DOCSLIB.ORG

Supplementary Table S4

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Table 4. The list of genes differentially expressed in CDK12 inactivated tumors (raw p-values are shown) GeneID Validated_Inhouse Validated_TCGA_RNAseq FoldChange_TCGA_Affy_NormalizedFoldChange_Affy_InHouse_Rawlog10PValue_TCGA_Affy_Normalizedlog10PValue_TCGA_RNAseq_Normalizedlog10PValue_Affy_InHouse_RawMean_TCGA_Affy SD_TCGA_Affy Mean_TCGA_RNAseq SD_TCGA_RNAseq Confounding_CN log10PValue_TCGA_RNAseq_CNENTREZ DESCRIPTION RPRD1A FC&PV FC&PV -2.8 -2.8 7 6.4 1.3 6.6 1.4 3.9 0.9 55197 regulation of nuclear pre-mRNA domain containing 1A BCCIP FC&PV FC -2.2 -1.8 8.1 0 1.5 5.7 0.8 4.1 0.4 56647 BRCA2 and CDKN1A interacting protein TERF2 FC FC&PV -1.9 -1.5 5.9 0 1 6.3 0.8 3.3 0.5 7014 telomeric repeat binding factor 2 SF3A3 Not_FC FC&PV 1.6 -0.8 3.5 0 0.8 6.9 0.6 5.2 0.5 CN 1.3 10946 splicing factor 3a, subunit 3, 60kDa THADA FC&PV FC -1.6 -1.1 3.4 0 2.8 6.2 0.7 2.2 0.4 63892 thyroid adenoma associated DENND1A Not_FC FC 1.5 -0.4 4.6 0.3 0.6 5.5 1.1 2.9 0.5 57706 DENN/MADD domain containing 1A CSTF3 Not_FC FC -1.4 0.5 4.8 0 0.6 6.8 0.6 3.7 0.5 CN_FC_oposite1.5 1479 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa NRAS FC&PV FC&PV 1.4 1 8.1 1.5 1.6 6.8 1 4.5 0.6 4893 neuroblastoma RAS viral (v-ras) oncogene homolog WDR5B FC&PV FC&PV -1.4 -1.9 4.4 0 2.6 5.9 0.8 2.6 0.5 54554 WD repeat domain 5B BBS1 FC FC&PV -1.3 -0.8 3.8 0 1 7 0.6 4 0.5 582 Bardet-Biedl syndrome 1 ORMDL2 FC FC&PV -1.3 -1.6 3.5 3.7 0.7 8 0.6 4.9 0.7 29095 ORMDL sphingolipid biosynthesis regulator 2 TMEM5 FC&PV FC&PV -1.3 -1.2 6 0 1.9 7.9 0.7 3.1 0.5 CN -1.4 10329 transmembrane protein 5 CIRBP Not_FC FC -1.2 0.7 3.8 1 1 7.5 0.8 4.7 0.6 1153 cold inducible RNA binding protein MRPS7 FC FC&PV -1.2 -0.9 4.1 2.7 0.9 7 0.8 4.6 0.6 CN -1.8 51081 mitochondrial ribosomal protein S7 MTX2 FC FC&PV 1.2 0.4 3.5 1.7 0.8 8.3 0.6 5 0.5 10651 metaxin 2 PPP3CB FC FC&PV -1.2 -1.2 3.1 0 0.7 6.7 0.5 3.4 0.5 5532 protein phosphatase 3, catalytic subunit, beta isozyme SHQ1 FC FC -1.2 -0.5 3.6 0 0.6 7 0.5 3.2 0.4 55164 SHQ1, H/ACA ribonucleoprotein assembly factor DNAJB4 FC FC 1.2 0.8 3.3 0.5 0.7 5.1 0.6 2.8 0.6 11080 DnaJ (Hsp40) homolog, subfamily B, member 4 TNFSF10 FC&PV FC&PV 1.2 2.6 5.6 4.6 1.9 9 1.7 5.8 1.7 CN 2.5 8743 tumor necrosis factor (ligand) superfamily, member 10 GLUL FC&PV FC 1.2 1.1 4.4 0.9 7.1 8.2 0.6 6.7 0.6 2752 glutamate-ammonia ligase C1orf109 Not_FC&PV FC&PV 1.1 -0.6 3.1 1.4 1.6 6.2 0.7 3.5 0.6 CN 1.3 54955 chromosome 1 open reading frame 109 SURF1 Not FC&PV -1.1 3.9 2.8 8.3 0.6 4.5 0.6 6834 surfeit 1 H2AFY2 Not FC&PV -1.1 3.3 1.8 5.7 0.7 4.1 1 55506 H2A histone family, member Y2 SNF8 FC FC&PV -1.1 -0.5 3.8 3.4 0.4 6.9 0.7 5 0.6 CN -1.5 11267 SNF8, ESCRT-II complex subunit NKIRAS2 FC FC&PV -1.1 -0.9 3.1 3.3 0.7 5.1 0.5 4.4 0.5 CN -2 28511 NFKB inhibitor interacting Ras-like 2 TSC1 FC FC -1.1 -0.5 6.1 0 0.6 5.4 0.5 2 0.5 7248 tuberous sclerosis 1 CSNK2A2 FC FC -1.1 -1.3 3.2 0 0.7 6.2 0.7 3.9 0.5 1459 casein kinase 2, alpha prime polypeptide KRCC1 FC&PV FC&PV 1.1 0.9 4 2.5 1.5 8.3 0.8 4.7 0.7 CN_FC_oposite-1.7 51315 lysine-rich coiled-coil 1 CD59 FC&PV FC&PV 1.1 1.6 3.2 2.6 8.7 8.6 0.8 5.3 0.8 CN 1.6 966 CD59 molecule, complement regulatory protein DOLK Not FC&PV -1 3.3 2.3 5.2 0.5 3.4 0.5 22845 dolichol kinase ABHD11 Not FC&PV -1 3.1 3.2 7.9 0.7 5.8 0.9 83451 abhydrolase domain containing 11 PDE9A FC FC&PV -1 -0.7 4.5 2.3 0.5 4.8 1 2.5 1.1 5152 phosphodiesterase 9A AGK FC FC&PV -1 -0.4 3.8 0 0.5 6.4 0.5 3.4 0.4 55750 acylglycerol kinase ERLIN2 FC FC -1 -1.5 3.8 1.2 1.2 5.7 1 3.1 0.7 11160 ER lipid raft associated 2 NQO2 FC FC 1 1.2 3.5 1.3 0.9 6.5 0.9 3 0.7 4835 NAD (P)H dehydrogenase, quinone 2 PIGP FC&PV FC&PV -1 -1.1 3.8 4.7 2.5 8.3 0.7 4 0.6 51227 phosphatidylinositol glycan anchor biosynthesis, class P UGGT2 Not_FC&PV Not -1.5 -1.9 7.7 0 3.1 4.9 0.7 1.6 0.4 55757 UDP-glucose glycoprotein glucosyltransferase 2 ALG13 Not_FC&PV Not -1.2 -1 5.3 0 2.2 4.8 0.8 2.6 0.5 79868 ALG13, UDP-N-acetylglucosaminyltransferase subunit INTS6 Not_FC&PV Not -1 -1.4 3.2 0 5.9 6 0.6 2.1 0.5 26512 integrator complex subunit 6 ERCC8 NA Not -1.1 4.9 0 4.8 0.5 1.2 0.3 1161 excision repair cross-complementation group 8 GRB2 FC&PV FC -0.9 -0.5 3.5 0 1.9 7.2 0.5 5.3 0.4 CN -1.6 2885 growth factor receptor-bound protein 2 IFT88 FC&PV FC -0.8 -1.3 2.9 0 2.4 5.4 0.5 1.3 