DOCSLIB.ORG

HGNC: Nomenclature of the Horse Genome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HGNC: Nomenclature of the Horse Genome 1/22/2018 Who are the HGNC and what do we do? • HUGO Gene Nomenclature Committee. • Responsible for approving unique symbols and names for human loci, including protein coding HGNC: genes, ncRNA genes and pseudogenes. • Maintain http://www.genenames.org Nomenclature of the horse • Collaborate with • CCDS: RefSeq, HAVANA, Ensembl, MGI, UCSC genome • Other databases, e.g. GeneCards, UniProt • Specialist resources, e.g. IMGT, IUPHAR, miRBase, Beth Yates – Scientific Programmer, HGNC, GtRNAdb EMBL-EBI, Hinxton, UK • Specialist advisors, e.g. HORDE (ORs), SLCS • GO Consortium, Human Genome Variation Society • Transforming genetic medicine initiative • Other species’ nomenclature groups, e.g. MGNC, RGNC, XGNC, ZNC, AGNC, CGNC, FlyBase https://vertebrate.genenames.org Other Vertebrate Gene Naming Groups What about Vertebrate Species with no Nomenclature Group? • Currently only six vertebrate models organisms have naming groups: • Unofficial names from • Inconsistencies between resources MGNC RGNC CGNC • Duplication of symbols within resources • Genes names may be incorrect or uninformative XGNC AGNC ZNC • Homologous genes are named based on HGNC human nomenclature Vertebrate Gene Nomenclature Committee HCOP – HGNC Comparison of Orthology Predictions tool • Gene Nomenclature Across Species meeting held in Cambridge, UK; in October 2009 • Gene nomenclature should, where possible, reflect homologous relationships across vertebrate species • Consensus naming, based on human gene nomenclature, should be extended beyond the species with nomenclature groups • Care must be taken when assigning gene names to incomplete genomes and to avoid humanisation of non-human genomes • Automated naming should initially focus on consensus 1:1 orthologs as identified by at least two comprehensive orthology resources • Complex families will require expert manual curation for cross-species nomenclature • VGNC is a new initiative extending the role of the HUGO Gene Nomenclature Committee (HGNC) to coordinate gene naming across vertebrates • Data will be distributed to genomic databases and model organism databases • The VGNC website will become a portal for all official vertebrate nomenclature 1 1/22/2018 Automated human nomenclature transferal Rules for gene nomenclature transferal to fail • CYP*/OR* or HLA* in gene symbol • HIST* or H[1-9] in symbol, plus ”histone” in gene name ✓ ✓ ✓ ✓ Human nomenclature • Name contains ( AND ) / opposite / *stream / neighbour / X-linked / Y- automatically transferred linked / region / syndrome / candidate / autosomal / virus / integration / cancer / leukemia / *oma = to orthologous gene if • Human gene locus type is not protein coding Gene A Gene B additional rules are passed • Locus type is not protein coding in both the NCBI gene and Ensembl Orthology assertion gene model for the orthologous gene Gene flagged for • Gene is not on the main assembly in human and/or the other species = investigation by • There is no HGNC approved symbol for the human gene ✓ 7 ✓ ✓ curators Mapping Tool Quick Curate Tool • Quick Curate tool summarises the information we have for a gene and its 1:1 human ortholog • Displays the reason why the human nomenclature was not automatically transferred • Links to Mapping tool which allows you to view Ensembl and NCBI gene models in a single genome browser www.vertebrate.genenames.org Current status of VGNC gene naming Species Number of 1:1 orthologs with Number of 1:1 orthologs with Total protein coding consensus in 4 resources consensus in 3 of the 4 resources genes Total approved (awaiting Total approved (awaiting approval) (Ensembl 91/NCBI gene) approval) Chimp 12,129 (565) 2,952 (517) 23,534 / 23,702 GCA_000001515.5 Cow 10,821 (527) 1639 (1860) 19,994 / 23,289 GCA_000003055.5 Dog 11,897 (493) 142 (2132) 19,856 / 20,424 GCA_000002285.2 Horse 10,142 (454) 935 (2598) 20,449 / 20,502 GCA_000002305.1 2 1/22/2018 Gene search Gene Symbol Report Data Download Dissemination of VGNC nomenclature data • JSON and TSV format files for gene nomenclature data are available from the VGNC