sign in sign up
<<
Home , Sheeppox

Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf Open Access

Molecular characterization of sheeppox from outbreaks in Karnataka, India

K. Sumana1,2, Yogisharadhya Revanaiah1, R. Apsana1, Parimal Roy1 and G. B. Manjunatha Reddy1

1. Indian Council of Agricultural Research Institute-National Institute of Veterinary Epidemiology and Disease Informatics, Yelahanka, Karnataka, India; 2. Department of Microbiology and Biotechnology, Jain University, Bengaluru, Karnataka, India. Corresponding author: G. B. Manjunatha Reddy, e-mail: [email protected] Co-authors: KS: [email protected], YR: [email protected], RA: [email protected], PR: [email protected] Received: 11-11-2019, Accepted: 16-01-2020, Published online: 28-02-2020 doi: www.doi.org/10.14202/vetworld.2020.386-391 How to cite this article: Sumana K, Revanaiah Y, Apsana R, Roy P, Reddy GBM (2020) Molecular characterization of sheeppox virus from outbreaks in Karnataka, India, Veterinary World, 13(2): 386-391.

Abstract Aim: This study aimed to characterize sheeppox virus (SPPV) using the P32 gene of the (CaPVs). Materials and Methods: Clinical samples of skin, scabs, and nasal swab from suspected outbreaks Horalagallu (n=13) and Gerahalli (n=11) at Ramanagara district in Karnataka were collected. All the samples were initially subjected to genus- specific diagnostic polymerase chain reaction (PCR). The pooled clinical samples from each outbreak were also subjected to virus isolation. The isolates were confirmed by CaPVs genotyping PCR targeting the full-length P32 gene, followed by sequencing and phylogenetic analysis. Results: The clinical signs and lesions varied from mild to severe degree with no specificity between age and sex. Specific cytopathic changes in cell morphology were observed in infected Vero cells from both outbreaks, which were confirmed by PCR. The complete P32 gene from two outbreaks was successfully amplified with the expected amplicon size of 1006bp. The sequencing and phylogenetic analysis revealed that both the outbreaks were due to SPPV and shared high similarity with published SPPVs from Karnataka and other parts of India. Conclusion: The current study showed that complete P32 gene-based genotypic PCR assay can be used for genetic characterization and molecular epidemiology of both sheeppox and goatpox diseases and also to differentiate the causative agents. The sequence analysis revealed 100% similarity among the two outbreak isolates suggesting the same strain of the virus and common source of infection for the outbreaks. Keywords: goatpox, P32, polymerase chain reaction, phylogenetic analysis, sheeppox. Introduction rate in a susceptible population of and goatpox Sheep and contribute greatly to the income may reach up to 50% in adults and 100% in the young of marginal and landless farmers of the farming com- stock and morbidity rate can reach up to 100% [8]. munity. India has the second largest population of goats Sheeppox and goatpox outbreaks are being increasingly (148.88 million) and fourth largest population of sheep reported from different parts of India [9]. (74.26 million) increased by 14.1% and 10.1%, respec- The virions of Capripox are ovoid in shape with an tively, over the previous census [1]. There are many dis- average size of 294 nm × 273 nm. Their genome is linear, eases which affect sheep and goats, among them sheep- double-stranded DNA of ~150 kb, contains 156 putative pox and goatpox are one of the major diseases and cause genes with high adenine and thymine (AT) content of severe economic loss in terms of damage to skin/hide 73-75% and shares 96% nucleotide (nt) identity. Among and wool, reduced milk yield, and mortality [2,3]. The the 156 open reading frames (ORFs), the conserved disease in sheep and is caused by sheeppox virus essential genes of replication, structure, and assembly are (SPPV) and goatpox virus (GTPV), respectively. The located in the middle region (ORFs 024 to 123) and ter- belong to the genus Capripoxvirus (CaPVs) of minal variable region (ORFs 01 to 023 and 124 to 156) the family [4,5]. Sheep and goatpox disease responsible for virulence and host range functions [10]. is enzootic in Northern and Central Africa and in Asia All the CaPVs having a structural protein called P32, con- including the Indian subcontinent [6,7]. The mortality tain a major immunogenic determinant [11]. CaPVs are currently classified within the genus based on the animal Copyright: Sumana, et al. Open Access. This article is distributed species from which the viruses are isolated. However, under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/ some SPPV and GTPV isolates found to be caused infec- by/4.0/), which permits unrestricted use, distribution, and tion in both sheep and goats [12,13]. As both SPPV and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the GTPV are antigenically closely related and show similar Creative Commons license, and indicate if changes were made. clinical signs hence, they cannot be differentiate based The Creative Commons Public Domain Dedication waiver (http:// creativecommons.org/publicdomain/zero/1.0/) applies to the data on serological methods [14]. Recent molecular stud- made available in this article, unless otherwise stated. ies have shown that CaPVs are phylogenetically and

