothallids is inferred by study of

morphology, as witnessing pollination events in the wild is rare (Borba & Semir 2001).

The variety of lip morphology in the species belonging to subgenera Ancipitia and

Scopula suggests many different pollination strategies are present (Diaz-Morales &

Karremans 2015). Using scanning electron microscopy (SEM), I will examine

morphology and use observations to speculate on pollination mechanisms.

Deceit and reward strategies are known to occur, and the use of sexual and aggregation pheromones have been reported (Karremans et al. 2015). Reward pollination refers to when the flower offers a reward to solicit pollination. The “small pan” on the lip of some species (Vogel 1990) is termed the glenion in

Pleurothallidinae and its presence is probably indicative of reward pollination (Frank

2015). Deceit pollination refers to when the lip of the flower appears to offer a reward, but does not. This deception can take the form of either resembling the scent/color scheme of a rewarding flower or resembling the female of the pollinator species. This elicits pseudocopulation by the male of the pollinator species, during which the pollinia are attached. The absence of a glenion, the overall structure of the lip, and the presence of an osmophore may be taken to indicate that a species utilizes pseudocopulation as a pollination mechanism (Frank 2015). Though osmophores are also present on some reward-pollinated flowers, and are therefore not a definitive indicator independent of other characteristics, they are critical to the efficacy of pseudocopulation (Frank 2015).

Due to the highly variable lip and column morphology present in species of subgenera Ancipitia and Scopula (Luer 1989), I hypothesize that several pollination strategies will be present within and between each subgenera; there may be a distinction along the taxonomic division in the form of pollination mechanism or morphological feature(s).

Phylogenetics

Genera within the subtribe Pleurothallidinae have been traditionally circumscribed on the basis of morphological characters and although this classification has been useful, several problems arise at the generic level (Higgins 2009). These problems are particularly apparent in the genus Pleurothallis, the largest genus of the subtribe (Dressler 1993, Luer 2002).

Luer (1986) described a Pleurothallis “as any pleurothallid that does not fit into

any of the other genera.” As described by Luer (1999), this misfit mega-genus has

historically included some 2000 species grouped artificially into 32 subgenera with

numerous sections, subsections, and series.

Several molecular studies (Pridgeon et al. 2001; Wilson et al. 2011; 2013) have confirmed the occurrence of polyphyly and paraphyly in the genus circumscribed on the basis of morphology, necessitating the re-circumscription of the genus in the light of phylogenies based on molecular data (Wilson et al. 2015). In Genera Orchidacearum

Vol. 4, Pridgeon (2005) proposed that a monophyletic genus Pleurothallis would include subgenera Ancipitia, Mirandia, Pleurothallis, Restrepioidia, Rhynchopera,

Scopula and Talpinaria. However, Luer suggested elevating the subgenera Ancipitia and Scopula to the generic level as Ancipitia (Luer) and Colombiana for the species of subgenus Scopula (Luer 2004). It is these two subgenera that are of interest in this study.

The subgenus Ancipitia was first described in 1986; the species within the subgenus being recognized by “the laterally compressed, two-edged ramicauls” and the

“solitary flowers produced from the apex of the ramicaul in a fascicle of usually elongated peduncles,” (Luer 1989). Ancipitia currently consists of 28 species, all originating from Central and South America (Luer 1989). The subgenus Scopula was also first described in 1986; the species within the subgenus being recognized by “the tuft of single-flowered peduncles emerging near the apex of the leaf from the median sulcus,” (Ospina & Dressler 1974). Scopula currently consists of six species, all restricted to South America. Aside from the emergence position of the flowers, plant and flower morphology are very similar between species of Ancipitia and Scopula (Luer

1989). Luer (1989) noted these similarities, but maintained a distinction between the two subgenera.

Due to the conflicting philosophies on the generic status of Ancipitia and

Scopula, further analysis is needed on the genetic level. Following the studies of

Wilson et al. (2011; 2013), analysis using nuclear internal transcribed spacer (ITS) region and the plastid maturase K (matK) gene will provide a more complete phylogenetic history. The internal transcribed spacer region, ITS, is commonly used for phylogenetic analysis due to the highly variable ITS1 and ITS2 sequences, which are separated by conserved coding regions (Salvolainen & Chase 2003). The matK gene is considered to have more variable sequences than other plastid genes (Chase et al. 2007), but is more difficult to amplify. Both genes can be useful in resolving genetic relationships by examining the single-nucleotide polymorphisms (SNPs) between species. With the use of Arpophyllum, Laelia and Pabstiella as outgroups as well as the inclusion of subgenus Pleurothallis type species (P. ruscifolia) and species from other subgenera within genus Pleurothallis, the genetic relationship of Ancipitia,

Scopula, and Pleurothallis, particularly within the larger context of genus

Pleurothallis, should become clearer.