website • REST API is currently in development to allow retrieval of • Gene nomenclature information • Orthologous genes • Gene family information Collaborations with expert curators Olfactory receptor naming • Cytochrome P450s • • David Nelson University of Tennessee Our olfactory receptor expert advisor has identified OR genes and • Jed Goldstone Woods Hole Oceanographic Institution pseudogenes in cow that do not have an existing gene model in either of Ensembl or NCBI RefSeq • Olfactory receptors • Doron Lancet & Tsviya Olender HORDE database, Weizmann Institute of Science • Some existing OR gene models in Ensembl are classified as protein coding but • UDP glucuronosyltransferases (UGTs) and Glutathione S-transferases (GSTs) manual curation identifies them as pseudogenes • Jed Goldstone Woods Hole Oceanographic Institution • ELAs • We will feed this information back to RefSeq and Ensembl to allow them to • Zinc Fingers build new or correct existing gene models • Histone genes • Examples of novel OR genes discovered in cow include • OR9S31, olfactory receptor family 9 subfamily S member 31 • OR11C1P, olfactory receptor family 11 subfamily C member 31 pseudogene 3 1/22/2018 Naming keratins across species Example gene family display from HGNC Keratin gene cluster I Keratin gene cluster II Human Chimp Cow Horse Dog Human Chimp Cow Horse Dog c17 c17 c19 c11 c9 c12 c12 c5 c6 c27 KRT222 KRT222 KRT222 KRT222 KRT222 KRT80 KRT80 KRT80 KRT80 KRT80 KRT24 KRT24 KRT24 KRT24 KRT24 KRT7 KRT7 KRT7 KRT7 KRT7 KRT223P - - - - KRT87P KRT87 LOC507184 KRT87P KRT87P KRT25 KRT25 KRT25 KRT25 KRT25 KRT88P KRT88P LOC787600 KRT88 KRT88 KRT26 KRT26 KRT26 KRT26 KRT26 - LOC615451 KRT129P - KRT27 KRT27 KRT27 KRT27 KRT27 KRT81 KRT81 KRT81 KRT81 KRT81 KRT28 KRT28 KRT28 KRT28 KRT28 KRT86 KRT86 KRT86 KRT86 KRT86 KRT10 KRT10 KRT10 KRT10A KRT10 KRT83 KRT83 KRT83 KRT83 KRT83 - - - KRT10B - KRT89P KRT89P KRT89 KRT89 KRT89 KRT12 KRT12 KRT12 KRT12 KRT12 KRT85 KRT85 KRT85 KRT85 KRT85 KRT20 KRT20 KRT20 KRT20 KRT20 KRT84 KRT84 KRT84 KRT84 KRT84 KRT23 KRT23 KRT23 KRT23 KRT23 KRT82 KRT82 KRT82 KRT82 KRT82 KRT39 KRT39 KRT39 KRT39 KRT39 KRT90P KRT90P/KRT124P KRT90/KRT124 KRT124 KRT124 KRT40 KRT40 KRT40 KRT40 KRT40 KRT75 KRT75 KRT75 KRT75 KRT75 KRT33A KRT33A KRT33A KRT33A KRT33A - - - KRT6P - KRT33B KRT33B KRT33B KRT33B KRT33B KRT6B KRT6B KRT6B KRT6B KRT6B KRT34 KRT34 KRT34 KRT34 KRT34 KRT6C KRT6C KRT6C KRT6C - KRT31 KRT31 KRT31 KRT31 KRT31 KRT6A KRT6A KRT6A KRT6A KRT6A KRT41P KRT41 KRT41P KRT41 KRT5 KRT5 KRT5 KRT5 KRT5 KRT37 KRT37 LOC515000 KRT37 KRT37 KRT71 KRT71 KRT71 KRT71 KRT71 KRT38 KRT38 LOC107131523 - KRT38 KRT74 KRT74 KRT74 KRT74 KRT74 KRT43P - - - KRT72 KRT72 KRT72 KRT72 KRT72 KRT32 KRT32 KRT32 KRT32 KRT32 KRT73 KRT73 KRT73 KRT73 KRT73 KRT35 KRT35 KRT35 KRT35 KRT35 KRT128P - - KRT128 - KRT36 KRT36 KRT36 KRT36 KRT36 KRT2 KRT2 KRT2 KRT2A KRT2 KRT13 KRT13 KRT13 KRT13 KRT13 - - - KRT2B - KRT15 KRT15 KRT15 KRT15 KRT15 - - KRT2C - KRT19 KRT19 KRT19 KRT19 KRT19 KRT1 KRT1 KRT1 KRT1 KRT1 KRT9 KRT9 KRT9 KRT9P KRT9 KRT77 KRT77 KRT77 KRT77 KRT77 KRT14 KRT14 KRT14 KRT14 KRT14 KRT126P - - KRT126P KRT126 KRT16 KRT16 KRT16 KRT16 KRT16 KRT127P - - - KRT127 KRT17 KRT17 KRT17 KRT17 KRT17 KRT125P - - - - KRT42P KRT42 KRT42 KRT42 KRT42 KRT76 KRT76 KRT76 KRT76 KRT76 LOC100336907 KRT3 KRT3 KRT3 KRT3 KRT3 Named automatically by VGNC KRT4 KRT4 KRT4 KRT4 KRT4 Named manually by VGNC KRT79 KRT79 KRT79 KRT79 KRT79 Name unresolved KRT78 KRT78 KRT78 KRT78 KRT78 bold VGNC name differs from Ensembl or NCBI Gene KRT8 KRT8 KRT8 KRT8 KRT8 red text Pseudogenes KRT18 KRT18 KRT18 KRT18 KRT18 Future plans with VGNC gene naming • Continue work on naming the remaining chimp, cow, dog and horse protein coding genes • VGNC will prioritize species for naming based on • Quality of genome sequence and annotations • Value of the species in terms of research • Level of interest/input from the research community • Potential next species to consider include pig and rhesus macaque • We will also investigate sheep when Ensembl and NCBI gene have both annotated the latest genome assembly • Gene family curation – specific gene families to be curated across multiple species at the same time Acknowledgements HGNC/VGNC Team Elspeth Bruford Ruth Seal Bethan Yates (Poster P0051) Susan Tweedie Kristian Gray Bryony Braschi Paul Denny Tamsin Jones contact us at [email protected] http://vertebrate.genenames.org 4.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Gene Nomenclature System for Rice
    Rice (2008) 1:72–84 DOI 10.1007/s12284-008-9004-9 Gene Nomenclature System for Rice Susan R. McCouch & CGSNL (Committee on Gene Symbolization, Nomenclature and Linkage, Rice Genetics Cooperative) Received: 11 April 2008 /Accepted: 3 June 2008 /Published online: 15 August 2008 # The Author(s) 2008 Abstract The Committee on Gene Symbolization, Nomen- protein sequence information that have been annotated and clature and Linkage (CGSNL) of the Rice Genetics Cooper- mapped on the sequenced genome assemblies, as well as ative has revised the gene nomenclature system for rice those determined by biochemical characterization and/or (Oryza) to take advantage of the completion of the rice phenotype characterization by way of forward genetics. With genome sequence and the emergence of new methods for these revisions, we enhance the potential for structural, detecting, characterizing, and describing genes in the functional, and evolutionary comparisons across organisms biological community. This paper outlines a set of standard and seek to harmonize the rice gene nomenclature system procedures for describing genes based on DNA, RNA, and with that of other model organisms. Newly identified rice genes can now be registered on-line at http://shigen.lab.nig. ac.jp/rice/oryzabase_submission/gene_nomenclature/. The current ex-officio member list below is correct as of the date of this galley proof. The current ex-officio members of CGSNL (The Keywords Oryza sativa . Genome sequencing . Committee on Gene Symbolization, Nomenclature and Linkage) are: Gene symbolization Atsushi Yoshimura from the Faculty of Agriculture, Kyushu University, Fukuoka, 812-8581, Japan, email: [email protected] Guozhen Liu from the Beijing Institute of Genomics of the Chinese Introduction Academy of Sciences, Beijing, People’s Republic of China, email: [email protected] The biological community is moving towards a universal Yasuo Nagato from the Graduate School of Agricultural and Life system for the naming of genes.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]
  • Method of Prognosing Cancers Verfahren Zur Prognose Von Krebsarten Procédé De Prognostic Des Cancers
    (19) TZZ Z _T (11) EP 2 295 602 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/574 (2006.01) C12Q 1/68 (2006.01) 11.07.2012 Bulletin 2012/28 (21) Application number: 10178350.4 (22) Date of filing: 26.07.2006 (54) Method of prognosing cancers Verfahren zur Prognose von Krebsarten Procédé de prognostic des cancers (84) Designated Contracting States: • KIHARA C ET AL: "Prediction of sensitivity of AT BE BG CH CY CZ DE DK EE ES FI FR GB GR esophageal tumors to adjuvant chemotherapy by HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI cDNA microarray analysis of gene-expression SK TR profiles", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, (30) Priority: 27.07.2005 US 703263 P BALTIMORE, MD, US, vol. 61, no. 17, September 2001 (2001-09), pages 6474-6479, XP002960719, (43) Date of publication of application: ISSN: 0008-5472 16.03.2011 Bulletin 2011/11 • PORTE H ET AL: "Overexpression of stromelysin-3, BM-40/SPARC, and MET genes in (62) Document number(s) of the earlier application(s) in human esophageal carcinoma: implications for accordance with Art. 76 EPC: prognosis.", CLINICAL CANCER RESEARCH : 06782211.4 / 1 907 582 AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. JUN (73) Proprietor: Oncotherapy Science, Inc. 1998, vol. 4, no. 6, June 1998 (1998-06), pages Kawasaki-shi 1375-1382, XP002407525, ISSN: 1078-0432 Kanagawa 213-0012 (JP) • "Affimetrix GeneChip Human Genome U133 Array Set HG-U133A", GEO, 11 March 2002 (72) Inventors: (2002-03-11), XP002254749, • Nakamura, Yusuke • WIGLE DENNIS A ET AL: "Molecular profiling of Tokyo 1138654 (JP) non-small cell lung cancer and correlation with • Daigo, Yataro disease-free survival", CANCER RESEARCH, Tokyo 1138654 (JP) AMERICAN ASSOCIATION FOR CANCER • Nakatsuru, Shuichi REREARCH, US, vol.