Veterinary World, EISSN: 2231-0916 386 Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf genetically distinct based on individual and whole-ge- 2000 rpm for 10 min. The supernatant was filtered nome sequencing [15-17]. with 0.45-micron syringe filter. Approximately 500 μl The present study was undertaken to differen- of inoculum was added to a confluent monolayer of tiate and characterize the SPPV isolates from field Vero cells by 1 h adsorption method at 37°C to allow outbreaks. virus attachment; the inoculum was decanted and fresh Materials and Methods maintenance medium (Dulbecco’s Modified Eagle’s Medium) was added. The cells were incubated at 37°C Ethical approval with 5% CO2 and examined periodically. Infected Ethical approval was not necessary for this study. flasks were given six blind passages at weekly inter- However, samples were collected as per the standard vals until cytopathic effect (CPE), which could be sample collection procedure without any unnecessary observed in seventh passage. The flasks showing CPE harm or stress to the animals. such as rounding, clumping, and detachment were Outbreak history and sample collection freeze-thawed 3 times and were further processed for The disease outbreaks were reported during virus confirmation. March 2016 from two mixed unvaccinated flocks DNA extraction and amplification consisting of Horalagallu and Gerahalli villages of The DNA was isolated from infected cells from Ramanagara district, Karnataka. The flocks consisted both the outbreaks (Horalagallu-Nasal swab, Gerahalli- of local breeds of sheep and goats of young and adult Skin scab) by DNeasy Blood and Tissue Kit (Qiagen, age groups of both the sex. The disease was observed Germany), as per the manufacturing protocol. The only in sheep, but in goats, there were no signs of dis- purity and quantity of extracted DNA was determined ease. The clinical samples of nasal swab, skin lesion, by spectrophotometer. DNA was initially subjected to and scabs were collected and were transported to the a diagnostic polymerase chain reaction (PCR) for the laboratory. identification of genus-specific CaPVs by amplifica- Virus isolation tion of partial P32 gene for virus confirmation. Later The skin scabs and nasal swabs were triturated same DNA samples were subjected to genotypic PCR with 1 ml of sterile phosphate-buffered saline, fol- by targeting full-length P32 gene (Table-1) [18,19]. lowed by 3 times freeze-thawing. The triturate was The PCR was carried out 25 µl reaction volume con- incubated with an antibiotic and antimycotic solu- taining 12.5 µl of Dream Taq Green PCR Master Mix tion for 1 h at 37°C, followed by centrifugation at (Thermo Fisher Scientific, USA), 10 pM of each for- ward and reverse primer, 7.5 µl of nuclease-free water, and 3 µl of extracted DNA with following conditions of initial denaturation at 94°C for 5 min, then 35 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min followed by final extension at 72°C for 10 min in thermocycler (S1000 thermal cycler, Bio-Rad). The specific amplification was confirmed by agarose gel electrophoresis (1% agar) using a gel documentation a b system (Syngene, Biodigital Pvt Ltd). Figure-1: Virus isolation: Vero cells showing characteristic Sequencing and phylogenetic analysis cytopathic effects such as rounding, clumping, and finally detachment of the cells were observed at seventh passage The gel slices containing PCR amplicons (a) compared to healthy (b). were purified using the GeneJET Gel Extraction

Table-1: List of primers used for partial and complete gene amplification of P32.