I hypothesize that genetic analysis will show the two subgenera (Figure 2),

Ancipitia and Scopula, to be very closely related, in as much as they may become one monophyletic clade. This is supported by previous phylogenetic research (Pridgeon et al. 2005) as well as the abundance of similar morphological characteristics (Luer

1989).

Figure 2: The Three Hypotheses (1) The current classification, (2) Luer’s hypothesis, and (3) the classification genetic data support

Materials and Methods

All methods were adapted or modified from those used by Frank (2015).

Plant Material

Plant material used includes live specimens as well as preserved DNA. The

species, identification numbers, and how they are analyzed are shown in the following

tables.

Table 1: Plant Data for Primary Interest Species

Species Plant ID Number Subgenus Sequencing SEM Pleurothallis anceps PL256 Ancipitia yes no Pleurothallis anthrax PL194 Ancipitia yes no Pleurothallis anthrax PL587 Ancipitia no yes Pleurothallis caprina PL704 Ancipitia yes no Pleurothallis condorensis PL258 Ancipitia yes no Pleurothallis crocodiliceps PL008 Ancipitia yes no Pleurothallis crocodiliceps PL009 Ancipitia yes yes Pleurothallis crocodiliceps PL847 Ancipitia yes no Pleurothallis crocodiliceps PL929 Ancipitia no yes Pleurothallis crocodiliceps PL930 Ancipitia no yes Pleurothallis crocodiliceps PL931 Ancipitia no yes Pleurothallis dunstervillei PL645 Ancipitia no yes Pleurothallis dunstervillei PL927 Ancipitia no yes Pleurothallis dunstervillei PL928 Ancipitia no yes Pleurothallis eumecocaulon PL204 Ancipitia yes no Pleurothallis eumecacaulon PL683 Ancipitia yes no Pleurothallis gratiosa PL588 Ancipitia no yes Pleurothallis inornata PL450 Ancipitia yes yes Pleurothallis onagriceps PL016 Ancipitia yes no Pleurothallis solium PL007 Ancipitia yes yes Pleurothallis sp. Mejia PL401 Ancipitia yes no Pleurothallis sp. Mejia PL894 Ancipitia yes no Pleurothallis vorator PL688 Ancipitia no yes Pleurothallis aspergillum PL191 Scopula yes yes Pleurothallis penicillata PL018 Scopula yes no Pleurothallis ruscaria PL262 Scopula yes no Pleurothallis scoparum PL192 Scopula yes no Pleurothallis silverstonei PL380 Scopula yes yes Pleurothallis tetroxys PL193 Scopula yes no Pleurothallis viduata PL017 Scopula yes no

Katharine Dupree 11

Table 2: Plant Information of Outgroups

Species Plant ID Number Subgenus Sequencing SEM Pleurothallis macrophylla PL397 Elongatia yes no Pleurothallis restrepioides PL297 Elongatia yes no Pleurothallis quadrifida PL295 Lalexia yes no Pleurothallis quadrifida PL469 Lalexia yes no Pleurothallis bivalvis PL021 Mac-Fasc yes no Pleurothallis hemileuca PL033 Mac-Fasc yes no Pleurothallis ruscifolia PL003 Pleurothallis yes no Pleurothallis nuda PL473 Restrepioidia yes no Pleurothallis tentaculata PL331 Restrepioidia yes no Pleurothallis pedunculata PL377 Rhynchopera yes no Pleurothallis schweinfurthii PL335 Rhynchopera yes no Pleurothallis punctulata PL310 Talpinaria yes no Pleurothallis sandemannii PL206 Talpinaria yes no Pleurothallis truncata PL157 Truncatae yes no Pleurothallis truncata PL339 Truncatae yes no Pabstiella aryter JF934816-JF934876 yes no Pabstiella tripterantha JF934815-JF934875 yes no Laelia anceps AY008576-AF263794 yes no Laelia gouldiana AY008577-EF079315 yes no Laelia rubescens AY429391-AY396098 yes no Arpophyllum giganteum yes no

Scanning Electron Microscopy (SEM) of Specimens

Specimens were preserved in 70% ethanol for transportation. Upon receipt, they were fixed in KEW mix, a mixture of 5% formalin solution (37.6% formaldehyde), 53% methanol, 5% glycerol, and 37% deionized water. They were then dehydrated in successively higher concentrations of ethanol for 15 min each (80%, 95%, 100%,

100%) before being placed in fresh 100% ethanol. Specimens were then removed from the ethanol and placed in the critical point dryer (EMS 850). The system was first cooled to 5°C, and then the chamber was filled with liquid CO2. While maintaining the system temperature at 5°C, the liquid CO2 in the chamber was purged and replaced two times.