0.3 8100 intraflagellar transport 88 FADS1 FC&PV FC -0.8 -1.7 2.7 0.3 7.8 5.4 1.1 2.7 1.2 3992 fatty acid desaturase 1 PIBF1 FC&PV FC -0.8 -2.3 2.5 0 4 5.4 0.7 1.9 0.5 10464 progesterone immunomodulatory binding factor 1 PCYT2 FC&PV FC -0.7 -1.1 2.4 1.2 3.5 5.1 0.6 4.3 0.7 CN -1.3 5833 phosphate cytidylyltransferase 2, ethanolamine TM9SF4 FC&PV FC 0.8 0.9 2.2 0 3.5 6.3 0.6 5.5 0.5 9777 transmembrane 9 superfamily protein member 4 IMPDH2 FC&PV FC -0.7 -0.8 2.2 1.1 1.7 9.7 0.7 6.4 0.8 3615 IMP (inosine 5'-monophosphate) dehydrogenase 2 HN1L FC&PV FC 0.8 1.1 2.1 0.6 1.4 6.2 0.6 5.3 0.6 90861 hematological and neurological expressed 1-like CDKN2A FC&PV FC&PV 0.7 1.3 4.4 2.5 2.1 6.6 1 6.6 1.7 1029 cyclin-dependent kinase inhibitor 2A TMEM223 FC&PV FC&PV -0.9 -1 3.4 1.9 1.6 8.3 0.5 5.1 0.5 79064 transmembrane protein 223 C11orf71 FC&PV FC&PV -0.9 -0.4 3.4 4.5 2.3 5.6 0.9 3 0.7 54494 chromosome 11 open reading frame 71 FOXK2 FC&PV FC&PV -0.8 -1.9 3 1.9 6 6 0.6 4.1 0.5 CN -2.9 3607 forkhead box K2 EPM2AIP1 FC&PV FC&PV -1.4 -0.8 3 3 4.8 7.3 0.6 3 0.6 9852 EPM2A (laforin) interacting protein 1 YTHDF1 FC&PV FC&PV -0.8 -0.7 2.9 0 1.4 8.2 0.6 4.5 0.5 CN -2 54915 YTH N (6)-methyladenosine RNA binding protein 1 NOTCH2 FC&PV FC&PV 1.1 0.5 2.9 1.9 2.5 6.8 0.6 4.4 0.7 4853 notch 2 TAGLN2 FC&PV FC&PV 0.9 0.6 2.9 1.4 2.9 8.4 0.5 8.4 0.6 8407 transgelin 2 MRPL12 FC&PV FC&PV -0.6 -0.9 2.7 2.3 1.4 7 0.6 6.5 0.8 CN -1.8 6182 mitochondrial ribosomal protein L12 TTI1 FC&PV FC&PV -0.8 -1.4 2.7 3 6.2 6.3 0.7 3.7 0.6 CN -4.2 9675 TELO2 interacting protein 1 FADS3 FC&PV FC&PV 1 1.2 2.7 1.5 6.3 5.2 0.5 4.7 0.6 3995 fatty acid desaturase 3 HEBP2 FC&PV FC&PV 1 1.3 2.6 1.6 3.3 9.7 0.7 6.1 0.8 23593 heme binding protein 2 ZNF512B FC&PV FC&PV -0.7 -0.5 2.6 2.9 1.4 5.9 0.6 3.6 0.6 CN -1.9 57473 zinc finger protein 512B ZNF195 FC&PV FC&PV 1.2 1.2 2.5 3.6 1.4 6.3 0.9 3.2 0.7 CN 2.9 7748 zinc finger protein 195 CFI FC&PV FC&PV 0.9 1.5 2.5 2.4 1.4 8.3 1.1 5.1 1.1 3426 complement factor I GCLM FC&PV FC&PV 0.9 1.3 2.5 2.1 1.3 6.7 0.8 3 0.6 2730 glutamate-cysteine ligase, modifier subunit SEZ6L2 FC&PV FC&PV 0.6 1.4 2.5 2.4 1.6 5.8 0.9 4.6 0.9 26470 seizure related 6 homolog (mouse)-like 2 