Primer name Sequence (5’‑3’) Length Tm (°C) Product length (bp) References SGPP32FP ACACAGGGGGATATGATTTTACC 23 52 237 [18] SGPP32RP ATACCGTTTTTCATTTCGTTAGC 23 B7‑Forward AACACTCTCATTGGTGTTCGG 21 57 1006 [19] A95‑Reverse CACATGGCAGATATCCCATTA 21

Table-2: Animal population and disease prevalence of two outbreak flocks.

Animals Sheep Goat details of outbreak Details of outbreak Number of clinical Number of clinical samples collected samples used Flock Morbidity Mortality Nasal Skin Nasal Skin scab Flock Morbidity size swab scab swab size Flock: 1‑horalagallu 60 40 21 5 8 2 2 20 0 Flock: 2‑gerahalli 80 60 33 4 7 2 2 5 0

Veterinary World, EISSN: 2231-0916 387 Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf Kit (Thermo Fisher Scientific, USA). The eluted DNA was extracted using the plasmid DNA extraction products were cloned into pGEM-T vector clon- kit (Thermo Fisher Scientific, USA) and sequenced ing kit (Promega) and transformed into the top ten (Eurofins, Bengaluru). The forward and reverse Escherichia coli cells. Blue-white screening was sequences were edited and submitted to GenBank. observed by adding X-gal (100 mg/µl) and Isopropyl Sequences obtained from the current study and other β- d-1-thiogalactopyranoside (50 mg/µl) on Luria GenBank sequences were aligned by ClustalW using Broth plate. Recombinant clones were confirmed by the neighbor-joining method [20] and the phyloge- colony PCR using gene-specific primers. The plasmid netic tree was constructed using MEGA 10.0.5 [21].

a b

Figure-2: Agarose electrophoresis: The clinical samples were subjected to a partial P32 gene showing specific amplification at 237bp band. M-1kb marker, L1-L4 – outbreak samples, L5-positive control, and L6 Negative control (a). Isolated samples subjected to full-length P32 gene with specific amplification at 1006bp. M-1kb marker, L1 - Negative control, L2, and L3 - outbreak samples, L4 and L5 - positive control (b).

Figure-3: Phylogenetic tree: Phylogenetic tree based full-length P32 gene nucleotide sequence of sheeppox virus (SPPV) isolate from outbreak was carried out by the neighbor–joining program using MEGA version 10.0.5 (bootstrap 1000). Current outbreak sequences of SPPV were indicted by the red color triangle shape.

Veterinary World, EISSN: 2231-0916 388 Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf

Figure-4: Nucleotide (nt) variation between sheeppox virus (SPPV) and goatpox virus (GTPV) viruses: Presence of three nt at 163:G, 164:A, and 165:T positions in SPPV, which are deleted in GTPV gene encoding for major envelope protein (P32).