Finally, the system was heated to 35°C and pressure was allowed to build until the liquid CO2 reached its critical point and vaporized. Once dry, specimens were placed

Katharine Dupree 12 on a stub with a carbon conductive tab. Edges of the specimen were carefully painted with liquid carbon in order to improve conductivity from the specimen to the stub. After the carbon was allowed to dry, mounted specimens were subjected to three rounds of sputter coating with gold. Specimens were imaged using a Jeol JSM-6390LV scanning electron microscope with an accelerating voltage of 10-15 kV.

DNA Extraction

Genomic DNA was extracted from fresh or frozen (-20°C) leaf tissue. Leaf tissue was frozen using liquid nitrogen and ground to a fine powder using a ceramic mortar and pestle. The mortar and pestle were cleaned with bleach between uses to prevent contamination. Genomic DNA was extracted from ground leaf tissue using a

DNeasy Plant Mini Kit (Qiagen) and stored at -20°C. Genomic DNA concentration was estimated by running a sample on a 0.8% agarose 1X TAE gel against known quantities of λ DNA at 100 V for 30 min.

PCR Amplification

Amplification of Nuclear ITS

The primer pair 17SE (ACGAATTCATGGTCCGGTGAAGTGTTCG) and 26SE

(TAGAATTCCCCGGTTCGCTCGCCGTTAC) was used to amplify ITS as described by Sun et al. (1994). A master mix was created using 12.5 μL 2x PCR Master Mix

(Promega), 1 μL 17SE (25 μM), 1 μL 26SE (25 μM), 1 μL dimethyl sulfoxide (DMSO), and 4.5 μL molecular biology grade water per reaction, for a total of 20 μL per reaction.

In a 0.2 mL PCR tube, 5 μL containing approximately 10 ng template DNA was added to 20 μL master mix and mixed thoroughly by pipetting. Four 25 μL PCR reactions

Katharine Dupree 13 were performed for each sample. PCR amplification was performed using a thermal cycler (Bio-Rad Laboratories, Inc.) with the following program:

1 cycle: 94°C for 5 min

5 cycles: 94°C for 1 min, 60°C for 1 min, 72°C for 3 min

30 cycles:94°C for 1 min, 58°C for 1 min, 72°C for 3 min

1 cycle: 72°C for 15 min

1 cycle: 4°C infinite hold

Amplification of plastid matK

The primer pair 390F (CGATCTATTCATTCAATATTTC) and 1326R

(TCTAGCACACGAAAGTCGAAGT) was used to amplify the plastid gene maturase

K (matK) as described by Cuénoud et al. (2002). A master mix was created using 12.5

μL 2x PCR Master Mix (Promega), 1 μL 390f (25 μM), 1 μL 1326r (25 μM), and 0.5

μL molecular biology grade water per reaction, for a total of 15 μL. In a 0.2 mL PCR tube, 10 μL containing approximately 2.5 ng template DNA was added to 15 μL master mix and mixed thoroughly by pipetting. Four to six 25 μL PCR reactions were performed for each sample. PCR amplification was performed using an iCycler thermal cycler (Bio-Rad Laboratories, Inc.) with the following program:

30 cycles:94°C for 1 min, 48°C for 30 s, 72°C for 1 min

1 cycle: 72°C for 7 min

1 cycle: 4°C infinite hold

Katharine Dupree 14

Gel Purification of PCR Product

A preparative gel was created using 50 mL 1X TAE buffer, 1.5% (0.75 g) agarose, and 3 μL ethidium bromide. The four ITS PCR reactions for each sample were combined to give a total volume of 100 μL. The six matK PCR reactions for each sample were split into two tubes, as this volume (150 μL) was too large for the gel wells. The PCR product solution was mixed with one-sixth total volume 6X

Blue/Orange Loading Dye (Promega) and loaded into a triple-sized well. Products were run alongside a 100 bp ladder in order to verify the desired product (ITS = ~875 bp, matK = ~930 bp). Gels were run at 100 V for 90 min, or until separation between the desired product and any non-specific bands was obtained. Gels were photographed using a BioDoc-It Imaging System (UVP). Using a UV transilluminator

(FisherBiotech FBTIV-614), the target band was excised from the gel using a razor blade, trimmed of excess agarose, and weighed to determine appropriate buffer volumes during gel extraction. PCR products were extracted from excised gel cubes using a QIAquick Gel Extraction Kit (QIAGEN) according to the protocol provided.

Concentration (ng/μL) and purity (A260/A280) of purified DNA were estimated on a

NanoDrop 2000 Spectrophotometer (Thermo Scientific) or Biophotometer

(Eppendorf).

Preparation of DNA for Sequencing

Purified PCR products were submitted to GeneWiz for sequencing. ITS PCR products were sent with the primers 17SE, 26SE, ITS1 (White et al. 1990), and ITS4

(White et al. 1990). matK PCR products were sent with the primers 390F, 1326R, Nina- matK-F (Sheade 2012), and Nina-matK-R (Sheade 2012).