TMEM41B FC&PV FC&PV 0.7 0.7 2.4 0 1.5 6.8 0.7 3 0.5 CN 2.3 440026 transmembrane protein 41B SPP1 FC&PV FC&PV 0.8 1.8 2.4 1.5 10.4 10.3 1.2 7.5 1.4 6696 secreted phosphoprotein 1 IFNGR1 FC&PV FC&PV 0.6 1.2 2.4 1.9 1.5 7.5 0.7 5 0.6 3459 interferon gamma receptor 1 PARVA FC&PV FC&PV 0.6 0.4 2.3 5.6 1.4 6.6 0.6 3.5 0.5 CN 2.4 55742 parvin, alpha GINS1 FC&PV FC&PV -0.7 -1.4 2.3 1.3 4.5 8 0.7 3 0.6 9837 GINS complex subunit 1 (Psf1 homolog) RBM8A FC&PV FC&PV -0.9 -1.6 2.3 0 3.4 7.1 0.8 4.6 0.6 9939 RNA binding motif protein 8A SWAP70 FC&PV FC&PV 1.1 0.9 2.2 0 1.3 5.5 0.7 2.6 0.6 CN 2.1 23075 SWAP switching B-cell complex 70kDa subunit HGSNAT FC&PV FC&PV 0.7 0.5 2.1 1.9 1.3 7 0.8 4.5 0.7 138050 heparan-alpha-glucosaminide N-acetyltransferase CTSD FC&PV FC&PV 0.9 1.5 2.1 1.7 9.2 6.2 0.7 8.8 0.8 CN 2.3 1509 cathepsin D TMEM50A FC&PV FC&PV 0.7 0.6 2.1 1.8 2.5 8.1 0.7 6.2 0.5 CN 1.7 23585 transmembrane protein 50A CA12 FC&PV FC&PV 1 3.6 2.1 1.9 2.7 5.4 1.4 3.1 1.6 771 carbonic anhydrase XII PPP1CB FC&PV FC&PV 0.9 1.4 2.1 1.3 1.9 8.2 0.5 6.2 0.6 5500 protein phosphatase 1, catalytic subunit, beta isozyme SGMS1 FC&PV FC&PV 0.8 0.7 2.1 1.5 1.3 6.4 0.9 3.2 0.7 259230 sphingomyelin synthase 1 PSMA1 FC&PV FC&PV 0.7 0.8 2.1 0 6.4 10 0.6 5.5 0.5 1.3 5682 proteasome subunit alpha 1 DCP1B FC&PV RNAseq_only -2 5.7 2 3.6 0.6 196513 decapping mRNA 1B HACL1 FC&PV RNAseq_only 1.1 4.8 1.4 3.2 0.5 26061 2-hydroxyacyl-CoA lyase 1 CPNE2 FC&PV RNAseq_only 1.8 4 1.7 4.3 0.8 221184 copine II OSMR FC&PV RNAseq_only 2.6 3.7 2.8 3.1 1.1 9180 oncostatin M receptor ATL3 FC&PV RNAseq_only 2.5 3.6 1.9 3.8 0.7 25923 atlastin GTPase 3 TMEM189 FC&PV RNAseq_only -0.4 3.4 2.8 4.5 0.6 CN -2.5 387521 transmembrane protein 189 OXLD1 FC&PV RNAseq_only -1 3.3 4.6 4.3 0.7 CN -1.8 339229 oxidoreductase-like domain containing 1 TCTEX1D2 FC&PV RNAseq_only 1.3 3.3 1.4 4 1 255758 Tctex1 domain containing 2 FAM114A1 FC&PV RNAseq_only 2 3.1 2 3.4 0.8 92689 family with sequence similarity 114, member A1 VPS25 FC&PV RNAseq_only -0.7 3.1 1.4 5.7 0.6 CN -2.1 84313 vacuolar protein sorting 25 homolog (S.
Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Structure and Function of the Human Recq DNA Helicases