Results and Discussion infect both the species, but the disease severity and Sheeppox and goatpox diseases of the Capripox pattern caused by the same isolate may vary between genus are enzootic in India and are accountable for high sheep and goats [23,24]. economic losses due to high morbidity and mortality. In both, the outbreaks, clinical signs such as The sheeppox disease outbreaks were reported in two fever, dullness, anorexia, vesicles, loss of wool, alo- separate mixed (sheep and goats) flocks from two dif- facia, mucopurulent nasal/oral discharge, edema of ferent villages under Kanakapura Tehsil, Ramanagara eyelids, conjunctivitis, nodules, and pox lesions were district of Karnataka were included in the study. The observed in the hairless region of the body including morbidity and mortality rate recorded were higher in muzzle, udder, teats, ventral part of the tail, lips, and Gerahalli with 75% (60/80) and 55% (33/60) com- on ears were recorded with variable degree similar to pared to Horalagallu village with 66.66% (40/60) and earlier reports [23,25]. Clinical samples (Nasal;4/6, 52.5% (21/40), respectively (Table-2). The variable Scab;25/25) were found positive for the partial P32 morbidity and mortality rates are mainly attributed to gene by preliminary screening by PCR [18]. The host species and virus isolate, pox disease [8]. On per- polled samples from both nasal and scabs showed sonal interaction with the farming community, it was characteristic cytopathic changes such as rounding of learned that the pox outbreaks are rarely encountered. cells, clumping, and finally detachment of cells from However, the outbreaks coincide with less rainfall and the surface in Vero cells (Figure-1). The CPE was fodder shortage during which there is very probability observed after sixth blind passage, i.e, seventh pas- of migration of flocks. Due to the less prevalence of sage in Vero cells. The growth of the virus was first pox disease in the past, the farmers did not practice confirmed by genus-specific PCR with a specific regular . However, in spite of community amplicon of size 237bp. Further to know species of grazing and water facility, the other flocks in the vil- virus isolates, two isolates (one for each outbreak) lages did not report the disease due to the practice of were subjected for complete of P32 gene PCR regular vaccination. During the present outbreak, only (Figure-2), followed by sequencing. The species of the sheep were affected even though in both villages, the virus was confirmed as SPPV by sequence analysis. herds affected had goats along with sheep. Off late, the The complete P32 gene sequences obtained were SPPVs and GTPVs infections are being reported with annotated at 972 nts using online tool BLAST-n and host specificity [22], whereas some strains equally GenBank accessions were obtained (MK607146 and

Veterinary World, EISSN: 2231-0916 389 Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf

MN639777). The sequence analysis revealed both Competing Interests the isolates belong to SPPV with the presence of The authors declare that they have no competing SPPV specific nts and amino acid (aa) as compared interests. to GTPV. The phylogenetic analysis showed that both the sequences from present outbreaks were grouped Publisher’s Note into SPPVs clade compared to other poxviruses. Veterinary World remains neutral with regard There were two separate clades of CaPVs with SPPV to jurisdictional claims in published institutional isolates forming separate groups from that of GTPV affiliation. isolates (Figure-3). The P32 sequence analysis of both SPPVs and GTPVs revealed the presence of three References specific nts for SPPV, which is deleted in the case of 1. Provisional Key Results 20th Livestock Census. (2019) GTPVs (Figure-4), confirming the present outbreaks Department of Animal Husbandry and Dairying. Available from: http://www.dahd.nic.in/division/provisional-key-re- were due to SPPV. The multiple alignments revealed sults-20th-livestock-census . Last accessed on 5-11-2019. that isolates of both outbreaks shared 100% with 2. Babiuk, S., Bowden, T., Boyle, D., Wallace, D. and each other at nt and aa levels indicating same strain Kitching, R. (2008) Capripox viruses: An emerging of SPPV causing the outbreaks in both the villages. worldwide threat to sheep, goats and cattle. Transbound. Emerg. Dis., 55(7): 263-272. This was also supported by the observation of farmers 3. Yeruham, I., Yadin, H., Van Ham, M., Bumbarov, V., that the flocks share common grazing land and water Soham, A. and Perl, S. (2007) Economic and epidemiolog- during summer session along with migratory flocks. ical aspects of an outbreak of sheeppox in a dairy sheep The isolates also a very high similarity with previ- flock. Vet. Rec., 160(7): 236-237. ously isolated SPPVs at the nt and aa from Karnataka, 4. Murphy, F., Faquet, C., Bishop, D., Ghabrial, S., Jarvis, A., Martelli, G., Mayo, M. and Summers, M. (1995) Virus followed by India. On the global level, the present iso- taxonomy: 6th report of the International Committee on lates were closely related to SPPV isolates of China as Taxonomy of Viruses. Arch. Virol. Suppl. 10 (1):85-86. reported earlier [18,26]. 5. Buller, R.M., Arif, B.M., Black, D.N., Dumbell, K.R., Esposito, J.J., Lefkowitz, E.J., McFadden, G., Moss, B., Conclusion Mercer, A.A., Moyer, R.W., Skinner, M.A. and The present outbreaks were attributed to the same Tripathy, D.N. (2005) Poxviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A., strain of SPPV based on clinical, virus isolation, host editors. Virus Taxonomy: Eighth Report of the International specificity, and sequence analysis. The present kind of Committee on the Taxonomy of Viruses. Elsevier Academic outbreaks with high morbidity and mortality warrants Press, Oxford. p117-133. the need for prevention and control of sheep and goat- 6. Venkatesan, G., Balamurugan, V., Singh, R.K. and Bhanuprakash, V. (2010) Goat pox virus isolated from an pox disease through regular vaccination and monitor- outbreak at Akola, Maharashtra (India) phylogenetically ing the host specificity of CaPVs for the improvement related to Chinese strain. Trop. Anim. Health Prod., 42(6): of specific homologous in future for prevent- 1053-1056. ing the economic loss to the farming community. 7. Madhavan, A., Venkatesan, G. and Kumar, A. (2016) Capri poxviruses of small ruminants: Current updates and future Authors’ Contributions perspectives. Asian J. Anim. Vet. Adv., 11(12): 757-770. 8. Bhanuprakash, V., Indrani, B.K., Hosamani, M. and The present study is the part of KS’s Ph.D., dis- Singh, R.K. (2006b) The current status of sheep pox dis- sertation work. KS, GBMR, and YR visited the field, ease. Comp. Immunol. Microbiol. Infect. Dis., 29(1): 27-60. collected the samples, KS and RA carried out the 9. Bhanuprakash, V., Hosamani, M. and Singh, R. (2011) laboratory experiment, SK drafted the manuscript. Prospects of control and eradication of capripox from the Indian subcontinent: A perspective. Antiviral Res., 91(3): GBMR, PR, and YR designed the work, provided 225-232. guidance with overall monitoring, analyzed the data 10. Tulman, E.R., Afonso, C.L., Lu, Z., Zsak, L., Sur, J.H., and edited the manuscript. The final manuscript was Sandybaev, N.T., Kerembekova, U.Z., Zaitsev, V.L., drafted, read, and approved by all the authors. Kutish, G.F. and Rock, D.L. (2002) The genomes of sheep- pox and goatpox viruses. J. Virol. 76(12): 6054-6061. Acknowledgments 11. Chand, P. (1992) Molecular and Immunological Characterization of a Major Envelope Protein of The authors wish to thank Indian Council of Capripoxvirus. Vol. 227. Ph.D. Thesis, University Agricultural Research Institute (ICAR), New Delhi, Surrey, UK. p187-196. India, for encouragement and support. This part of 12. Yan, X.M., Chu, Y.F., Wu, G.H., Zhao, Z.X., Li, J., the research work was funded from DBT-Twinning Zhu, H.X. and Zhang, Q. (2012) An outbreak of sheep pox Pox project (F. No-6-22(3)/DBT Twinning/ associated with goat poxvirus in Gansu province of China. Vet. Microbiol., 156(3-4): 425-428. NIVEDI//2013-14/4814-4820 dated. 03.12.2013), 13. Mirzaie, K., Barani, S.M. and Bokaie, S. (2015) A review Department of Biotechnology, Government of India. of sheep pox and goat pox: Perspective of their control and The authors also thank the Director of ICAR-National eradication in Iran. J. Adv. Vet. Anim. Res., 2(4): 373-381. Institute of Veterinary Epidemiology and Disease 14. Balinsky, C.A., Delhon, G., Smoliga, G., Prarat, M., French, R.A., Geary, S.J., Rock, D. L. and Rodriguez, L.L. Informatics and also staff for constant support and (2008) Rapid preclinical detection of sheeppox virus by a timely help. We are grateful to the veterinarians and real-time PCR assay. J. Clin. Microbiol., 46(2): 438-442. farmers who helped in sample collection. 15. Le Goff, C., Lamien, C.E., Fakhfakh, E., Chadeyras, A.,

Veterinary World, EISSN: 2231-0916 390 Available at www.veterinaryworld.org/Vol.13/February-2020/22.pdf