Katharine Dupree 15

Sequence Analysis and Phylogeny Construction

Trace files were downloaded from GeneWiz and viewed in FinchTV (Geospiza) to ensure sequence viability and to confirm that peaks were called correctly, edited for accuracy when they were not, and truncated at the appropriate sites. Trace files were then exported as FASTA files and aligned by eye using Se-Al software to create consensus sequences for each specimen. When sequences produced a poor consensus, with ambiguous nucleotides or a lack of corroboration between multiple sequences, samples were re-amplified, purified, and sent back to GeneWiz for another round of sequencing. Consensus sequences were exported to MEGA 6.06 and aligned by muscle.

A combined ITS and matK phylogeny was constructed by concatenating the two sequences in MEGA for all samples for which both ITS and matK were sequenced.

Phylogenies were constructed as Maximum parsimony (MP) trees with 1000 bootstrap replicates. MP trees were obtained using the Subtree-Pruning-Regrafting algorithm

(Nei & Kumar 2000) with search level 1 in which the initial trees were obtained by the random addition of sequences (10 replicates). All trees were rooted with Arpophyllum,

Laelia, and Pabstiella outgroup sequences from GenBank. In addition to species from

Ancipitia and Scopula, analyzed taxa included multiple species of Pleurothallis to offer context within Pleurothallidinae.

Katharine Dupree 16

Results

Floral Morphology: Subgenus Ancipitia

Pleurothallis anthrax

SEM of P. anthrax (Figures 3 & 4) shows the pollinarium above the lip with pollinia removed. The lip has a concave area with a distinct channel toward the back of the lip under the column. The outer sides of the lip are curled upward toward the column. The column appears papillate or papilliform.

A B

Figure 3: Pleurothallis anthrax (A) Illustration of floral morphology (Luer 1989) and (B) photograph (Varigos 2013) of P. anthrax .

Katharine Dupree 17

Figure 4: SEM of Pleurothallis anthrax

(A) Papilliform column, (B) concave area, and (C) channel

Pleurothallis crocodiliceps

SEM of P. crocodiliceps was performed on four variants (Figure 5-7). The lips themselves each vary in size (Figure 8). The columns each appear to have three lobes, and also vary in size (Figure 9). The lips have elongated papillae up to 200 µm long.

Superior lobes surround the base of the column and overlay the top of the lip. These lack a glenion and instead have a small cavity in the bottom center of the lip. Inside and above the cavity, there are short papillae.

Katharine Dupree 18

FigureFigure : Pleurothallis 5: Dissection crocodiliceps and morphology ofdissection Pleurothallis crocodiliceps variant (PL929) Katharine Dupree 19

FigureFigure : Pleurothallis 6:7: Dissection crocodiliceps and morphology ofdissection Pleurothallis crocodiliceps variant (PL930)(PL931) Katharine Dupree 20

Figure 8: SEM comparison of four Ecuadorean P. crocodiliceps variants All specimens vary in size, shape and structure. The length of papillae, size of superior lobes,

and size and depth of the central cavity are distinguishing characteristics.

Figure 9: SEM comparison of P. crocodiliceps columns Though the columns vary in size, they all present the characteristic triple lobe shape in either a robust or subtle form.

Pleurothallis dunstervillei

SEM of P. dunstervillei (Figure 10) was performed on three variants (Figure 11).

These variants are specimens from Colombia and Ecuador. Two of the specimens exhibit

a similar elongated shape with small, possibly waxy cells in the center of the lip. Around

these waxy cells are elongated papillae manifesting on the edges of the lip. The third variant

has a shorter, rounder shaped lip with a larger number and distribution of elongated

papillae. There appears to be a small concave area in the center of variant three, as well as

the existence of superior lobes that slightly overlay the lip.

Katharine Dupree 21

Figure 10: Pleurothallis dunstervillei (A) Illustration of floral morphology (Luer 1989) and (B) photograph (Kay 2012) . of P. dunstervillei

1 mm 1 mm 1 mm

Figure 11: SEM of three P. dunstervillei variants

All lips present similar shape and size, however, the third exhibits superior lobes, longer papillae, and the development of a concave area in the lower center of the lip.

Katharine Dupree 22

Pleurothallis gratiosa

SEM of P. gratiosa (Figures 12 & 13) shows the tip of the anther cap above the lip with pollinia removed. There are elongated papillae on the outside of the lip reaching up to 100 µm. The lip lacks lack a glenion and instead has a small cavity in the center of the lip. Inside the lip and in the cavity, there are shorter papillae.