    [Show full text]
  • 75 2. INTRODUCTION Triple-Negative Breast Cancer (TNBC)
    [Frontiers in Bioscience, Scholar, 11, 75-88, March 1, 2019] The persisting puzzle of racial disparity in triple negative breast cancer: looking through a new lens Chakravarthy Garlapati1, Shriya Joshi1, Bikram Sahoo1, Shobhna Kapoor2, Ritu Aneja1 1Department of Biology, Georgia State University, Atlanta, GA, USA, 2Department of Chemistry, Indian Institute of Technology Bombay, Powai, India TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Dissecting the TNBC racially disparate burden 3.1. Does race influence TNBC onset and progression? 3.2. Tumor microenvironment in TNBC and racial disparity 3.3. Differential gene signatures and pathways in racially distinct TNBC 3.4. Our Perspective: Looking racial disparity through a new lens 4. Conclusion 5. Acknowledgement 6. References 1. ABSTRACT 2. INTRODUCTION Triple-negative breast cancer (TNBC) Triple-negative breast cancer (TNBC), is characterized by the absence of estrogen a subtype of breast cancer (BC), accounts for and progesterone receptors and absence 15-20% of all BC diagnoses in the US. It has of amplification of human epidermal growth been recognized that women of African descent factor receptor (HER2). This disease has no are twice as likely to develop TNBC than approved treatment with a poor prognosis women of European descent (1). As the name particularly in African-American (AA) as foretells, TNBCs lack estrogen, progesterone, compared to European-American (EA) and human epidermal growth factor receptors. patients. Gene ontology analysis showed Unfortunately, TNBCs are defined by what they specific gene pathways that are differentially “lack” rather than what they “have” and thus this regulated and gene signatures that are negative nomenclature provides no actionable differentially expressed in AA as compared to information on “druggable” targets.
    [Show full text]
  • The Role of Inherited Keratin Variants in Liver Disease Development
    Department of Internal Medicine I, University Hospital Ulm Prof. Dr. Seufferlein The Role of Inherited Keratin Variants in Liver Disease Development Dissertation presented to the Medical Faculty of Ulm University to obtain the degree Doctor of Human Biology Özlem Kücükoglu From Gaziantep, Turkey 2013 Current Dean: Prof. Dr. Thomas Wirth Thesis reviewers: 1st reviewer: PD. Dr. Pavel Strnad 2nd reviewer: Prof. Dr. biol. hum. Uwe Knippschild Date of doctorate awarded: May 3, 2013 Parts of this dissertation have been published in the following journal article: Strnad P*, Kucukoglu O*, Lunova M, Guldiken N, Lienau TC, Stickel F, Omary MB., “Non-Coding Keratin Variants Associate With Liver Fibrosis Progression in Patients With Hemochromatosis” PloS One 2012;7(3). *These authors contributed equally to this work TABLE OF CONTENTS ABBREVIATIONS............................................................................................................IV 1. INTRODUCTION .......................................................................................................... 1 1.1. THE COMPOSITION AND FUNCTION OF CYTOSKELETON ......................................... 1 1.2. INTERMEDIATE FILAMENTS AND THEIR DISEASE ASSOCIATION ............................. 2 1.3. KERATINS............................................................................................................. 5 1.4. FUNCTION OF KERATINS: ...................................................................................... 5 1.5. REGULATION OF KERATINS (POSTTRANSLATIONAL MODIFICATIONS
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]