Aba-Adulugba, E., Libeau, G., Tuppurainen, E., 20. Tamura, K., Nei, M. and Kumar, S. (2004) Prospects Wallace, D.B., Adam, T., Silber, R., Gulyaz, V., Madani, H., for inferring very large phylogenies by using the neigh- Caufour, P., Hammami, S., Diallo, A. and Albina, E. bor-joining method. Proc. Natl. Acad. Sci. USA, 101(30): (2009) Capripoxvirus G-protein coupled chemokine recep- 11030-11035. tor: A host-range gene suitable for virus animal origin dis- 21. Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K. crimination. J. Gen. Virol., 90(Pt 8): 1967-1977. (2018) MEGA X: Molecular evolutionary genetics anal- 16. Lamien, C.E., Le Goff, C., Silber, R., Wallace, D.B., ysis across computing platforms. Mol. Biol. Evol., 35(6): Gulyaz, V., Tuppurainen, E., Madani, H., Caufour, P., 1547-1549. Adam, T., El Harrak, M., Luckins, A.G., Albina, E. 22. Manjunathareddy, G.B., Sumana, K., Apsana, R., and Diallo, A. (2011a) Use of the capripoxvirus homo- Yogisharadhya, R., Prajapati, A., Patil, S.S. and logue of Vaccinia virus 30 kDa RNA polymerase subunit Balamuragan, V. (2017) Investigation of malignant form (RPO30) gene as a novel diagnostic and genotyping tar- of sheep pox outbreak in fattening lambs in Mandya, get: Development of a classical PCR method to differen- Karnataka India. J. Vet. Pathol., 41(3): 184-188. tiate goat poxvirus from sheep poxvirus. Vet. Microbiol., 23. Verma, S., Verma, L.K., Gupta, V.K., Katoch, V.C., 149(1-2): 30-39. Dogra, V., Pal, B. and Sharma, M. (2011) Emerging capri- 17. Santhamani, R., Yogisharadhya, R., Venkatesan, G., poxvirus disease outbreaks in Himachal Pradesh, a Northern Shivachandra, S.B., Pandey, A.B. and Ramakrishnan, M.A. state of India, Transbound. Emerg. Dis., 58(1): 79-85. (2014) Molecular characterization of Indian sheeppox and 24. Ramakrishnan, M.A., Santhamani, R. and Pandey, A.B. goatpox viruses based on RPO30 and GPCR genes. Virus (2017) Capripox outbreak in a mixed flock of sheep and Genes, 49(2): 286-91. goats in India. Transbound. Emerg. Dis., 64(1): 27-30. 18. Manjunathareddy, G.B., Sumana, K., Babu, S., Yadav, J., 25. Singh, R., Chandra, D., Singh, K.P., Hosamani, M., Balamurugan, V., Hemadri, D., Patil, S.S., Suresh, K.P., Singh, R.K. and Chauhan, R.S. (2007) Epidemiological Gajendragad, M.R. and Rahman, H. (2015) Pathological investigation of sheep pox outbreaks in Rajasthan. Indian J. and molecular characterization of capripox virus outbreak Vet. Pathol., 31(2): 120-125. in sheep and goats in Karnataka. Indian J. Vet. Pathol., 26. Bhanuprakash, V., Venkatesan, G., Balamurugan, V., 39 (1): 11-14. Hosamani, M., Yogisharadhya, R., Chauhan, R.S, Pande, A., 19. Heine, H.G., Stevens, M.P., Foord, A.J. and Boyle, D.B. (1999) Mondal, B. and Singh, R.K. (2010) Pox outbreaks in sheep A capripoxvirus detection PCR and antibody ELISA based on and goats at Makhdoom (Uttar Pradesh), India: Evidence of the major antigen P32 the homolog of the Vaccinia virus H3L sheeppox virus infection in goats. Transbound. Emerg. Dis., gene. J. Immunol. Meth., 227(1-2): 187-196. 57(5): 375-382. ********

Veterinary World, EISSN: 2231-0916 391