Figure 12: Pleurothallis gratiosa (A) Illustration of floral morphology (Luer 1989) and (B) photograph (Doucette 2013) of P. gratiosa

Katharine Dupree 23

Figure 13: SEM of Pleurothallis gratiosa This specimen exhibits elongated papillae around the edges of the lip with shorter papillae surrounding the deep central cavity.

Pleurothallis inornata

SEM of P. inornata (Figures 14 & 15) shows the column above the lip with pollinia and viscidium still intact. The lip has a slightly concave area in the center.

The petals are far removed from the edges of the lip and the cellular structure is homogenous throughout, with the exception of the lower edge of the lip.

Figure 14: Pleurothallis inornata (A) Illustration of floral morphology (Luer 1989) and (B) photograph (Ecuagenera) of P. inornata

Katharine Dupree 24

Figure 15: SEM of Pleurothallis inornata (A)The pollinarium with the viscidium is intact and the lip has a

(B) small concave area.

Pleurothallis solium

SEM of P. solium (Figures 16 & 17) shows the pollinarium above the lip with pollinia removed. The lip has a large concave area in the center and a prominent channel beginning under the column. The edges of the lip curl upward toward the column, and the bottom of the lip is lobed.

Figure 16: Pleurothallis solium

(A)Illustration of floral morphology and (B) photograph of P. solium

Katharine Dupree 25

Figure 17: SEM of Pleurothallis solium This specimen exhibits a large well (A), a lobed lip (B), and curled edges that form a channel (C).

Pleurothallis vorator

P. vorator (Figures 18 & 19) shows the pollinarium above the lip with pollinia removed. The lip has a large cavity area in the center of the very bottom of the lip. The lip itself is very concave, with the central party of the lip having large, upraised cells.

The edges of the lip curl upward toward the column, further increasing concavity.

Katharine Dupree 26

Figure 18: Pleurothallis vorator (B) Illustration of floral morphology and (B) photograph (Delfini 2014) of P. vorator

Figure 19: SEM of Pleurothallis vorator This species exhibits upraised cells (A) and a central cavity (B).

Katharine Dupree 27

Floral Morphology: Subgenus Scopula

Pleurothallis aspergillum

SEM of P. aspergillum (Figures 20 & 21) shows the column above the lip with pollinia removed. The lip has a small concave area in the center of the bottom of the lip. The edges of the lip curve upward toward the column, creating a channel. The lip is fairly small, with the cellular structure being mostly short papillae.

Figure 20: Pleurothallis aspergillum (A) Illustration of floral morphology (Luer 1989) and (B) photograph . (Grobler 2014) of P. aspergillum

Figure 21: SEM of Pleurothallis aspergillum

This species exhibits a small lip with a concave channel (A) and a papillate lip.

Katharine Dupree 28

Pleurothallis silverstonei

SEM of P. silverstonei (Figures 22 & 23) shows the pollinarium above the lip

with pollinia removed. The lip has a large cavity in the center. The lip itself is very

concave with small cells that are fairly homogenous. The edges of the lip curl upward

toward the column, further increasing concavity. The petals are large and far removed

from the edges of the lip.

Figure 22: Pleurothallis silverstonei

(A) Illustration of floral morphology (Luer 1989) and (B) photograph (Vieira 2014) of P. silverstonei

Figure 23: SEM of Pleurothallis silverstonei This species exhibits a large well (A) and an entirely concave lip.

Katharine Dupree 29

Phylogeny

Nuclear Internal Transcribed Spacer (ITS)

The resulting aligned ITS matrix is comprised of 44 taxa. Maximum parsimony analysis produced one most parsimonious tree. In the MP bootstrap consensus tree,

Clade A grouping subgenera Ancipitia, Scopula, Acroniae and Pleurothallis received

69% bootstrap support (Figure 24). Clade B, grouping all species of subgenera Scopula together in a monophyletic clade within Pleurothallis, received 70% bootstrap support.

Ancipitia does not form an individual monophyletic clade within Pleurothallis according to ITS sequences.

Katharine Dupree 30

Figure 24: ITS phylogenetic tree Maximum Parsimony tree condensed at bootstrap values below 50% at 1000 bootstrap replications

Katharine Dupree 31

Plastid maturase K (matK)

The resulting aligned matK matrix is comprised of 44 taxa. Maximum parsimony analysis produced one most parsimonious tree. In the MP bootstrap consensus tree, Clade A, grouping subgenera Ancipitia, Scopula, Acroniae, and

Pleurothallis received 71% bootstrap support (Figure 25). Clade B, grouping all species of subgenera Scopula together within Pleurothallis, received 74% bootstrap support. Ancipitia does not form an individual monophyletic clade within Pleurothallis according to matK sequences.