    Structure and Function of the Human Recq DNA Helicases

    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2005 Structure and function of the human RecQ DNA helicases Garcia, P L Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-34420 Dissertation Published Version Originally published at: Garcia, P L. Structure and function of the human RecQ DNA helicases. 2005, University of Zurich, Faculty of Science. Structure and Function of the Human RecQ DNA Helicases Dissertation zur Erlangung der naturwissenschaftlichen Doktorw¨urde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultat¨ der Universitat¨ Z ¨urich von Patrick L. Garcia aus Unterseen BE Promotionskomitee Prof. Dr. Josef Jiricny (Vorsitz) Prof. Dr. Ulrich H ¨ubscher Dr. Pavel Janscak (Leitung der Dissertation) Z ¨urich, 2005 For my parents ii Summary The RecQ DNA helicases are highly conserved from bacteria to man and are required for the maintenance of genomic stability. All unicellular organisms contain a single RecQ helicase, whereas the number of RecQ homologues in higher organisms can vary. Mu- tations in the genes encoding three of the five human members of the RecQ family give rise to autosomal recessive disorders called Bloom syndrome, Werner syndrome and Rothmund-Thomson syndrome. These diseases manifest commonly with genomic in- stability and a high predisposition to cancer. However, the genetic alterations vary as well as the types of tumours in these syndromes. Furthermore, distinct clinical features are observed, like short stature and immunodeficiency in Bloom syndrome patients or premature ageing in Werner Syndrome patients. Also, the biochemical features of the human RecQ-like DNA helicases are diverse, pointing to different roles in the mainte- nance of genomic stability.
  • IP6K1 Upregulates the Formation of Processing Bodies by Promoting Proteome Remodeling on the Mrna Cap

    IP6K1 Upregulates the Formation of Processing Bodies by Promoting Proteome Remodeling on the Mrna Cap

    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. IP6K1 upregulates the formation of processing bodies by promoting proteome remodeling on the mRNA cap Akruti Shah1,2 and Rashna Bhandari1* 1Laboratory of Cell Signalling, Centre for DNA Fingerprinting and Diagnostics (CDFD), Inner Ring Road, Uppal, Hyderabad 500039, India. 2Graduate studies, Manipal Academy of Higher Education, Manipal 576104, India. *Correspondence to Rashna Bhandari; Email: [email protected] Running title: IP6K1 promotes mRNA turnover to induce P-bodies ORCID IDs Akruti Shah - 0000-0001-9557-4952 Rashna Bhandari - 0000-0003-3101-0204 This PDF file includes: Main Text Figures 1 to 6 Keywords mRNA decay/mRNA metabolism/P-bodies/translation suppression 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.199828; this version posted July 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Inositol hexakisphosphate kinases (IP6Ks) are ubiquitously expressed small molecule kinases that catalyze the conversion of the inositol phosphate IP6 to 5-IP7. IP6Ks have been reported to influence cellular functions by protein-protein interactions independent of their enzymatic activity.
  • Atlas Antibodies in Breast Cancer Research Table of Contents

    Atlas Antibodies in Breast Cancer Research Table of Contents

    ATLAS ANTIBODIES IN BREAST CANCER RESEARCH TABLE OF CONTENTS The Human Protein Atlas, Triple A Polyclonals and PrecisA Monoclonals (4-5) Clinical markers (6) Antibodies used in breast cancer research (7-13) Antibodies against MammaPrint and other gene expression test proteins (14-16) Antibodies identified in the Human Protein Atlas (17-14) Finding cancer biomarkers, as exemplified by RBM3, granulin and anillin (19-22) Co-Development program (23) Contact (24) Page 2 (24) Page 3 (24) The Human Protein Atlas: a map of the Human Proteome The Human Protein Atlas (HPA) is a The Human Protein Atlas consortium cell types. All the IHC images for Swedish-based program initiated in is mainly funded by the Knut and Alice the normal tissue have undergone 2003 with the aim to map all the human Wallenberg Foundation. pathology-based annotation of proteins in cells, tissues and organs expression levels. using integration of various omics The Human Protein Atlas consists of technologies, including antibody- six separate parts, each focusing on References based imaging, mass spectrometry- a particular aspect of the genome- 1. Sjöstedt E, et al. (2020) An atlas of the based proteomics, transcriptomics wide analysis of the human proteins: protein-coding genes in the human, pig, and and systems biology. mouse brain. Science 367(6482) 2. Thul PJ, et al. (2017) A subcellular map of • The Tissue Atlas shows the the human proteome. Science. 356(6340): All the data in the knowledge resource distribution of proteins across all eaal3321 is open access to allow scientists both major tissues and organs in the 3.
  • AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By

    AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation.
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis

    Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis

    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function

    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
  • Yeast Genome Gazetteer P35-65

    Yeast Genome Gazetteer P35-65

    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    1 Silencing Branched-Chain Ketoacid Dehydrogenase Or

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International