Katharine Dupree 32

Figure 24: ITS phylogenetic tree Maximum Parsimony tree condensed at bootstrap values below 50% at 1000 bootstrap replications

Figure 25: matK phylogenetic tree Maximum Parsimony tree condensed at bootstrap values below 50% at 1000 bootstrap replications

Katharine Dupree 33

Composite Tree

The resulting aligned matrix is comprised of 44 taxa, for which both ITS and matK sequences were obtained. Maximum parsimony analysis produced 8 most parsimonious trees. In the MP bootstrap consensus tree, Clade A, grouping subgenera

Ancipitia, Scopula, Acroniae, and Pleurothallis received 89% bootstrap support (Figure

26). Clade B, grouping subgenera Ancipitia and Scopula together, received 78% bootstrap support. Ancipitia and Scopula do not form individual monophyletic clades within this tree.

Katharine Dupree 34

Figure 26: Composite phylogenetic tree Maximum Parsimony tree condensed at bootstrap values below 50% at 1000 bootstrap replications

Katharine Dupree 35

Composite Tree Mapping Pollination Mechanisms

Mapping pollination mechanisms in the context of phylogeny showed the existence of both reward pollination and deceit pollination in the subsection

Ancipitia/Scopula (Figure 27).

Katharine Dupree 36

Figure 27: Combined ITS-matK phylogenetic tree with pollination mechanisms mapped Maximum Parsimony tree condensed at bootstrap values below 50% at 1000 bootstrap replications showed the existence of both reward pollination (blue) and deceit pollination (red) in the subsection Ancipitia/Scopula

Katharine Dupree 37

Discussion

Floral Morphology and Pollination Mechanisms

Through SEM analysis of floral lips, I observed morphological characteristics that suggested either reward or deceit pollination. Lips that contain channel-like structures and well-like depressions are hypothesized to be reward pollinated. Lips that contain elongated papillae upwards of 100 µm in length and a deep cavity toward the bottom center of the lip are hypothesized to be deceit pollinated, as these may simulate the female of the pollinator species. Within the taxonomic group Ancipitia, both reward and deceit pollination mechanisms were observed. There were four species hypothesized to be reward pollinated, and two species hypothesized to be deceit pollinated (Figure 28). Within taxonomic group Scopula, though underrepresented, only reward pollination mechanisms are observed in the two species studied (Figure

28). One species, P. vorator, presents characteristics that might suggest either reward or deceit pollination (Figure 29). The cavity seen could serve as a collection well for produced rewards or serve a function in pseudocopulation. The distinctively raised cells could be secretory cells that produce either a reward or pheromones to attract a male pollinator. Therefore, the pollination mechanism employed by this particular species remains unknown.

Species Subgenus Inferred Pollination Type Pleurothallis anthrax Ancipitia Reward Pleurothallis crocodiliceps Ancipitia Deceit Pleurothallis dunstervillei Ancipitia Reward Pleurothallis gratiosa Ancipitia Deceit Pleurothallis inornata Ancipitia Reward Pleurothallis solium Ancipitia Reward Pleurothallis vorator Ancipitia Unknown Pleurothallis aspergillum Scopula Reward Pleurothallis silverstonei Scopula Reward

Figure 28: Summation of species and pollination mechanisms

Katharine Dupree 38

A A

Figure 29 : SEM of Pleurothallis vorator This species exhibits upraised cells (A) and a central cavity (B).

Upon further observation, these two pollination strategies were subdivided to suggest more specific mechanisms for pollination. Flowers suggesting reward pollination were designated “open-access” or “directed”. Open-access reward pollination implies the flower allows access from all directions to the desired reward, such as in P. inornata. Directed reward pollination implies a channelling of the pollinator into a very specific area, such as when the petals or edges of the lip curve inward. Flowers suggesting deceit pollination were designated as pseudocopulation or reward mimic. Deceit pollination by pseudocopulation implies the lip simulates a female of the pollinator species, enticing the male to pseudocopulate. Deceit pollination by reward mimicry implies the floral structure of a non-reward species resembling a species of rewarding flower. No specimens within this study were identified to have a pollination strategy using reward mimicry.

Katharine Dupree 39

Although my data suggest there are two pollination mechanisms present within Ancipitia and only one present within Scopula, it is known that pollination by deceit also occurs within Scopula (Borba & Semir 2001). Therefore, it appears the type of pollination mechanism is not restricted to current taxonomic groupings within Pleurothallis.

Phylogenetics

For the individual ITS, matK, and combined ITS-matK phylogenetic trees, there was strong bootstrap support for a single monophyletic clade for subgenus

Pleurothallis. Within this clade were highly supported subsections including species from Anciptia/Scopula, Pleurothallis, and Acroniae. These results support other findings (Pridgeon & Chase 2001, Wilson et al. 2011, 2013) that suggest the current taxonomic groupings within the genus Pleurothallis are incorrect from a phylogenetic standpoint. Therefore, as opposed to Luer’s suggestion to elevate subgenera Ancipitia and Scopula to genera Ancipitia and Colombiana, my results support the demotion of these subgenera to a single subsection within the monophyletic subgenus Pleurothallis

(Figure 30).

Figure 30: The Three Hypotheses (1) The current classification, (2) Luer’s hypothesis, and (3) the classification my data support

Katharine Dupree 40

New Species found within Pleurothallis dunstervillei

Pleurothallis dunstervillei is one of the relatively few species that has been collected several times along its broad distribution (Karremans et al. 2016). It is known to occur from Venezuela, through Colombia and Ecuador to Peru. Through

SEM analysis of the lips of several variants of P. dunstervillei, one of such variants is hypothesized to actually be a separate species. Two identified variants are specimens from Colombia and Ecuador, which share similarities in size, structure and coloration (Figure 31). The third ‘variant’ has a similar size, however, the shape and coloration of the lip differs greatly from the Colombian and Ecuadorean forms. This

‘variant’ is hypothesized to be a separate species which has yet to be described.

A B C

1 mm 1 mm 1 mm Figure 31: SEM of P. dunstervillei variants All lips present similar shape and size, however, the third exhibits superior lobes, longer papillae, and the development of a concave area in the lower center of the lip.

Katharine Dupree 41

Species Complex of Pleurothallis crocodiliceps

Pleurothallis crocodiliceps is probably the most widespread and common species in the genus Pleurothallis (Karremans et al. 2016). The type species was collected in Ocaña, Colombia in the 1900’s. It is a highly variable species with many flower color forms and sizes across its distribution. The most stable character is apparently the tiny, microscopically hairy lip, with two narrow, falcate, membranous lobes (Karremans et al. 2016). The size of the lip makes it difficult to recognize morphological differences amongst the variations of this species, but through SEM of three Ecuadorean variants, it is hypothesized that a species complex exists. SEM of the four Ecuadorean variants showed the large variance of size, shape, and structure of the lips (Figure 32). Not only does the size of the lips vary, but the length of the two superior lobes and length of elongated papillae vary as well. The central cavity is different in shape and size for each lip, as well as the cellular surroundings, which suggests each variant attracts a different pollinator.

Katharine Dupree 42

Figure 32: Photo and SEM comparison of three Ecuadorean P. crocodiliceps variants All specimens vary in size, shape and structure. The length of papillae, size of superior lobes, and size and depth of the central cavity are distinguishing characteristics.

Due to the large number of variants (25-30) and the widespread distribution of

P. crocodiliceps, the existence of a species complex presents the possibility of many as yet unidentified new species throughout South America. Analysis and understanding of this species complex requires further specimen collection, identification, SEM analysis of lip micromorphology, and molecular studies.

Katharine Dupree 43

Literature Cited

Borba, E. L. & Semir, J. (2001) Pollinator specificity and convergence in fly-

pollinated Pleurothallis (Orchidaceae) species: a multiple population

approach. Annals of Botany 88: 75-88.

Chase, M. W., Cowan, R. S., Hollingsworth, P. M., van den Berg, C., Madrinan, S.,

Petersen, G., Seberg, O., Jorgensen, T., Cameron, K. M., Carine, M.,

Pedersen, N., Hedderson, T. A. J., Conrad, F., Salazar, G. A., Richardson, J.

E., Hollingsworth, M. L., Barraclough, T. G., Kelly, L. & Wilkinson, M.

(2007) A proposal for a standardized protocol to barcode all land plants.

Taxon 56(2): 295-299.

Claessens, J. & J. Kleynen (2013): The pollination of European orchids, Part 1:

Introduction and the genera Orchis and Dactylorhiza. Journal of the Hardy

Orchid Society 10(3): 83-89.

Diaz-Morrales, M. & Karremans, A. P. (2015). Pollination biology of five

species of Pleurothallidinae in a montane region in Costa Rica. Poster

presented at the V Scientific Conference on Andean Orchids.

Dressler, R. L. (1993) Phylogeny and Classification of the Orchid Family. Dioscorides

Press. U.S.A.

Frank, G. (2015) Phylogenetics and Scanning Electron Microscopy of the Orchid Genus

Andinia sensu lato: Evidence for Taxonomic Expansion and Pollination

Strategies. Undergraduate Senior Thesis, Colorado College.

https://digitalcc.coloradocollege.edu/islandora/object/coccc%3A11191

Katharine Dupree 44

Higgins, W.E. 2009. Pleurothallidinae: How Many Genera? In Sauleda, R.P. &

Sandow, L.A., Proceedings of the 19th World Orchid Conference.

American Printing Arts, Miami, Florida. 425-430.

Karremans, A. P., Pupulin, F., Grimaldi, D., Beentjes, K. K., Butot, R., Fazzi, G. E.,

Kaspers, K., Kruizinga, J., Roessingh, P., Smets, E. F. & Gravendeel, B.

(2015) Pollination of Specklinia by nectar feeding Drosophila: the first

reported case of deceptive syndrome employing aggregation pheromones in

Orchidaceae. Annals of Botany 116:437-455.

Karremans, A. P., Rodriguez-Martinez, L., Driessen, W. & Wilson, M. (2016)

Visualizing Pleurothallids: Subgenera Ancipitia and Colombiana.

Lankesteriana (in preparation).

Luer, C.A. (1986) Icones Pleurothallidinarum I, Systematics of the Pleurothallidinae.

Monographs in Systematic Botany from the Missouri Botanical Garden 15: 1-

81.

Luer, C.A. (1989) Icones Pleurothallidinarum VI, Systematics of Pleurothallis

Subgenus Ancipitia Subgenus Scopula and Trisetella. Monographs in

Systematic Botany from the Missouri Botanical Garden 31: 1-130.

Luer, C. A. (1999) Icones Pleurothallidinarum XVIII. Systematics of Pleurothallis

subgenus Pleurothallis section Pleurothallis subsection Antenniferae,

subsection Longiracemosae, subsection Macrophyllae-Racemosae, subsection

Perplexae, subgenus Pseudostelis, subgenus Acuminatia. Monographs in

Systematic Botany from the Missouri Botanical Garden, 76.

Luer, C. A. (2002) A Systematic Method of Classification of The Pleurothallidinae

Versus a Strictly Phylogenetic Method of Classification of The

Pleurothallidinae. Selbyana 23(1): 57-110.

Katharine Dupree 45

Luer, C.A. (2004) Icones Pleurothallidinarum XXVI. Pleurothallis subgenus

Acianthera and three allied subgenera. A second century of new species of

Stelis of Ecuador. Epibator, Ophidion, Zootrophion. Addenda to

Brachionidium, Dracula, Lepanthes, Platystele, Pleurothallis, Porroglossum,

and Masdevallia. New genera and combinations. Monographs in Systematic

Botany from the Missouri Botanical Garden 95: 265.

Ospina, M. H. & Dressler, R. L. (1974) Orquideas de las Americas. Litografia Arco

Bogota, Colombia.

Pridgeon, A. M. (2005) Subtribe Pleurothallidinae. Genera Orchidacearum Volume 4

Epidendroideae (PartOne) pp. 319–422. Editors Pridgeon, A. M., Cribb, P. J.,

Chase, M. W. & Rasmussen F. N. Great Britain: CPI Antony Rowe,

Chippenham and Eastbourne.

Pridgeon, A.M., Solano, R. & Chase, M.W. (2001) Phylogenetic relationships in

Pleurothallidinae (Orchidaceae): Combined evidence from nuclear and plastid

DNA sequences. American Journal of Botany 88: 2286–2308.

Salvolainen, V. & Chase, M.W. (2003) A decade of progress in plant molecular

hylogenetics. Trends in Genetics 19: 717-724.

Sun, Y., Skinner, D.Z., Liang, G.H. & Hulbert, S.H. (1994) Phylogenetic analysis

of Sorghum and related taxa using internal transcribed spacers of nuclear

ribosomal DNA. Theoretical and Applied Genetics 89: 26-32. van der Pijl, L. & Dodson, C. H. (1966) Orchid flowers: their pollination and

evolution. Coral Gables, Miami, USA: University of Miami Press.

Vogel, S. (1990) The role of scent glands in pollination (Transl. by Bhatti JS).

Washington, USA: Smithsonian Institution.

Katharine Dupree 46

Wilson, M., Belle, C., Dang, A., Hannan, P., Kellogg, L., Kenyon, C., Low, H.,

Mochizuki, A., Ngyuen, A., Sheade, N., Shan, L., Shum, A., Stayton, T., Volz,

C., Vosburgh, H.,

Wellman, H. & Woolley, M. (2013) A preliminary phylogenetic analysis of

Pleurothallis sensu lato based upon nuclear and plastid sequences.

Lankesteriana 13: 1-2.

Wilson, M., Belle, C., Dang, A., Hannan, P., Kenyon, C., Low, H., Stayton, T. &

Woolley, M. (2011) A phylogenetic analysis of the genus Pleurothallis, with

emphasis on Pleurothallis subsection Macrophyllae-Fasciculatae, using

nuclear ITS and chloroplast DNA Sequencing. Lankesteriana 11(3): 369.

Wilson, M., Canty, C., Cully, M., Dupree, K., Fatt, K., Hernandez, N., Kumagai,

A., McMahon, J. M., Nakamura, N. & Smith M. (2015) Phylogenetics

and Circumscription of the Genus Pleurothallis. Poster presented at the

V Scientific Conference on Andean Orchids.